strand cdna Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs protoscript first strand cdna synthesis kit
    qPCR analyses of candidate circRNA expression. Cells were treated with DMSO (control) and cisplatin as explained in Materials and Methods. RNAse R-treated RNA samples were used to prepare cDNAs using <t>ProtoScript</t> ® first strand <t>cDNA</t> synthesis kit (NEB, United States) with random primers. GoTaq q-PCR Master Mix (Promega, United States) was used for qPCR analyses. Data collected in three biological replicates were normalized against DMSO control and GAPDH. ∗∗ and ∗∗∗ denote p ≤ 0.01 and p ≤ 0.001, respectively. (A) HeLa cells; (B) MCF and Jurkat cells.
    Protoscript First Strand Cdna Synthesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1533 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/protoscript first strand cdna synthesis kit/product/New England Biolabs
    Average 99 stars, based on 1533 article reviews
    Price from $9.99 to $1999.99
    protoscript first strand cdna synthesis kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher revertaid first strand cdna synthesis kit
    IL-37 + T-cells play a protective role in DSS-induced chronic colitis in mice. ( A ) Relative weight curves of WT mice, DSS-induced WT mice, DSS-induced WT mice treated with PBS, and DSS-induced WT mice injected with IL-37 + T-cells in chronic colitis. The statistical significance between the relative weights of DSS-induced mice injected with IL-37 + T-cells versus DSS-induced mice treated with PBS at the end of the experiment is shown. ( B ) The disease activity index (DAI) was determined at day 63 of the study period, based on body weight loss (0, none; 1, 1–5%; 2, 5–10%; 3, 10–20%; 4, > 20%), stool consistency (0, normal; 2, loose stool; 4, diarrhea), and stool blood (0, negative; 2, fecal occult blood test positive; 4, gross bleeding). ( C ) Representative pictures of the colon from indicated treatment cohorts. ( D ) Macroscopic damage score of the colon in the four groups. ( E ) Representative haematoxylin and eosin (H E) staining of colon sections of mice. ( F ) Histological inflammation score. This score comprises the sum of architecture of the bowel, infiltration of neutrophils and mononuclear cells, gobleT-cell depletion, and epithelial cell erosion. Three sections per animal were evaluated. ( G ) Expressions of IFN-γ, IL-1β, TNF-α, and IL-10 mRNAs within colonic tissues in the four groups. Total RNA with the RNAiso Plusi Kit. cDNAs were synthesized by using the <t>RevertAid</t> First Strand <t>cDNA</t> Synthesis Kit according to the manufacturer’s instructions. qPCR amplification reactions were prepared with the SYBR Green PCR Kit and performed using the CFX96 Real-Time System. Data are means ± SEM ( n = 6). * p
    Revertaid First Strand Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 40345 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/revertaid first strand cdna synthesis kit/product/Thermo Fisher
    Average 99 stars, based on 40345 article reviews
    Price from $9.99 to $1999.99
    revertaid first strand cdna synthesis kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher first strand cdna
    Reduced expression of SENP1/SuPr-2 transcriptional isoforms in mutants. (A) RT-PCR analysis of <t>e12.5</t> wild-type (wt) or mutant (m) littermates. The size of the RT-PCR products in base pairs is at the left. The schematics to the right of each panel indicate the corresponding <t>cDNA</t> structure and location of primers used for the reactions. The upper five panels show PCR of SENP1/SuPr-2, and the lower panel shows HPRT results as the control. (B) Real-time RT-PCR analysis of SENP1/SuPr-2. Relative expression levels were normalized to HPRT.
    First Strand Cdna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 88991 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/first strand cdna/product/Thermo Fisher
    Average 99 stars, based on 88991 article reviews
    Price from $9.99 to $1999.99
    first strand cdna - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    94
    Thermo Fisher revertaid h minus first strand cdna synthesis kit
    Reduced expression of SENP1/SuPr-2 transcriptional isoforms in mutants. (A) RT-PCR analysis of <t>e12.5</t> wild-type (wt) or mutant (m) littermates. The size of the RT-PCR products in base pairs is at the left. The schematics to the right of each panel indicate the corresponding <t>cDNA</t> structure and location of primers used for the reactions. The upper five panels show PCR of SENP1/SuPr-2, and the lower panel shows HPRT results as the control. (B) Real-time RT-PCR analysis of SENP1/SuPr-2. Relative expression levels were normalized to HPRT.
    Revertaid H Minus First Strand Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 9555 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/revertaid h minus first strand cdna synthesis kit/product/Thermo Fisher
    Average 94 stars, based on 9555 article reviews
    Price from $9.99 to $1999.99
    revertaid h minus first strand cdna synthesis kit - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    99
    TaKaRa primescript 1st strand cdna synthesis kit
    Reduced expression of SENP1/SuPr-2 transcriptional isoforms in mutants. (A) RT-PCR analysis of <t>e12.5</t> wild-type (wt) or mutant (m) littermates. The size of the RT-PCR products in base pairs is at the left. The schematics to the right of each panel indicate the corresponding <t>cDNA</t> structure and location of primers used for the reactions. The upper five panels show PCR of SENP1/SuPr-2, and the lower panel shows HPRT results as the control. (B) Real-time RT-PCR analysis of SENP1/SuPr-2. Relative expression levels were normalized to HPRT.
    Primescript 1st Strand Cdna Synthesis Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 7752 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primescript 1st strand cdna synthesis kit/product/TaKaRa
    Average 99 stars, based on 7752 article reviews
    Price from $9.99 to $1999.99
    primescript 1st strand cdna synthesis kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    GE Healthcare first strand cdna synthesis kit
    Northern blot analysis of rasGEFM expression in parental and mutant strains . ( A ) Total <t>RNA</t> was extracted from AX2 cells developed in suspension for 0 to 9 hours or on filters. In the latter case the cells were harvested at mound (12 hours), first finger (16 hours) and preculminant (20 hours) stages. The membrane was hybridized to a radiolabelled rasGEFM specific probe (probe a ) corresponding to bp 760–1518 of the <t>cDNA</t> clone and to the actin gene used as a loading control. ( B ) Total RNA was extracted from different developmental Dictyostelium mutants starved in shaking suspension up to 6 hours. LW6 (G protein β subunit minus), HSB1 (PIA ts -mutant, defective in the G-protein adenylyl cyclase activation) and HSB50 (mutant blocked at mound stage).
    First Strand Cdna Synthesis Kit, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 99/100, based on 5249 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/first strand cdna synthesis kit/product/GE Healthcare
    Average 99 stars, based on 5249 article reviews
    Price from $9.99 to $1999.99
    first strand cdna synthesis kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript double stranded cdna synthesis kit
    Overview of Cufflinks. The algorithm takes as input <t>cDNA</t> fragment sequences that have been ( a ) aligned to the genome by software capable of producing spliced alignments, such as TopHat. With paired-end RNA-Seq, Cufflinks treats each pair of fragment reads as a single alignment. The algorithm assembles overlapping ‘bundles’ of fragment alignments ( b-c ) separately, which reduces running time and memory use because each bundle typically contains the fragments from no more than a few genes. Cufflinks then estimates the abundances of the assembled transcripts ( d-e ). ( b ) The first step in fragment assembly is to identify pairs of ‘incompatible’ fragments that must have originated from distinct spliced <t>mRNA</t> isoforms. Fragments are connected in an ‘overlap graph’ when they are compatible and their alignments overlap in the genome. Each fragment has one node in the graph, and an edge, directed from left to right along the genome, is placed between each pair of compatible fragments. In this example, the yellow, blue, and red fragments must have originated from separate isoforms, but any other fragment could have come from the same transcript as one of these three. ( c ) Assembling isoforms from the overlap graph. Paths through the graph correspond to sets of mutually compatible fragments that could be merged into complete isoforms. The overlap graph here can be minimally ‘covered’ by three paths, each representing a different isoform. Dilworth's Theorem states that the number of mutually incompatible reads is the same as the minimum number of transcripts needed to “explain” all the fragments. Cufflinks implements a proof of Dilworth's Theorem that produces a minimal set of paths that cover all the fragments in the overlap graph by finding the largest set of reads with the property that no two could have originated from the same isoform. ( d ) Estimating transcript abundance. Fragments are matched (denoted here using color) to the transcripts from which they could have originated. The violet fragment could have originated from the blue or red isoform. Gray fragments could have come from any of the three shown. Cufflinks estimates transcript abundances using a statistical model in which the probability of observing each fragment is a linear function of the abundances of the transcripts from which it could have originated. Because only the ends of each fragment are sequenced, the length of each may be unknown. Assigning a fragment to different isoforms often implies a different length for it. Cufflinks can incorporate the distribution of fragment lengths to help assign fragments to isoforms. For example, the violet fragment would be much longer, and very improbable according to Cufflinks' model, if it were to come from the red isoform instead of the blue isoform. ( e ) The program then numerically maximizes a function that assigns a likelihood to all possible sets of relative abundances of the yellow, red and blue isoforms (γ 1 ,γ 2 ,γ 3 ), producing the abundances that best explain the observed fragments, shown as a pie chart.
    Superscript Double Stranded Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 6021 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript double stranded cdna synthesis kit/product/Thermo Fisher
    Average 99 stars, based on 6021 article reviews
    Price from $9.99 to $1999.99
    superscript double stranded cdna synthesis kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    94
    Bio-Rad first strand cdna
    Heterologous expression of MdATG8i in Arabidopsis and growth phenotype. (A) PCR with gDNA; (B) PCR with <t>cDNA;</t> Lanes M, molecular marker DL2000; V, positive vector containing pGWB406- MdATG8i plasmid; WT, non-transformed wild-type; OE-6 and -7, MdATG8i -transgenic lines; (C) <t>qRT-PCR</t> analysis of MdATG8i transcripts in Arabidopsis lines OE-6 and OE-7; (D) Growth phenotype comparison of WT and transgenic lines under LD photoperiod; (E) Growth for rosettes from WT or transgenic lines under SD photoperiod; Data are means ± SD of 20 replicates. *, ** or *** indicates the statistically significant differences determined by Student's t -tests at P
    First Strand Cdna, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 6999 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/first strand cdna/product/Bio-Rad
    Average 94 stars, based on 6999 article reviews
    Price from $9.99 to $1999.99
    first strand cdna - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    99
    TaKaRa primescript first strand cdna synthesis kit
