t4 rna ligase 1 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs t4 rna ligase 1
    ( a ) Schematic illustration of the high efficiency, purification- and template-free, adapter oligonucleotide adenylation method using <t>T4</t> RNA ligase 1. The 3′ end of the adapter oligo was blocked by –ddC modification to prevent circularization and concatemerization. The 5′ base (shown in black) was swapped between dA, dC, dG, dT, rA, rC, rG, and rU to test bias. ( b ) The adapter adenylation efficiency was investigated as a function of 5′ terminal nucleotide. The reaction conditions were modified to exaggerate differences in efficiency (10 μL volume, 100 units ligase per nanomole adapter, 0.1 nanomole adapter, 30% PEG, 1 hour incubation). The rC and dG adapters are the most and least efficiently adenylated, respectively. ( c ) The adapter adenylation efficiency was then measured as a function of PEG % for a few representative adapters. In all cases, efficiency monotonically increased with PEG %. ( d ) Comparison of adenylation efficiency of as a function of PEG % under standard reaction conditions using the rA and dA adapters. Both the dA and rA adapters are efficiently adenylated at 35% PEG.
    T4 Rna Ligase 1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3220 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 1/product/New England Biolabs
    Average 99 stars, based on 3220 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 1 - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    92
    Thermo Fisher t4 rna ligase 1
    ( a ) Schematic illustration of the high efficiency, purification- and template-free, adapter oligonucleotide adenylation method using <t>T4</t> RNA ligase 1. The 3′ end of the adapter oligo was blocked by –ddC modification to prevent circularization and concatemerization. The 5′ base (shown in black) was swapped between dA, dC, dG, dT, rA, rC, rG, and rU to test bias. ( b ) The adapter adenylation efficiency was investigated as a function of 5′ terminal nucleotide. The reaction conditions were modified to exaggerate differences in efficiency (10 μL volume, 100 units ligase per nanomole adapter, 0.1 nanomole adapter, 30% PEG, 1 hour incubation). The rC and dG adapters are the most and least efficiently adenylated, respectively. ( c ) The adapter adenylation efficiency was then measured as a function of PEG % for a few representative adapters. In all cases, efficiency monotonically increased with PEG %. ( d ) Comparison of adenylation efficiency of as a function of PEG % under standard reaction conditions using the rA and dA adapters. Both the dA and rA adapters are efficiently adenylated at 35% PEG.
    T4 Rna Ligase 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 88 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 1/product/Thermo Fisher
    Average 92 stars, based on 88 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 1 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    Illumina Inc t4 rna ligase 1
    ( a ) Schematic illustration of the high efficiency, purification- and template-free, adapter oligonucleotide adenylation method using <t>T4</t> RNA ligase 1. The 3′ end of the adapter oligo was blocked by –ddC modification to prevent circularization and concatemerization. The 5′ base (shown in black) was swapped between dA, dC, dG, dT, rA, rC, rG, and rU to test bias. ( b ) The adapter adenylation efficiency was investigated as a function of 5′ terminal nucleotide. The reaction conditions were modified to exaggerate differences in efficiency (10 μL volume, 100 units ligase per nanomole adapter, 0.1 nanomole adapter, 30% PEG, 1 hour incubation). The rC and dG adapters are the most and least efficiently adenylated, respectively. ( c ) The adapter adenylation efficiency was then measured as a function of PEG % for a few representative adapters. In all cases, efficiency monotonically increased with PEG %. ( d ) Comparison of adenylation efficiency of as a function of PEG % under standard reaction conditions using the rA and dA adapters. Both the dA and rA adapters are efficiently adenylated at 35% PEG.
    T4 Rna Ligase 1, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 40 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 1/product/Illumina Inc
    Average 92 stars, based on 40 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 1 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    Enzymatics t4 rna ligase 1
