sybr green pcr master mix Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher sybr green pcr master mix
    Curcumin decreases BRCA1 occupancy at the HIV-1 LTR. A . TZM-bl cells were transfected with pcTat and treated the next day with vehicle (DMSO) or a titration of curcumin (0.5, 1, 10, and 20 μM). Samples were analyzed by western blot. Inset depicts a dose–response curve of BRCA1 protein abundance versus curcumin treatment based on the average densitometry counts with error bars representing standard error of three independent measurements. Western blot is representative of three independent experiments. Densitometry counts were taken from three independent treatments to acquire a dose–response curve of BRCA1 expression inhibition (inset plot) B . TZM-bl cells were transfected with pcTat and treated the next day with DMSO or 20 μM curcumin. Bright-Glo luciferase assays and CellTiter-Glo cell viability assays were performed 24 hours post-treatment as described by the manufacturer. Data was normalized to cells containing Tat and treated with DMSO as baseline for Tat-dependent LTR activation. Transfection and treatment assays were performed in triplicate and data plotted represents averaged data of two independent experiments. Error bars show the standard error of two averaged independent measurements. Viability assays were performed in triplicate. C . TZM-bl cells were transfected with pcTat and treated the next day with DMSO or curcumin (20 μM) for 24 hours prior to being collected for ChIP analysis. Antibodies used for ChIP were anti-BRCA1 (10 μg), anti-IgG (10 μg), and anti-RNA polymerase II (RNAP II, 10 μg). Quantitative <t>PCR</t> was performed using <t>SYBR</t> Green PCR Master Mix to analyze immunoprecipitated material. Single asterisk indicates p
    Sybr Green Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 103065 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr green pcr master mix/product/Thermo Fisher
    Average 99 stars, based on 103065 article reviews
    Price from $9.99 to $1999.99
    sybr green pcr master mix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher power sybr green pcr master mix
    Transcript levels of the “readthrough” acetylcholinesterase (AChE-R) variant are increased in cerebral cortex of AD subjects Relative mRNA levels of the transcripts for AChE-T (or “tailed”), AChE-R (or “readthrought”) and N-AChE (or N-extended) splice variants and for proline-rich membrane anchor 1 (PRiMA-1) were analysed by q <t>RT-PCR</t> in frontal cortex of NDC (n= 22) and AD subjects (n= 19). For AChE transcript analysis specific primers with Power <t>SYBR®</t> Green PCR Master Mix were employed and the specificity of the PCR products was confirmed by dissociation curve analysis. PRiMA-1 transcripts were measured using a specific TaqMan GenExpression Assay with TaqMan PCR Master Mix. Transcript levels were calculated by the comparative 2 −ΔCt method with respect to GAPDH. The results were confirmed in two independent determinations. Mean value ± SEM are represented. *Significantly increased ( p
    Power Sybr Green Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 71731 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/power sybr green pcr master mix/product/Thermo Fisher
    Average 99 stars, based on 71731 article reviews
    Price from $9.99 to $1999.99
    power sybr green pcr master mix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher fast sybr green master mix
    HuR associates with SCN5A mRNA (A) Schematic representation of the SCN5A mRNA ARE sites in its 3′-UTR. The length of the mRNA is indicated by a kilo base (kb)-scale. (B) HuR binds to the SCN5A mRNA. After IP of RNA-protein complexes from cardiomyocytes using either anti-HuR antibody (Anti-HuR) or control IgG, RNA was isolated, and then, the cDNA was synthesized in a presence or absence of the reverse transcription enzyme. Two sets of primers to different regions of SCN5A were used to amplify SCN5A fragments. The PCR products were visualized with <t>SYBR</t> ™ Safe DNA Gel Stain in agarose gels. (C) <t>qRT-PCR</t> was performed to confirm the results in (B).
    Fast Sybr Green Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 29027 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fast sybr green master mix/product/Thermo Fisher
    Average 99 stars, based on 29027 article reviews
    Price from $9.99 to $1999.99
    fast sybr green master mix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher powerup sybr green master mix
    Inhibition assays. Inhibition assays were set up as qPCR reactions using murine genomic DNA; a primer set specific to the mouse- HSD11β1 gene ( S1 Table ); and the <t>PowerUp</t> <t>SYBR</t> Green Master Mix. The reaction mixture was spiked with water (as a control) or extracted RNA or DNA from various kits. Shown are the Cq values for the control vs. reactions spiked with RNA (A) and DNA (B), in duplicate, with error bars representing standard deviations. (C) Fragment distribution of amplified RNA and DNA samples from select kits with corresponding positive controls (fresh PC-3 cells).
    Powerup Sybr Green Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 7232 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/powerup sybr green master mix/product/Thermo Fisher
    Average 99 stars, based on 7232 article reviews
    Price from $9.99 to $1999.99
    powerup sybr green master mix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher platinum sybr green qpcr supermix udg
    Inhibition assays. Inhibition assays were set up as qPCR reactions using murine genomic DNA; a primer set specific to the mouse- HSD11β1 gene ( S1 Table ); and the <t>PowerUp</t> <t>SYBR</t> Green Master Mix. The reaction mixture was spiked with water (as a control) or extracted RNA or DNA from various kits. Shown are the Cq values for the control vs. reactions spiked with RNA (A) and DNA (B), in duplicate, with error bars representing standard deviations. (C) Fragment distribution of amplified RNA and DNA samples from select kits with corresponding positive controls (fresh PC-3 cells).
    Platinum Sybr Green Qpcr Supermix Udg, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 10276 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/platinum sybr green qpcr supermix udg/product/Thermo Fisher
    Average 99 stars, based on 10276 article reviews
    Price from $9.99 to $1999.99
    platinum sybr green qpcr supermix udg - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher maxima sybr green rox qpcr master mix
    RTA inhibits vFLIP-induced expression of TNFα and ICAM1 in 293T cells. A-D. 293T cells were transfected with myc-vFLIP, RTA or empty vector control where indicated. At 72 hrs post-transfection, cells were harvested and split for RNA isolation and western blot (see D). For <t>qPCR</t> total RNA was isolated, reverse transcribed and quantified on an ABI7000 with using primers for TNFα and ICAM1 and <t>Sybr</t> green. The housekeeping genes used in the analysis were B-actin and GAPDH. Data was analyzed using the ΔΔCt method. A. vFLIP induced expression of TNFα and ICAM shown as fold regulation 2∧(-ΔΔCt). B and C. vFLIP induced expression of (B) TNFα, p = 0.0001 and (C) ICAM1, p = 0.0001 in the presence or absence of RTA calculated relative to vFLIP alone. Error bars represent standard error. D. Representative western blot from the same experiment, showing vFLIP and RTA protein expression, and RTA induced degradation of vFLIP.
    Maxima Sybr Green Rox Qpcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 6983 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/maxima sybr green rox qpcr master mix/product/Thermo Fisher
    Average 99 stars, based on 6983 article reviews
    Price from $9.99 to $1999.99
    maxima sybr green rox qpcr master mix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    92
    Toyobo sybr green real time pcr master mix
    Expression analysis of genes identified in the papilla by LM–RNA-seq. <t>qRT-PCR</t> was performed using the <t>SYBR</t> Green Real-Time PCR Master Mix with a Bio-Rad CFX96 Real-Time Detection System. cDNAs were prepared from total RNAs of stigma and leaf. Representation of the relative expression levels of the genes was normalized to the expression level of UBC21 . Quantitative validation of three replicates was calculated using the delta–delta threshold cycle relative quantification method.
    Sybr Green Real Time Pcr Master Mix, supplied by Toyobo, used in various techniques. Bioz Stars score: 92/100, based on 6877 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr green real time pcr master mix/product/Toyobo
    Average 92 stars, based on 6877 article reviews
    Price from $9.99 to $1999.99
    sybr green real time pcr master mix - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    99
    Thermo Fisher maxima sybr green qpcr master mix
    Relative mRNA expression of barrier function and nutrient sensing genes in different segments of intestinal mucosa in chickens injected in ovo with GOS. The panel includes genes encoding mucin, (A) MUC6 ; tight junctions components, (B) CLDN1 and (C) TJAP1 ; free fatty acid receptors, (D) FFAR2 and (E) FFAR4 ; and glucose transporters, (F) GLUT1 , (G) GLUT2 and (H) GLUT5 . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum and CEC–caecum. In ovo treatment groups: control (white bars)–injected in ovo with physiological saline; GOS (black bars)–injected in ovo with galactooligosaccharides. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) were collected from chickens on day 42 post-hatching. <t>RT-qPCR</t> data were generated with custom-designed primers used for amplification with <t>SYBR</t> green dye; Glucose-6-phosphate dehydrogenase ( G6PDH ) and beta-actin ( ACTB ) were used as reference genes; relative gene expression calculated as 2 –ΔΔCt; Two-way ANOVA with a post hoc HSD Tukey test was used to compare the groups. Asterisk indicates pair-wise significant differences ( P
    Maxima Sybr Green Qpcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 6413 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/maxima sybr green qpcr master mix/product/Thermo Fisher
    Average 99 stars, based on 6413 article reviews
    Price from $9.99 to $1999.99
    maxima sybr green qpcr master mix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    94
    Bio-Rad sybr green pcr master mix
    Expression patterns of SlIPT4 in tomato. Relative expression analysis of SlIPT4 was performed in different tissues ( a ), in leaves at different developmental stages ( b ), in different parts of flower at different developmental stages ( c ), in fruits at different stages ( d ), and in response to drought stress treatment ( e ) by <t>qRT-PCR.</t> Petals have been shed at the post-anthesis stage, so no data was shown at this stage. Data are expressed as relative values, based on the values of leaf ( a ), expending leaf ( b ), early mature <t>green</t> fruit ( c and d ), and corresponding control groups ( e ) taken as reference sample set to 1. Each value represents mean ± SE (standard error) of three replicates. Ro, root; St, stem; Le, leaf; Fl, flower; Fr, fruit. Yl, young leaf; El, expending leaf; Edl, expended leaf. EMG, early mature green; MG, mature green; Br, break; Or, orange; Ri, ripening. CK, control; DT, drought treatment; 2, 6, 12 and 24 h represent the hours after watering
    Sybr Green Pcr Master Mix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 5927 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr green pcr master mix/product/Bio-Rad
    Average 94 stars, based on 5927 article reviews
    Price from $9.99 to $1999.99
    sybr green pcr master mix - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    99
    Qiagen quantitect sybr green pcr master mix
    The expression of eight miRNAs detected by <t>SYBR</t> Green real-time <t>PCR</t> in oyster haemocytes after bacteria challenge and heat stress, including cgi-miR-8 (A), cgi-miR-12 (B), cgi-miR-100 (C), cgi-miR-125 (D), cgi-miR-1984 (E), scaffold631_909 (F), scaffold42648_5080 (G) and scaffold1599_5643 (H). 5S gene was used as an internal control to calibrate the cDNA template for all the samples. Each values were shown as mean ± SD (N = 5), and bars with different letters were significantly different ( P
    Quantitect Sybr Green Pcr Master Mix, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 5834 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitect sybr green pcr master mix/product/Qiagen
    Average 99 stars, based on 5834 article reviews
    Price from $9.99 to $1999.99
    quantitect sybr green pcr master mix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    94
    Toyobo sybr green realtime pcr master mix
    Rab8 regulates surface expression of Klotho. (a) A549 cells were transfected with Rab8 siRNAs, followed by western blotting assays to detect knockdown efficiency of siRNAs. (b) A549 cells were transfected with siRab8or myc-Rab8, and relative mRNA levels of Klotho were detected by <t>realtime</t> <t>PCR.</t> (c) A549 cells were transfected with siRab8or myc-Rab8, and relative protein levels of Klotho were detected by western blotting assay. (d) A549 cells transfected with Rab8 mutants or siRNA, then followed by surface biotinylation assay. Data shown are the mean ± SEM of three separate experiments (* p
    Sybr Green Realtime Pcr Master Mix, supplied by Toyobo, used in various techniques. Bioz Stars score: 94/100, based on 3921 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr green realtime pcr master mix/product/Toyobo
    Average 94 stars, based on 3921 article reviews
    Price from $9.99 to $1999.99
    sybr green realtime pcr master mix - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher power sybr green rna to ct 1 step kit
    Metanephric mesenchymal (MM) cell expression of <t>RNA</t> encoding mesenchymal and endothelial markers by RT-PCR. Total RNA was extracted from MM and ureteric bud (UB) cell lysates and reverse transcribed to synthesize cDNA with the use of the <t>SYBR</t> Green method. Ratio of cDNA transcript of marker: glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is shown for each cell line. The results show high transcript levels of mesenchymal markers forkhead box D1 (Foxd1), glioma-associated oncogene homolog 1 (Gli-1), and ANG-1 ( A–C ), as well as endothelial markers aquaporin 1 (AQP1), Flt-1 (vascular endothelial growth factor receptor 1; VEGFR1), Tie-2 (angiopoietin receptor), and platelet endothelial cell adhesion molecule (PECAM) ( D–G ) in MM cells relative to UB cells. Data are expressed as means ± SEM. n = 3 independent experiments. ∗ P
    Power Sybr Green Rna To Ct 1 Step Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2797 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/power sybr green rna to ct 1 step kit/product/Thermo Fisher
    Average 99 stars, based on 2797 article reviews
    Price from $9.99 to $1999.99
    power sybr green rna to ct 1 step kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    94
    Toyobo sybr green pcr master mix
    Wnt5a , FZD 4, FZD5 and RHOU are significantly down-regulated in newly diagnosed AML patients’ bone marrow samples compared to normal or CR group. Expression levels of Wnt5a , FZD4 , FZD5 and RHOU were determined by <t>RT-PCR</t> analysis of bone marrow samples from AML patients, either newly-diagnosed (AML-ND) or in complete remission (AML-CR), and healthy donors (CON) using <t>SYBR</t> Green PCR Master Mix. The Mann–Whitney test was used to compare differences between the two groups.
    Sybr Green Pcr Master Mix, supplied by Toyobo, used in various techniques. Bioz Stars score: 94/100, based on 3055 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr green pcr master mix/product/Toyobo
    Average 94 stars, based on 3055 article reviews
    Price from $9.99 to $1999.99
    sybr green pcr master mix - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher platinum taq polymerase
    Gene regulation by fatty acids. Myotubes were incubated with fatty acids (100 µM) or BSA (40 µM, control) for 24 h and harvested for RNA isolation. Real-time <t>PCR</t> was performed with platinum <t>Taq</t> polymerase and SYBR green on an iCycler PCR
    Platinum Taq Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 8048 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/platinum taq polymerase/product/Thermo Fisher
    Average 99 stars, based on 8048 article reviews
    Price from $9.99 to $1999.99
    platinum taq polymerase - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    92
    Thermo Fisher sybr greener qpcr supermix
    Gene regulation by fatty acids. Myotubes were incubated with fatty acids (100 µM) or BSA (40 µM, control) for 24 h and harvested for RNA isolation. Real-time <t>PCR</t> was performed with platinum <t>Taq</t> polymerase and SYBR green on an iCycler PCR
    Sybr Greener Qpcr Supermix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 2455 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr greener qpcr supermix/product/Thermo Fisher
    Average 92 stars, based on 2455 article reviews
    Price from $9.99 to $1999.99
    sybr greener qpcr supermix - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript iii platinum sybr green one step qrt pcr kit
    In vitro and ex vivo transcriptional regulation of chIFIT5 gene. ( A ) ChIFN-β itself, or produced by different stimuli, can initiate JAK-STAT signalling pathway and culminate in the induction of hundreds of ISGs. IFIT family of genes is one such antiviral effector of innate immune responses. ( B ) Quantitation of chIFIT5 mRNA in cells stimulated with 1000 U of chIFN-β, 10 μg/mL of LPS, 5 μg/mL of poly I:C or 1 MOI of NDV for 24 hours before RNA extraction and analysis for <t>qRT-PCR</t> using primers specific for the chIFIT5 gene. ( C–F ) Total cellular RNA was extracted from CEF cells at 1, 2, 4, 8, 16, and 24 hours post-NDV infection and was subjected to quantitation of mRNA for chIFIT5 ( C ), viral mRNA ( D ), chMx ( E ) and chIFN-β ( F , G ) RNA collected from seven organs infected or not with H9N2 influenza viruses were used to determine the level of chIFIT5 mRNA and M gene of the virus. Fold change induction in all experiments was determined by 2 −∆∆CT algorithm and data presented is average of <t>three</t> independent experiments.
    Superscript Iii Platinum Sybr Green One Step Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1742 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii platinum sybr green one step qrt pcr kit/product/Thermo Fisher
    Average 99 stars, based on 1742 article reviews
    Price from $9.99 to $1999.99
    superscript iii platinum sybr green one step qrt pcr kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher taqman universal pcr master mix
    In silico and experimental evidence predict the 3’UTR of PDHX is targeted by MicroRNA-27b. a Diagram illustrating the stepwise approach used to select potential miR-27b targets for experimental validation. b Preliminary luciferase assay of MCF7 cells transiently cotransfected with a PDHX luciferase vector and miR-27b mimic or control. Luciferase expression is quantitated by measuring the degree of luminescence detected by a luminometer 24 h post-transfection for each assay. c and d <t>TaqMan</t> <t>qRT-PCR</t> assessing miR-27b levels in transfected MCF7 and 4175 cells to confirm adequate delivery of RNA oligonucleotides into the cell. e Nucleotide sequences indicating the location of miR-27b binding within the PDHX 3’UTR. The sequence of the original luciferase construct and the eight base pair substitutions present in the mutant construct are shown beneath. Luciferase assays in MCF7 ( f ) and 4175 ( g ) cells, showing miR-27b targeting of the PDHX-3’UTR sequence is lost upon mutation of the seed region. h Expression of PDHX in the Staunton Cell line dataset accessed online using Oncomine. PDHX Fold Change (vs average of all cancers): − 5.602; p -value: 0.023. Under-expression Gene Rank for PDHX: 335 (in top 7%)
    Taqman Universal Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 54482 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman universal pcr master mix/product/Thermo Fisher
    Average 99 stars, based on 54482 article reviews
    Price from $9.99 to $1999.99
    taqman universal pcr master mix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Curcumin decreases BRCA1 occupancy at the HIV-1 LTR. A . TZM-bl cells were transfected with pcTat and treated the next day with vehicle (DMSO) or a titration of curcumin (0.5, 1, 10, and 20 μM). Samples were analyzed by western blot. Inset depicts a dose–response curve of BRCA1 protein abundance versus curcumin treatment based on the average densitometry counts with error bars representing standard error of three independent measurements. Western blot is representative of three independent experiments. Densitometry counts were taken from three independent treatments to acquire a dose–response curve of BRCA1 expression inhibition (inset plot) B . TZM-bl cells were transfected with pcTat and treated the next day with DMSO or 20 μM curcumin. Bright-Glo luciferase assays and CellTiter-Glo cell viability assays were performed 24 hours post-treatment as described by the manufacturer. Data was normalized to cells containing Tat and treated with DMSO as baseline for Tat-dependent LTR activation. Transfection and treatment assays were performed in triplicate and data plotted represents averaged data of two independent experiments. Error bars show the standard error of two averaged independent measurements. Viability assays were performed in triplicate. C . TZM-bl cells were transfected with pcTat and treated the next day with DMSO or curcumin (20 μM) for 24 hours prior to being collected for ChIP analysis. Antibodies used for ChIP were anti-BRCA1 (10 μg), anti-IgG (10 μg), and anti-RNA polymerase II (RNAP II, 10 μg). Quantitative PCR was performed using SYBR Green PCR Master Mix to analyze immunoprecipitated material. Single asterisk indicates p