    Basic characteristics of pJAB1. ( a ) The <t>PCR</t> result of the pJAB1 gene. M, 5000 bp DNA marker; 1, the pJAB1 gene; 2, blank control. ( b ) The exon–intron structure. Eight exons were found in the <t>cDNA</t> sequence. ( c ) The secondary structure showing chromo, MPN and DEAD domains in the pJAB1 protein. ( d ) Comparison of the nucleotide sequences of pJAB1 and hJAB1. Short bars represent the identical nucleotides among the two sequences. Different regions were indicated by lowercase letters
    Primescript First Strand Cdna Synthesis Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 2734 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primescript first strand cdna synthesis kit/product/TaKaRa
    Average 99 stars, based on 2734 article reviews
    Price from $9.99 to $1999.99
    primescript first strand cdna synthesis kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    94
    Toyobo first strand cdna
    MECP2 inhibited miR-338 expression in gastric cancer cells ( A ) The BGC-823 and SGC-7901 cells were treated with 5-Azacytidine (5-Aza) (5 μmol), the equal volume of DMSO as control, expression of miR-338-3p and pre-miR-338 was measured by qRT-PCR. The expression of miR-338-3p and pre-miR-338 was normalized to U6 RNA. ( B ) qRT-PCR and western blot analysis of MECP2 protein and <t>mRNA</t> levels expression in BGC-823 and SGC-7901 cells were transfected with GV146 vector containing <t>cDNA</t> of MECP2 or control vector. ( C ) The miR-338-3p and pre-miR-338 expression was quantified by qRT-PCR in BGC-823 and SGC-7901 cells transfected with GV146 vector containing cDNA of MECP2 or control vector. ( D ) qRT-PCR analysis of the miR-338-3p and pre-miR-338 expression in BGC-823 and SGC-7901 cells following transfection with two MECP2 siRNAs or control siRNA. ( E ) Sketch of the putative CpG island locus and the MECP2 binding site in human miR-338 promoter. ( F ) ChIP assays were performed with control (rat IgG), anti-MECP2 antibody to determine MECP2 occupancy of miR-338 promoter. ( G ) qRT-PCR analysis was performed with primers spanning predicted CpG island of miR-338. ( H ) Western blot analyses of P-REX2 and phosphorylated AKT(Ser-473) in BGC-823 cells transfected with MECP2 siRNA1 or control siRNA. ( I ) MTT assay was performed to determine the growth of BGC-823 and SGC-7901 cells after cotransfected with MECP2 siRNA1 and inhibitor control or siRNA control and miR-338-3p inhibitor. ( J ) Early Cell apoptosis were detected by Annexin-V/propidium iodide combined labeling flow cytometry in BGC-823 and SGC-7901 cells 48 hours after transfection. Each data represented mean ± SD. * P
    First Strand Cdna, supplied by Toyobo, used in various techniques. Bioz Stars score: 94/100, based on 4326 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/first strand cdna/product/Toyobo
    Average 94 stars, based on 4326 article reviews
    Price from $9.99 to $1999.99
    first strand cdna - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    93
    Thermo Fisher revertaidtm first strand cdna synthesis kit
    MECP2 inhibited miR-338 expression in gastric cancer cells ( A ) The BGC-823 and SGC-7901 cells were treated with 5-Azacytidine (5-Aza) (5 μmol), the equal volume of DMSO as control, expression of miR-338-3p and pre-miR-338 was measured by qRT-PCR. The expression of miR-338-3p and pre-miR-338 was normalized to U6 RNA. ( B ) qRT-PCR and western blot analysis of MECP2 protein and <t>mRNA</t> levels expression in BGC-823 and SGC-7901 cells were transfected with GV146 vector containing <t>cDNA</t> of MECP2 or control vector. ( C ) The miR-338-3p and pre-miR-338 expression was quantified by qRT-PCR in BGC-823 and SGC-7901 cells transfected with GV146 vector containing cDNA of MECP2 or control vector. ( D ) qRT-PCR analysis of the miR-338-3p and pre-miR-338 expression in BGC-823 and SGC-7901 cells following transfection with two MECP2 siRNAs or control siRNA. ( E ) Sketch of the putative CpG island locus and the MECP2 binding site in human miR-338 promoter. ( F ) ChIP assays were performed with control (rat IgG), anti-MECP2 antibody to determine MECP2 occupancy of miR-338 promoter. ( G ) qRT-PCR analysis was performed with primers spanning predicted CpG island of miR-338. ( H ) Western blot analyses of P-REX2 and phosphorylated AKT(Ser-473) in BGC-823 cells transfected with MECP2 siRNA1 or control siRNA. ( I ) MTT assay was performed to determine the growth of BGC-823 and SGC-7901 cells after cotransfected with MECP2 siRNA1 and inhibitor control or siRNA control and miR-338-3p inhibitor. ( J ) Early Cell apoptosis were detected by Annexin-V/propidium iodide combined labeling flow cytometry in BGC-823 and SGC-7901 cells 48 hours after transfection. Each data represented mean ± SD. * P
    Revertaidtm First Strand Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 2571 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/revertaidtm first strand cdna synthesis kit/product/Thermo Fisher
    Average 93 stars, based on 2571 article reviews
    Price from $9.99 to $1999.99
    revertaidtm first strand cdna synthesis kit - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    99
    New England Biolabs protoscript ii first strand cdna synthesis kit
    MECP2 inhibited miR-338 expression in gastric cancer cells ( A ) The BGC-823 and SGC-7901 cells were treated with 5-Azacytidine (5-Aza) (5 μmol), the equal volume of DMSO as control, expression of miR-338-3p and pre-miR-338 was measured by qRT-PCR. The expression of miR-338-3p and pre-miR-338 was normalized to U6 RNA. ( B ) qRT-PCR and western blot analysis of MECP2 protein and <t>mRNA</t> levels expression in BGC-823 and SGC-7901 cells were transfected with GV146 vector containing <t>cDNA</t> of MECP2 or control vector. ( C ) The miR-338-3p and pre-miR-338 expression was quantified by qRT-PCR in BGC-823 and SGC-7901 cells transfected with GV146 vector containing cDNA of MECP2 or control vector. ( D ) qRT-PCR analysis of the miR-338-3p and pre-miR-338 expression in BGC-823 and SGC-7901 cells following transfection with two MECP2 siRNAs or control siRNA. ( E ) Sketch of the putative CpG island locus and the MECP2 binding site in human miR-338 promoter. ( F ) ChIP assays were performed with control (rat IgG), anti-MECP2 antibody to determine MECP2 occupancy of miR-338 promoter. ( G ) qRT-PCR analysis was performed with primers spanning predicted CpG island of miR-338. ( H ) Western blot analyses of P-REX2 and phosphorylated AKT(Ser-473) in BGC-823 cells transfected with MECP2 siRNA1 or control siRNA. ( I ) MTT assay was performed to determine the growth of BGC-823 and SGC-7901 cells after cotransfected with MECP2 siRNA1 and inhibitor control or siRNA control and miR-338-3p inhibitor. ( J ) Early Cell apoptosis were detected by Annexin-V/propidium iodide combined labeling flow cytometry in BGC-823 and SGC-7901 cells 48 hours after transfection. Each data represented mean ± SD. * P
    Protoscript Ii First Strand Cdna Synthesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1292 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/protoscript ii first strand cdna synthesis kit/product/New England Biolabs
    Average 99 stars, based on 1292 article reviews
    Price from $9.99 to $1999.99
    protoscript ii first strand cdna synthesis kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    92
    Thermo Fisher maxima h minus first strand cdna synthesis kit
    MECP2 inhibited miR-338 expression in gastric cancer cells ( A ) The BGC-823 and SGC-7901 cells were treated with 5-Azacytidine (5-Aza) (5 μmol), the equal volume of DMSO as control, expression of miR-338-3p and pre-miR-338 was measured by qRT-PCR. The expression of miR-338-3p and pre-miR-338 was normalized to U6 RNA. ( B ) qRT-PCR and western blot analysis of MECP2 protein and <t>mRNA</t> levels expression in BGC-823 and SGC-7901 cells were transfected with GV146 vector containing <t>cDNA</t> of MECP2 or control vector. ( C ) The miR-338-3p and pre-miR-338 expression was quantified by qRT-PCR in BGC-823 and SGC-7901 cells transfected with GV146 vector containing cDNA of MECP2 or control vector. ( D ) qRT-PCR analysis of the miR-338-3p and pre-miR-338 expression in BGC-823 and SGC-7901 cells following transfection with two MECP2 siRNAs or control siRNA. ( E ) Sketch of the putative CpG island locus and the MECP2 binding site in human miR-338 promoter. ( F ) ChIP assays were performed with control (rat IgG), anti-MECP2 antibody to determine MECP2 occupancy of miR-338 promoter. ( G ) qRT-PCR analysis was performed with primers spanning predicted CpG island of miR-338. ( H ) Western blot analyses of P-REX2 and phosphorylated AKT(Ser-473) in BGC-823 cells transfected with MECP2 siRNA1 or control siRNA. ( I ) MTT assay was performed to determine the growth of BGC-823 and SGC-7901 cells after cotransfected with MECP2 siRNA1 and inhibitor control or siRNA control and miR-338-3p inhibitor. ( J ) Early Cell apoptosis were detected by Annexin-V/propidium iodide combined labeling flow cytometry in BGC-823 and SGC-7901 cells 48 hours after transfection. Each data represented mean ± SD. * P
    Maxima H Minus First Strand Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1494 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/maxima h minus first strand cdna synthesis kit/product/Thermo Fisher
    Average 92 stars, based on 1494 article reviews
    Price from $9.99 to $1999.99
    maxima h minus first strand cdna synthesis kit - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    Illumina Inc double stranded cdna
    Methods for total RNA-Seq Shown are the salient details for five protocols for total RNA-Seq. DSN-lite (Duplex-specific nuclease, low C 0 t normalization), RNase H, and <t>Ribo-Zero</t> were tested for low quality samples; SMART was tested for low quantity samples. NuGEN, which generates double-stranded <t>cDNA</t> amplified using Ribo-SPIA (Single Primer Isothermal Amplification), was tested for both types of samples: (NuGEN 100f for low quality; NuGEN 1i for low quantity, and NuGEN 1f for low quantity and low quality). In each case, RNA and matching cDNA are in black, adaptors and primers in color, and rRNA is in grey.
    Double Stranded Cdna, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 2655 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/double stranded cdna/product/Illumina Inc
    Average 92 stars, based on 2655 article reviews
    Price from $9.99 to $1999.99
    double stranded cdna - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    94
    Toyobo first strand cdna synthesis kit
    Reverse transcriptase-PCR analysis demonstrates a polycistronic transcript of mtsABC mRNA . Total <t>RNA</t> from S. iniae HD-1 was reverse transcribed into <t>cDNA,</t> and PCR was performed with ORF-specific primers. Each box contains products with the same primer pairs. For PCR, S. iniae HD-1 genomic DNA was used as the template (on the left), and for reverse transcriptase-PCR, S. iniae HD-1 RNA was used as the template (on the right).
    First Strand Cdna Synthesis Kit, supplied by Toyobo, used in various techniques. Bioz Stars score: 94/100, based on 1692 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/first strand cdna synthesis kit/product/Toyobo
    Average 94 stars, based on 1692 article reviews
    Price from $9.99 to $1999.99
    first strand cdna synthesis kit - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    qPCR analyses of candidate circRNA expression. Cells were treated with DMSO (control) and cisplatin as explained in Materials and Methods. RNAse R-treated RNA samples were used to prepare cDNAs using ProtoScript ® first strand cDNA synthesis kit (NEB, United States) with random primers. GoTaq q-PCR Master Mix (Promega, United States) was used for qPCR analyses. Data collected in three biological replicates were normalized against DMSO control and GAPDH. ∗∗ and ∗∗∗ denote p ≤ 0.01 and p ≤ 0.001, respectively. (A) HeLa cells; (B) MCF and Jurkat cells.