    Adenylation of 3’ adapter using <t>T4</t> RNA ligase 1. ( A ) Effect of PEG8000 concentration on adenylation efficiency. A synthetic oligo BL1 mimicking the first small RNA cloning linker reported by Lau et al. (2001) was adenylated overnight with 1 U/μL T4 RNA ligase at various PEG concentration. Non-adenylated oligo as the negative control (NC) is loaded on the left lane. ( B ) Effect of temperature and 5’ nucleotide composition on adenylation efficiency. Oligos were adenylated overnight in the presence of 20% PEG8000 at various temperatures. ( C ) Impact of oligo concentration on adenylation efficiency. Substrates with different concentrations were adenylated overnight with 20% PEG8000 at room temperature. All adenylation products were analyzed on the 20% denatured PAGE, stained with SYBR-Gold and photograph under UV.
    T4 Rna Ligase 1, supplied by Enzymatics, used in various techniques. Bioz Stars score: 92/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 1/product/Enzymatics
    Average 92 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 1 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    99
    New England Biolabs t4 rnl1 ligase
    Adenylation of 3’ adapter using <t>T4</t> RNA ligase 1. ( A ) Effect of PEG8000 concentration on adenylation efficiency. A synthetic oligo BL1 mimicking the first small RNA cloning linker reported by Lau et al. (2001) was adenylated overnight with 1 U/μL T4 RNA ligase at various PEG concentration. Non-adenylated oligo as the negative control (NC) is loaded on the left lane. ( B ) Effect of temperature and 5’ nucleotide composition on adenylation efficiency. Oligos were adenylated overnight in the presence of 20% PEG8000 at various temperatures. ( C ) Impact of oligo concentration on adenylation efficiency. Substrates with different concentrations were adenylated overnight with 20% PEG8000 at room temperature. All adenylation products were analyzed on the 20% denatured PAGE, stained with SYBR-Gold and photograph under UV.
    T4 Rnl1 Ligase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rnl1 ligase/product/New England Biolabs
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    t4 rnl1 ligase - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    88
    Epicentre Biotechnologies t4 rnl1
    RNA 3′-end attachment. ( A ) Comparison of optimized T4 Rnl2tr ligation to published ligation conditions. Synthetic ssRNA oligonucleotides with either 2′-hydroxyl (OH) or 2′- O -methyl ( O -Me) 3′-ends were ligated to pre-adenylated DNA adapter (AppLinker) using T4 Rnl2tr or <t>T4</t> Rnl1 under different ligation conditions (conditions 1, 2, 3; detailed in Materials and Methods). Ligation products were resolved and visualized by SYBR Gold staining. ( B ) Quantification of ligation efficiency. Percent ligation refers to the amount of input RNA converted to ligated species as measured by densitometry. Data points represent the mean ± SEM; n = 3 experimental replicates.
    T4 Rnl1, supplied by Epicentre Biotechnologies, used in various techniques. Bioz Stars score: 88/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rnl1/product/Epicentre Biotechnologies
    Average 88 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    t4 rnl1 - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    91
    fisher scientific t4 rna ligase 1
    RNA 3′-end attachment. ( A ) Comparison of optimized T4 Rnl2tr ligation to published ligation conditions. Synthetic ssRNA oligonucleotides with either 2′-hydroxyl (OH) or 2′- O -methyl ( O -Me) 3′-ends were ligated to pre-adenylated DNA adapter (AppLinker) using T4 Rnl2tr or <t>T4</t> Rnl1 under different ligation conditions (conditions 1, 2, 3; detailed in Materials and Methods). Ligation products were resolved and visualized by SYBR Gold staining. ( B ) Quantification of ligation efficiency. Percent ligation refers to the amount of input RNA converted to ligated species as measured by densitometry. Data points represent the mean ± SEM; n = 3 experimental replicates.
    T4 Rna Ligase 1, supplied by fisher scientific, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 1/product/fisher scientific
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 1 - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    Image Search Results