    Journal: Virology Journal

    Article Title: BRCA1 functions as a novel transcriptional cofactor in HIV-1 infection

    doi: 10.1186/s12985-015-0266-8

    Figure Lengend Snippet: Curcumin decreases BRCA1 occupancy at the HIV-1 LTR. A . TZM-bl cells were transfected with pcTat and treated the next day with vehicle (DMSO) or a titration of curcumin (0.5, 1, 10, and 20 μM). Samples were analyzed by western blot. Inset depicts a dose–response curve of BRCA1 protein abundance versus curcumin treatment based on the average densitometry counts with error bars representing standard error of three independent measurements. Western blot is representative of three independent experiments. Densitometry counts were taken from three independent treatments to acquire a dose–response curve of BRCA1 expression inhibition (inset plot) B . TZM-bl cells were transfected with pcTat and treated the next day with DMSO or 20 μM curcumin. Bright-Glo luciferase assays and CellTiter-Glo cell viability assays were performed 24 hours post-treatment as described by the manufacturer. Data was normalized to cells containing Tat and treated with DMSO as baseline for Tat-dependent LTR activation. Transfection and treatment assays were performed in triplicate and data plotted represents averaged data of two independent experiments. Error bars show the standard error of two averaged independent measurements. Viability assays were performed in triplicate. C . TZM-bl cells were transfected with pcTat and treated the next day with DMSO or curcumin (20 μM) for 24 hours prior to being collected for ChIP analysis. Antibodies used for ChIP were anti-BRCA1 (10 μg), anti-IgG (10 μg), and anti-RNA polymerase II (RNAP II, 10 μg). Quantitative PCR was performed using SYBR Green PCR Master Mix to analyze immunoprecipitated material. Single asterisk indicates p

    Article Snippet: Quantitative PCR was performed using SYBR Green PCR Master Mix (#4309155, Applied Biosystems, Foster City, CA) with 5 μl of immunoprecipitated material, 0.2 μM of primer [HIV-1 LTR (−69 − +175) Forward 5′-CTGGGCGGGACTGGGGAG-3′ and Reverse 5′-TCACACAACAGACGGGCACAC-3′].

    Techniques: Transfection, Titration, Western Blot, Expressing, Inhibition, Luciferase, Activation Assay, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, SYBR Green Assay, Polymerase Chain Reaction, Immunoprecipitation

    BRCA1 is present at the HIV-1 LTR in HIV infected T-cells. A . CEM cells were infected with NL4-3 virus (p24 = 5000 pg/ml) for 4 hours and collected 72 hours post-infection for ChIP analysis. Antibodies used for ChIP were anti-BRCA1 (10 μg), anti-V5 (10 μg), and anti-histone H3-phosphorylated at S10 (pS10-H3, 5 μg). Quantitative PCR was performed using SYBR Green PCR Master Mix to analyze immunoprecipitated material. B . CEM cells were pre-treated with DMSO or 10 μM ATM inhibitor (ATM in ) for 2 hours. Cells were then infected with NL4-3 virus (p24 = 5000 pg/ml) for 4 hours, followed by post-treating the cells with DMSO or ATM in . Cells were collected 72 hours post-infection for ChIP analysis. Antibodies used for ChIP were anti-BRCA1 (10 μg), p-BRCA1 S1423 (10 μg), and anti-V5 (10 μg). Quantitative PCR was performed using SYBR Green PCR Master Mix to analyze immunoprecipitated material. Double asterisk indicates statistically significant difference p ≤ 0.01.

    Journal: Virology Journal

    Article Title: BRCA1 functions as a novel transcriptional cofactor in HIV-1 infection

    doi: 10.1186/s12985-015-0266-8

    Figure Lengend Snippet: BRCA1 is present at the HIV-1 LTR in HIV infected T-cells. A . CEM cells were infected with NL4-3 virus (p24 = 5000 pg/ml) for 4 hours and collected 72 hours post-infection for ChIP analysis. Antibodies used for ChIP were anti-BRCA1 (10 μg), anti-V5 (10 μg), and anti-histone H3-phosphorylated at S10 (pS10-H3, 5 μg). Quantitative PCR was performed using SYBR Green PCR Master Mix to analyze immunoprecipitated material. B . CEM cells were pre-treated with DMSO or 10 μM ATM inhibitor (ATM in ) for 2 hours. Cells were then infected with NL4-3 virus (p24 = 5000 pg/ml) for 4 hours, followed by post-treating the cells with DMSO or ATM in . Cells were collected 72 hours post-infection for ChIP analysis. Antibodies used for ChIP were anti-BRCA1 (10 μg), p-BRCA1 S1423 (10 μg), and anti-V5 (10 μg). Quantitative PCR was performed using SYBR Green PCR Master Mix to analyze immunoprecipitated material. Double asterisk indicates statistically significant difference p ≤ 0.01.

    Article Snippet: Quantitative PCR was performed using SYBR Green PCR Master Mix (#4309155, Applied Biosystems, Foster City, CA) with 5 μl of immunoprecipitated material, 0.2 μM of primer [HIV-1 LTR (−69 − +175) Forward 5′-CTGGGCGGGACTGGGGAG-3′ and Reverse 5′-TCACACAACAGACGGGCACAC-3′].

