streptavidin agarose Solulink Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Solulink streptavidin agarose
    Mex3B colocalizes with TLR3 in the endosome and promotes the processing, stability and ligand binding of TLR3. (A) Mex3B colocalizes with TLR3 in the endosomes. The 293 cells (1 × 10 5 ) were cotransfected with Mex3B-HA and TLR3-Flag plus KDEL-GFP (ER marker), EEA1-GFP (early endosome marker) or LAMP-1-GFP (lysosome marker). Twenty hours after transfection, cells were fixed with 4% paraformaldehyde, stained with anti-Flag and anti-HA antibodies, and subjected to confocal microscopy. (B) Mex3B is sorted into the lumen of endosomes. HCT116 (Mex3B-3×Flag) cells (4 × 10 8 ) were collected and washed twice with ice-cold PBS. Endosome/lysosome fractions were isolated and either left untreated, treated with proteinase K (5 ng/ml) or treated with proteinase plus 0.1% Triton X-100 for 15 min at room temperature. The samples were then analyzed with the indicated antibodies. (C) Overexpression of Mex3B increases the abundance of processed C-terminal fragment of TLR3. The 293 cells (2 × 10 5 ) were transfected with the indicated plasmids. Twenty-four hours after transfection, cells were treated with poly(I:C) (20 μg/ml) for the indicated times before immunoblot. The relative amount of total TLR3 was quantitated by the Bio-Rad Quantity One program. (D) Knockdown of Mex3B affects the stability of TLR3. The 293 cells (2 × 10 5 ) were transfected with TLR3 (0.5 μg) and Mex3B-RNAi plasmid (1 μg). Transfected cells were selected with puromycin (1 μg/ml) for 24 h and then treated with poly(I:C) for the indicated times before immunoblot. (E) Mex3B enhances binding of poly(I:C) to TLR3. The 293 cells (2 × 10 6 ) were transfected with the indicated plasmids (5 μg each). Cell lysates were mixed at 1:1 ratio as indicated and incubated with biotinylated-poly(I:C) for 1 h before pull-down assays were performed with <t>streptavidin</t> agarose. Precipitates and cell lysates were analyzed by immunoblot with the indicated antibodies.
    Streptavidin Agarose, supplied by Solulink, used in various techniques. Bioz Stars score: 94/100, based on 52 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin agarose/product/Solulink
    Average 94 stars, based on 52 article reviews
    Price from $9.99 to $1999.99
    streptavidin agarose - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    91
    Solulink streptavidin agarose beads
    Cep170 is an FHDC1-interacting protein. BirA*-tagged FHDC1 was expressed in NIH 3T3 cells by transient transfection. Ciliogenesis was induced as before in low-serum media. BirA*-FHDC1 (red) was detected by virtue of the encoded myc-tag. (A) BirA*-FHDC1 is recruited to the elongated cilia and, following exogenous biotin treatment, induces biotinylation of cytoplasmic microtubules (green) and the cilia (acetylated tubulin, white). Specific punctate structures within the cytoplasmic microtubule network were also labeled (arrows). Biotinylated proteins were detected with <t>Alexa488-streptavidin.</t> (B) BirA*-FHDC1 (red) induces biotinylation of puncta (green) that colocalize with γ-tubulin puncta detected with anti–γ-tubulin (white). (C) BirA*-FHDC1 induces biotinylation of endogenous Cep170. As in B, BirA*-FHDC1 was expressed by transient transfection and its ability to induce biotinylation of the endogenous Cep170 was assessed by IB. myc-FHDC1 and FMNL2-BirA* were included as negative controls. Total biotinylated proteins were isolated from each sample using streptavidin–agarose beads. The eluted proteins were immunoblotted using the indicated antibodies. Endogenous Cep170 is only present in the pool of biotinylated proteins induced by BirA*-FHDC1 (arrow).
    Streptavidin Agarose Beads, supplied by Solulink, used in various techniques. Bioz Stars score: 91/100, based on 44 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin agarose beads/product/Solulink
    Average 91 stars, based on 44 article reviews
    Price from $9.99 to $1999.99
    streptavidin agarose beads - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    90
    Solulink streptavidin agarose resin
    Cep170 is an FHDC1-interacting protein. BirA*-tagged FHDC1 was expressed in NIH 3T3 cells by transient transfection. Ciliogenesis was induced as before in low-serum media. BirA*-FHDC1 (red) was detected by virtue of the encoded myc-tag. (A) BirA*-FHDC1 is recruited to the elongated cilia and, following exogenous biotin treatment, induces biotinylation of cytoplasmic microtubules (green) and the cilia (acetylated tubulin, white). Specific punctate structures within the cytoplasmic microtubule network were also labeled (arrows). Biotinylated proteins were detected with <t>Alexa488-streptavidin.</t> (B) BirA*-FHDC1 (red) induces biotinylation of puncta (green) that colocalize with γ-tubulin puncta detected with anti–γ-tubulin (white). (C) BirA*-FHDC1 induces biotinylation of endogenous Cep170. As in B, BirA*-FHDC1 was expressed by transient transfection and its ability to induce biotinylation of the endogenous Cep170 was assessed by IB. myc-FHDC1 and FMNL2-BirA* were included as negative controls. Total biotinylated proteins were isolated from each sample using streptavidin–agarose beads. The eluted proteins were immunoblotted using the indicated antibodies. Endogenous Cep170 is only present in the pool of biotinylated proteins induced by BirA*-FHDC1 (arrow).
    Streptavidin Agarose Resin, supplied by Solulink, used in various techniques. Bioz Stars score: 90/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin agarose resin/product/Solulink
    Average 90 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    streptavidin agarose resin - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    Image Search Results