    ( a ) Schematic illustration of the high efficiency, purification- and template-free, adapter oligonucleotide adenylation method using T4 RNA ligase 1. The 3′ end of the adapter oligo was blocked by –ddC modification to prevent circularization and concatemerization. The 5′ base (shown in black) was swapped between dA, dC, dG, dT, rA, rC, rG, and rU to test bias. ( b ) The adapter adenylation efficiency was investigated as a function of 5′ terminal nucleotide. The reaction conditions were modified to exaggerate differences in efficiency (10 μL volume, 100 units ligase per nanomole adapter, 0.1 nanomole adapter, 30% PEG, 1 hour incubation). The rC and dG adapters are the most and least efficiently adenylated, respectively. ( c ) The adapter adenylation efficiency was then measured as a function of PEG % for a few representative adapters. In all cases, efficiency monotonically increased with PEG %. ( d ) Comparison of adenylation efficiency of as a function of PEG % under standard reaction conditions using the rA and dA adapters. Both the dA and rA adapters are efficiently adenylated at 35% PEG.

    Journal: Scientific Reports

    Article Title: Efficient synthesis of stably adenylated DNA and RNA adapters for microRNA capture using T4 RNA ligase 1

    doi: 10.1038/srep15620

    Figure Lengend Snippet: ( a ) Schematic illustration of the high efficiency, purification- and template-free, adapter oligonucleotide adenylation method using T4 RNA ligase 1. The 3′ end of the adapter oligo was blocked by –ddC modification to prevent circularization and concatemerization. The 5′ base (shown in black) was swapped between dA, dC, dG, dT, rA, rC, rG, and rU to test bias. ( b ) The adapter adenylation efficiency was investigated as a function of 5′ terminal nucleotide. The reaction conditions were modified to exaggerate differences in efficiency (10 μL volume, 100 units ligase per nanomole adapter, 0.1 nanomole adapter, 30% PEG, 1 hour incubation). The rC and dG adapters are the most and least efficiently adenylated, respectively. ( c ) The adapter adenylation efficiency was then measured as a function of PEG % for a few representative adapters. In all cases, efficiency monotonically increased with PEG %. ( d ) Comparison of adenylation efficiency of as a function of PEG % under standard reaction conditions using the rA and dA adapters. Both the dA and rA adapters are efficiently adenylated at 35% PEG.

    Article Snippet: Unless otherwise indicated, the adenylation reaction was performed using the optimized conditions of a 25 μL reaction volume containing 0.05 nanomole dA adapter, 1X T4 RNA Ligase Buffer (New England Biolabs, Ipswich, MA), 35% PEG, 1 mM ATP, and 300 units of T4 RNA Ligase 1 (New England Biolabs, Ipswich, MA) per nanomole adapter.

    Techniques: Purification, Modification, Incubation

    microRNA-adapter ligation was performed using adenylated adapters generated by either (a) T4 RNA ligase 1 or (c) archaeal RNA ligase. The adapters were labeled with Cy5 while the synthetic microRNA were labeled with Cy3. Lanes 1 and 2 show that both methods are capable of fully adenylating the adapters. Lanes 4 and 6 show that let-7a microRNA can be effectively ligated both in the absence and presence of total RNA background. Lane 5 shows that large RNA molecules within the total RNA are captured by both adapters. No de-adenylation is observed with either method. ( b ) The T4 RNA ligase 1 adenylated adapter was used to capture RNA from 10, 100, or 1000 ng of pancreatic tissue total RNA spiked with 0.01 picomoles of 6 synthetic microRNA. The three ligation products from the top are large RNA molecules intrinsic to the total RNA that have been captured by the adapter. As expected, they vary in linear proportion to the total RNA input. The band in the middle is the spiked microRNA captured by the adapter which remains constant across all three samples as expected. The large band at the bottom of the gel is free adenylated Cy5 adapter.

    Journal: Scientific Reports

    Article Title: Efficient synthesis of stably adenylated DNA and RNA adapters for microRNA capture using T4 RNA ligase 1

    doi: 10.1038/srep15620

    Figure Lengend Snippet: microRNA-adapter ligation was performed using adenylated adapters generated by either (a) T4 RNA ligase 1 or (c) archaeal RNA ligase. The adapters were labeled with Cy5 while the synthetic microRNA were labeled with Cy3. Lanes 1 and 2 show that both methods are capable of fully adenylating the adapters. Lanes 4 and 6 show that let-7a microRNA can be effectively ligated both in the absence and presence of total RNA background. Lane 5 shows that large RNA molecules within the total RNA are captured by both adapters. No de-adenylation is observed with either method. ( b ) The T4 RNA ligase 1 adenylated adapter was used to capture RNA from 10, 100, or 1000 ng of pancreatic tissue total RNA spiked with 0.01 picomoles of 6 synthetic microRNA. The three ligation products from the top are large RNA molecules intrinsic to the total RNA that have been captured by the adapter. As expected, they vary in linear proportion to the total RNA input. The band in the middle is the spiked microRNA captured by the adapter which remains constant across all three samples as expected. The large band at the bottom of the gel is free adenylated Cy5 adapter.

