stat3 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Cell Signaling Technology Inc stat3
    Activation of <t>STAT3</t> is via sIL-6R and not mIL-6R in cancer cells
    Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 16521 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 16521 article reviews
    Price from $9.99 to $1999.99
    stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    94
    Santa Cruz Biotechnology stat3
    <t>STAT3</t> is a potential transcriptional regulator in the promoter of the mouse Mn-SOD gene. A , Schematic diagram for putative STAT3 binding sites in the promoter of the mouse Mn-SOD gene. B , Transcriptional activity of the mouse Mn-SOD gene was determined
    Stat3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 6212 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stat3/product/Santa Cruz Biotechnology
    Average 94 stars, based on 6212 article reviews
    Price from $9.99 to $1999.99
    stat3 - by Bioz Stars, 2020-10
    94/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc p stat3
    <t>STAT3</t> is a potential transcriptional regulator in the promoter of the mouse Mn-SOD gene. A , Schematic diagram for putative STAT3 binding sites in the promoter of the mouse Mn-SOD gene. B , Transcriptional activity of the mouse Mn-SOD gene was determined
    P Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 5684 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 5684 article reviews
    Price from $9.99 to $1999.99
    p stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc anti stat3
    TRIM28 functions as a cofactor for RORγt and <t>STAT3.</t> a Overlay of TRIM28 binding peaks with that of RORγt and STAT3 in Th17 cells. b Genome-wide distributions of binding peaks of RORγt, STAT3, and p300 at TRIM28 binding sites. c IGV browser view of RORγt, STAT3, and TRIM28 binding peaks at the Il17-Il17f gene locus. d Binding of RORγt and STAT3 to the Il17-Il17f gene locus in WT and Trim28 −/ − Th17 cells cultured at TGF-β plus IL-6 condition. e Overexpression of RORγt in WT or TRIM28 KO CD4 + T cells polarized under neutral (Th0) or Th17 (TGF-β plus IL-6) conditions. d , e The experiments were repeated 2–3 times with consistent results, and Student’s t test was used for the statistical test (ns = not significant; * p
    Anti Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 3773 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 3773 article reviews
    Price from $9.99 to $1999.99
    anti stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc phospho stat3
    TRIM28 functions as a cofactor for RORγt and <t>STAT3.</t> a Overlay of TRIM28 binding peaks with that of RORγt and STAT3 in Th17 cells. b Genome-wide distributions of binding peaks of RORγt, STAT3, and p300 at TRIM28 binding sites. c IGV browser view of RORγt, STAT3, and TRIM28 binding peaks at the Il17-Il17f gene locus. d Binding of RORγt and STAT3 to the Il17-Il17f gene locus in WT and Trim28 −/ − Th17 cells cultured at TGF-β plus IL-6 condition. e Overexpression of RORγt in WT or TRIM28 KO CD4 + T cells polarized under neutral (Th0) or Th17 (TGF-β plus IL-6) conditions. d , e The experiments were repeated 2–3 times with consistent results, and Student’s t test was used for the statistical test (ns = not significant; * p
    Phospho Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 3675 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phospho stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 3675 article reviews
    Price from $9.99 to $1999.99
    phospho stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    stat3  (Abcam)
    98
    Abcam stat3
    TRIM28 functions as a cofactor for RORγt and <t>STAT3.</t> a Overlay of TRIM28 binding peaks with that of RORγt and STAT3 in Th17 cells. b Genome-wide distributions of binding peaks of RORγt, STAT3, and p300 at TRIM28 binding sites. c IGV browser view of RORγt, STAT3, and TRIM28 binding peaks at the Il17-Il17f gene locus. d Binding of RORγt and STAT3 to the Il17-Il17f gene locus in WT and Trim28 −/ − Th17 cells cultured at TGF-β plus IL-6 condition. e Overexpression of RORγt in WT or TRIM28 KO CD4 + T cells polarized under neutral (Th0) or Th17 (TGF-β plus IL-6) conditions. d , e The experiments were repeated 2–3 times with consistent results, and Student’s t test was used for the statistical test (ns = not significant; * p
    Stat3, supplied by Abcam, used in various techniques. Bioz Stars score: 98/100, based on 1167 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stat3/product/Abcam
    Average 98 stars, based on 1167 article reviews
    Price from $9.99 to $1999.99
    stat3 - by Bioz Stars, 2020-10
    98/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc anti phospho stat3
    Epha2 on oral epithelial cells binds β-glucan and primes the cells for an inflammatory response ( Left panel ) EphA2 (blue) and dectin-1 (green) bind to exposed β-glucan on the fungal surface. Binding to EphA2 is independent of Ca 2+ and activates mitogen-activated protein kinase (MAPK) and signal transducer and activator of transcription 3 <t>(Stat3).</t> Binding to dectin-1 requires Ca 2+ and activates nuclear factor ‘kappa-light-chain-enhancer’ of activated B-cells (NF-κB). ( Right panel ) During fungal proliferation, prolonged activation of EphA2 via EGFR (grey) induces the endocytosis of C. albicans and a pro-inflammatory response in the epithelial cells. EphA2-EGFR induces endocytosis and triggers MAPK signaling. EphA2 also activates Stat3 Activation of the Stat3 and MAPK pathways leads to the release of alarmins, cytokines, chemokines, and host defense peptides (HDPs, orange helix).
    Anti Phospho Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1473 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti phospho stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 1473 article reviews
    Price from $9.99 to $1999.99
    anti phospho stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    92
    Santa Cruz Biotechnology anti stat3
    SDHB and IDH 2 protein levels are associated with Gleason grade SDHB protein expression levels in a TMA ( n = 83) detected by immunohistochemistry (IHC). Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q, adj. P ‐value; n.s., not significant. TMA, tissue microarray. Representative IHC staining of SDHB in normal prostate glands and Gleason grade (GL) 3–5 PCa glands. Scale bar = 100 μm. IDH2 protein expression levels in a TMA ( n = 83) detected by IHC. Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q, adj. P ‐value; n.s., not significant. Representative IHC staining of IDH2 in normal prostate glands and GL 3–5 PCa glands. Scale bar = 100 μm. Nuclear (N) and cytoplasmic (C) <t>STAT3</t> protein expression levels in a TMA ( n = 83) detected by IHC. Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q = adj. P ‐value; n.s., not significant. Source data are available online for this figure.
    Anti Stat3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1721 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti stat3/product/Santa Cruz Biotechnology
    Average 92 stars, based on 1721 article reviews
    Price from $9.99 to $1999.99
    anti stat3 - by Bioz Stars, 2020-10
    92/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc phospho stat3 tyr705
    SDHB and IDH 2 protein levels are associated with Gleason grade SDHB protein expression levels in a TMA ( n = 83) detected by immunohistochemistry (IHC). Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q, adj. P ‐value; n.s., not significant. TMA, tissue microarray. Representative IHC staining of SDHB in normal prostate glands and Gleason grade (GL) 3–5 PCa glands. Scale bar = 100 μm. IDH2 protein expression levels in a TMA ( n = 83) detected by IHC. Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q, adj. P ‐value; n.s., not significant. Representative IHC staining of IDH2 in normal prostate glands and GL 3–5 PCa glands. Scale bar = 100 μm. Nuclear (N) and cytoplasmic (C) <t>STAT3</t> protein expression levels in a TMA ( n = 83) detected by IHC. Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q = adj. P ‐value; n.s., not significant. Source data are available online for this figure.
    Phospho Stat3 Tyr705, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1478 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phospho stat3 tyr705/product/Cell Signaling Technology Inc
    Average 99 stars, based on 1478 article reviews
    Price from $9.99 to $1999.99
    phospho stat3 tyr705 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc anti p stat3
    Nuclear translocation of <t>STAT3</t> was suppressed by ursolic acid in HCT116 cells. The localization of STAT3 (red) and 4,6-diamidino-2-phenylindole (DAPI) (blue) in HCT116 cells. HCT116 cells were treated by ursolic acid for 24 h. STAT3 was probed with primary antibody and labelled using secondary antibody conjugated. Scale bar = 40 μm. Corresponding zoomed images of the STAT3, DAPI, and Merge (indicated by the yellow box).
    Anti P Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 901 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti p stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 901 article reviews
    Price from $9.99 to $1999.99
    anti p stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc phosphorylated stat3
    Activation of <t>STAT3</t> is significantly impaired in the SCG and DRG of low and high dose diabetic mice. Cell counts were performed in the SCG ( a,b ) and DRG ( c,d ) for low dose ( a,c ) and high dose ( b,d ) diabetic mice. The percentage of HuD/C-positive neurons displaying positive staining for phosphorylated STAT3 in the nucleus was calculated. n=5–7/group. * = p
    Phosphorylated Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1037 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phosphorylated stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 1037 article reviews
    Price from $9.99 to $1999.99
    phosphorylated stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    98
    Abcam p stat3
    Activation of <t>STAT3</t> is significantly impaired in the SCG and DRG of low and high dose diabetic mice. Cell counts were performed in the SCG ( a,b ) and DRG ( c,d ) for low dose ( a,c ) and high dose ( b,d ) diabetic mice. The percentage of HuD/C-positive neurons displaying positive staining for phosphorylated STAT3 in the nucleus was calculated. n=5–7/group. * = p
    P Stat3, supplied by Abcam, used in various techniques. Bioz Stars score: 98/100, based on 797 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p stat3/product/Abcam
    Average 98 stars, based on 797 article reviews
    Price from $9.99 to $1999.99
    p stat3 - by Bioz Stars, 2020-10
    98/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc antibody against stat3
    FEZF1-AS1 promotes <t>STAT3</t> expression. ( A ) FEZF1-AS1 knockdown inhibited the protein levels of p-STAT3 and STAT3 in ES2 cells. ( B ) Expression correlation between STAT3 and FEZF1-AS1 was determined by qRT-PCR in ovarian cancer tissues. * P
    Antibody Against Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 151 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antibody against stat3/product/Cell Signaling Technology Inc
    Average 93 stars, based on 151 article reviews
    Price from $9.99 to $1999.99
    antibody against stat3 - by Bioz Stars, 2020-10
    93/100 stars
      Buy from Supplier