    Mex3B colocalizes with TLR3 in the endosome and promotes the processing, stability and ligand binding of TLR3. (A) Mex3B colocalizes with TLR3 in the endosomes. The 293 cells (1 × 10 5 ) were cotransfected with Mex3B-HA and TLR3-Flag plus KDEL-GFP (ER marker), EEA1-GFP (early endosome marker) or LAMP-1-GFP (lysosome marker). Twenty hours after transfection, cells were fixed with 4% paraformaldehyde, stained with anti-Flag and anti-HA antibodies, and subjected to confocal microscopy. (B) Mex3B is sorted into the lumen of endosomes. HCT116 (Mex3B-3×Flag) cells (4 × 10 8 ) were collected and washed twice with ice-cold PBS. Endosome/lysosome fractions were isolated and either left untreated, treated with proteinase K (5 ng/ml) or treated with proteinase plus 0.1% Triton X-100 for 15 min at room temperature. The samples were then analyzed with the indicated antibodies. (C) Overexpression of Mex3B increases the abundance of processed C-terminal fragment of TLR3. The 293 cells (2 × 10 5 ) were transfected with the indicated plasmids. Twenty-four hours after transfection, cells were treated with poly(I:C) (20 μg/ml) for the indicated times before immunoblot. The relative amount of total TLR3 was quantitated by the Bio-Rad Quantity One program. (D) Knockdown of Mex3B affects the stability of TLR3. The 293 cells (2 × 10 5 ) were transfected with TLR3 (0.5 μg) and Mex3B-RNAi plasmid (1 μg). Transfected cells were selected with puromycin (1 μg/ml) for 24 h and then treated with poly(I:C) for the indicated times before immunoblot. (E) Mex3B enhances binding of poly(I:C) to TLR3. The 293 cells (2 × 10 6 ) were transfected with the indicated plasmids (5 μg each). Cell lysates were mixed at 1:1 ratio as indicated and incubated with biotinylated-poly(I:C) for 1 h before pull-down assays were performed with streptavidin agarose. Precipitates and cell lysates were analyzed by immunoblot with the indicated antibodies.