    Journal: Frontiers in Genetics

    Article Title: Transcriptomics Analysis of Circular RNAs Differentially Expressed in Apoptotic HeLa Cells

    doi: 10.3389/fgene.2019.00176

    Figure Lengend Snippet: qPCR analyses of candidate circRNA expression. Cells were treated with DMSO (control) and cisplatin as explained in Materials and Methods. RNAse R-treated RNA samples were used to prepare cDNAs using ProtoScript ® first strand cDNA synthesis kit (NEB, United States) with random primers. GoTaq q-PCR Master Mix (Promega, United States) was used for qPCR analyses. Data collected in three biological replicates were normalized against DMSO control and GAPDH. ∗∗ and ∗∗∗ denote p ≤ 0.01 and p ≤ 0.001, respectively. (A) HeLa cells; (B) MCF and Jurkat cells.

    Article Snippet: Subsequently, RNA clean-up was performed with Nucleospin RNA kit (Macherey Nagel, Germany) according to the manufacturer’s instructions. cDNAs were prepared from RNAse R+ and RNAseR- RNA samples with ProtoScript® first strand cDNA synthesis kit (NEB, United States) with random primers in a total volume of 50 ul according to the manufacturer’s instructions.

    Techniques: Real-time Polymerase Chain Reaction, Expressing, Polymerase Chain Reaction

    IL-37 + T-cells play a protective role in DSS-induced chronic colitis in mice. ( A ) Relative weight curves of WT mice, DSS-induced WT mice, DSS-induced WT mice treated with PBS, and DSS-induced WT mice injected with IL-37 + T-cells in chronic colitis. The statistical significance between the relative weights of DSS-induced mice injected with IL-37 + T-cells versus DSS-induced mice treated with PBS at the end of the experiment is shown. ( B ) The disease activity index (DAI) was determined at day 63 of the study period, based on body weight loss (0, none; 1, 1–5%; 2, 5–10%; 3, 10–20%; 4, > 20%), stool consistency (0, normal; 2, loose stool; 4, diarrhea), and stool blood (0, negative; 2, fecal occult blood test positive; 4, gross bleeding). ( C ) Representative pictures of the colon from indicated treatment cohorts. ( D ) Macroscopic damage score of the colon in the four groups. ( E ) Representative haematoxylin and eosin (H E) staining of colon sections of mice. ( F ) Histological inflammation score. This score comprises the sum of architecture of the bowel, infiltration of neutrophils and mononuclear cells, gobleT-cell depletion, and epithelial cell erosion. Three sections per animal were evaluated. ( G ) Expressions of IFN-γ, IL-1β, TNF-α, and IL-10 mRNAs within colonic tissues in the four groups. Total RNA with the RNAiso Plusi Kit. cDNAs were synthesized by using the RevertAid First Strand cDNA Synthesis Kit according to the manufacturer’s instructions. qPCR amplification reactions were prepared with the SYBR Green PCR Kit and performed using the CFX96 Real-Time System. Data are means ± SEM ( n = 6). * p