    93
    Becton Dickinson stat3
    Effect of expression <t>STAT3-KD</t> and expression of WT- STAT3 on GBMX10 GIC tumorigenicity GBMX10 iSTAT3-KD GICs (10 6 cells) transduced with luciferase-encoding lentivirus were injected into the flanks of NSG mice. After tumor induction was validated, Dox was delivered by oral gavage twice daily, and tumor development was monitored by live animal imaging. Representative bioluminescent images of mice injected with X10 iSTAT3-KD cells and then treated with Dox (X10 STAT3-KD) and rescued with WT-STAT3 (X10 STAT3 rescue) or not Dox-Treated (X10) at 21 days post-injection.
    Stat3, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 93/100, based on 642 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stat3/product/Becton Dickinson
    Average 93 stars, based on 642 article reviews
    Price from $9.99 to $1999.99
    stat3 - by Bioz Stars, 2020-10
    93/100 stars
      Buy from Supplier

    92
    Thermo Fisher stat3
    The inhibition of the <t>STAT1/STAT3</t> signaling reverses the kynurenine-dependent immunosuppression in multidrug resistant cells. A549/dx cells were grown for 48 h in fresh medium (CTRL), treated with a non-targeting scrambled siRNA (scr) or with a specific siRNAs pool targeting STAT1 or STAT3, respectively (si STAT1, si STAT3). Untreated chemosensitive A549 cells were used as control. A . The expression of STAT1, STAT3, IDO1, IDO2 and TDO was measured in whole cell lysates by Western blotting, 48 h after the transfection. The β-tubulin expression was used as control of equal protein loading. The figure is representative of 3 experiments with similar results. B . The kynurenine levels in the cell culture supernatants were measured spectrophotometrically. Data are presented as means ± SD (n = 4). * p
    Stat3, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1029 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stat3/product/Thermo Fisher
    Average 92 stars, based on 1029 article reviews
    Price from $9.99 to $1999.99
    stat3 - by Bioz Stars, 2020-10
    92/100 stars
      Buy from Supplier

    99
    Abcam anti stat3
    The gemcitabine-erlotinib (E+G) combination group inhibits the activity of the JAK-STAT pathway, as well as the expression of downstream HIF-1α, cyclin D1 and p53. (A and B) The protein levels of phosphorylated <t>STAT3</t> Tyr 705 (p-STAT3 Tyr 705 ), HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells were analyzed by western blotting, respectively. (C and D) The protein expression of p-STAT3 Tyr 705 , HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells was calculated using one-way ANOVA. *P
    Anti Stat3, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 578 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti stat3/product/Abcam
    Average 99 stars, based on 578 article reviews
    Price from $9.99 to $1999.99
    anti stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    93
    Upstate Biotechnology Inc stat3
    Tyrosine phosphorylation and activation of Etk upon coexpression with v-Src in 293 cells. 293 cells were transiently transfected with wild-type (WT) or kinase-defective (KD), T7-tagged Etk and/or v-Src as indicated above each lane. Two days later, cells were lysed and the cell lysates were used for immunoprecipitations with anti-T7 antibody. (A) As shown on the left, the immunocomplexes were subjected to in vitro kinase assays in the presence of [γ- 32 P]ATP and enolase as an exogenous substrate. Phosphorylated proteins were separated by SDS-PAGE and detected by autoradiography. Kinase assay products similar to those of lanes 2 and 3 of the blot shown on the left were separated on a longer gel and detected by autoradiography. The estimated migration of <t>STAT3</t> protein is indicated by the asterisk. (B) Immunocomplexes (lanes are as described for panel A) were resolved by SDS-PAGE and subjected to Western blotting (WB) with antiphosphotyrosine antibody (anti-PY) or anti-Etk antibody.
    Stat3, supplied by Upstate Biotechnology Inc, used in various techniques. Bioz Stars score: 93/100, based on 300 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stat3/product/Upstate Biotechnology Inc
    Average 93 stars, based on 300 article reviews
    Price from $9.99 to $1999.99
    stat3 - by Bioz Stars, 2020-10
    93/100 stars
      Buy from Supplier

    Image Search Results


    Activation of STAT3 is via sIL-6R and not mIL-6R in cancer cells

    Journal: Gastroenterology

    Article Title: Interleukin 6 Alters Localization of hMSH3, Leading to DNA Mismatch Repair Defects in Colorectal Cancer Cells

    doi: 10.1053/j.gastro.2014.11.027

    Figure Lengend Snippet: Activation of STAT3 is via sIL-6R and not mIL-6R in cancer cells

    Article Snippet: For the WB detection of pSTAT3 and/or STAT3, anti-pSTAT3 (Tyr705; 1:1000; Cell Signaling), anti-pSTAT3 (Try705; 1:1000; Calbiochem, Darmstadt, Germany; only for ), anti-pSTAT3 (Ser727; 1:1000; Cell signaling), and STAT3 (1:2000; Cell Signaling) were used.

    Techniques: Activation Assay

    Phosphorylation (activation) of STAT3 upon IL-6 treatment

    Journal: Gastroenterology

    Article Title: Interleukin 6 Alters Localization of hMSH3, Leading to DNA Mismatch Repair Defects in Colorectal Cancer Cells

    doi: 10.1053/j.gastro.2014.11.027

    Figure Lengend Snippet: Phosphorylation (activation) of STAT3 upon IL-6 treatment

    Article Snippet: For the WB detection of pSTAT3 and/or STAT3, anti-pSTAT3 (Tyr705; 1:1000; Cell Signaling), anti-pSTAT3 (Try705; 1:1000; Calbiochem, Darmstadt, Germany; only for ), anti-pSTAT3 (Ser727; 1:1000; Cell signaling), and STAT3 (1:2000; Cell Signaling) were used.