    Journal: Cell Research

    Article Title: The RNA-binding protein Mex3B is a coreceptor of Toll-like receptor 3 in innate antiviral response

    doi: 10.1038/cr.2016.16

    Figure Lengend Snippet: Mex3B colocalizes with TLR3 in the endosome and promotes the processing, stability and ligand binding of TLR3. (A) Mex3B colocalizes with TLR3 in the endosomes. The 293 cells (1 × 10 5 ) were cotransfected with Mex3B-HA and TLR3-Flag plus KDEL-GFP (ER marker), EEA1-GFP (early endosome marker) or LAMP-1-GFP (lysosome marker). Twenty hours after transfection, cells were fixed with 4% paraformaldehyde, stained with anti-Flag and anti-HA antibodies, and subjected to confocal microscopy. (B) Mex3B is sorted into the lumen of endosomes. HCT116 (Mex3B-3×Flag) cells (4 × 10 8 ) were collected and washed twice with ice-cold PBS. Endosome/lysosome fractions were isolated and either left untreated, treated with proteinase K (5 ng/ml) or treated with proteinase plus 0.1% Triton X-100 for 15 min at room temperature. The samples were then analyzed with the indicated antibodies. (C) Overexpression of Mex3B increases the abundance of processed C-terminal fragment of TLR3. The 293 cells (2 × 10 5 ) were transfected with the indicated plasmids. Twenty-four hours after transfection, cells were treated with poly(I:C) (20 μg/ml) for the indicated times before immunoblot. The relative amount of total TLR3 was quantitated by the Bio-Rad Quantity One program. (D) Knockdown of Mex3B affects the stability of TLR3. The 293 cells (2 × 10 5 ) were transfected with TLR3 (0.5 μg) and Mex3B-RNAi plasmid (1 μg). Transfected cells were selected with puromycin (1 μg/ml) for 24 h and then treated with poly(I:C) for the indicated times before immunoblot. (E) Mex3B enhances binding of poly(I:C) to TLR3. The 293 cells (2 × 10 6 ) were transfected with the indicated plasmids (5 μg each). Cell lysates were mixed at 1:1 ratio as indicated and incubated with biotinylated-poly(I:C) for 1 h before pull-down assays were performed with streptavidin agarose. Precipitates and cell lysates were analyzed by immunoblot with the indicated antibodies.

    Article Snippet: Lysates were incubated with biotinylated-poly(I:C) for 1 h at 4 °C and then incubated with streptavidin agarose for another 2 h at 4 °C.

    Techniques: Ligand Binding Assay, Marker, Transfection, Staining, Confocal Microscopy, Isolation, Over Expression, Plasmid Preparation, Binding Assay, Incubation

    Identification of the A1 aptamer region necessary for PCNA binding. ( A ) Pull-down analysis of the binding of A1 aptamer variants shortened at the 5′ or 3′ end to PCNA. Aptamers were bound to streptavidin-agarose resin and incubated with HisTag-PCNA. After washing unbound proteins, bound HisTag-PCNA was denatured, separated by 12% SDS-PAGE and stained with Coomassie brilliant blue. Lane M, protein mass marker; 1, full-length A1; 2, −10/5′ variant; 3, −20/5′ variant; 4, −10/3′ variant; 5, −20/3′ variant; 6, −30/3′ variant (referred to as the α-PCNA aptamer); 7, −40/3′ variant. The presented results are representative. ( B ) Densitometric analysis of HisTag-PCNA bound to A1 aptamer variants presented on panel (A). The results are normalized relative to the signal from the protein sample bound to the full-length aptamer (100%). Results are means of triplicate measurements, and errors represent standard deviation.