    Techniques: Infection, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, SYBR Green Assay, Polymerase Chain Reaction, Immunoprecipitation

    mRNA levels for articular cartilage markers (aggrecan, type II collagen (α1(II)) and catabolic markers (Cox-2, IL-6, iNOS, MMP-13) in vehicle-treated, Wnt3a-treated, IL-1ß-treated, or combined Wnt3a- and IL-1ß-treated human articular chondrocytes overexpressing AnxA6. Human articular chondrocytes were transfected with empty expression vector (EV) or expression vector containing full-length AnxA6 ( AnxA6 ). Twelve hours after transfection cells were serum-starved for 24 h followed by treatment with IL-1ß, Wnt3a, IL-1ß, or combined IL-1ß and Wnt3a for 24h. Levels of mRNA were determined by real-time PCR using SYBR Green and normalized to the level of 18S RNA. The mRNA levels are expressed relative to the level of vehicle-treated cells transfected with empty expression vector, which was set as 1. Data were obtained from triplicate PCRs using RNA from 3 different cultures ( n = 3). Values are the mean ± SD. (**p

    Journal: PLoS ONE

    Article Title: Annexin A6 regulates catabolic events in articular chondrocytes via the modulation of NF-κB and Wnt/ß-catenin signaling

    doi: 10.1371/journal.pone.0197690

    Figure Lengend Snippet: mRNA levels for articular cartilage markers (aggrecan, type II collagen (α1(II)) and catabolic markers (Cox-2, IL-6, iNOS, MMP-13) in vehicle-treated, Wnt3a-treated, IL-1ß-treated, or combined Wnt3a- and IL-1ß-treated human articular chondrocytes overexpressing AnxA6. Human articular chondrocytes were transfected with empty expression vector (EV) or expression vector containing full-length AnxA6 ( AnxA6 ). Twelve hours after transfection cells were serum-starved for 24 h followed by treatment with IL-1ß, Wnt3a, IL-1ß, or combined IL-1ß and Wnt3a for 24h. Levels of mRNA were determined by real-time PCR using SYBR Green and normalized to the level of 18S RNA. The mRNA levels are expressed relative to the level of vehicle-treated cells transfected with empty expression vector, which was set as 1. Data were obtained from triplicate PCRs using RNA from 3 different cultures ( n = 3). Values are the mean ± SD. (**p

    Article Snippet: PCRs were performed with a SYBR Green PCR Master Mix kit (Applied Biosystems), with 95°C for 10 min followed by 40 cycles at 95°C for 15 s and 60°C for 1 min, and 1 cycle at 95°C for 15 s and 60°C for 1 min.

    Techniques: Transfection, Expressing, Plasmid Preparation, Real-time Polymerase Chain Reaction, SYBR Green Assay

    c-Myc-bound promoters in mouse embryonic stem cells identified by ChIP-chip analysis and validated by qChIP-PCR. (A) Examples of three gene promoter regions identified using chromatin immunoprecipitation with anti-c-Myc antibody to probe DNA microarrays (see Methods and Materials for details). Shown are the fold enrichment ratios for anti-Myc ChIP-enriched versus total input genomic DNA (y axis) for all probes within the genomic regions indicated. Numbers represent the beginning and the end probe positions (x axis). The transcriptional start sites and direction of transcription are noted by arrows. (B) Validation by qChIP-PCR of putative c-Myc target genes in AK7 mES cells. Forty-four genes were selected at random for validation and included c-Myc target and non-c-Myc target genes as determined from the initial promoter array. Equal amounts of anti-c-Myc ChIP DNA and total input DNA were used for quantitative PCR employing SYBR Green detection with an ABI7900HT system. Bar heights represent the average fold enrichment ratios from 2 independent sets of anti-Myc ChIP-enriched versus total input genomic DNA. qChIP-PCR data derived for R1 mES cells is shown in Supplementary Figure S2 ).

    Journal: PLoS ONE

    Article Title: Gene Regulation and Epigenetic Remodeling in Murine Embryonic Stem Cells by c-Myc

    doi: 10.1371/journal.pone.0007839

    Figure Lengend Snippet: c-Myc-bound promoters in mouse embryonic stem cells identified by ChIP-chip analysis and validated by qChIP-PCR. (A) Examples of three gene promoter regions identified using chromatin immunoprecipitation with anti-c-Myc antibody to probe DNA microarrays (see Methods and Materials for details). Shown are the fold enrichment ratios for anti-Myc ChIP-enriched versus total input genomic DNA (y axis) for all probes within the genomic regions indicated. Numbers represent the beginning and the end probe positions (x axis). The transcriptional start sites and direction of transcription are noted by arrows. (B) Validation by qChIP-PCR of putative c-Myc target genes in AK7 mES cells. Forty-four genes were selected at random for validation and included c-Myc target and non-c-Myc target genes as determined from the initial promoter array. Equal amounts of anti-c-Myc ChIP DNA and total input DNA were used for quantitative PCR employing SYBR Green detection with an ABI7900HT system. Bar heights represent the average fold enrichment ratios from 2 independent sets of anti-Myc ChIP-enriched versus total input genomic DNA. qChIP-PCR data derived for R1 mES cells is shown in Supplementary Figure S2 ).

    Article Snippet: To validate the ChIP-chip data from the promoter array, 1 ng input and ChIP DNA for Real-Time PCR was carried out using SYBR green PCR mix (Applied Biosystems) on ABI7900HT detection system.

    Techniques: Chromatin Immunoprecipitation, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, SYBR Green Assay, Derivative Assay

    Characterization of hCAF1-depleted cells. MCF7 cells were transfected with vectors expressing control miRNA (mock) or with two alternative miRNAs (called kd, and kd-1) targeting hCAF1. After vector transfection and selection, mock, hCAF1 kd and hCAF1 kd-1 cells were obtained. Total RNA or protein extracts were prepared to test hCAF1 knockdown efficiency. ( A ) Left panel, SYBR green real-time RT–PCR analysis was performed for detection of transcript levels of hCAF1. Results were normalized using 36B4 mRNA level as an internal control. Transcript levels in control cells (mock) were set to 1. Right panel, hCAF1 protein levels were analysed by western blot from 30 μg of protein extracts. ( B ) Endogenous hCAF1 expression and localization in hCAF1 kd and hCAF1 kd-1 compared to the mock control, by Immunofluorescent staining using mouse polyclonal anti-CAF1 antibody and goat anti-mouse Alexa 488-conjugated secondary antibody (green). Scale bar=20 μm. ( C ) Upper: summary of Human Exon 1.0 ST Array analysis results. Diagram of the hierarchical clustering of gene expression profiles of control versus hCAF1-deficient hCAF1 kd cell lines. Probes are represented vertically, whereas conditions are shown horizontally. Lower: type I and II interferon distribution by ISG Database. ( D ) Validation of the DNA array screen. SYBR green RT-qPCR analysis of the upregulated gene products IFI27, IFI6, TAP1, STAT1, IFITM1, HERC6, PLSCR1 and the downregulated gene CSTA. Total RNA isolated from mock and hCAF1 kd cells was reverse transcribed, and PCR was performed with primers specific for the transcripts of the indicated genes. Gene expression levels were normalized to internal controls 36B4 and shown as expression levels of hCAF1 kd cells relative to expression levels in control cells (arbitrarily set to 1). ( E , F ) Rescue of hCAF1 functions in knockdown cells. hCAF1 kd cells were stably transfected with a plasmid expressing mouse flag CAF1 (insensitive to miRNAs), or with the empty vector used as a control. ( E ) The expression of the indicated genes was analysed by real-time RT-qPCR as in ( D ). ( F ) Efficiency of flag mCAF1 overexpression and the protein expression of the indicated hCAF1-regulated genes was assessed by western blot. The experiments illustrated in ( D ) and ( E ) were performed in triplicate and expressed as mean values of three independent experiments. Standard deviations are shown. page.

    Journal: The EMBO Journal

    Article Title: hCAF1/CNOT7 regulates interferon signalling by targeting STAT1

    doi: 10.1038/emboj.2013.11

    Figure Lengend Snippet: Characterization of hCAF1-depleted cells. MCF7 cells were transfected with vectors expressing control miRNA (mock) or with two alternative miRNAs (called kd, and kd-1) targeting hCAF1. After vector transfection and selection, mock, hCAF1 kd and hCAF1 kd-1 cells were obtained. Total RNA or protein extracts were prepared to test hCAF1 knockdown efficiency. ( A ) Left panel, SYBR green real-time RT–PCR analysis was performed for detection of transcript levels of hCAF1. Results were normalized using 36B4 mRNA level as an internal control. Transcript levels in control cells (mock) were set to 1. Right panel, hCAF1 protein levels were analysed by western blot from 30 μg of protein extracts. ( B ) Endogenous hCAF1 expression and localization in hCAF1 kd and hCAF1 kd-1 compared to the mock control, by Immunofluorescent staining using mouse polyclonal anti-CAF1 antibody and goat anti-mouse Alexa 488-conjugated secondary antibody (green). Scale bar=20 μm. ( C ) Upper: summary of Human Exon 1.0 ST Array analysis results. Diagram of the hierarchical clustering of gene expression profiles of control versus hCAF1-deficient hCAF1 kd cell lines. Probes are represented vertically, whereas conditions are shown horizontally. Lower: type I and II interferon distribution by ISG Database. ( D ) Validation of the DNA array screen. SYBR green RT-qPCR analysis of the upregulated gene products IFI27, IFI6, TAP1, STAT1, IFITM1, HERC6, PLSCR1 and the downregulated gene CSTA. Total RNA isolated from mock and hCAF1 kd cells was reverse transcribed, and PCR was performed with primers specific for the transcripts of the indicated genes. Gene expression levels were normalized to internal controls 36B4 and shown as expression levels of hCAF1 kd cells relative to expression levels in control cells (arbitrarily set to 1). ( E , F ) Rescue of hCAF1 functions in knockdown cells. hCAF1 kd cells were stably transfected with a plasmid expressing mouse flag CAF1 (insensitive to miRNAs), or with the empty vector used as a control. ( E ) The expression of the indicated genes was analysed by real-time RT-qPCR as in ( D ). ( F ) Efficiency of flag mCAF1 overexpression and the protein expression of the indicated hCAF1-regulated genes was assessed by western blot. The experiments illustrated in ( D ) and ( E ) were performed in triplicate and expressed as mean values of three independent experiments. Standard deviations are shown. page.

    Article Snippet: Real-time PCR was performed with SYBR Green qPCR master mix (Applied Biosystems) in a Step One plus real-time PCR detection system (Applied Biosystems).

    Techniques: Transfection, Expressing, Plasmid Preparation, Selection, SYBR Green Assay, Quantitative RT-PCR, Western Blot, Staining, DNA Array, Isolation, Polymerase Chain Reaction, Stable Transfection, Over Expression, Polyacrylamide Gel Electrophoresis

    miRNA profiling of prostate cancer cells and effect of combination therapy on miRNA expression. Total RNA including miRNAs was isolated from DU145-TXR and DU145 cells (A) or PC3 and PC3-TXR cells (B) using miRNEasy RNA isolation kit. SYBR Green based pathway-focused miScript miRNA PCR Array (Qiagen, MD) was used for miRNA profiling studies. The plates were run on a Roche Light Cycler 480® instrument and the expression of individual miRNAs was analyzed using the obtained C p values and the ΔΔCt method. Table in the insert (C) confirms validation of miRNA profiling data by miScript primer assay. Validation of miRNA profiling data was done by a SYBR Green based real time RT-PCR assay of selected miRNAs. As a normalizer, SNORD6 was used as a housekeeping miRNA. (D) Efficacy of combination therapy on restoration of miR 200 c and 34a was determined by treating DU145-TXR cells with PTX (0.5 µM) and CYA (10 µM)combination for 48 h after which total RNA was extracted, converted to cDNA and used as template for miScript primer assay for determining expression of miRNAs 200c and 34a. Untreated DU145-TXR cells were used as control for calculating fold change after a SYBR Green real time RT-PCR assay. Data represents mean ± SD (n = 3). * p

    Journal: PLoS ONE

    Article Title: Chemoresistance in Prostate Cancer Cells Is Regulated by miRNAs and Hedgehog Pathway

    doi: 10.1371/journal.pone.0040021

    Figure Lengend Snippet: miRNA profiling of prostate cancer cells and effect of combination therapy on miRNA expression. Total RNA including miRNAs was isolated from DU145-TXR and DU145 cells (A) or PC3 and PC3-TXR cells (B) using miRNEasy RNA isolation kit. SYBR Green based pathway-focused miScript miRNA PCR Array (Qiagen, MD) was used for miRNA profiling studies. The plates were run on a Roche Light Cycler 480® instrument and the expression of individual miRNAs was analyzed using the obtained C p values and the ΔΔCt method. Table in the insert (C) confirms validation of miRNA profiling data by miScript primer assay. Validation of miRNA profiling data was done by a SYBR Green based real time RT-PCR assay of selected miRNAs. As a normalizer, SNORD6 was used as a housekeeping miRNA. (D) Efficacy of combination therapy on restoration of miR 200 c and 34a was determined by treating DU145-TXR cells with PTX (0.5 µM) and CYA (10 µM)combination for 48 h after which total RNA was extracted, converted to cDNA and used as template for miScript primer assay for determining expression of miRNAs 200c and 34a. Untreated DU145-TXR cells were used as control for calculating fold change after a SYBR Green real time RT-PCR assay. Data represents mean ± SD (n = 3). * p

    Article Snippet: SYBR Green real-time PCR master mix and reverse transcription reagents were purchased from Applied Biosystems (Foster city, CA).