    Techniques: Activation Assay

    IL-6 induces hMSH3 shift from the nucleus to the cytoplasm through IL-6–sIL-6R-STAT3 pathway

    Journal: Gastroenterology

    Article Title: Interleukin 6 Alters Localization of hMSH3, Leading to DNA Mismatch Repair Defects in Colorectal Cancer Cells

    doi: 10.1053/j.gastro.2014.11.027

    Figure Lengend Snippet: IL-6 induces hMSH3 shift from the nucleus to the cytoplasm through IL-6–sIL-6R-STAT3 pathway

    Article Snippet: For the WB detection of pSTAT3 and/or STAT3, anti-pSTAT3 (Tyr705; 1:1000; Cell Signaling), anti-pSTAT3 (Try705; 1:1000; Calbiochem, Darmstadt, Germany; only for ), anti-pSTAT3 (Ser727; 1:1000; Cell signaling), and STAT3 (1:2000; Cell Signaling) were used.

    Techniques:

    Forced expression of constitutively-activated STAT3 (S3c) led to partial nuclear accumulation of S3c and cytosolic leakage of hMSH3

    Journal: Gastroenterology

    Article Title: Interleukin 6 Alters Localization of hMSH3, Leading to DNA Mismatch Repair Defects in Colorectal Cancer Cells

    doi: 10.1053/j.gastro.2014.11.027

    Figure Lengend Snippet: Forced expression of constitutively-activated STAT3 (S3c) led to partial nuclear accumulation of S3c and cytosolic leakage of hMSH3

    Article Snippet: For the WB detection of pSTAT3 and/or STAT3, anti-pSTAT3 (Tyr705; 1:1000; Cell Signaling), anti-pSTAT3 (Try705; 1:1000; Calbiochem, Darmstadt, Germany; only for ), anti-pSTAT3 (Ser727; 1:1000; Cell signaling), and STAT3 (1:2000; Cell Signaling) were used.

    Techniques: Expressing

    TLR2 is necessary for LIF induction and stress responses following light damage (LD). mRNA expression as measured by qRT-PCR following light damage is shown for ( A ) MT1, ( B ) IL-1b, ( C ) ATF3, ( D ) CXCL1, ( E ) Hmox1, ( F ) LIF. White bars: No LD controls, black bars: mice exposed to light damage. Y-axes are log 2 (fold change relative to TLR2 +/+ males with no LD). Statistics: Two-way ANOVA with multiple comparisons. ( A – F ) n = 11–16 mice in sex-specific groups exposed to light damage. Mice with no light damage: n = 3–6. ( G , H ) Protein expression of phosphorylated STAT3 (pSTAT3) following LD in TLR2 −/− mice and controls. Statistics: unpaired, two-tailed t-test. ( G , H ) n = 3–4 mice, representative of 3 independent experiments. Western blots were cropped. Full, uncropped versions of these blots can be found in Figs S7 and S8 .

    Journal: Scientific Reports

    Article Title: Damage-associated molecular pattern recognition is required for induction of retinal neuroprotective pathways in a sex-dependent manner

    doi: 10.1038/s41598-018-27479-x

    Figure Lengend Snippet: TLR2 is necessary for LIF induction and stress responses following light damage (LD). mRNA expression as measured by qRT-PCR following light damage is shown for ( A ) MT1, ( B ) IL-1b, ( C ) ATF3, ( D ) CXCL1, ( E ) Hmox1, ( F ) LIF. White bars: No LD controls, black bars: mice exposed to light damage. Y-axes are log 2 (fold change relative to TLR2 +/+ males with no LD). Statistics: Two-way ANOVA with multiple comparisons. ( A – F ) n = 11–16 mice in sex-specific groups exposed to light damage. Mice with no light damage: n = 3–6. ( G , H ) Protein expression of phosphorylated STAT3 (pSTAT3) following LD in TLR2 −/− mice and controls. Statistics: unpaired, two-tailed t-test. ( G , H ) n = 3–4 mice, representative of 3 independent experiments. Western blots were cropped. Full, uncropped versions of these blots can be found in Figs S7 and S8 .

    Article Snippet: Antibodies used: pSTAT3 Y705 (1:2,000 Rabbit, #9145), total STAT3 (1:2,000, Rabbit, #9132 L) (Cell Signaling Technology, Danvars, MA), and actin (Goat, ab6276, Abcam, Cambridge, UK).

    Techniques: Expressing, Quantitative RT-PCR, Mouse Assay, Two Tailed Test, Western Blot

    Western blot analyses showing phosphorylation of a STAT3 Tyr705 , b AKT Ser473 and c ERK1/2 Thr202/Tyr204 in human vascular endothelial cells treated with IL-6 alone (50 ng/ml) or in combination with sIL-6R (100 ng/ml). One representative blot containing the phosphorylated protein, total protein and β-tubulin (loading control) is shown for each pathway (left column). The signals from the phosphorylated proteins and total proteins are first normalized to β-tubulin, and the ratio of the phosphorylated proteins and the total proteins are calculated. The graphs show arbitrary units (a.u., control is set to 1) compiled from 3 independent experiments presented as mean ± SEM for each pathway (right column). * p

    Journal: Cell Communication and Signaling : CCS

    Article Title: Activation of the JAK/STAT3 and PI3K/AKT pathways are crucial for IL-6 trans-signaling-mediated pro-inflammatory response in human vascular endothelial cells

    doi: 10.1186/s12964-018-0268-4

    Figure Lengend Snippet: Western blot analyses showing phosphorylation of a STAT3 Tyr705 , b AKT Ser473 and c ERK1/2 Thr202/Tyr204 in human vascular endothelial cells treated with IL-6 alone (50 ng/ml) or in combination with sIL-6R (100 ng/ml). One representative blot containing the phosphorylated protein, total protein and β-tubulin (loading control) is shown for each pathway (left column). The signals from the phosphorylated proteins and total proteins are first normalized to β-tubulin, and the ratio of the phosphorylated proteins and the total proteins are calculated. The graphs show arbitrary units (a.u., control is set to 1) compiled from 3 independent experiments presented as mean ± SEM for each pathway (right column). * p

    Article Snippet: For detecting signaling proteins, membranes were incubated with the following primary antibodies: anti-phospho-Stat3Tyr705 antibody (Cell Signaling Technology, USA, #9131; 1:1000 dilution), anti-phospho-AKTSer473 antibody (Cell Signaling Technology, USA, #4060; 1:2000 dilution), anti-phospho-ERK1/2 antibody (Cell Signaling Technology, USA, #9106; 1:2000 dilution), anti-STAT3 antibody (Cell Signaling Technology, USA, #4904; 1:2000 dilution), anti-AKT antibody (Cell Signaling Technology, USA, #2920; 1:2000 dilution), anti-ERK1/2 antibody (Cell Signaling Technology, USA, #4695; 1:1000 dilution), anti-phospho IκBαSer32 antibody (Cell Signaling Technology, USA, #2859; 1:1000 dilution), anti-phospho-NFκB p65Ser536 antibody (Cell Signaling Technology, USA, #3033; 1:1000 dilution), anti-NFκB p65 antibody (Cell Signaling Technology, USA, #6956; 1:1000 dilution), anti-IκBα antibody (Santa Cruz Biotechnology, USA, SC-371; 1:750 dilution), anti-p52 antibody (Millipore, USA, #05–361; 1:1000 dilution), and anti-β-Tubulin antibody (Millipore, USA, #05–661; 1:2000 dilution).