    Journal: Nucleic Acids Research

    Article Title: Inhibition of DNA replication by an anti-PCNA aptamer/PCNA complex

    doi: 10.1093/nar/gkx1184

    Figure Lengend Snippet: Identification of the A1 aptamer region necessary for PCNA binding. ( A ) Pull-down analysis of the binding of A1 aptamer variants shortened at the 5′ or 3′ end to PCNA. Aptamers were bound to streptavidin-agarose resin and incubated with HisTag-PCNA. After washing unbound proteins, bound HisTag-PCNA was denatured, separated by 12% SDS-PAGE and stained with Coomassie brilliant blue. Lane M, protein mass marker; 1, full-length A1; 2, −10/5′ variant; 3, −20/5′ variant; 4, −10/3′ variant; 5, −20/3′ variant; 6, −30/3′ variant (referred to as the α-PCNA aptamer); 7, −40/3′ variant. The presented results are representative. ( B ) Densitometric analysis of HisTag-PCNA bound to A1 aptamer variants presented on panel (A). The results are normalized relative to the signal from the protein sample bound to the full-length aptamer (100%). Results are means of triplicate measurements, and errors represent standard deviation.

    Article Snippet: Impact of α-PCNA aptamer on DNA pol δ and ϵ binding to 30/90-mer primer-template DNA A 100 pmol sample of 30/90-mer DNA template generated by annealing 100 pmol of biotinylated 90-mer template (5′-TGAGGTTCAGCAAGGTGATGCTTTAGATTTTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGT TGCAGGCGGTGTTAATACTGACCGCCT-biotin-3′) with 200 pmol of 30-mer primer (5′-CAGTGCCACGCTGAGAGCCAGCAGCAAATG-3′) was conjugated with 50 μl of Streptavidin Agarose Ultra Performance beads (Solulink, USA).

    Techniques: Binding Assay, Incubation, SDS Page, Staining, Marker, Variant Assay, Standard Deviation

    The impact of the α-PCNA aptamer and PCNA on the 30/90-mer primer-template DNA/DNA pol δ or ϵ complex. A 300 fmol sample of DNA pol δ ( A ) and 400 fmol of DNA pol ϵ ( B ) were incubated with 1 pmol of 30/90-mer primer-template DNA immobilized on streptavidin-agarose beads in buffer with or without 1 pmol of PCNA, and with 500 fmol ( A ) or 250 fmol ( B ) of reference1 (Ref1) or α-PCNA aptamer. After incubation, beads were washed, and bound protein was denatured, separated by 10% SDS-PAGE and subjected to western blotting. DNA pol δ and ϵ were detected using anti-p125 and -p261 antibodies, respectively. The presented results are representative.

    Journal: Nucleic Acids Research

    Article Title: Inhibition of DNA replication by an anti-PCNA aptamer/PCNA complex

    doi: 10.1093/nar/gkx1184

    Figure Lengend Snippet: The impact of the α-PCNA aptamer and PCNA on the 30/90-mer primer-template DNA/DNA pol δ or ϵ complex. A 300 fmol sample of DNA pol δ ( A ) and 400 fmol of DNA pol ϵ ( B ) were incubated with 1 pmol of 30/90-mer primer-template DNA immobilized on streptavidin-agarose beads in buffer with or without 1 pmol of PCNA, and with 500 fmol ( A ) or 250 fmol ( B ) of reference1 (Ref1) or α-PCNA aptamer. After incubation, beads were washed, and bound protein was denatured, separated by 10% SDS-PAGE and subjected to western blotting. DNA pol δ and ϵ were detected using anti-p125 and -p261 antibodies, respectively. The presented results are representative.

    Article Snippet: Impact of α-PCNA aptamer on DNA pol δ and ϵ binding to 30/90-mer primer-template DNA A 100 pmol sample of 30/90-mer DNA template generated by annealing 100 pmol of biotinylated 90-mer template (5′-TGAGGTTCAGCAAGGTGATGCTTTAGATTTTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGT TGCAGGCGGTGTTAATACTGACCGCCT-biotin-3′) with 200 pmol of 30-mer primer (5′-CAGTGCCACGCTGAGAGCCAGCAGCAAATG-3′) was conjugated with 50 μl of Streptavidin Agarose Ultra Performance beads (Solulink, USA).