    Techniques: Expressing, Isolation, SYBR Green Assay, Polymerase Chain Reaction, Quantitative RT-PCR

    Effect of PTX and CYA on P-gp expression in DU145-TXR cells. Following treatment, with various drugs as described, total protein was extracted and separated by SDS-PAGE before probing with P-gp antibody. Actin was used as a loading control. A combination of 0.5 µM PTX and 10 µM CYA was more effective in downregulating P-gp expression in drug-resistant prostate cancer cells than monotherapy with either CYA or PTX at 10 and 0.5 µM concentration. P-gp downregulation with 25 µM CYA was nearly similar to that obtained by combination therapy. (B) Expression of Hh pathway and stem cell marker genes in DU145-TXR cells. Total RNA was extracted from cells and reverse transcribed to cDNA. Real time RT-PCR was carried out using SYBR Green chemistry and Ct values thus obtained were used to calculate the fold change. Drug resistant DU145-TXR cells have higher expression of all three genes tested. PTX sensitive DU145 cells were used as control and gene expression values for DU145-TXR cells were normalized with respect to the control values. * p

    Journal: PLoS ONE

    Article Title: Chemoresistance in Prostate Cancer Cells Is Regulated by miRNAs and Hedgehog Pathway

    doi: 10.1371/journal.pone.0040021

    Figure Lengend Snippet: Effect of PTX and CYA on P-gp expression in DU145-TXR cells. Following treatment, with various drugs as described, total protein was extracted and separated by SDS-PAGE before probing with P-gp antibody. Actin was used as a loading control. A combination of 0.5 µM PTX and 10 µM CYA was more effective in downregulating P-gp expression in drug-resistant prostate cancer cells than monotherapy with either CYA or PTX at 10 and 0.5 µM concentration. P-gp downregulation with 25 µM CYA was nearly similar to that obtained by combination therapy. (B) Expression of Hh pathway and stem cell marker genes in DU145-TXR cells. Total RNA was extracted from cells and reverse transcribed to cDNA. Real time RT-PCR was carried out using SYBR Green chemistry and Ct values thus obtained were used to calculate the fold change. Drug resistant DU145-TXR cells have higher expression of all three genes tested. PTX sensitive DU145 cells were used as control and gene expression values for DU145-TXR cells were normalized with respect to the control values. * p

    Article Snippet: SYBR Green real-time PCR master mix and reverse transcription reagents were purchased from Applied Biosystems (Foster city, CA).

    Techniques: Expressing, SDS Page, Concentration Assay, Marker, Quantitative RT-PCR, SYBR Green Assay

    SP fraction analysis and miRNA profiling of clinical prostate tissues. (A) Human prostate cancer tissue was converted to single cell suspensions as described in ‘ Methods ’. Cells were stained with Hoechst dye and analyzed as described previously. Nearly 1% of total viable cell population was gated as the SP fraction. (B) Total RNA was isolated from another set of human prostate tissues (cancer and benign) using miRNEasy RNA isolation kit. SYBR Green based pathway-focused miScript miRNA PCR Array (Qiagen, MD) was used for miRNA profiling studies. The plates were run on a Roche Light Cycler 480® instrument and the expression of individual miRNAs was analyzed using the obtained C t values and the ΔΔCt method. The fold changes in the tumor tissues were normalized with respect to the benign prostate tissue. (C) Table in the insert confirms validation of miRNA profiling data by miScript primer assay. Validation of miRNA profiling data was done by RT-PCR estimation of selected miRNAs200c, 34a and 29b. SNORD6 was used as a housekeeping miRNA for data normalization.

    Journal: PLoS ONE

    Article Title: Chemoresistance in Prostate Cancer Cells Is Regulated by miRNAs and Hedgehog Pathway

    doi: 10.1371/journal.pone.0040021

    Figure Lengend Snippet: SP fraction analysis and miRNA profiling of clinical prostate tissues. (A) Human prostate cancer tissue was converted to single cell suspensions as described in ‘ Methods ’. Cells were stained with Hoechst dye and analyzed as described previously. Nearly 1% of total viable cell population was gated as the SP fraction. (B) Total RNA was isolated from another set of human prostate tissues (cancer and benign) using miRNEasy RNA isolation kit. SYBR Green based pathway-focused miScript miRNA PCR Array (Qiagen, MD) was used for miRNA profiling studies. The plates were run on a Roche Light Cycler 480® instrument and the expression of individual miRNAs was analyzed using the obtained C t values and the ΔΔCt method. The fold changes in the tumor tissues were normalized with respect to the benign prostate tissue. (C) Table in the insert confirms validation of miRNA profiling data by miScript primer assay. Validation of miRNA profiling data was done by RT-PCR estimation of selected miRNAs200c, 34a and 29b. SNORD6 was used as a housekeeping miRNA for data normalization.

    Article Snippet: SYBR Green real-time PCR master mix and reverse transcription reagents were purchased from Applied Biosystems (Foster city, CA).

    Techniques: Staining, Isolation, SYBR Green Assay, Polymerase Chain Reaction, Expressing, Reverse Transcription Polymerase Chain Reaction

    Real time RT-PCR identification of gene targets of miRNA in DU145-TXR Cells. Several genes involved in cancer related biological processes and known targets of differentially expressed miRNAs in our study are altered in PTX resistant DU145 TXR cells. Following RNA extraction and SYBR Green based real time RT-PCR using specific gene primers, Cp values were calculated and resistant DU145 cells were used to normalize the expression of individual genes. Data represents the mean ± SD (n = 3).

    Journal: PLoS ONE

    Article Title: Chemoresistance in Prostate Cancer Cells Is Regulated by miRNAs and Hedgehog Pathway

    doi: 10.1371/journal.pone.0040021

    Figure Lengend Snippet: Real time RT-PCR identification of gene targets of miRNA in DU145-TXR Cells. Several genes involved in cancer related biological processes and known targets of differentially expressed miRNAs in our study are altered in PTX resistant DU145 TXR cells. Following RNA extraction and SYBR Green based real time RT-PCR using specific gene primers, Cp values were calculated and resistant DU145 cells were used to normalize the expression of individual genes. Data represents the mean ± SD (n = 3).

    Article Snippet: SYBR Green real-time PCR master mix and reverse transcription reagents were purchased from Applied Biosystems (Foster city, CA).

    Techniques: Quantitative RT-PCR, RNA Extraction, SYBR Green Assay, Expressing

    Comparison of the results obtained with real time RT-PCR and DNA microarrays analyses for aldolase , BAK1, CDNK1A, GADD45A, GAPDH, GPX1 , and MCL1 genes. After the incubation, total RNA was extracted, submitted to reverse transcription and then to amplification in the presence of SYBR Green and specific primers. RPL13A was used as the house keeping gene for data normalization. For real-time RT-PCR results, data are given in fold-induction. For DNA microarray results, mean ratios indicate a fold-increase or decrease in gene expression. They are highlighted in blue if statistically non significant, in yellow for quantitative data and in green for qualitative data, given with + or - signs (according to the inserted table).

    Journal: Molecular Cancer

    Article Title: Differential effects of hypoxia on etoposide-induced apoptosis according to the cancer cell lines

    doi: 10.1186/1476-4598-6-61

    Figure Lengend Snippet: Comparison of the results obtained with real time RT-PCR and DNA microarrays analyses for aldolase , BAK1, CDNK1A, GADD45A, GAPDH, GPX1 , and MCL1 genes. After the incubation, total RNA was extracted, submitted to reverse transcription and then to amplification in the presence of SYBR Green and specific primers. RPL13A was used as the house keeping gene for data normalization. For real-time RT-PCR results, data are given in fold-induction. For DNA microarray results, mean ratios indicate a fold-increase or decrease in gene expression. They are highlighted in blue if statistically non significant, in yellow for quantitative data and in green for qualitative data, given with + or - signs (according to the inserted table).

    Article Snippet: Amplification reaction assays contained 1× SYBR Green PCR Mastermix (Applied Biosystem) and primers (Eurogentec) at the optimal concentrations.

    Techniques: Quantitative RT-PCR, Incubation, Amplification, SYBR Green Assay, Microarray, Expressing

    Transcript levels of the “readthrough” acetylcholinesterase (AChE-R) variant are increased in cerebral cortex of AD subjects Relative mRNA levels of the transcripts for AChE-T (or “tailed”), AChE-R (or “readthrought”) and N-AChE (or N-extended) splice variants and for proline-rich membrane anchor 1 (PRiMA-1) were analysed by q RT-PCR in frontal cortex of NDC (n= 22) and AD subjects (n= 19). For AChE transcript analysis specific primers with Power SYBR® Green PCR Master Mix were employed and the specificity of the PCR products was confirmed by dissociation curve analysis. PRiMA-1 transcripts were measured using a specific TaqMan GenExpression Assay with TaqMan PCR Master Mix. Transcript levels were calculated by the comparative 2 −ΔCt method with respect to GAPDH. The results were confirmed in two independent determinations. Mean value ± SEM are represented. *Significantly increased ( p

    Journal: Journal of Alzheimer's disease : JAD

    Article Title: Increased expression of readthrough acetylcholinesterase variants in the brains of Alzheimer's disease patients

    doi: 10.3233/JAD-160220

    Figure Lengend Snippet: Transcript levels of the “readthrough” acetylcholinesterase (AChE-R) variant are increased in cerebral cortex of AD subjects Relative mRNA levels of the transcripts for AChE-T (or “tailed”), AChE-R (or “readthrought”) and N-AChE (or N-extended) splice variants and for proline-rich membrane anchor 1 (PRiMA-1) were analysed by q RT-PCR in frontal cortex of NDC (n= 22) and AD subjects (n= 19). For AChE transcript analysis specific primers with Power SYBR® Green PCR Master Mix were employed and the specificity of the PCR products was confirmed by dissociation curve analysis. PRiMA-1 transcripts were measured using a specific TaqMan GenExpression Assay with TaqMan PCR Master Mix. Transcript levels were calculated by the comparative 2 −ΔCt method with respect to GAPDH. The results were confirmed in two independent determinations. Mean value ± SEM are represented. *Significantly increased ( p

    Article Snippet: First-strand cDNAs were synthesized by reverse transcription of 1.5 μg of total RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems; Life Technologies Paisley, UK), according to the manufacturer's instructions. q RT-PCR amplification was performed using StepOne-Plus™ Real-Time PCR System with Power SYBR® Green PCR Master Mix (Applied Biosystems) according to the manufacturer's instructions for analysis of AChE transcripts.

    Techniques: Variant Assay, Reverse Transcription Polymerase Chain Reaction, SYBR Green Assay, Polymerase Chain Reaction

    E 2 increases the whole-cell T-type calcium current and the mRNA expression of Cav3.1 , but decreases the function of Stim1 in POMC neurons. (A) The current amplitude was normalized to the cell capacitance to calculate current density. Bar graphs summarize the density of T-type calcium current in POMC neurons from oil- and E 2 -treated animals. (B) Cav 3.1 mRNA expression was determined using the Taqman real-time PCR method in POMC neuronal pools (five cells in each pool). (C) Stim1 was measured in the arcuate nucleus in oil- and E 2 -treated females using SYBR Green real-time PCR (see “Materials and Methods”). (D) Based on single-cell RT-PCR analysis (65 cells from three female mice) > 75% of POMC neurons express Stim1 mRNA. A representative gel illustrating that single POMC-EGFP neurons express mRNA for Pomc and Stim1 , but not AgRP . –RT indicates that single cell reacted without RT; + indicates positive tissue control (with RT); – indicates negative tissue control (without RT). (E) In OVX females, insulin (Ins; 20 µM/4 µL “puff” application into bath) generated an inward current (4 pA) that washed out after several minutes, during which time the store-operated Ca 2+ channel inhibitor GSK 7975A (10 µM) was applied. A second application of insulin (puff application) generated 8 pA current. V hold = –60 mV. (F) GSK augmented the insulin-induced inward current by 2.9 ± 0.9-fold (n = 8). Data points represent the mean ± SEM. Unpaired two-tailed Student t test: t (15) = 3.986, P = 0.0012 (for T-type current); t (8) = 4.818, P = 0.0013 (for Cav3.1 mRNA); t (10) = 2.764, P = 0.020 (for Stim1 mRNA); t (25) = 2.184, P = 0.0386 (for GSK augmentation of insulin-induced inward current). * P