    Journal: International Journal of Molecular Sciences

    Article Title: Anti-Inflammatory Effect of IL-37-Producing T-Cell Population in DSS-Induced Chronic Inflammatory Bowel Disease in Mice

    doi: 10.3390/ijms19123884

    Figure Lengend Snippet: IL-37 + T-cells play a protective role in DSS-induced chronic colitis in mice. ( A ) Relative weight curves of WT mice, DSS-induced WT mice, DSS-induced WT mice treated with PBS, and DSS-induced WT mice injected with IL-37 + T-cells in chronic colitis. The statistical significance between the relative weights of DSS-induced mice injected with IL-37 + T-cells versus DSS-induced mice treated with PBS at the end of the experiment is shown. ( B ) The disease activity index (DAI) was determined at day 63 of the study period, based on body weight loss (0, none; 1, 1–5%; 2, 5–10%; 3, 10–20%; 4, > 20%), stool consistency (0, normal; 2, loose stool; 4, diarrhea), and stool blood (0, negative; 2, fecal occult blood test positive; 4, gross bleeding). ( C ) Representative pictures of the colon from indicated treatment cohorts. ( D ) Macroscopic damage score of the colon in the four groups. ( E ) Representative haematoxylin and eosin (H E) staining of colon sections of mice. ( F ) Histological inflammation score. This score comprises the sum of architecture of the bowel, infiltration of neutrophils and mononuclear cells, gobleT-cell depletion, and epithelial cell erosion. Three sections per animal were evaluated. ( G ) Expressions of IFN-γ, IL-1β, TNF-α, and IL-10 mRNAs within colonic tissues in the four groups. Total RNA with the RNAiso Plusi Kit. cDNAs were synthesized by using the RevertAid First Strand cDNA Synthesis Kit according to the manufacturer’s instructions. qPCR amplification reactions were prepared with the SYBR Green PCR Kit and performed using the CFX96 Real-Time System. Data are means ± SEM ( n = 6). * p

    Article Snippet: The Nanodrop spectrophotometer (Thermo Scientific, Waltham, MA, USA) was used to measure absorbance. cDNAs were synthesized by using the RevertAid First Strand cDNA Synthesis Kit (ThermoFisher, Waltham, MA, USA) according to manufacturer’s instructions.

    Techniques: Mouse Assay, Injection, Activity Assay, Staining, Synthesized, Real-time Polymerase Chain Reaction, Amplification, SYBR Green Assay, Polymerase Chain Reaction

    Long non-coding RNA LINC01021 was downregulated by Da0324 treatment in gastric cancer cells. A. Volcano plots of lncRNAs differentially expressed between the control and Da0324 treatment groups. SGC7901 cells were treated with DMSO (control) or 4 μM Da0324 for 48 h and high-throughput sequencing assay was performed. The X-axis represents log 2 of fold changes. The Y-axis represents -log 10 of P values. Red spots denote upregulated lncRNAs, blue spots denote downregulated lncRNAs. B. Heatmap of the top 40 lncRNAs most significantly differentially expressed in SGC7901 cells with Da0324 treatment. C. Ten differentially expressed lncRNAs regulated by Da0324 were validated by qRT-PCR. SGC7901 cells were treated with DMSO (control) or 4 μM Da0324 for 48 h. RNAs were isolated and converted to cDNA. Quantitative real-time PCR was performed to determine the expression level of lncRNAs. GAPDH was used as a housekeeping gene. All bars represent relative expression levels and data represent mean ± SD. ***, P

    Journal: American Journal of Translational Research

    Article Title: Downregulation of LINC01021 by curcumin analog Da0324 inhibits gastric cancer progression through activation of P53

    doi:

    Figure Lengend Snippet: Long non-coding RNA LINC01021 was downregulated by Da0324 treatment in gastric cancer cells. A. Volcano plots of lncRNAs differentially expressed between the control and Da0324 treatment groups. SGC7901 cells were treated with DMSO (control) or 4 μM Da0324 for 48 h and high-throughput sequencing assay was performed. The X-axis represents log 2 of fold changes. The Y-axis represents -log 10 of P values. Red spots denote upregulated lncRNAs, blue spots denote downregulated lncRNAs. B. Heatmap of the top 40 lncRNAs most significantly differentially expressed in SGC7901 cells with Da0324 treatment. C. Ten differentially expressed lncRNAs regulated by Da0324 were validated by qRT-PCR. SGC7901 cells were treated with DMSO (control) or 4 μM Da0324 for 48 h. RNAs were isolated and converted to cDNA. Quantitative real-time PCR was performed to determine the expression level of lncRNAs. GAPDH was used as a housekeeping gene. All bars represent relative expression levels and data represent mean ± SD. ***, P

    Article Snippet: Total RNA was reverse transcribed to cDNA using the Revert Aid First-Strand cDNA Synthesis Kit (Thermo Fisher Scientific).

    Techniques: Next-Generation Sequencing, Quantitative RT-PCR, Isolation, Real-time Polymerase Chain Reaction, Expressing

    Reduced expression of SENP1/SuPr-2 transcriptional isoforms in mutants. (A) RT-PCR analysis of e12.5 wild-type (wt) or mutant (m) littermates. The size of the RT-PCR products in base pairs is at the left. The schematics to the right of each panel indicate the corresponding cDNA structure and location of primers used for the reactions. The upper five panels show PCR of SENP1/SuPr-2, and the lower panel shows HPRT results as the control. (B) Real-time RT-PCR analysis of SENP1/SuPr-2. Relative expression levels were normalized to HPRT.

    Journal: Molecular and Cellular Biology

    Article Title: Mutation of SENP1/SuPr-2 Reveals an Essential Role for Desumoylation in Mouse Development

    doi: 10.1128/MCB.25.12.5171-5182.2005

    Figure Lengend Snippet: Reduced expression of SENP1/SuPr-2 transcriptional isoforms in mutants. (A) RT-PCR analysis of e12.5 wild-type (wt) or mutant (m) littermates. The size of the RT-PCR products in base pairs is at the left. The schematics to the right of each panel indicate the corresponding cDNA structure and location of primers used for the reactions. The upper five panels show PCR of SENP1/SuPr-2, and the lower panel shows HPRT results as the control. (B) Real-time RT-PCR analysis of SENP1/SuPr-2. Relative expression levels were normalized to HPRT.

    Article Snippet: Briefly, first-strand cDNA was synthesized from total e12.5 RNA isolated with TRIzol Reagent (Invitrogen), using Superscript II reverse transcriptase (Invitrogen) primed with oligonucleotides TGAGCCAAGGAAACTGTCTGAGG (lying in SENP1/SuPr-2 exon 5) and AAGCAGTGGTATCAACGCAGAGTACGCGGG.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Mutagenesis, Polymerase Chain Reaction, Quantitative RT-PCR

    Elevated gene 50 transcription is accompanied by hypomethylation of the gene 50 promoter at day 18. (A) Quantitative RT-PCR for total gene 50 (G50) (exon 2) transcripts on cDNA generated from total splenocyte RNA. Transcript levels are elevated in Cre-positive

    Journal: Journal of Virology

    Article Title: The De Novo Methyltransferases DNMT3a and DNMT3b Target the Murine Gammaherpesvirus Immediate-Early Gene 50 Promoter during Establishment of Latency ▿

    doi: 10.1128/JVI.00060-10

    Figure Lengend Snippet: Elevated gene 50 transcription is accompanied by hypomethylation of the gene 50 promoter at day 18. (A) Quantitative RT-PCR for total gene 50 (G50) (exon 2) transcripts on cDNA generated from total splenocyte RNA. Transcript levels are elevated in Cre-positive

    Article Snippet: Twenty microliters of DNase-treated RNA was subsequently used for first-strand cDNA synthesis by use of SuperScript II reverse transcriptase (Invitrogen).

    Techniques: Quantitative RT-PCR, Generated

    Calponin-3-GFP is expressed from the endogenous Cnn3 locus. A. RT-PCR analysis of the Cnn3 mRNA splicing in targeted cells. Total RNA from the pre-B cell line Oct as well as from pre-B cells derived from a Cnn3 ki f/f mouse was transcribed into cDNA and analyzed by PCR. Primer pairs for PCRs 1 and 2 are depicted in the schematic illustration of the targeted allele. A sample lacking cDNA served as a control. B. Western blot analysis for expression of the calponin-3-GFP fusion protein from the targeted Cnn3 locus. Pre-B cells derived from a Cnn3 ki f/f mouse or a non-targeted littermate were lysed and subjected to SDS-PAGE and blotting. Oct pre-B cells expressing GFP and calponin-3-GFP were used as a control. Equal loading was demonstrated by anti-eIF4α. C. Flow cytometric analysis of cells from a Cnn3 ki f/f mouse or a non-targeted +/+ littermate. Cells were isolated from the bone marrow of the respective mice, stained with an anti-IgM antibody and analyzed for expression of IgM and GFP by flow cytometry. Numbers indicate the percentage of cells in the respective gate.