    Article Snippet: Unless otherwise indicated, the adenylation reaction was performed using the optimized conditions of a 25 μL reaction volume containing 0.05 nanomole dA adapter, 1X T4 RNA Ligase Buffer (New England Biolabs, Ipswich, MA), 35% PEG, 1 mM ATP, and 300 units of T4 RNA Ligase 1 (New England Biolabs, Ipswich, MA) per nanomole adapter.

    Techniques: Ligation, Generated, Labeling

    Adenylated adapters generated using either T4 RNA ligase 1 or archaeal RNA ligase were used for microRNA-adapter ligation of a mixture containing 80 nt let-7a precursor DNA molecules and 22 nt let-7a mature microRNA molecules. The amount of PEG in the reaction mixture was also varied. Circularized DNA ligation product is only generated using the archaeal RNA ligase adenylated adapters.

    Journal: Scientific Reports

    Article Title: Efficient synthesis of stably adenylated DNA and RNA adapters for microRNA capture using T4 RNA ligase 1

    doi: 10.1038/srep15620

    Figure Lengend Snippet: Adenylated adapters generated using either T4 RNA ligase 1 or archaeal RNA ligase were used for microRNA-adapter ligation of a mixture containing 80 nt let-7a precursor DNA molecules and 22 nt let-7a mature microRNA molecules. The amount of PEG in the reaction mixture was also varied. Circularized DNA ligation product is only generated using the archaeal RNA ligase adenylated adapters.

    Article Snippet: Unless otherwise indicated, the adenylation reaction was performed using the optimized conditions of a 25 μL reaction volume containing 0.05 nanomole dA adapter, 1X T4 RNA Ligase Buffer (New England Biolabs, Ipswich, MA), 35% PEG, 1 mM ATP, and 300 units of T4 RNA Ligase 1 (New England Biolabs, Ipswich, MA) per nanomole adapter.

    Techniques: Generated, Ligation, DNA Ligation

    Schematic overview of the modified protocol. a , wet experiment. Irradiated with 365 nm UV, RNAs were cross-linked by AMT at the paired region, and survive DNase I, RNase T1 and RNase H treatments which digest DNA and single strand RNA. Cross-linked RNAs were ligated by T4 RNA ligase 1. After photoreversal of cross-linkages by 254 nm UV, the ligated RNAs could be sequenced and identified. b , bioinformatics analysis

    Journal: BMC Genomics

    Article Title: Detecting RNA-RNA interactions in E. coli using a modified CLASH method

    doi: 10.1186/s12864-017-3725-3

    Figure Lengend Snippet: Schematic overview of the modified protocol. a , wet experiment. Irradiated with 365 nm UV, RNAs were cross-linked by AMT at the paired region, and survive DNase I, RNase T1 and RNase H treatments which digest DNA and single strand RNA. Cross-linked RNAs were ligated by T4 RNA ligase 1. After photoreversal of cross-linkages by 254 nm UV, the ligated RNAs could be sequenced and identified. b , bioinformatics analysis

    Article Snippet: Cross-linked RNA molecules were then ligated using 40 U of T4 RNA ligase 1 (New England Biolabs, M0204), 1 mM ATP, and 40 U RNase inhibitors in RNA ligase 1 buffer for 1 h at 15 °C, and kept for 16 h at 4 °C.