    Techniques: Western Blot

    Effects of rh-TSG-6 and TSG-6 siRNA treatments on SOCS3/STAT3 axis. a Effect of exogenous TSG-6 on STAT3 pathway expression was evaluated by western blot and the relative IL-6, IL-10, SOCS3, p-STAT3, and STAT3 densities were quantificationally evaluated. b The representative western blot analysis of STAT3 axis in SAH rats accepted intracerebroventricular injection of siRNA as indicated and quantification of the level of IL-6, IL-10, SOCS3, p-STAT3 and STAT3 after deficiency of TSG-6. Data are expressed as the mean ± SD from six rats. ** P

    Journal: Journal of Neuroinflammation

    Article Title: TSG-6 attenuates inflammation-induced brain injury via modulation of microglial polarization in SAH rats through the SOCS3/STAT3 pathway

    doi: 10.1186/s12974-018-1279-1

    Figure Lengend Snippet: Effects of rh-TSG-6 and TSG-6 siRNA treatments on SOCS3/STAT3 axis. a Effect of exogenous TSG-6 on STAT3 pathway expression was evaluated by western blot and the relative IL-6, IL-10, SOCS3, p-STAT3, and STAT3 densities were quantificationally evaluated. b The representative western blot analysis of STAT3 axis in SAH rats accepted intracerebroventricular injection of siRNA as indicated and quantification of the level of IL-6, IL-10, SOCS3, p-STAT3 and STAT3 after deficiency of TSG-6. Data are expressed as the mean ± SD from six rats. ** P

    Article Snippet: The following primary antibodies were used for WB: mouse anti-TSG-6 (Santa Cruz Biotechnology; 1:800), rabbit anti-STAT3 (Cell Signaling Technology; 1:2000), rabbit anti-phosphorylated STAT3 at Tyr705 (Cell Signaling Technology; 1:1000), rabbit anti-SOCS3 (Abcam; 1:1000), mouse anti-CD163 (AbD Serotec; 1:500), rabbit anti-CD86 (ProteinTech; 1:600), rabbit anti-IL-6 (PeproTech; 1:800), rabbit anti-IL-10 (ProteinTech; 1:600), and rabbit anti-β-actin (Cell Signaling Technology; 1:1000).

    Techniques: Expressing, Western Blot, Injection

    The effects of rh-TSG-6 on phosphorylation of Stat3 and cellular location of p-STAT3. The phosphorylation of STAT3 was assessed by immunofluorescent double-labeling. Immunoreactivity for p-STAT3 is attenuated at 24 h in the SAH + rh-TSG-6 group, as compared with the SAH + vehicle group. TSG-6 deficiency increased the expression of p-STAT3 and more translocation from the cytosol to the nucleus occurs was observed. Scale bar = 20 μm

    Journal: Journal of Neuroinflammation

    Article Title: TSG-6 attenuates inflammation-induced brain injury via modulation of microglial polarization in SAH rats through the SOCS3/STAT3 pathway

    doi: 10.1186/s12974-018-1279-1

    Figure Lengend Snippet: The effects of rh-TSG-6 on phosphorylation of Stat3 and cellular location of p-STAT3. The phosphorylation of STAT3 was assessed by immunofluorescent double-labeling. Immunoreactivity for p-STAT3 is attenuated at 24 h in the SAH + rh-TSG-6 group, as compared with the SAH + vehicle group. TSG-6 deficiency increased the expression of p-STAT3 and more translocation from the cytosol to the nucleus occurs was observed. Scale bar = 20 μm

    Article Snippet: The following primary antibodies were used for WB: mouse anti-TSG-6 (Santa Cruz Biotechnology; 1:800), rabbit anti-STAT3 (Cell Signaling Technology; 1:2000), rabbit anti-phosphorylated STAT3 at Tyr705 (Cell Signaling Technology; 1:1000), rabbit anti-SOCS3 (Abcam; 1:1000), mouse anti-CD163 (AbD Serotec; 1:500), rabbit anti-CD86 (ProteinTech; 1:600), rabbit anti-IL-6 (PeproTech; 1:800), rabbit anti-IL-10 (ProteinTech; 1:600), and rabbit anti-β-actin (Cell Signaling Technology; 1:1000).

    Techniques: Labeling, Expressing, Translocation Assay

    STAT3 is a potential transcriptional regulator in the promoter of the mouse Mn-SOD gene. A , Schematic diagram for putative STAT3 binding sites in the promoter of the mouse Mn-SOD gene. B , Transcriptional activity of the mouse Mn-SOD gene was determined

    Journal:

    Article Title: Regulation of Mn-SOD Activity and Neuroprotection by STAT3 in Mice after Cerebral Ischemia

    doi: 10.1523/JNEUROSCI.1110-09.2009

    Figure Lengend Snippet: STAT3 is a potential transcriptional regulator in the promoter of the mouse Mn-SOD gene. A , Schematic diagram for putative STAT3 binding sites in the promoter of the mouse Mn-SOD gene. B , Transcriptional activity of the mouse Mn-SOD gene was determined

    Article Snippet: It is well known that phosphorylation of STAT3 at Tyr-705 is more important than phosphorylation of STAT3 at Ser-727 for the dimerization and translocation of STAT3 and its role as a transcription factor.

    Techniques: Binding Assay, Activity Assay

    STAT3 is an up-stream regulator of Mn-SOD in mouse brains and Mn-SOD is a direct target of STAT3 in reperfusion-induced cell death. A , Protein nitrosylation was quantified from Western blots using a 3-nitrotyrosine antibody. The protein level of Mn-SOD

    Journal:

    Article Title: Regulation of Mn-SOD Activity and Neuroprotection by STAT3 in Mice after Cerebral Ischemia

    doi: 10.1523/JNEUROSCI.1110-09.2009

    Figure Lengend Snippet: STAT3 is an up-stream regulator of Mn-SOD in mouse brains and Mn-SOD is a direct target of STAT3 in reperfusion-induced cell death. A , Protein nitrosylation was quantified from Western blots using a 3-nitrotyrosine antibody. The protein level of Mn-SOD

    Article Snippet: It is well known that phosphorylation of STAT3 at Tyr-705 is more important than phosphorylation of STAT3 at Ser-727 for the dimerization and translocation of STAT3 and its role as a transcription factor.

    Techniques: Western Blot

    Inhibition of STAT3 by ischemic reperfusion increases generation of O 2 •− . A , ROS production shown by HEt (red) and 4′,6 diamidino-2-phenylindole (DAPI, blue) staining of ischemic regions (cortex) on the contralateral and ipsilateral

    Journal:

    Article Title: Regulation of Mn-SOD Activity and Neuroprotection by STAT3 in Mice after Cerebral Ischemia

    doi: 10.1523/JNEUROSCI.1110-09.2009

    Figure Lengend Snippet: Inhibition of STAT3 by ischemic reperfusion increases generation of O 2 •− . A , ROS production shown by HEt (red) and 4′,6 diamidino-2-phenylindole (DAPI, blue) staining of ischemic regions (cortex) on the contralateral and ipsilateral

    Article Snippet: It is well known that phosphorylation of STAT3 at Tyr-705 is more important than phosphorylation of STAT3 at Ser-727 for the dimerization and translocation of STAT3 and its role as a transcription factor.

    Techniques: Inhibition, Staining

    Inhibition of STAT3 by ischemic reperfusion enhances brain damage and neuronal cell death. A , The vehicle (50% DMSO in PBS) and AG490 (10 nmol in 50% DMSO in PBS) were injected i.c.v. before 1 h onset of 45 min of MCAO. The animals were sacrificed after

    Journal:

    Article Title: Regulation of Mn-SOD Activity and Neuroprotection by STAT3 in Mice after Cerebral Ischemia

    doi: 10.1523/JNEUROSCI.1110-09.2009

    Figure Lengend Snippet: Inhibition of STAT3 by ischemic reperfusion enhances brain damage and neuronal cell death. A , The vehicle (50% DMSO in PBS) and AG490 (10 nmol in 50% DMSO in PBS) were injected i.c.v. before 1 h onset of 45 min of MCAO. The animals were sacrificed after

    Article Snippet: It is well known that phosphorylation of STAT3 at Tyr-705 is more important than phosphorylation of STAT3 at Ser-727 for the dimerization and translocation of STAT3 and its role as a transcription factor.