    Journal: PLoS ONE

    Article Title: A Conditional Knockout Mouse Model Reveals That Calponin-3 Is Dispensable for Early B Cell Development

    doi: 10.1371/journal.pone.0128385

    Figure Lengend Snippet: Calponin-3-GFP is expressed from the endogenous Cnn3 locus. A. RT-PCR analysis of the Cnn3 mRNA splicing in targeted cells. Total RNA from the pre-B cell line Oct as well as from pre-B cells derived from a Cnn3 ki f/f mouse was transcribed into cDNA and analyzed by PCR. Primer pairs for PCRs 1 and 2 are depicted in the schematic illustration of the targeted allele. A sample lacking cDNA served as a control. B. Western blot analysis for expression of the calponin-3-GFP fusion protein from the targeted Cnn3 locus. Pre-B cells derived from a Cnn3 ki f/f mouse or a non-targeted littermate were lysed and subjected to SDS-PAGE and blotting. Oct pre-B cells expressing GFP and calponin-3-GFP were used as a control. Equal loading was demonstrated by anti-eIF4α. C. Flow cytometric analysis of cells from a Cnn3 ki f/f mouse or a non-targeted +/+ littermate. Cells were isolated from the bone marrow of the respective mice, stained with an anti-IgM antibody and analyzed for expression of IgM and GFP by flow cytometry. Numbers indicate the percentage of cells in the respective gate.

    Article Snippet: 1 μg of RNA was reverse-transcribed into cDNA using the First Strand cDNA Synthesis Kit (Fermentas) according to the manufacturers’ instructions.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Derivative Assay, Polymerase Chain Reaction, Western Blot, Expressing, SDS Page, Flow Cytometry, Isolation, Mouse Assay, Staining, Cytometry

    Genetic organization of PeWBVYV. (A) PeWBVYV ORFs and validation strategy using RT-PCR amplification. UTR, untranslated region. (B) Strategy for assembly of cDNA corresponding to the PeWBVYV RNA genome from overlapping fragments by overlap extension PCR. (C) PCR amplification of cDNA corresponding to the PeWBVYV RNA genome by overlap PCR.

    Journal: Journal of Virology

    Article Title: Transmission of a New Polerovirus Infecting Pepper by the Whitefly Bemisia tabaci

    doi: 10.1128/JVI.00488-19

    Figure Lengend Snippet: Genetic organization of PeWBVYV. (A) PeWBVYV ORFs and validation strategy using RT-PCR amplification. UTR, untranslated region. (B) Strategy for assembly of cDNA corresponding to the PeWBVYV RNA genome from overlapping fragments by overlap extension PCR. (C) PCR amplification of cDNA corresponding to the PeWBVYV RNA genome by overlap PCR.

    Article Snippet: Treatment with DNase I and synthesis of first-strand cDNA with 2 μg RNA and random hexamers were done using a Maxima first-strand cDNA synthesis kit (Thermo Fisher Scientific).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction

    Overexpression of GMF in mouse neuroblastoma N18 cells after transfection with GMF/adenovirus construct (GMF-V). Mouse N18 cells were plated into 24-well plates (1×10 5 cells per well) and grown in DMEM/F12 containing 5% fetal bovine serum (complete medium). Replication-defective human adenovirus vector containing a full length GMF cDNA (GMF-V) or cytoplasmic lacZ cDNA (LacZ) at 20 MOI (multiplicity of infectivity) were added to cells in serum-free and antibiotic free DMEM/F12 medium for 4 h. Cells were rinsed and allowed to grow in fresh complete medium for another 24 h. Mock-transfected controls were processed identically in the absence of virus. Cell lysates (20 μg protein per lane) were subjected to SDS-polyacrylamide gel electrophoresis followed by electroblotting. The blots were probed with anti-GMF (G2-09) antibody and anti-β-actin antibody. Actin served as internal marker showing equal sample loading. For siRNA mediated down-regulation of GMF expression in N18, cells were transfected with duplex siRNA targeted against GMF (GsiRNA 10 nM), or with a control scrambled sequence (CsiRNA 10 nM). Cells were transfected with siRNA 4 h prior to adenovirus transfections. Lane 1, mock infection; lane 2, lacZ; lane 3, GMF-V; lane 4, CsiRNA; and lane 5, GsiRNA. (A) Western blot. (B) RT-PCR. The data shown are representative of at least three experiments.

    Journal: Brain research

    Article Title: Glia maturation factor overexpression in neuroblastoma cells activates glycogen synthase kinase-3? and caspase-3

    doi: 10.1016/j.brainres.2007.11.011

    Figure Lengend Snippet: Overexpression of GMF in mouse neuroblastoma N18 cells after transfection with GMF/adenovirus construct (GMF-V). Mouse N18 cells were plated into 24-well plates (1×10 5 cells per well) and grown in DMEM/F12 containing 5% fetal bovine serum (complete medium). Replication-defective human adenovirus vector containing a full length GMF cDNA (GMF-V) or cytoplasmic lacZ cDNA (LacZ) at 20 MOI (multiplicity of infectivity) were added to cells in serum-free and antibiotic free DMEM/F12 medium for 4 h. Cells were rinsed and allowed to grow in fresh complete medium for another 24 h. Mock-transfected controls were processed identically in the absence of virus. Cell lysates (20 μg protein per lane) were subjected to SDS-polyacrylamide gel electrophoresis followed by electroblotting. The blots were probed with anti-GMF (G2-09) antibody and anti-β-actin antibody. Actin served as internal marker showing equal sample loading. For siRNA mediated down-regulation of GMF expression in N18, cells were transfected with duplex siRNA targeted against GMF (GsiRNA 10 nM), or with a control scrambled sequence (CsiRNA 10 nM). Cells were transfected with siRNA 4 h prior to adenovirus transfections. Lane 1, mock infection; lane 2, lacZ; lane 3, GMF-V; lane 4, CsiRNA; and lane 5, GsiRNA. (A) Western blot. (B) RT-PCR. The data shown are representative of at least three experiments.

    Article Snippet: The first strand cDNA synthesis was carried out, using a ThermoScript RT-PCR system kit (GibcoBRL, Life Technologies).

    Techniques: Over Expression, Transfection, Construct, Plasmid Preparation, Infection, Polyacrylamide Gel Electrophoresis, Marker, Expressing, Sequencing, Western Blot, Reverse Transcription Polymerase Chain Reaction

    Topoisomerase-I-specific CD4+ T cells show a Th17 polarized functional phenotype. a CD4+ T cell subsets were identified by flow cytometry using the combined surface expression of chemokine receptors CCR6, CXCR3, and CCR4. b After sorting, the different T helper subsets were stimulated with anti-CD3/CD28 beads for 48 h and secretion of IFNγ, IL-4, and IL-17A was measured in their supernatants by enzyme-linked immunosorbent assay ( bars represent mean ± SE, n = 3). c The distribution of polarized T helper subsets within topo-I-specific CD4+ T cells ( closed circles ) is shown in comparison to the general CD4+ population ( open circles ). T test with Bonferroni correction was used for multiple comparisons. Lines indicate mean ± SD. d After sorting topo-I-specific CD4+ T cells according to their polarized T helper phenotype (range 16–2064 cells), mRNA expression levels of IFNγ, IL-4, and IL-17A were measured by qPCR using the Arcturus® PicoPure® RNA Isolation system, which is designed to recover high-quality RNA from a very low number of cells (10–500 cells) and to accomplish cDNA synthesis from minimal amounts of cDNA. IFNγ and IL-17A expression was calculated as fold change in reference to a mix of topo-I-reactive CD4+ T cells from three patients; IL-4 expression is reported as delta Ct from actin expression since it was not detectable in the reference population. Data are representative of four separate patients (mean ± SE)

    Journal: Arthritis Research & Therapy

    Article Title: Frequency of circulating topoisomerase-I-specific CD4 T cells predicts presence and progression of interstitial lung disease in scleroderma

    doi: 10.1186/s13075-016-0993-2

    Figure Lengend Snippet: Topoisomerase-I-specific CD4+ T cells show a Th17 polarized functional phenotype. a CD4+ T cell subsets were identified by flow cytometry using the combined surface expression of chemokine receptors CCR6, CXCR3, and CCR4. b After sorting, the different T helper subsets were stimulated with anti-CD3/CD28 beads for 48 h and secretion of IFNγ, IL-4, and IL-17A was measured in their supernatants by enzyme-linked immunosorbent assay ( bars represent mean ± SE, n = 3). c The distribution of polarized T helper subsets within topo-I-specific CD4+ T cells ( closed circles ) is shown in comparison to the general CD4+ population ( open circles ). T test with Bonferroni correction was used for multiple comparisons. Lines indicate mean ± SD. d After sorting topo-I-specific CD4+ T cells according to their polarized T helper phenotype (range 16–2064 cells), mRNA expression levels of IFNγ, IL-4, and IL-17A were measured by qPCR using the Arcturus® PicoPure® RNA Isolation system, which is designed to recover high-quality RNA from a very low number of cells (10–500 cells) and to accomplish cDNA synthesis from minimal amounts of cDNA. IFNγ and IL-17A expression was calculated as fold change in reference to a mix of topo-I-reactive CD4+ T cells from three patients; IL-4 expression is reported as delta Ct from actin expression since it was not detectable in the reference population. Data are representative of four separate patients (mean ± SE)

    Article Snippet: Single-strand cDNAs were synthesized with the Superscript III first-strand cDNA synthesis kit following the manufacturer’s protocol (Invitrogen, Life Technologies, Waltham, MA, USA).