    Techniques: Incubation, SDS Page, Western Blot

    Determination of the α-PCNA aptamer/PCNA complex dissociation constant by pull-down assay. Biotinylated α-PCNA aptamer (concentration range from 0 to 100 μM) bound to streptavidin-agarose resin was incubated with 100 nM HisTag-PCNA. Unbound protein was denatured, separated by 12% SDS-PAGE and stained with Coomassie brilliant blue. Densitometric analysis of data from pull-down assays was performed using a Multispectral Imaging System IMAGER with Launch VisionWorksLS. The dissociation constant ( K D = 5.1 ± 0.59 μM) of the complex was calculated based on the equilibrium concentration of HisTag-PCNA/α-PCNA aptamer as a function of free α-PCNA aptamer (total aptamer) using GraphPad Prism software. Results are the mean of triplicate measurements, and error bars represent standard deviation.

    Journal: Nucleic Acids Research

    Article Title: Inhibition of DNA replication by an anti-PCNA aptamer/PCNA complex

    doi: 10.1093/nar/gkx1184

    Figure Lengend Snippet: Determination of the α-PCNA aptamer/PCNA complex dissociation constant by pull-down assay. Biotinylated α-PCNA aptamer (concentration range from 0 to 100 μM) bound to streptavidin-agarose resin was incubated with 100 nM HisTag-PCNA. Unbound protein was denatured, separated by 12% SDS-PAGE and stained with Coomassie brilliant blue. Densitometric analysis of data from pull-down assays was performed using a Multispectral Imaging System IMAGER with Launch VisionWorksLS. The dissociation constant ( K D = 5.1 ± 0.59 μM) of the complex was calculated based on the equilibrium concentration of HisTag-PCNA/α-PCNA aptamer as a function of free α-PCNA aptamer (total aptamer) using GraphPad Prism software. Results are the mean of triplicate measurements, and error bars represent standard deviation.

    Article Snippet: Impact of α-PCNA aptamer on DNA pol δ and ϵ binding to 30/90-mer primer-template DNA A 100 pmol sample of 30/90-mer DNA template generated by annealing 100 pmol of biotinylated 90-mer template (5′-TGAGGTTCAGCAAGGTGATGCTTTAGATTTTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGT TGCAGGCGGTGTTAATACTGACCGCCT-biotin-3′) with 200 pmol of 30-mer primer (5′-CAGTGCCACGCTGAGAGCCAGCAGCAAATG-3′) was conjugated with 50 μl of Streptavidin Agarose Ultra Performance beads (Solulink, USA).

    Techniques: Pull Down Assay, Concentration Assay, Incubation, SDS Page, Staining, Imaging, Software, Standard Deviation

    RELCH controls the OSBP-dependent cholesterol transfer from the RE-like membrane to the Golgi-like membrane via tethering activity. (A) Bead-based liposome tethering assay between Golgi- and RE-like liposomes containing rhodamine-PE (Rho-PE; red) and OG-PE (green), respectively. The protein-bound beads (the binding of myr-Arf1, Rab11a, OSBP, and RELCH is demonstrated in Fig. S5 [A–D]) were mixed and imaged under a fluorescence microscope (top left). In the top right panel, the tethering assay using the streptavidin-His protein and biotin-PC–containing liposomes is shown. The asterisks indicate the contacts between two beads. The liposome tethering efficiency was calculated as the ratio of the number of contacts to the total number of beads. The data were collected from randomly selected fields per group. Representative examples of the counts and calculations are shown in Fig. S5 G. The results are presented in the dot-plot graphs (bottom). The green lines indicate the mean of each group. ANOVA, Wilcoxon, and Kruskal–Wallis tests were performed (****, P