    Techniques: Inhibition, Injection

    STAT3 is significantly downregulated by ischemic reperfusion in a mouse MCAO model. Whole cell protein extracts were obtained from the cerebral cortex and caudate putamen (except the hippocampus) of male mouse brains after 1, 3, 6, and 12 h of reperfusion

    Journal:

    Article Title: Regulation of Mn-SOD Activity and Neuroprotection by STAT3 in Mice after Cerebral Ischemia

    doi: 10.1523/JNEUROSCI.1110-09.2009

    Figure Lengend Snippet: STAT3 is significantly downregulated by ischemic reperfusion in a mouse MCAO model. Whole cell protein extracts were obtained from the cerebral cortex and caudate putamen (except the hippocampus) of male mouse brains after 1, 3, 6, and 12 h of reperfusion

    Article Snippet: It is well known that phosphorylation of STAT3 at Tyr-705 is more important than phosphorylation of STAT3 at Ser-727 for the dimerization and translocation of STAT3 and its role as a transcription factor.

    Techniques:

    Inhibition of STAT3 reduces Mn-SOD expression in mouse brains and cortical neurons. A , The protein levels of Mn-SOD, total STAT3, and phospho-STAT3 (Y705) in the cerebral cortex and caudate putamen (except the hippocampus) of male mouse brains injected

    Journal:

    Article Title: Regulation of Mn-SOD Activity and Neuroprotection by STAT3 in Mice after Cerebral Ischemia

    doi: 10.1523/JNEUROSCI.1110-09.2009

    Figure Lengend Snippet: Inhibition of STAT3 reduces Mn-SOD expression in mouse brains and cortical neurons. A , The protein levels of Mn-SOD, total STAT3, and phospho-STAT3 (Y705) in the cerebral cortex and caudate putamen (except the hippocampus) of male mouse brains injected

    Article Snippet: It is well known that phosphorylation of STAT3 at Tyr-705 is more important than phosphorylation of STAT3 at Ser-727 for the dimerization and translocation of STAT3 and its role as a transcription factor.

    Techniques: Inhibition, Expressing, Injection

    Recruitment of STAT3 into the promoter of the mouse Mn-SOD gene is diminished by ischemic reperfusion. A , B , Recruitment of STAT3 into the promoter of the mouse Mn-SOD gene in chromatin from sham-operated mouse cortices or from mouse cortices subjected

    Journal:

    Article Title: Regulation of Mn-SOD Activity and Neuroprotection by STAT3 in Mice after Cerebral Ischemia

    doi: 10.1523/JNEUROSCI.1110-09.2009

    Figure Lengend Snippet: Recruitment of STAT3 into the promoter of the mouse Mn-SOD gene is diminished by ischemic reperfusion. A , B , Recruitment of STAT3 into the promoter of the mouse Mn-SOD gene in chromatin from sham-operated mouse cortices or from mouse cortices subjected

    Article Snippet: It is well known that phosphorylation of STAT3 at Tyr-705 is more important than phosphorylation of STAT3 at Ser-727 for the dimerization and translocation of STAT3 and its role as a transcription factor.

    Techniques:

    Active STAT3 binds on the putative motifs in the Mn-SOD promoter and its binding is blocked by ischemic reperfusion. A , Activity of STAT3 binding to DNA in the Mn-SOD promoter was determined by EMSA analysis using nuclear extracts from sham-operated mouse

    Journal:

    Article Title: Regulation of Mn-SOD Activity and Neuroprotection by STAT3 in Mice after Cerebral Ischemia

    doi: 10.1523/JNEUROSCI.1110-09.2009

    Figure Lengend Snippet: Active STAT3 binds on the putative motifs in the Mn-SOD promoter and its binding is blocked by ischemic reperfusion. A , Activity of STAT3 binding to DNA in the Mn-SOD promoter was determined by EMSA analysis using nuclear extracts from sham-operated mouse

    Article Snippet: It is well known that phosphorylation of STAT3 at Tyr-705 is more important than phosphorylation of STAT3 at Ser-727 for the dimerization and translocation of STAT3 and its role as a transcription factor.

    Techniques: Binding Assay, Activity Assay

    Inhibition of STAT3 by ischemic reperfusion induces mitochondrial-dependent apoptosis in mouse brains. A , Evaluation of the amount of released cytochrome c from mitochondria in the cytosolic fraction of primary cortical neurons with or without 50 µM

    Journal:

    Article Title: Regulation of Mn-SOD Activity and Neuroprotection by STAT3 in Mice after Cerebral Ischemia

    doi: 10.1523/JNEUROSCI.1110-09.2009

    Figure Lengend Snippet: Inhibition of STAT3 by ischemic reperfusion induces mitochondrial-dependent apoptosis in mouse brains. A , Evaluation of the amount of released cytochrome c from mitochondria in the cytosolic fraction of primary cortical neurons with or without 50 µM

    Article Snippet: It is well known that phosphorylation of STAT3 at Tyr-705 is more important than phosphorylation of STAT3 at Ser-727 for the dimerization and translocation of STAT3 and its role as a transcription factor.

    Techniques: Inhibition

    Knockdown of cyclin D1, CDK4, or Rb disrupts Stat3 and C/EBPβ binding and simultaneously induces C/EBPα binding to the miR-21 and miR-181b promoters in sepsis Gr1 + CD11b + MDSCs Gr1 + CD11b + cells were isolated from the bone marrow of late septic mice and transfected with cyclin D1-, CDK4-, Rb-specific or control siRNA for 36 hr. ( A ) Knockdown of cyclin D1 or CDK4 inhibits Rb phosphorylation. Levels of Rb and p-Rb in cell lysate were determined by immunoblot. Cells were fixed, lyzed, and chromatin immunoprecipitation (ChIP) was performed with antibody specific to p-Stat3, C/EBPβ or C/EBPα, as described in Fig. 2 . ( B and D ) the recovered, ChIP DNA was amplified by semi-quantitative PCR using primers that flank the Stat3 and C/EBP binding sites in the miR-21 and miR-181b promoters. An IgG-immunoprecipitated samples is shown as a negative control. The results are representative of three experiments. ( C and E ) the recovered DNA was amplified by real-time PCR. Samples values were normalized to the “input” DNA values and are presented as fold enrichment relative to the IgG-immunoprecipitated samples (set at 1-fold). Data are expressed as mean ± s.d. of three experiments. (F) Levels of c-Myc protein after the Rb knockdown in sepsis Gr1 + CD11b + cells isolated from the bone marrow. The results are representative of two experiments.

    Journal: Immunology and cell biology

    Article Title: Stat3 and C/EBPβ synergize to induce miR-21 and miR-181b expression during sepsis

    doi: 10.1038/icb.2016.63

    Figure Lengend Snippet: Knockdown of cyclin D1, CDK4, or Rb disrupts Stat3 and C/EBPβ binding and simultaneously induces C/EBPα binding to the miR-21 and miR-181b promoters in sepsis Gr1 + CD11b + MDSCs Gr1 + CD11b + cells were isolated from the bone marrow of late septic mice and transfected with cyclin D1-, CDK4-, Rb-specific or control siRNA for 36 hr. ( A ) Knockdown of cyclin D1 or CDK4 inhibits Rb phosphorylation. Levels of Rb and p-Rb in cell lysate were determined by immunoblot. Cells were fixed, lyzed, and chromatin immunoprecipitation (ChIP) was performed with antibody specific to p-Stat3, C/EBPβ or C/EBPα, as described in Fig. 2 . ( B and D ) the recovered, ChIP DNA was amplified by semi-quantitative PCR using primers that flank the Stat3 and C/EBP binding sites in the miR-21 and miR-181b promoters. An IgG-immunoprecipitated samples is shown as a negative control. The results are representative of three experiments. ( C and E ) the recovered DNA was amplified by real-time PCR. Samples values were normalized to the “input” DNA values and are presented as fold enrichment relative to the IgG-immunoprecipitated samples (set at 1-fold). Data are expressed as mean ± s.d. of three experiments. (F) Levels of c-Myc protein after the Rb knockdown in sepsis Gr1 + CD11b + cells isolated from the bone marrow. The results are representative of two experiments.

    Article Snippet: The remaining chromatin solution was immunoprecipitated overnight at 4°C with protein G magnetic beads and 3 μg of antibody specific to p-Stat3, C/EBPα, C/EBPβ, p-Rb, or isotype control antibody (Santa Cruz Biotechnology).