    Techniques: Modification, Irradiation

    Endoribonucleolytic cleavage with purified H5 protein results in a 3′-OH. A , schematic of potential cleavage products for the TAP-treated (+TAP) or untreated (−TAP) 430-nt ssRNA substrate. I and II , possible scenarios depending on the nature of 3′ ends after cleavage. Ends denoted in boldface type indicate possible results of cleavage. B , schematic of the potential and actual products after treatment of the cleavage reaction with Terminator exonuclease ( Term ). I and II , possible outcomes depending on the nature of 3′ ends after cleavage. Gray line , RNA degraded by Terminator; black line , RNA not degraded by Terminator. C , schematic of the potential and actual products after [5′- 32 P]pCp treatment of unlabeled, purified RNA substrate and products from a cleavage reaction. Black line , RNA labeled with [5′- 32 P]pCp; gray line , RNA not labeled with [5′- 32 P]pCp. Lane 1 , RNA substrate treated with H5 in cleavage assay, purified, and labeled with [5′- 32 P]pCp; lane 2 , RNA substrate treated with buffer in cleavage assay, purified, and labeled with [5′- 32 P]pCp; lane 3 , RNA substrate labeled with [5′- 32 P]pCp.

    Journal: The Journal of Biological Chemistry

    Article Title: Biochemical and Biophysical Properties of a Putative Hub Protein Expressed by Vaccinia Virus *

    doi: 10.1074/jbc.M112.442012

    Figure Lengend Snippet: Endoribonucleolytic cleavage with purified H5 protein results in a 3′-OH. A , schematic of potential cleavage products for the TAP-treated (+TAP) or untreated (−TAP) 430-nt ssRNA substrate. I and II , possible scenarios depending on the nature of 3′ ends after cleavage. Ends denoted in boldface type indicate possible results of cleavage. B , schematic of the potential and actual products after treatment of the cleavage reaction with Terminator exonuclease ( Term ). I and II , possible outcomes depending on the nature of 3′ ends after cleavage. Gray line , RNA degraded by Terminator; black line , RNA not degraded by Terminator. C , schematic of the potential and actual products after [5′- 32 P]pCp treatment of unlabeled, purified RNA substrate and products from a cleavage reaction. Black line , RNA labeled with [5′- 32 P]pCp; gray line , RNA not labeled with [5′- 32 P]pCp. Lane 1 , RNA substrate treated with H5 in cleavage assay, purified, and labeled with [5′- 32 P]pCp; lane 2 , RNA substrate treated with buffer in cleavage assay, purified, and labeled with [5′- 32 P]pCp; lane 3 , RNA substrate labeled with [5′- 32 P]pCp.

    Article Snippet: This RNA (and RNA not subjected to the cleavage reaction) was then labeled in a reaction containing 150 μCi of [5′-32 P]pCp (3000 Ci/mmol; PerkinElmer Life Sciences) and 10 units of RNA ligase (New England Biolabs) at 4 °C overnight.

    Techniques: Purification, Labeling, Cleavage Assay

    ( A ) Schematic processing of the p1 16S rRNA. The extra-sequences of 115 nt and 33 nt, flanking the m 16S rRNA at its 5′ and 3′ ends, respectively, are shown on a grey background. RA and FA are the primers used for 3′5′ RACE analysis. The site of annealing of RA to m 16S rRNA, and that of FA to the reverse complement of the m 16S rRNA, are indicated by arrows. Figure not drawn to scale. ( B ) Expected sizes in bp of the RT-PCR products (amplicons) obtained from the different species of 16S rRNA ( p1 , p2 , p3 and m ) by 3′5′ RACE. ( C–F ) Agarose gel electrophoresis of RT-PCR products obtained by 3′5′ RACE from total RNA isolated from MC4100 bacteria grown at 30°C (C), or 44°C (D), or 45°C (E) or 46°C (F). Each RNA sample was thermo-denatured (lanes b), or not (lanes a) prior to the 3′5′ ligation. The sizes (in bp) of the molecular weight markers are indicated to the left of each gel (M). ( G ) The thermodenaturation step dissociates the complementary sequences present at the 3′ and 5′ends of the p1 16S rRNA, and therefore offers to all the 16S rRNA species an equal chance to access to the T4 RNA ligase.