    Journal: Endocrinology

    Article Title: Estradiol Protects Proopiomelanocortin Neurons Against Insulin Resistance

    doi: 10.1210/en.2017-00793

    Figure Lengend Snippet: E 2 increases the whole-cell T-type calcium current and the mRNA expression of Cav3.1 , but decreases the function of Stim1 in POMC neurons. (A) The current amplitude was normalized to the cell capacitance to calculate current density. Bar graphs summarize the density of T-type calcium current in POMC neurons from oil- and E 2 -treated animals. (B) Cav 3.1 mRNA expression was determined using the Taqman real-time PCR method in POMC neuronal pools (five cells in each pool). (C) Stim1 was measured in the arcuate nucleus in oil- and E 2 -treated females using SYBR Green real-time PCR (see “Materials and Methods”). (D) Based on single-cell RT-PCR analysis (65 cells from three female mice) > 75% of POMC neurons express Stim1 mRNA. A representative gel illustrating that single POMC-EGFP neurons express mRNA for Pomc and Stim1 , but not AgRP . –RT indicates that single cell reacted without RT; + indicates positive tissue control (with RT); – indicates negative tissue control (without RT). (E) In OVX females, insulin (Ins; 20 µM/4 µL “puff” application into bath) generated an inward current (4 pA) that washed out after several minutes, during which time the store-operated Ca 2+ channel inhibitor GSK 7975A (10 µM) was applied. A second application of insulin (puff application) generated 8 pA current. V hold = –60 mV. (F) GSK augmented the insulin-induced inward current by 2.9 ± 0.9-fold (n = 8). Data points represent the mean ± SEM. Unpaired two-tailed Student t test: t (15) = 3.986, P = 0.0012 (for T-type current); t (8) = 4.818, P = 0.0013 (for Cav3.1 mRNA); t (10) = 2.764, P = 0.020 (for Stim1 mRNA); t (25) = 2.184, P = 0.0386 (for GSK augmentation of insulin-induced inward current). * P

    Article Snippet: The results were as follows: Pik3cb (p110 β ), m = –3.481, r 2 = 0.95, efficiency = 96%; Gapdh , m = –3.35, r 2 = 0.99, efficiency = 98.7%; Socs3 , m = –3.294, r 2 = 0.90, efficiency = 100%; Trpc5 , m = –3.161, r 2 = 0.95, efficiency = 100%; Stim1 , m = –3.407, r 2 = 0.98, efficiency = 97%. qPCR was performed on a Quantstudio 7 Flex Real-Time PCR System (Life Technologies, Grand Island, NY) using Power SYBR Green Master Mix (Life Technologies) according to established protocols ( ).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, SYBR Green Assay, Reverse Transcription Polymerase Chain Reaction, Mouse Assay, Generated, Two Tailed Test

    HuR associates with SCN5A mRNA (A) Schematic representation of the SCN5A mRNA ARE sites in its 3′-UTR. The length of the mRNA is indicated by a kilo base (kb)-scale. (B) HuR binds to the SCN5A mRNA. After IP of RNA-protein complexes from cardiomyocytes using either anti-HuR antibody (Anti-HuR) or control IgG, RNA was isolated, and then, the cDNA was synthesized in a presence or absence of the reverse transcription enzyme. Two sets of primers to different regions of SCN5A were used to amplify SCN5A fragments. The PCR products were visualized with SYBR ™ Safe DNA Gel Stain in agarose gels. (C) qRT-PCR was performed to confirm the results in (B).

    Journal: Heart rhythm

    Article Title: HuR-mediated SCN5A mRNA stability reduces arrhythmic risk in heart failure

    doi: 10.1016/j.hrthm.2018.02.018

    Figure Lengend Snippet: HuR associates with SCN5A mRNA (A) Schematic representation of the SCN5A mRNA ARE sites in its 3′-UTR. The length of the mRNA is indicated by a kilo base (kb)-scale. (B) HuR binds to the SCN5A mRNA. After IP of RNA-protein complexes from cardiomyocytes using either anti-HuR antibody (Anti-HuR) or control IgG, RNA was isolated, and then, the cDNA was synthesized in a presence or absence of the reverse transcription enzyme. Two sets of primers to different regions of SCN5A were used to amplify SCN5A fragments. The PCR products were visualized with SYBR ™ Safe DNA Gel Stain in agarose gels. (C) qRT-PCR was performed to confirm the results in (B).

    Article Snippet: Quantitative real-time reverse-transcriptase polymerase chain reaction (qRT-PCR) was carried out using gene-specific primers, Fast SYBR® Green Master Mix and 7500 Fast Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA).

    Techniques: Isolation, Synthesized, Polymerase Chain Reaction, Staining, Quantitative RT-PCR

    Downregulating UPF1 from HeLa or HepG2 cells results in an upregulation of the endogenous HFE transcripts which indicates that the physiological human HFE mRNA is a natural NMD-target. HeLa cells were transiently transfected with synthetic small-interfering RNA (siRNA) duplexes directed to human UPF1 or to a non-endogenous target (Luciferase; Luc) used as control. Twenty-four (24 h), forty-eight (48 h) and seventy-two hours (72 h) after siRNA treatment, cells were harvested and protein and RNA were isolated. (A) Representative Western blot analysis of the HeLa and HepG2 cells extracts transfected with human UPF1 siRNA. Immunoblotting was performed using a human UPF1 specific antibody and a α-tubulin specific antibody to control for variations in protein loading. The percentage (%) of UPF1 protein remaining expressed in the cells after siRNA treatment is indicated below each lane and was achieved by densitometric analysis using ImageJ software. (B) Relative changes in HFE mRNA levels were analyzed by quantitative reverse transcription-coupled real-time PCR (RT-qPCR), normalized to the levels of endogenous G protein pathway suppressor 1 ( GPS1 ) mRNA. For that, cDNA was synthesized from total RNA and then, each cDNA sample was used as template for qPCR, which was performed using the SYBR Green Master Mix (Applied Biosystems) and primers that specifically hybridize to the 5′-end of HFE exon seven. Quantification of the transcript levels was performed by the absolute quantification method. Levels of HFE mRNA obtained after cellular UPF1 siRNA treatment were compared to those obtained after Luciferase siRNA treatment at the same conditions (defined as 1; arbitrary units). The histogram shows the mean and standard deviations from three independent experiments, corresponding to three independent transfections. Statistical analysis was performed using Student's t test (unpaired, two tailed). Below the histograms, there is a schematic representation of the human HFE mRNA showing its seven exons and the position of the polyadenylation [poly(A)] signals used in its 3′-end processing. The location of the initiation (AUG) and termination (STOP) codons is also represented. The double arrow represents the coordinates of the amplicon obtained in the qPCR. (C) Relative changes in HFE mRNA levels were quantified by RT-qPCR as in B but using primers that specifically hybridize to the 5′-end of the HFE exon six. Quantification of the transcript levels was performed by the absolute quantification method. Levels of HFE mRNA obtained after cellular UPF1 siRNA treatment were compared to those obtained after Luciferase siRNA treatment at the same conditions (defined as 1; arbitrary units). The histogram shows the mean and standard deviations from three independent experiments, corresponding to three independent transfections. Statistical analysis was performed as in B . Below the histograms, there is a schematic representation of the human HFE mRNA showing its seven exons and the position of the polyadenylation [poly(A)] signals used in its 3′-end processing. The location of the initiation (AUG) and termination (STOP) codons is also represented. Arrows represent the position of primers used in the qPCR. (D) Representative Western blot analysis of HeLa cells extracts transfected with human UPF1 siRNA or with a control Luciferase siRNA target. Twenty-four hours after siRNA treatment, cells were transfected with the β-globin reporter constructs (β39). Twenty-four hours post transfection, protein and RNA were isolated from the cells for analysis. Immunoblotting to confirm UPF1 knockdown was carried out with anti-UPF1 and with anti-α-tubulin antibodies (as a loading control). Identification of each band is on the right. The percentage (%) of UPF1 protein remaining expressed in the cells after siRNA treatment is indicated below each lane and was achieved as in A . (E) Relative β-globin mRNA levels in UPF1-depleted HeLa cells, normalized to the levels of puromycin resistance mRNA (plasmids carrying the reporter β-globin gene also contain the Puro r gene), were determined by quantitative RT-qPCR and compared to the corresponding β39 mRNA levels under control conditions (Luc siRNA-treated HeLa cells) (defined as 1; arbitrary units). Using the same RNA samples, relative changes in HFE mRNA levels were also quantified by RT-qPCR, using experimental conditions as in B . Levels of HFE mRNA obtained after cellular UPF1 siRNA treatment were compared to those obtained after Luciferase siRNA treatment (defined as 1; arbitrary units). The histogram shows the mean and standard deviations from three independent experiments, corresponding to three independent transfections. Statistical analysis was performed as in B .

    Journal: PLoS ONE

    Article Title: Alternative Polyadenylation and Nonsense-Mediated Decay Coordinately Regulate the Human HFE mRNA Levels

    doi: 10.1371/journal.pone.0035461

    Figure Lengend Snippet: Downregulating UPF1 from HeLa or HepG2 cells results in an upregulation of the endogenous HFE transcripts which indicates that the physiological human HFE mRNA is a natural NMD-target. HeLa cells were transiently transfected with synthetic small-interfering RNA (siRNA) duplexes directed to human UPF1 or to a non-endogenous target (Luciferase; Luc) used as control. Twenty-four (24 h), forty-eight (48 h) and seventy-two hours (72 h) after siRNA treatment, cells were harvested and protein and RNA were isolated. (A) Representative Western blot analysis of the HeLa and HepG2 cells extracts transfected with human UPF1 siRNA. Immunoblotting was performed using a human UPF1 specific antibody and a α-tubulin specific antibody to control for variations in protein loading. The percentage (%) of UPF1 protein remaining expressed in the cells after siRNA treatment is indicated below each lane and was achieved by densitometric analysis using ImageJ software. (B) Relative changes in HFE mRNA levels were analyzed by quantitative reverse transcription-coupled real-time PCR (RT-qPCR), normalized to the levels of endogenous G protein pathway suppressor 1 ( GPS1 ) mRNA. For that, cDNA was synthesized from total RNA and then, each cDNA sample was used as template for qPCR, which was performed using the SYBR Green Master Mix (Applied Biosystems) and primers that specifically hybridize to the 5′-end of HFE exon seven. Quantification of the transcript levels was performed by the absolute quantification method. Levels of HFE mRNA obtained after cellular UPF1 siRNA treatment were compared to those obtained after Luciferase siRNA treatment at the same conditions (defined as 1; arbitrary units). The histogram shows the mean and standard deviations from three independent experiments, corresponding to three independent transfections. Statistical analysis was performed using Student's t test (unpaired, two tailed). Below the histograms, there is a schematic representation of the human HFE mRNA showing its seven exons and the position of the polyadenylation [poly(A)] signals used in its 3′-end processing. The location of the initiation (AUG) and termination (STOP) codons is also represented. The double arrow represents the coordinates of the amplicon obtained in the qPCR. (C) Relative changes in HFE mRNA levels were quantified by RT-qPCR as in B but using primers that specifically hybridize to the 5′-end of the HFE exon six. Quantification of the transcript levels was performed by the absolute quantification method. Levels of HFE mRNA obtained after cellular UPF1 siRNA treatment were compared to those obtained after Luciferase siRNA treatment at the same conditions (defined as 1; arbitrary units). The histogram shows the mean and standard deviations from three independent experiments, corresponding to three independent transfections. Statistical analysis was performed as in B . Below the histograms, there is a schematic representation of the human HFE mRNA showing its seven exons and the position of the polyadenylation [poly(A)] signals used in its 3′-end processing. The location of the initiation (AUG) and termination (STOP) codons is also represented. Arrows represent the position of primers used in the qPCR. (D) Representative Western blot analysis of HeLa cells extracts transfected with human UPF1 siRNA or with a control Luciferase siRNA target. Twenty-four hours after siRNA treatment, cells were transfected with the β-globin reporter constructs (β39). Twenty-four hours post transfection, protein and RNA were isolated from the cells for analysis. Immunoblotting to confirm UPF1 knockdown was carried out with anti-UPF1 and with anti-α-tubulin antibodies (as a loading control). Identification of each band is on the right. The percentage (%) of UPF1 protein remaining expressed in the cells after siRNA treatment is indicated below each lane and was achieved as in A . (E) Relative β-globin mRNA levels in UPF1-depleted HeLa cells, normalized to the levels of puromycin resistance mRNA (plasmids carrying the reporter β-globin gene also contain the Puro r gene), were determined by quantitative RT-qPCR and compared to the corresponding β39 mRNA levels under control conditions (Luc siRNA-treated HeLa cells) (defined as 1; arbitrary units). Using the same RNA samples, relative changes in HFE mRNA levels were also quantified by RT-qPCR, using experimental conditions as in B . Levels of HFE mRNA obtained after cellular UPF1 siRNA treatment were compared to those obtained after Luciferase siRNA treatment (defined as 1; arbitrary units). The histogram shows the mean and standard deviations from three independent experiments, corresponding to three independent transfections. Statistical analysis was performed as in B .

    Article Snippet: Real-time PCR was performed in an ABI Prism 7000 Sequence Detection System using SYBR Green Master Mix (Applied Biosystems).

    Techniques: Transfection, Small Interfering RNA, Luciferase, Isolation, Western Blot, Software, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Synthesized, SYBR Green Assay, Two Tailed Test, Amplification, Construct

    2.7. SYBR green Quantitative RT- PCR

    Journal: Journal of Immunological Methods

    Article Title: Characterization and use of a rabbit-anti-mouse VPAC1 antibody by flow cytometry

    doi: 10.1016/j.jim.2011.10.009

    Figure Lengend Snippet: 2.7. SYBR green Quantitative RT- PCR

    Article Snippet: Fast SYBR green PCR master mix was purchased from Applied Biosystems (Foster City, CA).