    Techniques: Binding Assay, Isolation, Mouse Assay, Transfection, Chromatin Immunoprecipitation, Amplification, Real-time Polymerase Chain Reaction, Immunoprecipitation, Negative Control

    A diagram depicting transcription regulation of miR-21 and miR-181b promoters in Gr1 + CD11b + cells Under normal conditions (i.e., steady-state myelopoiesis), Rb protein is de-phosphorylated via cyclin-dependent kinase (cdk) inhibitor p21-dependent feedback mechanism and thus cannot interact with the C/EBPα protein, allowing it to bind and inactivate the miR-21 and miR-181b promoters. During sepsis, Rb is phosphorylated by a cyclin D1-cdk4 protein complex and interacts with and displaces the C/EBPα protein, thus allowing the Stat3 and C/EBPβ proteins to bind and activate the miR-21 and miR-181b promoters. This differential regulatory pathway requires an IL-6-mediated signal.

    Journal: Immunology and cell biology

    Article Title: Stat3 and C/EBPβ synergize to induce miR-21 and miR-181b expression during sepsis

    doi: 10.1038/icb.2016.63

    Figure Lengend Snippet: A diagram depicting transcription regulation of miR-21 and miR-181b promoters in Gr1 + CD11b + cells Under normal conditions (i.e., steady-state myelopoiesis), Rb protein is de-phosphorylated via cyclin-dependent kinase (cdk) inhibitor p21-dependent feedback mechanism and thus cannot interact with the C/EBPα protein, allowing it to bind and inactivate the miR-21 and miR-181b promoters. During sepsis, Rb is phosphorylated by a cyclin D1-cdk4 protein complex and interacts with and displaces the C/EBPα protein, thus allowing the Stat3 and C/EBPβ proteins to bind and activate the miR-21 and miR-181b promoters. This differential regulatory pathway requires an IL-6-mediated signal.

    Article Snippet: The remaining chromatin solution was immunoprecipitated overnight at 4°C with protein G magnetic beads and 3 μg of antibody specific to p-Stat3, C/EBPα, C/EBPβ, p-Rb, or isotype control antibody (Santa Cruz Biotechnology).

    Techniques:

    Stat3 and C/EBPβ, but not C/EBPα, bind to miR-21 and miR-181 promoter in sepsis Gr1 + CD11b + MDSCs ( A ) Protein binding in total Gr1 + CD11b + cell population. Gr1 + CD11b + cells were isolated and pooled (n = 6 mice per group) from the bone marrow of sham and septic mice. Cells were fixed in 1% formaldehyde to cross-link protein-DNA complexes. Cells were lyzed and the pelleted nuclei were digested with chromatin shearing enzymatic cocktail. The chromatin solution was then immunoprecipitated with antibodies specific to p-Stat3 (Tyr 705 ), C/EBPβ, C/EBPα, p-Rb (Ser 780 ), or IgG isotype control antibody. Next, chromatin cross-links were reversed to recover the protein-bound DNA. The purified DNA was amplified by qPCR to measure the level of enrichment of miR-21 and miR-181b sequences in the immunoprecipitated complexes using promoter-specific primer/probe sets. PCR reactions were performed in triplicate. Samples were normalized to the “input” DNA (i.e., DNA isolated before immunoprecipitation) and are presented as fold enrichment relative to the IgG-immunoprecipitated samples (set at 1-fold). Data are expressed as mean ± s.d. (* p ≤ 0.05) of three experiments. *, compare with early sepsis. ( B ) Stat3 and C/EBPβ binding to the miR-21 and miR-181 promoters in Gr1 + CD11b + MDSCs is restriced to the CD31 + subset. The CD31 + cell were then purified from the total Gr1 + CD11b + cell population by positive selection. Cells were treated, and chromatin was immunoprecipitated as described above. PCR was performed to measure the levels of the miR-21 and miR-181b promoter DNA sequence enrichment in chromatin immunoprecipitated from the CD31 + -enriched Gr1 + CD11b + cells from the bone marrow and spleens. Data are expressed as mean ± s.d. of three experiment s .

    Journal: Immunology and cell biology

    Article Title: Stat3 and C/EBPβ synergize to induce miR-21 and miR-181b expression during sepsis

    doi: 10.1038/icb.2016.63

    Figure Lengend Snippet: Stat3 and C/EBPβ, but not C/EBPα, bind to miR-21 and miR-181 promoter in sepsis Gr1 + CD11b + MDSCs ( A ) Protein binding in total Gr1 + CD11b + cell population. Gr1 + CD11b + cells were isolated and pooled (n = 6 mice per group) from the bone marrow of sham and septic mice. Cells were fixed in 1% formaldehyde to cross-link protein-DNA complexes. Cells were lyzed and the pelleted nuclei were digested with chromatin shearing enzymatic cocktail. The chromatin solution was then immunoprecipitated with antibodies specific to p-Stat3 (Tyr 705 ), C/EBPβ, C/EBPα, p-Rb (Ser 780 ), or IgG isotype control antibody. Next, chromatin cross-links were reversed to recover the protein-bound DNA. The purified DNA was amplified by qPCR to measure the level of enrichment of miR-21 and miR-181b sequences in the immunoprecipitated complexes using promoter-specific primer/probe sets. PCR reactions were performed in triplicate. Samples were normalized to the “input” DNA (i.e., DNA isolated before immunoprecipitation) and are presented as fold enrichment relative to the IgG-immunoprecipitated samples (set at 1-fold). Data are expressed as mean ± s.d. (* p ≤ 0.05) of three experiments. *, compare with early sepsis. ( B ) Stat3 and C/EBPβ binding to the miR-21 and miR-181 promoters in Gr1 + CD11b + MDSCs is restriced to the CD31 + subset. The CD31 + cell were then purified from the total Gr1 + CD11b + cell population by positive selection. Cells were treated, and chromatin was immunoprecipitated as described above. PCR was performed to measure the levels of the miR-21 and miR-181b promoter DNA sequence enrichment in chromatin immunoprecipitated from the CD31 + -enriched Gr1 + CD11b + cells from the bone marrow and spleens. Data are expressed as mean ± s.d. of three experiment s .

    Article Snippet: The remaining chromatin solution was immunoprecipitated overnight at 4°C with protein G magnetic beads and 3 μg of antibody specific to p-Stat3, C/EBPα, C/EBPβ, p-Rb, or isotype control antibody (Santa Cruz Biotechnology).

    Techniques: Protein Binding, Isolation, Mouse Assay, Immunoprecipitation, Purification, Amplification, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Binding Assay, Selection, Sequencing

    Electrophoretic mobility shift assay of Stat3 and C/EBPβ binding specificity to the miR-21 and miR-181b promoters EMSA was performed to determine the Stat3 and C/EBPβ binding specificity to the miR-21 and miR-181b promoters. Nuclear proteins were isolated from CD31 + cells purified from the bone marrow Gr1 + CD11b + cells from late septic mice. Protein extract was incubated with biotin-labeled double-stranded DNA oligos containing the Stat3 or C/EBP binding sites in the miR-21 and miR-181b promoters. The protein-DNA complexes were then electrophoresed on 6% native polyacrylamide gel, immunoblotted, and the DNA was visualized with streptavidin-conjugated antibody and chemiluminescent reagent. ( A ) Stat3 and C/EBPβ binding to miR-21 promoter. In lane 3, 3 μg of antibody specific to p-Stat3 or C/EBPβ was incubated with the nuclear protein for 5 min before the addition of the labeled DNA probe. In lanes 5 and 6, 200-fold excess of unlabeled wild-type or mutated probe, respectively, was used as a competitor to confirm the binding specificity. Results are representative of three experiments. ( B ) Stat3 and C/EBPβ binding to miR-181b promoter. The short arrow with an asterisk indicates a non-specific band, which migrated at the same rate as the supershifted complex. The results are representative of two experiments.