    Journal: Nucleic Acids Research

    Article Title: Late steps of ribosome assembly in E. coli are sensitive to a severe heat stress but are assisted by the HSP70 chaperone machine †

    doi: 10.1093/nar/gkq1049

    Figure Lengend Snippet: ( A ) Schematic processing of the p1 16S rRNA. The extra-sequences of 115 nt and 33 nt, flanking the m 16S rRNA at its 5′ and 3′ ends, respectively, are shown on a grey background. RA and FA are the primers used for 3′5′ RACE analysis. The site of annealing of RA to m 16S rRNA, and that of FA to the reverse complement of the m 16S rRNA, are indicated by arrows. Figure not drawn to scale. ( B ) Expected sizes in bp of the RT-PCR products (amplicons) obtained from the different species of 16S rRNA ( p1 , p2 , p3 and m ) by 3′5′ RACE. ( C–F ) Agarose gel electrophoresis of RT-PCR products obtained by 3′5′ RACE from total RNA isolated from MC4100 bacteria grown at 30°C (C), or 44°C (D), or 45°C (E) or 46°C (F). Each RNA sample was thermo-denatured (lanes b), or not (lanes a) prior to the 3′5′ ligation. The sizes (in bp) of the molecular weight markers are indicated to the left of each gel (M). ( G ) The thermodenaturation step dissociates the complementary sequences present at the 3′ and 5′ends of the p1 16S rRNA, and therefore offers to all the 16S rRNA species an equal chance to access to the T4 RNA ligase.

    Article Snippet: We circularized 5 µg of total RNA with T4 RNA ligase (New England Biolabs, n° M0204) and subjected to RT-PCR across the 5′3′ junction, using the primer FA (5′ATCT GGATCC GATTCATGACTGGGGTGAAGTC 3′, with a 10-nt extension including a BamH1 site (underlined), and the primer RA (5′ATCT GAATTC GTTCGACTTGCATGTGTTAGGC 3′, with a 10-nt extension including an EcoR1 site (underlined), transcriptase reverse M-MuLV RT.RNase H− (Finnzymes, n° F-572), and Taq DNA polymerase (New England Biolabs, n° M0267).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Isolation, Ligation, Molecular Weight

    Adenylation of 3’ adapter using T4 RNA ligase 1. ( A ) Effect of PEG8000 concentration on adenylation efficiency. A synthetic oligo BL1 mimicking the first small RNA cloning linker reported by Lau et al. (2001) was adenylated overnight with 1 U/μL T4 RNA ligase at various PEG concentration. Non-adenylated oligo as the negative control (NC) is loaded on the left lane. ( B ) Effect of temperature and 5’ nucleotide composition on adenylation efficiency. Oligos were adenylated overnight in the presence of 20% PEG8000 at various temperatures. ( C ) Impact of oligo concentration on adenylation efficiency. Substrates with different concentrations were adenylated overnight with 20% PEG8000 at room temperature. All adenylation products were analyzed on the 20% denatured PAGE, stained with SYBR-Gold and photograph under UV.

    Journal: Plant Methods

    Article Title: A cost-effective method for Illumina small RNA-Seq library preparation using T4 RNA ligase 1 adenylated adapters

    doi: 10.1186/1746-4811-8-41

    Figure Lengend Snippet: Adenylation of 3’ adapter using T4 RNA ligase 1. ( A ) Effect of PEG8000 concentration on adenylation efficiency. A synthetic oligo BL1 mimicking the first small RNA cloning linker reported by Lau et al. (2001) was adenylated overnight with 1 U/μL T4 RNA ligase at various PEG concentration. Non-adenylated oligo as the negative control (NC) is loaded on the left lane. ( B ) Effect of temperature and 5’ nucleotide composition on adenylation efficiency. Oligos were adenylated overnight in the presence of 20% PEG8000 at various temperatures. ( C ) Impact of oligo concentration on adenylation efficiency. Substrates with different concentrations were adenylated overnight with 20% PEG8000 at room temperature. All adenylation products were analyzed on the 20% denatured PAGE, stained with SYBR-Gold and photograph under UV.