    Journal: The Journal of Cell Biology

    Article Title: The Rab11-binding protein RELCH/KIAA1468 controls intracellular cholesterol distribution

    doi: 10.1083/jcb.201709123

    Figure Lengend Snippet: RELCH controls the OSBP-dependent cholesterol transfer from the RE-like membrane to the Golgi-like membrane via tethering activity. (A) Bead-based liposome tethering assay between Golgi- and RE-like liposomes containing rhodamine-PE (Rho-PE; red) and OG-PE (green), respectively. The protein-bound beads (the binding of myr-Arf1, Rab11a, OSBP, and RELCH is demonstrated in Fig. S5 [A–D]) were mixed and imaged under a fluorescence microscope (top left). In the top right panel, the tethering assay using the streptavidin-His protein and biotin-PC–containing liposomes is shown. The asterisks indicate the contacts between two beads. The liposome tethering efficiency was calculated as the ratio of the number of contacts to the total number of beads. The data were collected from randomly selected fields per group. Representative examples of the counts and calculations are shown in Fig. S5 G. The results are presented in the dot-plot graphs (bottom). The green lines indicate the mean of each group. ANOVA, Wilcoxon, and Kruskal–Wallis tests were performed (****, P

    Article Snippet: After washing again, the cells were lysed, and the cleared lysate was incubated with 20 µl streptavidin beads (N-1000; SoluLink) for 1 h at 4°C.

    Techniques: Activity Assay, Binding Assay, Fluorescence, Microscopy

    Cep170 is an FHDC1-interacting protein. BirA*-tagged FHDC1 was expressed in NIH 3T3 cells by transient transfection. Ciliogenesis was induced as before in low-serum media. BirA*-FHDC1 (red) was detected by virtue of the encoded myc-tag. (A) BirA*-FHDC1 is recruited to the elongated cilia and, following exogenous biotin treatment, induces biotinylation of cytoplasmic microtubules (green) and the cilia (acetylated tubulin, white). Specific punctate structures within the cytoplasmic microtubule network were also labeled (arrows). Biotinylated proteins were detected with Alexa488-streptavidin. (B) BirA*-FHDC1 (red) induces biotinylation of puncta (green) that colocalize with γ-tubulin puncta detected with anti–γ-tubulin (white). (C) BirA*-FHDC1 induces biotinylation of endogenous Cep170. As in B, BirA*-FHDC1 was expressed by transient transfection and its ability to induce biotinylation of the endogenous Cep170 was assessed by IB. myc-FHDC1 and FMNL2-BirA* were included as negative controls. Total biotinylated proteins were isolated from each sample using streptavidin–agarose beads. The eluted proteins were immunoblotted using the indicated antibodies. Endogenous Cep170 is only present in the pool of biotinylated proteins induced by BirA*-FHDC1 (arrow).

    Journal: Molecular Biology of the Cell

    Article Title: Actin-dependent regulation of cilia length by the inverted formin FHDC1

    doi: 10.1091/mbc.E18-02-0088

    Figure Lengend Snippet: Cep170 is an FHDC1-interacting protein. BirA*-tagged FHDC1 was expressed in NIH 3T3 cells by transient transfection. Ciliogenesis was induced as before in low-serum media. BirA*-FHDC1 (red) was detected by virtue of the encoded myc-tag. (A) BirA*-FHDC1 is recruited to the elongated cilia and, following exogenous biotin treatment, induces biotinylation of cytoplasmic microtubules (green) and the cilia (acetylated tubulin, white). Specific punctate structures within the cytoplasmic microtubule network were also labeled (arrows). Biotinylated proteins were detected with Alexa488-streptavidin. (B) BirA*-FHDC1 (red) induces biotinylation of puncta (green) that colocalize with γ-tubulin puncta detected with anti–γ-tubulin (white). (C) BirA*-FHDC1 induces biotinylation of endogenous Cep170. As in B, BirA*-FHDC1 was expressed by transient transfection and its ability to induce biotinylation of the endogenous Cep170 was assessed by IB. myc-FHDC1 and FMNL2-BirA* were included as negative controls. Total biotinylated proteins were isolated from each sample using streptavidin–agarose beads. The eluted proteins were immunoblotted using the indicated antibodies. Endogenous Cep170 is only present in the pool of biotinylated proteins induced by BirA*-FHDC1 (arrow).

    Article Snippet: Protein concentration was determined by BCA assay and equal amounts of each lysate were incubated separately with streptavidin agarose beads (Solulink) for 3 h at 4°C.

    Techniques: Transfection, Labeling, Isolation