    Techniques: SYBR Green Assay, Quantitative RT-PCR

    Inhibition assays. Inhibition assays were set up as qPCR reactions using murine genomic DNA; a primer set specific to the mouse- HSD11β1 gene ( S1 Table ); and the PowerUp SYBR Green Master Mix. The reaction mixture was spiked with water (as a control) or extracted RNA or DNA from various kits. Shown are the Cq values for the control vs. reactions spiked with RNA (A) and DNA (B), in duplicate, with error bars representing standard deviations. (C) Fragment distribution of amplified RNA and DNA samples from select kits with corresponding positive controls (fresh PC-3 cells).

    Journal: PLoS ONE

    Article Title: Reliability and performance of commercial RNA and DNA extraction kits for FFPE tissue cores

    doi: 10.1371/journal.pone.0179732

    Figure Lengend Snippet: Inhibition assays. Inhibition assays were set up as qPCR reactions using murine genomic DNA; a primer set specific to the mouse- HSD11β1 gene ( S1 Table ); and the PowerUp SYBR Green Master Mix. The reaction mixture was spiked with water (as a control) or extracted RNA or DNA from various kits. Shown are the Cq values for the control vs. reactions spiked with RNA (A) and DNA (B), in duplicate, with error bars representing standard deviations. (C) Fragment distribution of amplified RNA and DNA samples from select kits with corresponding positive controls (fresh PC-3 cells).

    Article Snippet: Briefly, standard real-time PCR reactions were set up using murine genomic DNA derived from the Ep4 cell-line as the template; a primer set specific to the HSD11β1 gene ( ); and the PowerUp SYBR Green Master Mix (ThermoFisher Scientific, USA).

    Techniques: Inhibition, Real-time Polymerase Chain Reaction, SYBR Green Assay, Amplification

    RTA inhibits vFLIP-induced expression of TNFα and ICAM1 in 293T cells. A-D. 293T cells were transfected with myc-vFLIP, RTA or empty vector control where indicated. At 72 hrs post-transfection, cells were harvested and split for RNA isolation and western blot (see D). For qPCR total RNA was isolated, reverse transcribed and quantified on an ABI7000 with using primers for TNFα and ICAM1 and Sybr green. The housekeeping genes used in the analysis were B-actin and GAPDH. Data was analyzed using the ΔΔCt method. A. vFLIP induced expression of TNFα and ICAM shown as fold regulation 2∧(-ΔΔCt). B and C. vFLIP induced expression of (B) TNFα, p = 0.0001 and (C) ICAM1, p = 0.0001 in the presence or absence of RTA calculated relative to vFLIP alone. Error bars represent standard error. D. Representative western blot from the same experiment, showing vFLIP and RTA protein expression, and RTA induced degradation of vFLIP.

    Journal: PLoS ONE

    Article Title: KSHV RTA Abolishes NF?B Responsive Gene Expression during Lytic Reactivation by Targeting vFLIP for Degradation via the Proteasome

    doi: 10.1371/journal.pone.0091359

    Figure Lengend Snippet: RTA inhibits vFLIP-induced expression of TNFα and ICAM1 in 293T cells. A-D. 293T cells were transfected with myc-vFLIP, RTA or empty vector control where indicated. At 72 hrs post-transfection, cells were harvested and split for RNA isolation and western blot (see D). For qPCR total RNA was isolated, reverse transcribed and quantified on an ABI7000 with using primers for TNFα and ICAM1 and Sybr green. The housekeeping genes used in the analysis were B-actin and GAPDH. Data was analyzed using the ΔΔCt method. A. vFLIP induced expression of TNFα and ICAM shown as fold regulation 2∧(-ΔΔCt). B and C. vFLIP induced expression of (B) TNFα, p = 0.0001 and (C) ICAM1, p = 0.0001 in the presence or absence of RTA calculated relative to vFLIP alone. Error bars represent standard error. D. Representative western blot from the same experiment, showing vFLIP and RTA protein expression, and RTA induced degradation of vFLIP.

    Article Snippet: The resulting cDNA was used for qPCR performed on an ABI Prism 7000 Sequence Detection System using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Fermentas) as per manufacturer's specifications. vFLIP, ICAM1, TNFα, GAPDH, and Beta-actin were amplified using the following primers: B-actin F 5′-CAT GTA CGT TGC TAT CCA GGC-3′ , R 5′-CTC CTT AAT GTC ACG CAC GAT-3′ ; GAPDH F 5′-AAT CCC ATC ACC ATC TTC CAG-3′ , R 5′-AAA TGA GCC CCA GCC TTC-3′ ; ICAM1 F 5′-CAA TGT GCT ATT CAA ACT GCC C-3, R 5′-CAGCGTAGGGTAAGGTTCTTG-3′ ; TNFα F 5′-ACT TTG GAG TGA TCG GCC-3′ , R 5′-GCT TGA GGG TTT GCT ACA AC-3′; vFLIP F 5′- GGATGCCCTAATGTCAATGC-3′ , R 5′- GGCGATAGTGTTGGAGTGT-3′ .

    Techniques: Expressing, Transfection, Plasmid Preparation, Isolation, Western Blot, Real-time Polymerase Chain Reaction, SYBR Green Assay

    Expression analysis of genes identified in the papilla by LM–RNA-seq. qRT-PCR was performed using the SYBR Green Real-Time PCR Master Mix with a Bio-Rad CFX96 Real-Time Detection System. cDNAs were prepared from total RNAs of stigma and leaf. Representation of the relative expression levels of the genes was normalized to the expression level of UBC21 . Quantitative validation of three replicates was calculated using the delta–delta threshold cycle relative quantification method.

    Journal: Plant and Cell Physiology

    Article Title: Cell Type-Specific Transcriptome of Brassicaceae Stigmatic Papilla Cells From a Combination of Laser Microdissection and RNA Sequencing

    doi: 10.1093/pcp/pct133

    Figure Lengend Snippet: Expression analysis of genes identified in the papilla by LM–RNA-seq. qRT-PCR was performed using the SYBR Green Real-Time PCR Master Mix with a Bio-Rad CFX96 Real-Time Detection System. cDNAs were prepared from total RNAs of stigma and leaf. Representation of the relative expression levels of the genes was normalized to the expression level of UBC21 . Quantitative validation of three replicates was calculated using the delta–delta threshold cycle relative quantification method.

    Article Snippet: Total RNA was reverse-transcribed using the SuperScript III First-Strand Synthesis system with oligo(dT) primer, according to the manufacturer’s instructions. qRT-PCR was performed using the SYBR Green Real-Time PCR Master Mix (Toyobo) with a Bio-Rad CFX96 Real-Time Detection System.

    Techniques: Expressing, RNA Sequencing Assay, Quantitative RT-PCR, SYBR Green Assay, Real-time Polymerase Chain Reaction

    Relative mRNA expression of barrier function and nutrient sensing genes in different segments of intestinal mucosa in chickens injected in ovo with GOS. The panel includes genes encoding mucin, (A) MUC6 ; tight junctions components, (B) CLDN1 and (C) TJAP1 ; free fatty acid receptors, (D) FFAR2 and (E) FFAR4 ; and glucose transporters, (F) GLUT1 , (G) GLUT2 and (H) GLUT5 . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum and CEC–caecum. In ovo treatment groups: control (white bars)–injected in ovo with physiological saline; GOS (black bars)–injected in ovo with galactooligosaccharides. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) were collected from chickens on day 42 post-hatching. RT-qPCR data were generated with custom-designed primers used for amplification with SYBR green dye; Glucose-6-phosphate dehydrogenase ( G6PDH ) and beta-actin ( ACTB ) were used as reference genes; relative gene expression calculated as 2 –ΔΔCt; Two-way ANOVA with a post hoc HSD Tukey test was used to compare the groups. Asterisk indicates pair-wise significant differences ( P

    Journal: PLoS ONE

    Article Title: Modulation of microbial communities and mucosal gene expression in chicken intestines after galactooligosaccharides delivery In Ovo

    doi: 10.1371/journal.pone.0212318

    Figure Lengend Snippet: Relative mRNA expression of barrier function and nutrient sensing genes in different segments of intestinal mucosa in chickens injected in ovo with GOS. The panel includes genes encoding mucin, (A) MUC6 ; tight junctions components, (B) CLDN1 and (C) TJAP1 ; free fatty acid receptors, (D) FFAR2 and (E) FFAR4 ; and glucose transporters, (F) GLUT1 , (G) GLUT2 and (H) GLUT5 . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum and CEC–caecum. In ovo treatment groups: control (white bars)–injected in ovo with physiological saline; GOS (black bars)–injected in ovo with galactooligosaccharides. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) were collected from chickens on day 42 post-hatching. RT-qPCR data were generated with custom-designed primers used for amplification with SYBR green dye; Glucose-6-phosphate dehydrogenase ( G6PDH ) and beta-actin ( ACTB ) were used as reference genes; relative gene expression calculated as 2 –ΔΔCt; Two-way ANOVA with a post hoc HSD Tukey test was used to compare the groups. Asterisk indicates pair-wise significant differences ( P

    Article Snippet: A total reaction volume of 10 μl in a 384-well plate format contained 5 μl Maxima SYBR Green qPCR Master Mix (Thermo Scientific/Fermentas, Vilnius, Lithuania), 0.2 μM of each primer, specific to 16s rDNA of Bifidobacterium spp. (F: GCGTGCTTAACACATGCAAGTC , R: CACCCGTTTCCAGGAGCTATT ) [ ], Lactobacillus spp. (F: AGCAGTAGGGAATCTTCCA , R: CACCGCTACACATGGAG ) [ , ] or universal bacteria (F: ACTCCTACGGGAGGCAGCAGT , R: GTATTACCGCGGCTGCTGGCAC ) [ ] and 2 ng of bacterial DNA template.

    Techniques: Expressing, Injection, In Ovo, Capillary Electrochromatography, Incubation, Quantitative RT-PCR, Generated, Amplification, SYBR Green Assay

    A heat map of hierarchically clustered gene expression in different segments of intestinal mucosa in chicken treated with GOS in ovo . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum, and CEC–caecum. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) collected from chickens on day 42 post-hatching. RT-qPCR data were generated with custom-designed primers used for amplification with SYBR green dye; Glucose-6-phosphate dehydrogenase (G6PDH) and beta-actin (ACTB) were used as reference genes; relative gene expression (fold change) calculated as 2 –ΔΔCt . A Multiexperiment Viewer version 4.9 (MeV) was used for constructing a Hierarchical Cluster Tree based on fold change. Colours (red-black-green) show relative gene expression changes in GOS vs. C (red: down-regulated, green: up-regulated genes).

    Journal: PLoS ONE

    Article Title: Modulation of microbial communities and mucosal gene expression in chicken intestines after galactooligosaccharides delivery In Ovo

    doi: 10.1371/journal.pone.0212318

    Figure Lengend Snippet: A heat map of hierarchically clustered gene expression in different segments of intestinal mucosa in chicken treated with GOS in ovo . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum, and CEC–caecum. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) collected from chickens on day 42 post-hatching. RT-qPCR data were generated with custom-designed primers used for amplification with SYBR green dye; Glucose-6-phosphate dehydrogenase (G6PDH) and beta-actin (ACTB) were used as reference genes; relative gene expression (fold change) calculated as 2 –ΔΔCt . A Multiexperiment Viewer version 4.9 (MeV) was used for constructing a Hierarchical Cluster Tree based on fold change. Colours (red-black-green) show relative gene expression changes in GOS vs. C (red: down-regulated, green: up-regulated genes).

    Article Snippet: A total reaction volume of 10 μl in a 384-well plate format contained 5 μl Maxima SYBR Green qPCR Master Mix (Thermo Scientific/Fermentas, Vilnius, Lithuania), 0.2 μM of each primer, specific to 16s rDNA of Bifidobacterium spp. (F: GCGTGCTTAACACATGCAAGTC , R: CACCCGTTTCCAGGAGCTATT ) [ ], Lactobacillus spp. (F: AGCAGTAGGGAATCTTCCA , R: CACCGCTACACATGGAG ) [ , ] or universal bacteria (F: ACTCCTACGGGAGGCAGCAGT , R: GTATTACCGCGGCTGCTGGCAC ) [ ] and 2 ng of bacterial DNA template.