    Article Snippet: Reagents T4 RNA liagse 2, truncated (NEB) 50% PEG8000 (NEB) 10 mM ATP (NEB) RNase Inhibitor (Promega) T4 RNA ligase 1 (Enzymatics) SuperScriptIII Reverse Transcriptase (Invitrogen) Phusion Hotstart DNA Polymerase (NEB) MinElute Gel Extraction kit (Qiagen) Quant-iT HS DNA assay kit (Inivtrogen)

    Techniques: Concentration Assay, Clone Assay, Negative Control, Polyacrylamide Gel Electrophoresis, Staining

    RNA 3′-end attachment. ( A ) Comparison of optimized T4 Rnl2tr ligation to published ligation conditions. Synthetic ssRNA oligonucleotides with either 2′-hydroxyl (OH) or 2′- O -methyl ( O -Me) 3′-ends were ligated to pre-adenylated DNA adapter (AppLinker) using T4 Rnl2tr or T4 Rnl1 under different ligation conditions (conditions 1, 2, 3; detailed in Materials and Methods). Ligation products were resolved and visualized by SYBR Gold staining. ( B ) Quantification of ligation efficiency. Percent ligation refers to the amount of input RNA converted to ligated species as measured by densitometry. Data points represent the mean ± SEM; n = 3 experimental replicates.

    Journal: RNA

    Article Title: Optimization of enzymatic reaction conditions for generating representative pools of cDNA from small RNA

    doi: 10.1261/rna.2242610

    Figure Lengend Snippet: RNA 3′-end attachment. ( A ) Comparison of optimized T4 Rnl2tr ligation to published ligation conditions. Synthetic ssRNA oligonucleotides with either 2′-hydroxyl (OH) or 2′- O -methyl ( O -Me) 3′-ends were ligated to pre-adenylated DNA adapter (AppLinker) using T4 Rnl2tr or T4 Rnl1 under different ligation conditions (conditions 1, 2, 3; detailed in Materials and Methods). Ligation products were resolved and visualized by SYBR Gold staining. ( B ) Quantification of ligation efficiency. Percent ligation refers to the amount of input RNA converted to ligated species as measured by densitometry. Data points represent the mean ± SEM; n = 3 experimental replicates.

    Article Snippet: Following extraction with phenol:chloroform:isoamyl alcohol, 25:24:1 and ethanol precipitation, RNA (5–15 pmol) was ligated to an adenylated DNA adapter with the sequence 5′-AppTCGTATGCCGTCTTCTGCTTGT-NH2 -3′ using T4 Rnl1 or T4 Rnl2tr at a 2:1 molar ratio of adapter to small RNA.

    Techniques: Ligation, Staining

    RNA 3′-end adapter ligation bias against 2′- O -methylated small RNA 3′-ends. Synthetic ssRNA oligonucleotides with either 2′-hydroxyl (OH) or 2′- O -methyl ( O -Me) 3′-ends and different 3′-terminal nucleotides (A, C, G, or U) were ligated to a pre-adenylated DNA adapter (AppLinker) using either T4 Rnl2tr or T4 Rnl1. Ligation products were resolved and visualized by SYBR Gold staining. Percent ligation refers to the relative amount of input RNA converted to ligated species as measured by densitometry. Data points represent the mean ± SEM;  n  = 3 experimental replicates.

    Journal: RNA

    Article Title: Optimization of enzymatic reaction conditions for generating representative pools of cDNA from small RNA

    doi: 10.1261/rna.2242610

    Figure Lengend Snippet: RNA 3′-end adapter ligation bias against 2′- O -methylated small RNA 3′-ends. Synthetic ssRNA oligonucleotides with either 2′-hydroxyl (OH) or 2′- O -methyl ( O -Me) 3′-ends and different 3′-terminal nucleotides (A, C, G, or U) were ligated to a pre-adenylated DNA adapter (AppLinker) using either T4 Rnl2tr or T4 Rnl1. Ligation products were resolved and visualized by SYBR Gold staining. Percent ligation refers to the relative amount of input RNA converted to ligated species as measured by densitometry. Data points represent the mean ± SEM; n = 3 experimental replicates.

    Article Snippet: Following extraction with phenol:chloroform:isoamyl alcohol, 25:24:1 and ethanol precipitation, RNA (5–15 pmol) was ligated to an adenylated DNA adapter with the sequence 5′-AppTCGTATGCCGTCTTCTGCTTGT-NH2 -3′ using T4 Rnl1 or T4 Rnl2tr at a 2:1 molar ratio of adapter to small RNA.

    Techniques: Ligation, Methylation, Staining