    Techniques: Functional Assay, Flow Cytometry, Cytometry, Expressing, Enzyme-linked Immunosorbent Assay, Real-time Polymerase Chain Reaction, Isolation

    Northern blot analysis of rasGEFM expression in parental and mutant strains . ( A ) Total RNA was extracted from AX2 cells developed in suspension for 0 to 9 hours or on filters. In the latter case the cells were harvested at mound (12 hours), first finger (16 hours) and preculminant (20 hours) stages. The membrane was hybridized to a radiolabelled rasGEFM specific probe (probe a ) corresponding to bp 760–1518 of the cDNA clone and to the actin gene used as a loading control. ( B ) Total RNA was extracted from different developmental Dictyostelium mutants starved in shaking suspension up to 6 hours. LW6 (G protein β subunit minus), HSB1 (PIA ts -mutant, defective in the G-protein adenylyl cyclase activation) and HSB50 (mutant blocked at mound stage).

    Journal: BMC Cell Biology

    Article Title: A novel Dictyostelium RasGEF required for chemotaxis and development

    doi: 10.1186/1471-2121-6-43

    Figure Lengend Snippet: Northern blot analysis of rasGEFM expression in parental and mutant strains . ( A ) Total RNA was extracted from AX2 cells developed in suspension for 0 to 9 hours or on filters. In the latter case the cells were harvested at mound (12 hours), first finger (16 hours) and preculminant (20 hours) stages. The membrane was hybridized to a radiolabelled rasGEFM specific probe (probe a ) corresponding to bp 760–1518 of the cDNA clone and to the actin gene used as a loading control. ( B ) Total RNA was extracted from different developmental Dictyostelium mutants starved in shaking suspension up to 6 hours. LW6 (G protein β subunit minus), HSB1 (PIA ts -mutant, defective in the G-protein adenylyl cyclase activation) and HSB50 (mutant blocked at mound stage).

    Article Snippet: As template, cDNA isolated with "First strand cDNA synthesis kit" (Amersham Pharmacia Biotech), from RNA of cells developed for 5 hours on solid substrata, was used.

    Techniques: Northern Blot, Expressing, Mutagenesis, Activation Assay

    Disruption of the rasGEFM gene . ( A ) Southern blot of genomic DNA from parental strain (AX2) and rasGEFM null mutant (HSB61). Genomic DNA was digested with Eco RI, separated in 0.8% agarose gel, blotted onto nylon membrane and probed with probe a ( rasGEFM N-terminal fragment corresponding to bp 0–617 of the cDNA clone), probe b (corresponding to bp 760–1518 of the rasGEFM cDNA clone) and probe c ( bsr cassette). Three different probes were used to characterize the genomic locus of the mutant and the parental strain. In the rasGEFM null strain the central part of the gene (recognized by probe b ), was replaced by the blasticidin cassette (recognized by probe c ), which has the same size of the replaced fragment. Because of that, the size of the locus remains unchanged, but the central part is recognized specifically by bsr (probe c ) or probe b in HSB61 or AX2, respectively. Both AX2 and HSB61 genomic loci are recognized by the probe a . ( B ) Northern blot of total RNA extracted from HSB61 cells at the indicated time points of growth and development. The membrane was hybridized to the rasGEFM and to the actin gene.

    Journal: BMC Cell Biology

    Article Title: A novel Dictyostelium RasGEF required for chemotaxis and development

    doi: 10.1186/1471-2121-6-43

    Figure Lengend Snippet: Disruption of the rasGEFM gene . ( A ) Southern blot of genomic DNA from parental strain (AX2) and rasGEFM null mutant (HSB61). Genomic DNA was digested with Eco RI, separated in 0.8% agarose gel, blotted onto nylon membrane and probed with probe a ( rasGEFM N-terminal fragment corresponding to bp 0–617 of the cDNA clone), probe b (corresponding to bp 760–1518 of the rasGEFM cDNA clone) and probe c ( bsr cassette). Three different probes were used to characterize the genomic locus of the mutant and the parental strain. In the rasGEFM null strain the central part of the gene (recognized by probe b ), was replaced by the blasticidin cassette (recognized by probe c ), which has the same size of the replaced fragment. Because of that, the size of the locus remains unchanged, but the central part is recognized specifically by bsr (probe c ) or probe b in HSB61 or AX2, respectively. Both AX2 and HSB61 genomic loci are recognized by the probe a . ( B ) Northern blot of total RNA extracted from HSB61 cells at the indicated time points of growth and development. The membrane was hybridized to the rasGEFM and to the actin gene.

    Article Snippet: As template, cDNA isolated with "First strand cDNA synthesis kit" (Amersham Pharmacia Biotech), from RNA of cells developed for 5 hours on solid substrata, was used.

    Techniques: Southern Blot, Mutagenesis, Agarose Gel Electrophoresis, Northern Blot

    (A) DNA construct for Vδ6.3Tg mice. The detailed DNA construction is described in Materials and Methods. A mouse TCRδ6.3 cDNA clone was isolated from the RL6.14 hybridoma (from C57BL/6 DN thymocytes) and inserted into the class I promoter/Ig enhancer expression cassette. (B) Expression of Vδ6.3 transgene at an early stage of fetal thymic T cell development. E15 embryos were obtained from TCR-δ −/ − Vδ6.3Tg crosses. Each littermate was typed (data not shown) and analyzed individually. RNA was extracted from total thymocytes and RT-PCR was performed using Vδ6.3 transgene specific primers (Cδ primer and β-globin primer in A, as forward and reverse primers, respectively). β-actin RT-PCR was performed in parallel as a positive control. A 550-bp band specific for Vδ6.3 transgene expression was detected in the thymus of E15 TCRδ −/ − Vδ6.3Tg embryos but not in control (non-Tg) embryos. (C) Expression of endogenous Vδ−Cδ transcripts in wt adult thymic γδ T cells and wt E15 thymocytes. Wt E15 thymocytes were obtained from timed pregnant females. Adult thymic γδ T cells were obtained by electronic sorting after CD4/CD8 complement depletion. RNA was extracted and RT-PCR was performed using specific primers for the indicated Vδ-Cδ transcripts. β-actin RT-PCR was performed in parallel as a positive control.

    Journal: The Journal of Experimental Medicine

    Article Title: T Cell Receptor Specificity Is Critical for the Development of Epidermal ?? T Cells

    doi:

    Figure Lengend Snippet: (A) DNA construct for Vδ6.3Tg mice. The detailed DNA construction is described in Materials and Methods. A mouse TCRδ6.3 cDNA clone was isolated from the RL6.14 hybridoma (from C57BL/6 DN thymocytes) and inserted into the class I promoter/Ig enhancer expression cassette. (B) Expression of Vδ6.3 transgene at an early stage of fetal thymic T cell development. E15 embryos were obtained from TCR-δ −/ − Vδ6.3Tg crosses. Each littermate was typed (data not shown) and analyzed individually. RNA was extracted from total thymocytes and RT-PCR was performed using Vδ6.3 transgene specific primers (Cδ primer and β-globin primer in A, as forward and reverse primers, respectively). β-actin RT-PCR was performed in parallel as a positive control. A 550-bp band specific for Vδ6.3 transgene expression was detected in the thymus of E15 TCRδ −/ − Vδ6.3Tg embryos but not in control (non-Tg) embryos. (C) Expression of endogenous Vδ−Cδ transcripts in wt adult thymic γδ T cells and wt E15 thymocytes. Wt E15 thymocytes were obtained from timed pregnant females. Adult thymic γδ T cells were obtained by electronic sorting after CD4/CD8 complement depletion. RNA was extracted and RT-PCR was performed using specific primers for the indicated Vδ-Cδ transcripts. β-actin RT-PCR was performed in parallel as a positive control.