    Journal: Immunology and cell biology

    Article Title: Stat3 and C/EBPβ synergize to induce miR-21 and miR-181b expression during sepsis

    doi: 10.1038/icb.2016.63

    Figure Lengend Snippet: Electrophoretic mobility shift assay of Stat3 and C/EBPβ binding specificity to the miR-21 and miR-181b promoters EMSA was performed to determine the Stat3 and C/EBPβ binding specificity to the miR-21 and miR-181b promoters. Nuclear proteins were isolated from CD31 + cells purified from the bone marrow Gr1 + CD11b + cells from late septic mice. Protein extract was incubated with biotin-labeled double-stranded DNA oligos containing the Stat3 or C/EBP binding sites in the miR-21 and miR-181b promoters. The protein-DNA complexes were then electrophoresed on 6% native polyacrylamide gel, immunoblotted, and the DNA was visualized with streptavidin-conjugated antibody and chemiluminescent reagent. ( A ) Stat3 and C/EBPβ binding to miR-21 promoter. In lane 3, 3 μg of antibody specific to p-Stat3 or C/EBPβ was incubated with the nuclear protein for 5 min before the addition of the labeled DNA probe. In lanes 5 and 6, 200-fold excess of unlabeled wild-type or mutated probe, respectively, was used as a competitor to confirm the binding specificity. Results are representative of three experiments. ( B ) Stat3 and C/EBPβ binding to miR-181b promoter. The short arrow with an asterisk indicates a non-specific band, which migrated at the same rate as the supershifted complex. The results are representative of two experiments.

    Article Snippet: The remaining chromatin solution was immunoprecipitated overnight at 4°C with protein G magnetic beads and 3 μg of antibody specific to p-Stat3, C/EBPα, C/EBPβ, p-Rb, or isotype control antibody (Santa Cruz Biotechnology).

    Techniques: Electrophoretic Mobility Shift Assay, Binding Assay, Isolation, Purification, Mouse Assay, Incubation, Labeling

    Rb is phosphorylated by cyclin D1-CDK4 protein complex in sepsis Gr1 + CD11b + cells and binds to C/EBPα, whereas p-Stat3 binds to C/EBPβ (A) Gr1 + CD11b + cells were isolated from the bone marrow of sham and septic mice and levels of Rb and p-Rb proteins were determined by immunoblot. ( B and C ) Knockdown of cyclin D1 or CDK4 inhibits Rb phosphorylation. CD31 + cells were purified from total Gr1 + CD11b + MDSCs isolated from the bone marrow of late septic mice. Cells were transfected with cyclin D1-, CDK4-specific or control siRNA. After 36 hr, cells were harvested and cell lysates were prepared for immunoblot. ( B ) Levels of the cyclin D1 and CDK4 proteins after the knockdown. Lower panel shows densitometry of the cyclin D1 and CDK4 protein bands. Sample values were normalized to β-actin levels. ( C ) levels of p-Stat3, C/EPBβ, C/EBPα, and p-Rb proteins after cyclin D1 or CDK4 knockdown. The results are representative of three experiments. ( D ) Co-immunoprecipitation analysis of protein binding to Rb. Bone marrow Gr1 + CD11b + cell lysates were prepared and immunoprecipitated with Rb-specific or IgG isotype control antibody using protein G-agarose beads. The immunoprecipitated protein complexes were resolved on denaturing polyacrylamide gel and then immunoblotted with specific antibody against Rb, p-Rb (Ser 780 ), p-Stat3 (Tyr 705 ), C/EBPβ or C/EBPα. ( E ) Co-immunoprecipitation analysis of protein binding to Stat3. Cell lysates were immunoprecipitated with Stat3-specific antibody and immunoblotted as in D . The results are representative of three experiments. ( F ) Protein levels in the crude (input) extract before the immunoprecipitation. The results are representative of two experiments.

    Journal: Immunology and cell biology

    Article Title: Stat3 and C/EBPβ synergize to induce miR-21 and miR-181b expression during sepsis

    doi: 10.1038/icb.2016.63

    Figure Lengend Snippet: Rb is phosphorylated by cyclin D1-CDK4 protein complex in sepsis Gr1 + CD11b + cells and binds to C/EBPα, whereas p-Stat3 binds to C/EBPβ (A) Gr1 + CD11b + cells were isolated from the bone marrow of sham and septic mice and levels of Rb and p-Rb proteins were determined by immunoblot. ( B and C ) Knockdown of cyclin D1 or CDK4 inhibits Rb phosphorylation. CD31 + cells were purified from total Gr1 + CD11b + MDSCs isolated from the bone marrow of late septic mice. Cells were transfected with cyclin D1-, CDK4-specific or control siRNA. After 36 hr, cells were harvested and cell lysates were prepared for immunoblot. ( B ) Levels of the cyclin D1 and CDK4 proteins after the knockdown. Lower panel shows densitometry of the cyclin D1 and CDK4 protein bands. Sample values were normalized to β-actin levels. ( C ) levels of p-Stat3, C/EPBβ, C/EBPα, and p-Rb proteins after cyclin D1 or CDK4 knockdown. The results are representative of three experiments. ( D ) Co-immunoprecipitation analysis of protein binding to Rb. Bone marrow Gr1 + CD11b + cell lysates were prepared and immunoprecipitated with Rb-specific or IgG isotype control antibody using protein G-agarose beads. The immunoprecipitated protein complexes were resolved on denaturing polyacrylamide gel and then immunoblotted with specific antibody against Rb, p-Rb (Ser 780 ), p-Stat3 (Tyr 705 ), C/EBPβ or C/EBPα. ( E ) Co-immunoprecipitation analysis of protein binding to Stat3. Cell lysates were immunoprecipitated with Stat3-specific antibody and immunoblotted as in D . The results are representative of three experiments. ( F ) Protein levels in the crude (input) extract before the immunoprecipitation. The results are representative of two experiments.

    Article Snippet: The remaining chromatin solution was immunoprecipitated overnight at 4°C with protein G magnetic beads and 3 μg of antibody specific to p-Stat3, C/EBPα, C/EBPβ, p-Rb, or isotype control antibody (Santa Cruz Biotechnology).

    Techniques: Isolation, Mouse Assay, Purification, Transfection, Immunoprecipitation, Protein Binding

    The Stat3 and C/EBP binding sites from miR-21 or miR-181b promoters enhance reporter gene expression ( A ) Gr1 + CD11b + cells were isolated from the bone marrow of naive mice. Cells were transfected with a renilla luciferase plasmid plus a luciferase plasmid containing native or mutated Stat3 and C/EBP binding sites. Cells were incubated for 24 hr without or with 10 ng/ml of recombinant mouse IL-6. Transfection with a luciferase plasmid that contains the CMV promoter only served as a control for maximum luciferase activity. Transfection with a luciferase plasmid that contains the miniCMV enhancer only (no inserts) served as a positive control. Luciferase values were normalized to renilla luciferase and are presented relative to the positive control (set at 100%). Data are expressed as mean ± s.d. (* p ≤ 0.05) of three experiments. *, compare with positive control; **, compare with Stat3 wt + Cebp wt site construct. ( B ) Rb knockdown in sepsis Gr1 + CD11b + MDSCs diminishes the reporter gene expression that is induced by the Stat3 and C/EBP binding sequences. Gr1 + CD11b + cells were isolated from the bone marrow of late septic mice. Cells were first transfected with pools of control or Rb-specific siRNA for 24 hr. Cells were then washed, transfected with luciferase plasmids containing the Stat3 and C/EBP binding sites from the miR promoters, and treated as described in A . Cells were incubated for 24 hr without or with 10 ng/ml of mouse rIL-6. Data are expressed as mean ± s.d. )* p ≤ 0.05) of three experiments and are presented relative to the positive control, which contains no Stat3 or C/EBP binding sites. *, compare with positive control; **, compare with Rb siRNA. ( C ) IL-6 induces phosphorylation of Stat3 and Rb proteins during sepsis. Gr1 + CD11b + cells were isolated from the bone marrow of late septic mice and stimulated with IL-6. Levels of p-Stat3 and p-Rb were determined by immunoblot. The results are representative of two experiments.