    Techniques: Expressing, In Ovo, Capillary Electrochromatography, Injection, Incubation, Quantitative RT-PCR, Generated, Amplification, SYBR Green Assay

    Relative mRNA expression of intestinal immune-related genes in different segments of intestinal mucosa in chickens injected in ovo with GOS. The panel includes genes encoding cytokines, (A) IL-1β , (B) IL10 and (C) IL12p40 ; and host defence peptides, (D) AvBD1 and (E) CATHL . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum, and CEC–caecum. In ovo treatment groups: control (white bars), injected in ovo with physiological saline; GOS (black bars)–injected in ovo with galactooligosaccharides. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) were collected from chickens on day 42 post-hatching. RT-qPCR data were generated with custom-designed primers used for amplification with SYBR green dye; Glucose-6-phosphate dehydrogenase ( G6PDH ) and beta-actin ( ACTB ) were used as reference genes; relative gene expression calculated as 2 –ΔΔCt; Two-way ANOVA with post hoc HSD Tukey test was used to compare the groups. Asterisk indicates pair-wise significant differences ( P

    Journal: PLoS ONE

    Article Title: Modulation of microbial communities and mucosal gene expression in chicken intestines after galactooligosaccharides delivery In Ovo

    doi: 10.1371/journal.pone.0212318

    Figure Lengend Snippet: Relative mRNA expression of intestinal immune-related genes in different segments of intestinal mucosa in chickens injected in ovo with GOS. The panel includes genes encoding cytokines, (A) IL-1β , (B) IL10 and (C) IL12p40 ; and host defence peptides, (D) AvBD1 and (E) CATHL . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum, and CEC–caecum. In ovo treatment groups: control (white bars), injected in ovo with physiological saline; GOS (black bars)–injected in ovo with galactooligosaccharides. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) were collected from chickens on day 42 post-hatching. RT-qPCR data were generated with custom-designed primers used for amplification with SYBR green dye; Glucose-6-phosphate dehydrogenase ( G6PDH ) and beta-actin ( ACTB ) were used as reference genes; relative gene expression calculated as 2 –ΔΔCt; Two-way ANOVA with post hoc HSD Tukey test was used to compare the groups. Asterisk indicates pair-wise significant differences ( P

    Article Snippet: A total reaction volume of 10 μl in a 384-well plate format contained 5 μl Maxima SYBR Green qPCR Master Mix (Thermo Scientific/Fermentas, Vilnius, Lithuania), 0.2 μM of each primer, specific to 16s rDNA of Bifidobacterium spp. (F: GCGTGCTTAACACATGCAAGTC , R: CACCCGTTTCCAGGAGCTATT ) [ ], Lactobacillus spp. (F: AGCAGTAGGGAATCTTCCA , R: CACCGCTACACATGGAG ) [ , ] or universal bacteria (F: ACTCCTACGGGAGGCAGCAGT , R: GTATTACCGCGGCTGCTGGCAC ) [ ] and 2 ng of bacterial DNA template.

    Techniques: Expressing, Injection, In Ovo, Capillary Electrochromatography, Incubation, Quantitative RT-PCR, Generated, Amplification, SYBR Green Assay

    Expression patterns of SlIPT4 in tomato. Relative expression analysis of SlIPT4 was performed in different tissues ( a ), in leaves at different developmental stages ( b ), in different parts of flower at different developmental stages ( c ), in fruits at different stages ( d ), and in response to drought stress treatment ( e ) by qRT-PCR. Petals have been shed at the post-anthesis stage, so no data was shown at this stage. Data are expressed as relative values, based on the values of leaf ( a ), expending leaf ( b ), early mature green fruit ( c and d ), and corresponding control groups ( e ) taken as reference sample set to 1. Each value represents mean ± SE (standard error) of three replicates. Ro, root; St, stem; Le, leaf; Fl, flower; Fr, fruit. Yl, young leaf; El, expending leaf; Edl, expended leaf. EMG, early mature green; MG, mature green; Br, break; Or, orange; Ri, ripening. CK, control; DT, drought treatment; 2, 6, 12 and 24 h represent the hours after watering

    Journal: BMC Plant Biology

    Article Title: Tomato (Solanum lycopersicum) SlIPT4, encoding an isopentenyltransferase, is involved in leaf senescence and lycopene biosynthesis during fruit ripening

    doi: 10.1186/s12870-018-1327-0

    Figure Lengend Snippet: Expression patterns of SlIPT4 in tomato. Relative expression analysis of SlIPT4 was performed in different tissues ( a ), in leaves at different developmental stages ( b ), in different parts of flower at different developmental stages ( c ), in fruits at different stages ( d ), and in response to drought stress treatment ( e ) by qRT-PCR. Petals have been shed at the post-anthesis stage, so no data was shown at this stage. Data are expressed as relative values, based on the values of leaf ( a ), expending leaf ( b ), early mature green fruit ( c and d ), and corresponding control groups ( e ) taken as reference sample set to 1. Each value represents mean ± SE (standard error) of three replicates. Ro, root; St, stem; Le, leaf; Fl, flower; Fr, fruit. Yl, young leaf; El, expending leaf; Edl, expended leaf. EMG, early mature green; MG, mature green; Br, break; Or, orange; Ri, ripening. CK, control; DT, drought treatment; 2, 6, 12 and 24 h represent the hours after watering

    Article Snippet: Quantitative real-time PCR (qRT-PCR) was performed using cDNAs corresponding to 2 ng of total RNA in 10 μL reaction volume using SYBR GREEN PCR Master Mix on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, USA).

    Techniques: Expressing, Quantitative RT-PCR

    The expression of eight miRNAs detected by SYBR Green real-time PCR in oyster haemocytes after bacteria challenge and heat stress, including cgi-miR-8 (A), cgi-miR-12 (B), cgi-miR-100 (C), cgi-miR-125 (D), cgi-miR-1984 (E), scaffold631_909 (F), scaffold42648_5080 (G) and scaffold1599_5643 (H). 5S gene was used as an internal control to calibrate the cDNA template for all the samples. Each values were shown as mean ± SD (N = 5), and bars with different letters were significantly different ( P

    Journal: PLoS ONE

    Article Title: The Identification and Characteristics of Immune-Related MicroRNAs in Haemocytes of Oyster Crassostrea gigas

    doi: 10.1371/journal.pone.0088397

    Figure Lengend Snippet: The expression of eight miRNAs detected by SYBR Green real-time PCR in oyster haemocytes after bacteria challenge and heat stress, including cgi-miR-8 (A), cgi-miR-12 (B), cgi-miR-100 (C), cgi-miR-125 (D), cgi-miR-1984 (E), scaffold631_909 (F), scaffold42648_5080 (G) and scaffold1599_5643 (H). 5S gene was used as an internal control to calibrate the cDNA template for all the samples. Each values were shown as mean ± SD (N = 5), and bars with different letters were significantly different ( P

    Article Snippet: The quantitative real-time PCR was carried out in a total volume of 25.0 µL, containing 12.5 µL of 2x QuantiTect SYBR Green PCR Master Mix (QIAGEN, miScript SYBR Green PCR Kit), 2.5 µL of diluted cDNA, 2.5 µL of each primers (10 mmol L−1 ), and 5.0 µL of RNase-free water.

    Techniques: Expressing, SYBR Green Assay, Real-time Polymerase Chain Reaction

    Rab8 regulates surface expression of Klotho. (a) A549 cells were transfected with Rab8 siRNAs, followed by western blotting assays to detect knockdown efficiency of siRNAs. (b) A549 cells were transfected with siRab8or myc-Rab8, and relative mRNA levels of Klotho were detected by realtime PCR. (c) A549 cells were transfected with siRab8or myc-Rab8, and relative protein levels of Klotho were detected by western blotting assay. (d) A549 cells transfected with Rab8 mutants or siRNA, then followed by surface biotinylation assay. Data shown are the mean ± SEM of three separate experiments (* p

    Journal: EBioMedicine

    Article Title: Rab8 GTPase regulates Klotho-mediated inhibition of cell growth and progression by directly modulating its surface expression in human non-small cell lung cancer

    doi: 10.1016/j.ebiom.2019.10.040

    Figure Lengend Snippet: Rab8 regulates surface expression of Klotho. (a) A549 cells were transfected with Rab8 siRNAs, followed by western blotting assays to detect knockdown efficiency of siRNAs. (b) A549 cells were transfected with siRab8or myc-Rab8, and relative mRNA levels of Klotho were detected by realtime PCR. (c) A549 cells were transfected with siRab8or myc-Rab8, and relative protein levels of Klotho were detected by western blotting assay. (d) A549 cells transfected with Rab8 mutants or siRNA, then followed by surface biotinylation assay. Data shown are the mean ± SEM of three separate experiments (* p

    Article Snippet: Fetal bovine serum (GIBCO), 0.25% trypsin (GIBCO), SYBR Green Realtime PCR Master Mix (TOYOBO, QRT-101), First Strand cDNA Synthesis Kit (TOYOBO, FSK-101), Trizol (Invitrogen, 66012), Lipofectamine® 2000 Reagent (Invitrogen, Cat. #11618-019), Opti-MEM (Invitrogen, Cat. #31985-062).

    Techniques: Expressing, Transfection, Western Blot, Polymerase Chain Reaction, Surface Biotinylation Assay

    Metanephric mesenchymal (MM) cell expression of RNA encoding mesenchymal and endothelial markers by RT-PCR. Total RNA was extracted from MM and ureteric bud (UB) cell lysates and reverse transcribed to synthesize cDNA with the use of the SYBR Green method. Ratio of cDNA transcript of marker: glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is shown for each cell line. The results show high transcript levels of mesenchymal markers forkhead box D1 (Foxd1), glioma-associated oncogene homolog 1 (Gli-1), and ANG-1 ( A–C ), as well as endothelial markers aquaporin 1 (AQP1), Flt-1 (vascular endothelial growth factor receptor 1; VEGFR1), Tie-2 (angiopoietin receptor), and platelet endothelial cell adhesion molecule (PECAM) ( D–G ) in MM cells relative to UB cells. Data are expressed as means ± SEM. n = 3 independent experiments. ∗ P

    Journal: The American Journal of Pathology

    Article Title: Mouse Metanephric Mesenchymal Cell–Derived Angioblasts Undergo Vasculogenesis in Three-Dimensional Culture

    doi: 10.1016/j.ajpath.2017.10.022

    Figure Lengend Snippet: Metanephric mesenchymal (MM) cell expression of RNA encoding mesenchymal and endothelial markers by RT-PCR. Total RNA was extracted from MM and ureteric bud (UB) cell lysates and reverse transcribed to synthesize cDNA with the use of the SYBR Green method. Ratio of cDNA transcript of marker: glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is shown for each cell line. The results show high transcript levels of mesenchymal markers forkhead box D1 (Foxd1), glioma-associated oncogene homolog 1 (Gli-1), and ANG-1 ( A–C ), as well as endothelial markers aquaporin 1 (AQP1), Flt-1 (vascular endothelial growth factor receptor 1; VEGFR1), Tie-2 (angiopoietin receptor), and platelet endothelial cell adhesion molecule (PECAM) ( D–G ) in MM cells relative to UB cells. Data are expressed as means ± SEM. n = 3 independent experiments. ∗ P

    Article Snippet: Twenty nanograms of total RNA from each sample was amplified with specific primers with the use of the Power SYBR Green RNA-to-CT 1-Step Kit and 7900HT fast Real-Time PCR System (Applied Biosystems, Foster City, CA).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, SYBR Green Assay, Marker

    Wnt5a , FZD 4, FZD5 and RHOU are significantly down-regulated in newly diagnosed AML patients’ bone marrow samples compared to normal or CR group. Expression levels of Wnt5a , FZD4 , FZD5 and RHOU were determined by RT-PCR analysis of bone marrow samples from AML patients, either newly-diagnosed (AML-ND) or in complete remission (AML-CR), and healthy donors (CON) using SYBR Green PCR Master Mix. The Mann–Whitney test was used to compare differences between the two groups.

    Journal: BMC Cancer

    Article Title: Wnt signaling is involved in 6-benzylthioinosine-induced AML cell differentiation

    doi: 10.1186/1471-2407-14-886

    Figure Lengend Snippet: Wnt5a , FZD 4, FZD5 and RHOU are significantly down-regulated in newly diagnosed AML patients’ bone marrow samples compared to normal or CR group. Expression levels of Wnt5a , FZD4 , FZD5 and RHOU were determined by RT-PCR analysis of bone marrow samples from AML patients, either newly-diagnosed (AML-ND) or in complete remission (AML-CR), and healthy donors (CON) using SYBR Green PCR Master Mix. The Mann–Whitney test was used to compare differences between the two groups.

    Article Snippet: For patient samples, qRT-PCR was performed using SYBR Green PCR Master Mix (Toyobo) on an ABI Prism 7500 sequence detection system.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, SYBR Green Assay, Polymerase Chain Reaction, MANN-WHITNEY

    Gene regulation by fatty acids. Myotubes were incubated with fatty acids (100 µM) or BSA (40 µM, control) for 24 h and harvested for RNA isolation. Real-time PCR was performed with platinum Taq polymerase and SYBR green on an iCycler PCR

    Journal: Journal of Lipid Research

    Article Title: Metabolic switching of human myotubes is improved by n-3 fatty acids

    doi: 10.1194/jlr.M003319

    Figure Lengend Snippet: Gene regulation by fatty acids. Myotubes were incubated with fatty acids (100 µM) or BSA (40 µM, control) for 24 h and harvested for RNA isolation. Real-time PCR was performed with platinum Taq polymerase and SYBR green on an iCycler PCR

    Article Snippet: Real-time PCR was performed with platinum Taq polymerase (Invitrogen, Breda, The Netherlands) and SYBR green on an iCycler PCR machine (Bio-Rad Laboratories).