    Article Snippet: The first-strand cDNA from extracted RNA was synthesized with oligo(dT) (Amersham Pharmacia Biotech) in a final volume of 20 μl using AMV reverse transcriptase.

    Techniques: Construct, Mouse Assay, Isolation, Expressing, Reverse Transcription Polymerase Chain Reaction, Positive Control

    Overview of Cufflinks. The algorithm takes as input cDNA fragment sequences that have been ( a ) aligned to the genome by software capable of producing spliced alignments, such as TopHat. With paired-end RNA-Seq, Cufflinks treats each pair of fragment reads as a single alignment. The algorithm assembles overlapping ‘bundles’ of fragment alignments ( b-c ) separately, which reduces running time and memory use because each bundle typically contains the fragments from no more than a few genes. Cufflinks then estimates the abundances of the assembled transcripts ( d-e ). ( b ) The first step in fragment assembly is to identify pairs of ‘incompatible’ fragments that must have originated from distinct spliced mRNA isoforms. Fragments are connected in an ‘overlap graph’ when they are compatible and their alignments overlap in the genome. Each fragment has one node in the graph, and an edge, directed from left to right along the genome, is placed between each pair of compatible fragments. In this example, the yellow, blue, and red fragments must have originated from separate isoforms, but any other fragment could have come from the same transcript as one of these three. ( c ) Assembling isoforms from the overlap graph. Paths through the graph correspond to sets of mutually compatible fragments that could be merged into complete isoforms. The overlap graph here can be minimally ‘covered’ by three paths, each representing a different isoform. Dilworth's Theorem states that the number of mutually incompatible reads is the same as the minimum number of transcripts needed to “explain” all the fragments. Cufflinks implements a proof of Dilworth's Theorem that produces a minimal set of paths that cover all the fragments in the overlap graph by finding the largest set of reads with the property that no two could have originated from the same isoform. ( d ) Estimating transcript abundance. Fragments are matched (denoted here using color) to the transcripts from which they could have originated. The violet fragment could have originated from the blue or red isoform. Gray fragments could have come from any of the three shown. Cufflinks estimates transcript abundances using a statistical model in which the probability of observing each fragment is a linear function of the abundances of the transcripts from which it could have originated. Because only the ends of each fragment are sequenced, the length of each may be unknown. Assigning a fragment to different isoforms often implies a different length for it. Cufflinks can incorporate the distribution of fragment lengths to help assign fragments to isoforms. For example, the violet fragment would be much longer, and very improbable according to Cufflinks' model, if it were to come from the red isoform instead of the blue isoform. ( e ) The program then numerically maximizes a function that assigns a likelihood to all possible sets of relative abundances of the yellow, red and blue isoforms (γ 1 ,γ 2 ,γ 3 ), producing the abundances that best explain the observed fragments, shown as a pie chart.

    Journal: Nature biotechnology

    Article Title: Transcript assembly and abundance estimation from RNA-Seq reveals thousands of new transcripts and switching among isoforms

    doi: 10.1038/nbt.1621

    Figure Lengend Snippet: Overview of Cufflinks. The algorithm takes as input cDNA fragment sequences that have been ( a ) aligned to the genome by software capable of producing spliced alignments, such as TopHat. With paired-end RNA-Seq, Cufflinks treats each pair of fragment reads as a single alignment. The algorithm assembles overlapping ‘bundles’ of fragment alignments ( b-c ) separately, which reduces running time and memory use because each bundle typically contains the fragments from no more than a few genes. Cufflinks then estimates the abundances of the assembled transcripts ( d-e ). ( b ) The first step in fragment assembly is to identify pairs of ‘incompatible’ fragments that must have originated from distinct spliced mRNA isoforms. Fragments are connected in an ‘overlap graph’ when they are compatible and their alignments overlap in the genome. Each fragment has one node in the graph, and an edge, directed from left to right along the genome, is placed between each pair of compatible fragments. In this example, the yellow, blue, and red fragments must have originated from separate isoforms, but any other fragment could have come from the same transcript as one of these three. ( c ) Assembling isoforms from the overlap graph. Paths through the graph correspond to sets of mutually compatible fragments that could be merged into complete isoforms. The overlap graph here can be minimally ‘covered’ by three paths, each representing a different isoform. Dilworth's Theorem states that the number of mutually incompatible reads is the same as the minimum number of transcripts needed to “explain” all the fragments. Cufflinks implements a proof of Dilworth's Theorem that produces a minimal set of paths that cover all the fragments in the overlap graph by finding the largest set of reads with the property that no two could have originated from the same isoform. ( d ) Estimating transcript abundance. Fragments are matched (denoted here using color) to the transcripts from which they could have originated. The violet fragment could have originated from the blue or red isoform. Gray fragments could have come from any of the three shown. Cufflinks estimates transcript abundances using a statistical model in which the probability of observing each fragment is a linear function of the abundances of the transcripts from which it could have originated. Because only the ends of each fragment are sequenced, the length of each may be unknown. Assigning a fragment to different isoforms often implies a different length for it. Cufflinks can incorporate the distribution of fragment lengths to help assign fragments to isoforms. For example, the violet fragment would be much longer, and very improbable according to Cufflinks' model, if it were to come from the red isoform instead of the blue isoform. ( e ) The program then numerically maximizes a function that assigns a likelihood to all possible sets of relative abundances of the yellow, red and blue isoforms (γ 1 ,γ 2 ,γ 3 ), producing the abundances that best explain the observed fragments, shown as a pie chart.

    Article Snippet: After removal of hydrolysis ions by G50 Sephadex filtration (USA Scientific catalog # 1415-1602), the fragmented mRNA was random primed with hexamers and reverse-transcribed using the Super Script II cDNA synthesis kit (Invitrogen catalog # 11917010).

    Techniques: Software, RNA Sequencing Assay

    Heterologous expression of MdATG8i in Arabidopsis and growth phenotype. (A) PCR with gDNA; (B) PCR with cDNA; Lanes M, molecular marker DL2000; V, positive vector containing pGWB406- MdATG8i plasmid; WT, non-transformed wild-type; OE-6 and -7, MdATG8i -transgenic lines; (C) qRT-PCR analysis of MdATG8i transcripts in Arabidopsis lines OE-6 and OE-7; (D) Growth phenotype comparison of WT and transgenic lines under LD photoperiod; (E) Growth for rosettes from WT or transgenic lines under SD photoperiod; Data are means ± SD of 20 replicates. *, ** or *** indicates the statistically significant differences determined by Student's t -tests at P

    Journal: Frontiers in Plant Science

    Article Title: Characterization of an Autophagy-Related Gene MdATG8i from Apple

    doi: 10.3389/fpls.2016.00720

    Figure Lengend Snippet: Heterologous expression of MdATG8i in Arabidopsis and growth phenotype. (A) PCR with gDNA; (B) PCR with cDNA; Lanes M, molecular marker DL2000; V, positive vector containing pGWB406- MdATG8i plasmid; WT, non-transformed wild-type; OE-6 and -7, MdATG8i -transgenic lines; (C) qRT-PCR analysis of MdATG8i transcripts in Arabidopsis lines OE-6 and OE-7; (D) Growth phenotype comparison of WT and transgenic lines under LD photoperiod; (E) Growth for rosettes from WT or transgenic lines under SD photoperiod; Data are means ± SD of 20 replicates. *, ** or *** indicates the statistically significant differences determined by Student's t -tests at P

    Article Snippet: The same amount of mRNA (2 μg) from each sample was used to synthesize first-strand cDNA. qRT-PCR was performed on an iQ 5.0 instrument (Bio-Rad, Hercules, CA, USA), using a SYBR Premix Ex Taq kit (TaKaRa, Kyoto, Japan) according to the manufacturer's instructions.

    Techniques: Expressing, Polymerase Chain Reaction, Marker, Plasmid Preparation, Transformation Assay, Transgenic Assay, Quantitative RT-PCR

    Basic characteristics of pJAB1. ( a ) The PCR result of the pJAB1 gene. M, 5000 bp DNA marker; 1, the pJAB1 gene; 2, blank control. ( b ) The exon–intron structure. Eight exons were found in the cDNA sequence. ( c ) The secondary structure showing chromo, MPN and DEAD domains in the pJAB1 protein. ( d ) Comparison of the nucleotide sequences of pJAB1 and hJAB1. Short bars represent the identical nucleotides among the two sequences. Different regions were indicated by lowercase letters

    Journal: Cell Death & Disease

    Article Title: Porcine JAB1 significantly enhances apoptosis induced by staurosporine

    doi: 10.1038/cddis.2013.357

    Figure Lengend Snippet: Basic characteristics of pJAB1. ( a ) The PCR result of the pJAB1 gene. M, 5000 bp DNA marker; 1, the pJAB1 gene; 2, blank control. ( b ) The exon–intron structure. Eight exons were found in the cDNA sequence. ( c ) The secondary structure showing chromo, MPN and DEAD domains in the pJAB1 protein. ( d ) Comparison of the nucleotide sequences of pJAB1 and hJAB1. Short bars represent the identical nucleotides among the two sequences. Different regions were indicated by lowercase letters

    Article Snippet: Extracted RNAs were subjected to RT-PCR using first-strand cDNA synthesis kit (Takara Bio., Dalian, China).

    Techniques: Polymerase Chain Reaction, Marker, Sequencing

    MECP2 inhibited miR-338 expression in gastric cancer cells ( A ) The BGC-823 and SGC-7901 cells were treated with 5-Azacytidine (5-Aza) (5 μmol), the equal volume of DMSO as control, expression of miR-338-3p and pre-miR-338 was measured by qRT-PCR. The expression of miR-338-3p and pre-miR-338 was normalized to U6 RNA. ( B ) qRT-PCR and western blot analysis of MECP2 protein and mRNA levels expression in BGC-823 and SGC-7901 cells were transfected with GV146 vector containing cDNA of MECP2 or control vector. ( C ) The miR-338-3p and pre-miR-338 expression was quantified by qRT-PCR in BGC-823 and SGC-7901 cells transfected with GV146 vector containing cDNA of MECP2 or control vector. ( D ) qRT-PCR analysis of the miR-338-3p and pre-miR-338 expression in BGC-823 and SGC-7901 cells following transfection with two MECP2 siRNAs or control siRNA. ( E ) Sketch of the putative CpG island locus and the MECP2 binding site in human miR-338 promoter. ( F ) ChIP assays were performed with control (rat IgG), anti-MECP2 antibody to determine MECP2 occupancy of miR-338 promoter. ( G ) qRT-PCR analysis was performed with primers spanning predicted CpG island of miR-338. ( H ) Western blot analyses of P-REX2 and phosphorylated AKT(Ser-473) in BGC-823 cells transfected with MECP2 siRNA1 or control siRNA. ( I ) MTT assay was performed to determine the growth of BGC-823 and SGC-7901 cells after cotransfected with MECP2 siRNA1 and inhibitor control or siRNA control and miR-338-3p inhibitor. ( J ) Early Cell apoptosis were detected by Annexin-V/propidium iodide combined labeling flow cytometry in BGC-823 and SGC-7901 cells 48 hours after transfection. Each data represented mean ± SD. * P

    Journal: Oncotarget

    Article Title: MECP2 promotes the growth of gastric cancer cells by suppressing miR-338-mediated antiproliferative effect

    doi: 10.18632/oncotarget.9197

    Figure Lengend Snippet: MECP2 inhibited miR-338 expression in gastric cancer cells ( A ) The BGC-823 and SGC-7901 cells were treated with 5-Azacytidine (5-Aza) (5 μmol), the equal volume of DMSO as control, expression of miR-338-3p and pre-miR-338 was measured by qRT-PCR. The expression of miR-338-3p and pre-miR-338 was normalized to U6 RNA. ( B ) qRT-PCR and western blot analysis of MECP2 protein and mRNA levels expression in BGC-823 and SGC-7901 cells were transfected with GV146 vector containing cDNA of MECP2 or control vector. ( C ) The miR-338-3p and pre-miR-338 expression was quantified by qRT-PCR in BGC-823 and SGC-7901 cells transfected with GV146 vector containing cDNA of MECP2 or control vector. ( D ) qRT-PCR analysis of the miR-338-3p and pre-miR-338 expression in BGC-823 and SGC-7901 cells following transfection with two MECP2 siRNAs or control siRNA. ( E ) Sketch of the putative CpG island locus and the MECP2 binding site in human miR-338 promoter. ( F ) ChIP assays were performed with control (rat IgG), anti-MECP2 antibody to determine MECP2 occupancy of miR-338 promoter. ( G ) qRT-PCR analysis was performed with primers spanning predicted CpG island of miR-338. ( H ) Western blot analyses of P-REX2 and phosphorylated AKT(Ser-473) in BGC-823 cells transfected with MECP2 siRNA1 or control siRNA. ( I ) MTT assay was performed to determine the growth of BGC-823 and SGC-7901 cells after cotransfected with MECP2 siRNA1 and inhibitor control or siRNA control and miR-338-3p inhibitor. ( J ) Early Cell apoptosis were detected by Annexin-V/propidium iodide combined labeling flow cytometry in BGC-823 and SGC-7901 cells 48 hours after transfection. Each data represented mean ± SD. * P

    Article Snippet: For mRNA analyses, the first-strand cDNA was synthesized according to the manufacturer's protocol (Toyobo, Osaka, Japan). while for quantification of miR-338-3p, miR-338-5p and pre-miR338, miRNA was reverse transcribed using miRNA-specific primers.

    Techniques: Expressing, Quantitative RT-PCR, Western Blot, Transfection, Plasmid Preparation, Binding Assay, Chromatin Immunoprecipitation, MTT Assay, Labeling, Flow Cytometry, Cytometry

    Methods for total RNA-Seq Shown are the salient details for five protocols for total RNA-Seq. DSN-lite (Duplex-specific nuclease, low C 0 t normalization), RNase H, and Ribo-Zero were tested for low quality samples; SMART was tested for low quantity samples. NuGEN, which generates double-stranded cDNA amplified using Ribo-SPIA (Single Primer Isothermal Amplification), was tested for both types of samples: (NuGEN 100f for low quality; NuGEN 1i for low quantity, and NuGEN 1f for low quantity and low quality). In each case, RNA and matching cDNA are in black, adaptors and primers in color, and rRNA is in grey.

    Journal: Nature methods

    Article Title: Comprehensive comparative analysis of RNA sequencing methods for degraded or low input samples

    doi: 10.1038/nmeth.2483

    Figure Lengend Snippet: Methods for total RNA-Seq Shown are the salient details for five protocols for total RNA-Seq. DSN-lite (Duplex-specific nuclease, low C 0 t normalization), RNase H, and Ribo-Zero were tested for low quality samples; SMART was tested for low quantity samples. NuGEN, which generates double-stranded cDNA amplified using Ribo-SPIA (Single Primer Isothermal Amplification), was tested for both types of samples: (NuGEN 100f for low quality; NuGEN 1i for low quantity, and NuGEN 1f for low quantity and low quality). In each case, RNA and matching cDNA are in black, adaptors and primers in color, and rRNA is in grey.

    Article Snippet: For the Ribo-Zero libraries, we synthesized double-stranded cDNA and prepared an indexed Illumina library as described for the RNase H libraries.

    Techniques: RNA Sequencing Assay, Amplification

    Reverse transcriptase-PCR analysis demonstrates a polycistronic transcript of mtsABC mRNA . Total RNA from S. iniae HD-1 was reverse transcribed into cDNA, and PCR was performed with ORF-specific primers. Each box contains products with the same primer pairs. For PCR, S. iniae HD-1 genomic DNA was used as the template (on the left), and for reverse transcriptase-PCR, S. iniae HD-1 RNA was used as the template (on the right).

    Journal: BMC Microbiology

    Article Title: A solute-binding protein for iron transport in Streptococcus iniae

    doi: 10.1186/1471-2180-10-309

    Figure Lengend Snippet: Reverse transcriptase-PCR analysis demonstrates a polycistronic transcript of mtsABC mRNA . Total RNA from S. iniae HD-1 was reverse transcribed into cDNA, and PCR was performed with ORF-specific primers. Each box contains products with the same primer pairs. For PCR, S. iniae HD-1 genomic DNA was used as the template (on the left), and for reverse transcriptase-PCR, S. iniae HD-1 RNA was used as the template (on the right).

    Article Snippet: First-strand cDNA was synthesized from 1 μg total RNA using the first-strand cDNA synthesis kit with ReverTra Ace-α-reverse transcriptase (Toyobo Co., Ltd.).

    Techniques: Polymerase Chain Reaction