    Techniques: Incubation, Isolation, Real-time Polymerase Chain Reaction, SYBR Green Assay, Polymerase Chain Reaction

    In vitro and ex vivo transcriptional regulation of chIFIT5 gene. ( A ) ChIFN-β itself, or produced by different stimuli, can initiate JAK-STAT signalling pathway and culminate in the induction of hundreds of ISGs. IFIT family of genes is one such antiviral effector of innate immune responses. ( B ) Quantitation of chIFIT5 mRNA in cells stimulated with 1000 U of chIFN-β, 10 μg/mL of LPS, 5 μg/mL of poly I:C or 1 MOI of NDV for 24 hours before RNA extraction and analysis for qRT-PCR using primers specific for the chIFIT5 gene. ( C–F ) Total cellular RNA was extracted from CEF cells at 1, 2, 4, 8, 16, and 24 hours post-NDV infection and was subjected to quantitation of mRNA for chIFIT5 ( C ), viral mRNA ( D ), chMx ( E ) and chIFN-β ( F , G ) RNA collected from seven organs infected or not with H9N2 influenza viruses were used to determine the level of chIFIT5 mRNA and M gene of the virus. Fold change induction in all experiments was determined by 2 −∆∆CT algorithm and data presented is average of three independent experiments.

    Journal: Scientific Reports

    Article Title: Chicken Interferon-induced Protein with Tetratricopeptide Repeats 5 Antagonizes Replication of RNA Viruses

    doi: 10.1038/s41598-018-24905-y

    Figure Lengend Snippet: In vitro and ex vivo transcriptional regulation of chIFIT5 gene. ( A ) ChIFN-β itself, or produced by different stimuli, can initiate JAK-STAT signalling pathway and culminate in the induction of hundreds of ISGs. IFIT family of genes is one such antiviral effector of innate immune responses. ( B ) Quantitation of chIFIT5 mRNA in cells stimulated with 1000 U of chIFN-β, 10 μg/mL of LPS, 5 μg/mL of poly I:C or 1 MOI of NDV for 24 hours before RNA extraction and analysis for qRT-PCR using primers specific for the chIFIT5 gene. ( C–F ) Total cellular RNA was extracted from CEF cells at 1, 2, 4, 8, 16, and 24 hours post-NDV infection and was subjected to quantitation of mRNA for chIFIT5 ( C ), viral mRNA ( D ), chMx ( E ) and chIFN-β ( F , G ) RNA collected from seven organs infected or not with H9N2 influenza viruses were used to determine the level of chIFIT5 mRNA and M gene of the virus. Fold change induction in all experiments was determined by 2 −∆∆CT algorithm and data presented is average of three independent experiments.

    Article Snippet: A total of 200 ng of RNA was used in PCR reactions using SuperScript® III Platinum® SYBR® Green One-Step qRT-PCR Kit (Invitrogen, Carlsbad, CA, USA).

    Techniques: In Vitro, Ex Vivo, Produced, Quantitation Assay, RNA Extraction, Quantitative RT-PCR, Infection

    Silencing of endogenous chIFIT5 gene in transgenic chicken embryos and impact on the virus replication. ( A ) Three shRNA targeting exon 2 of chIFIT5 were cloned in pRFPRNAiC vector between NheI and MluI downstream to the chicken U6 promoter. ( B ) DF-1 cells were transfected with 500 ng of pRFPRNAiC-shRNA plasmid expressing each of the cloned shRNA or empty vector. The expression of RFP marker gene demonstrates the integrity of the constructs. ( C ) Transfer of validated shRNA (shRNA #3) cassette between NotI and ClaI sites in RCASBP(A) vector. ( D ) Silencing efficacies of all three chIFIT5-targeted shRNA compared to scrambled (non-targeting) shRNA. DF-1 cells, transfected with 500 ng of each of the plasmids, were used to extract total cellular RNA and the level of chIFIT5 gene silencing was monitored using qRT-PCR. ( E ) Retroviruses were rescued in DF-1 cells and stained for structural gag protein indicating the replication-competency of these retroviruses. ( F ) Infectious cells stably expressing pre-validated shRNA against chIFIT5 gene were inoculated in 3 days old chicken embryos and allowed to develop until 9 days post-embryonation when 100 FPUs of NDV were inoculated per transgenic egg and the quantification of the virus replication was performed on day 14 post-embryonation. ( G ) Quantitative analysis of viruses in NDV-infected and un-infected transgenic embryos expressing shRNA, wt chIFIT5 or shRNA-resistant chIFIT5. Each dot represents individual chicken embryo in all experimental groups.

    Journal: Scientific Reports

    Article Title: Chicken Interferon-induced Protein with Tetratricopeptide Repeats 5 Antagonizes Replication of RNA Viruses

    doi: 10.1038/s41598-018-24905-y

    Figure Lengend Snippet: Silencing of endogenous chIFIT5 gene in transgenic chicken embryos and impact on the virus replication. ( A ) Three shRNA targeting exon 2 of chIFIT5 were cloned in pRFPRNAiC vector between NheI and MluI downstream to the chicken U6 promoter. ( B ) DF-1 cells were transfected with 500 ng of pRFPRNAiC-shRNA plasmid expressing each of the cloned shRNA or empty vector. The expression of RFP marker gene demonstrates the integrity of the constructs. ( C ) Transfer of validated shRNA (shRNA #3) cassette between NotI and ClaI sites in RCASBP(A) vector. ( D ) Silencing efficacies of all three chIFIT5-targeted shRNA compared to scrambled (non-targeting) shRNA. DF-1 cells, transfected with 500 ng of each of the plasmids, were used to extract total cellular RNA and the level of chIFIT5 gene silencing was monitored using qRT-PCR. ( E ) Retroviruses were rescued in DF-1 cells and stained for structural gag protein indicating the replication-competency of these retroviruses. ( F ) Infectious cells stably expressing pre-validated shRNA against chIFIT5 gene were inoculated in 3 days old chicken embryos and allowed to develop until 9 days post-embryonation when 100 FPUs of NDV were inoculated per transgenic egg and the quantification of the virus replication was performed on day 14 post-embryonation. ( G ) Quantitative analysis of viruses in NDV-infected and un-infected transgenic embryos expressing shRNA, wt chIFIT5 or shRNA-resistant chIFIT5. Each dot represents individual chicken embryo in all experimental groups.

    Article Snippet: A total of 200 ng of RNA was used in PCR reactions using SuperScript® III Platinum® SYBR® Green One-Step qRT-PCR Kit (Invitrogen, Carlsbad, CA, USA).

    Techniques: Transgenic Assay, shRNA, Clone Assay, Plasmid Preparation, Transfection, Expressing, Marker, Construct, Quantitative RT-PCR, Staining, Stable Transfection, Infection

    In silico and experimental evidence predict the 3’UTR of PDHX is targeted by MicroRNA-27b. a Diagram illustrating the stepwise approach used to select potential miR-27b targets for experimental validation. b Preliminary luciferase assay of MCF7 cells transiently cotransfected with a PDHX luciferase vector and miR-27b mimic or control. Luciferase expression is quantitated by measuring the degree of luminescence detected by a luminometer 24 h post-transfection for each assay. c and d TaqMan qRT-PCR assessing miR-27b levels in transfected MCF7 and 4175 cells to confirm adequate delivery of RNA oligonucleotides into the cell. e Nucleotide sequences indicating the location of miR-27b binding within the PDHX 3’UTR. The sequence of the original luciferase construct and the eight base pair substitutions present in the mutant construct are shown beneath. Luciferase assays in MCF7 ( f ) and 4175 ( g ) cells, showing miR-27b targeting of the PDHX-3’UTR sequence is lost upon mutation of the seed region. h Expression of PDHX in the Staunton Cell line dataset accessed online using Oncomine. PDHX Fold Change (vs average of all cancers): − 5.602; p -value: 0.023. Under-expression Gene Rank for PDHX: 335 (in top 7%)

    Journal: Molecular Cancer

    Article Title: Suppression of PDHX by microRNA-27b deregulates cell metabolism and promotes growth in breast cancer

    doi: 10.1186/s12943-018-0851-8

    Figure Lengend Snippet: In silico and experimental evidence predict the 3’UTR of PDHX is targeted by MicroRNA-27b. a Diagram illustrating the stepwise approach used to select potential miR-27b targets for experimental validation. b Preliminary luciferase assay of MCF7 cells transiently cotransfected with a PDHX luciferase vector and miR-27b mimic or control. Luciferase expression is quantitated by measuring the degree of luminescence detected by a luminometer 24 h post-transfection for each assay. c and d TaqMan qRT-PCR assessing miR-27b levels in transfected MCF7 and 4175 cells to confirm adequate delivery of RNA oligonucleotides into the cell. e Nucleotide sequences indicating the location of miR-27b binding within the PDHX 3’UTR. The sequence of the original luciferase construct and the eight base pair substitutions present in the mutant construct are shown beneath. Luciferase assays in MCF7 ( f ) and 4175 ( g ) cells, showing miR-27b targeting of the PDHX-3’UTR sequence is lost upon mutation of the seed region. h Expression of PDHX in the Staunton Cell line dataset accessed online using Oncomine. PDHX Fold Change (vs average of all cancers): − 5.602; p -value: 0.023. Under-expression Gene Rank for PDHX: 335 (in top 7%)

    Article Snippet: The 20-μl PCR reactions included 1.33 μl of RT product, 10 μl of TaqMan Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems), and 1 μl of primer and probe mix (Applied Biosystems).

    Techniques: In Silico, Luciferase, Plasmid Preparation, Expressing, Transfection, Quantitative RT-PCR, Binding Assay, Sequencing, Construct, Mutagenesis

    PDHX mRNA and protein expression is suppressed by miR-27b in vitro. a and b Time course RT-PCR of cells transiently transfected with the indicated oligonucleotide. c and d RNA was collected from cells as above for evaluation of PDHX expression by quantitative RT-PCR using SYBR Green to probe for PDHX expression. e Cell lysates from transiently-transfected MCF7 and 4175 cells were collected and probed for PDHX protein and Vinculin loading control. ZR75 cells stably expressing elevated miR-27b or scr control, as well as 4175 cells expressing either the 27b-ZIP construct or scr control were used to replicate the experiments in transiently transfected cells. RNA was also collected from the stable cell and reverse transcribed for quantitation of PDHX expression by standard PCR followed by gel electrophoresis ( f ) as well as qPCR ( g and h ). Confirmation of the miR-27b expression status of the ZR75 ( i ) and 4175 ( j ) stable cell lines (previously generated in our lab) was completed by TaqMan qRT-PCR. The same RNA samples collected for PDHX qPCR were again used to measure the miR-27b level of these cells. k IB of PDHX protein using stable cell lysates as in panel e

    Journal: Molecular Cancer

    Article Title: Suppression of PDHX by microRNA-27b deregulates cell metabolism and promotes growth in breast cancer

    doi: 10.1186/s12943-018-0851-8

    Figure Lengend Snippet: PDHX mRNA and protein expression is suppressed by miR-27b in vitro. a and b Time course RT-PCR of cells transiently transfected with the indicated oligonucleotide. c and d RNA was collected from cells as above for evaluation of PDHX expression by quantitative RT-PCR using SYBR Green to probe for PDHX expression. e Cell lysates from transiently-transfected MCF7 and 4175 cells were collected and probed for PDHX protein and Vinculin loading control. ZR75 cells stably expressing elevated miR-27b or scr control, as well as 4175 cells expressing either the 27b-ZIP construct or scr control were used to replicate the experiments in transiently transfected cells. RNA was also collected from the stable cell and reverse transcribed for quantitation of PDHX expression by standard PCR followed by gel electrophoresis ( f ) as well as qPCR ( g and h ). Confirmation of the miR-27b expression status of the ZR75 ( i ) and 4175 ( j ) stable cell lines (previously generated in our lab) was completed by TaqMan qRT-PCR. The same RNA samples collected for PDHX qPCR were again used to measure the miR-27b level of these cells. k IB of PDHX protein using stable cell lysates as in panel e

    Article Snippet: The 20-μl PCR reactions included 1.33 μl of RT product, 10 μl of TaqMan Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems), and 1 μl of primer and probe mix (Applied Biosystems).

    Techniques: Expressing, In Vitro, Reverse Transcription Polymerase Chain Reaction, Transfection, Quantitative RT-PCR, SYBR Green Assay, Stable Transfection, Construct, Quantitation Assay, Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Real-time Polymerase Chain Reaction, Generated