    Journal: Immunology and cell biology

    Article Title: Stat3 and C/EBPβ synergize to induce miR-21 and miR-181b expression during sepsis

    doi: 10.1038/icb.2016.63

    Figure Lengend Snippet: The Stat3 and C/EBP binding sites from miR-21 or miR-181b promoters enhance reporter gene expression ( A ) Gr1 + CD11b + cells were isolated from the bone marrow of naive mice. Cells were transfected with a renilla luciferase plasmid plus a luciferase plasmid containing native or mutated Stat3 and C/EBP binding sites. Cells were incubated for 24 hr without or with 10 ng/ml of recombinant mouse IL-6. Transfection with a luciferase plasmid that contains the CMV promoter only served as a control for maximum luciferase activity. Transfection with a luciferase plasmid that contains the miniCMV enhancer only (no inserts) served as a positive control. Luciferase values were normalized to renilla luciferase and are presented relative to the positive control (set at 100%). Data are expressed as mean ± s.d. (* p ≤ 0.05) of three experiments. *, compare with positive control; **, compare with Stat3 wt + Cebp wt site construct. ( B ) Rb knockdown in sepsis Gr1 + CD11b + MDSCs diminishes the reporter gene expression that is induced by the Stat3 and C/EBP binding sequences. Gr1 + CD11b + cells were isolated from the bone marrow of late septic mice. Cells were first transfected with pools of control or Rb-specific siRNA for 24 hr. Cells were then washed, transfected with luciferase plasmids containing the Stat3 and C/EBP binding sites from the miR promoters, and treated as described in A . Cells were incubated for 24 hr without or with 10 ng/ml of mouse rIL-6. Data are expressed as mean ± s.d. )* p ≤ 0.05) of three experiments and are presented relative to the positive control, which contains no Stat3 or C/EBP binding sites. *, compare with positive control; **, compare with Rb siRNA. ( C ) IL-6 induces phosphorylation of Stat3 and Rb proteins during sepsis. Gr1 + CD11b + cells were isolated from the bone marrow of late septic mice and stimulated with IL-6. Levels of p-Stat3 and p-Rb were determined by immunoblot. The results are representative of two experiments.

    Article Snippet: The remaining chromatin solution was immunoprecipitated overnight at 4°C with protein G magnetic beads and 3 μg of antibody specific to p-Stat3, C/EBPα, C/EBPβ, p-Rb, or isotype control antibody (Santa Cruz Biotechnology).

    Techniques: Binding Assay, Expressing, Isolation, Mouse Assay, Transfection, Luciferase, Plasmid Preparation, Incubation, Recombinant, Activity Assay, Positive Control, Construct

    Stat3 and C/EBPβ activate miR-21 and miR-181b expression in sepsis Gr1 + CD11b + MDSCs Sepsis was induced by cecal ligation and puncture (CLP). ( A and B ) Bone marrow cells were harvested from septic mice that were moribund and sacrificed at days 1–5 (representing early sepsis) and at days 6–28 (representing late sepsis) as well as sham mice. Gr1 + CD11b + cells were then purified using magnetic beads and pooled from 6 mice per group. Cell lysates were prepared and levels of total and phosphorylated (p-Stat3; Tyr 705 ) Stat3 (A), and C/EBPβ proteins (B) were determined by immunoblot. The results are representative of two experiments. Lower panel in A shows densitometry of the p-Stat3 bands. Values were normalized to β-actin and are presented relative to sham, which is set at 1-fold. ( C ) Knockdown of Stat3 or C/EBPβ in sepsis MDSCs inhibits miR-21 and miR-181b expression. Gr1 + CD11b + cells were isolated from the bone marrow of late septic mice, pooled (n = 6 mice per group), and transfected with Stat3-specific, C/EBPβ-specific, or control siRNA. After 36 hr in culture, cells were harvested and levels of miR-21 and miR-181 were determined by northern blot. Levels of the U6 RNA were also measured as an internal control. The knockdown was confirmed by western blotting (not shown). ( D ) Phosphorylation of Stat3 in the bone marrow during sepsis is restricted to the Gr1 + CD11b + MDSCs. CD3 + T cells were isolated from whole bone marrow cells by positive selection using anti-CD3 magnetic beads. To isolate CD19 + cells, whole bone marrow cells from late septic mice were first depleted of Gr1 − CD11b + cells (which mostly consists of CD19 + and CD11c + cells). CD19 + cells were then positively selected from the depleted cell population using anti-CD19 magnetic beads. The results are representative of two immunoblots using two different cell preparations. ( E ) A schematic diagram depicting the Stat3 and C/EBPβ binding sites in the miR-21 and miR-181b promoters. ( F ) The miR-21 and miR-181b promoter fragments used in the luciferase gene constructs (see Fig. 6 ). The Stat3 and C/EBP binding sites are underlined. The core nucleotides of the consensus binding sites are bolded. Lower case letters indicate the mutation introduced in the binding site.

    Journal: Immunology and cell biology

    Article Title: Stat3 and C/EBPβ synergize to induce miR-21 and miR-181b expression during sepsis

    doi: 10.1038/icb.2016.63

    Figure Lengend Snippet: Stat3 and C/EBPβ activate miR-21 and miR-181b expression in sepsis Gr1 + CD11b + MDSCs Sepsis was induced by cecal ligation and puncture (CLP). ( A and B ) Bone marrow cells were harvested from septic mice that were moribund and sacrificed at days 1–5 (representing early sepsis) and at days 6–28 (representing late sepsis) as well as sham mice. Gr1 + CD11b + cells were then purified using magnetic beads and pooled from 6 mice per group. Cell lysates were prepared and levels of total and phosphorylated (p-Stat3; Tyr 705 ) Stat3 (A), and C/EBPβ proteins (B) were determined by immunoblot. The results are representative of two experiments. Lower panel in A shows densitometry of the p-Stat3 bands. Values were normalized to β-actin and are presented relative to sham, which is set at 1-fold. ( C ) Knockdown of Stat3 or C/EBPβ in sepsis MDSCs inhibits miR-21 and miR-181b expression. Gr1 + CD11b + cells were isolated from the bone marrow of late septic mice, pooled (n = 6 mice per group), and transfected with Stat3-specific, C/EBPβ-specific, or control siRNA. After 36 hr in culture, cells were harvested and levels of miR-21 and miR-181 were determined by northern blot. Levels of the U6 RNA were also measured as an internal control. The knockdown was confirmed by western blotting (not shown). ( D ) Phosphorylation of Stat3 in the bone marrow during sepsis is restricted to the Gr1 + CD11b + MDSCs. CD3 + T cells were isolated from whole bone marrow cells by positive selection using anti-CD3 magnetic beads. To isolate CD19 + cells, whole bone marrow cells from late septic mice were first depleted of Gr1 − CD11b + cells (which mostly consists of CD19 + and CD11c + cells). CD19 + cells were then positively selected from the depleted cell population using anti-CD19 magnetic beads. The results are representative of two immunoblots using two different cell preparations. ( E ) A schematic diagram depicting the Stat3 and C/EBPβ binding sites in the miR-21 and miR-181b promoters. ( F ) The miR-21 and miR-181b promoter fragments used in the luciferase gene constructs (see Fig. 6 ). The Stat3 and C/EBP binding sites are underlined. The core nucleotides of the consensus binding sites are bolded. Lower case letters indicate the mutation introduced in the binding site.

    Article Snippet: The remaining chromatin solution was immunoprecipitated overnight at 4°C with protein G magnetic beads and 3 μg of antibody specific to p-Stat3, C/EBPα, C/EBPβ, p-Rb, or isotype control antibody (Santa Cruz Biotechnology).

    Techniques: Expressing, Ligation, Mouse Assay, Purification, Magnetic Beads, Isolation, Transfection, Northern Blot, Western Blot, Selection, Binding Assay, Luciferase, Construct, Mutagenesis

    TRIM28 functions as a cofactor for RORγt and STAT3. a Overlay of TRIM28 binding peaks with that of RORγt and STAT3 in Th17 cells. b Genome-wide distributions of binding peaks of RORγt, STAT3, and p300 at TRIM28 binding sites. c IGV browser view of RORγt, STAT3, and TRIM28 binding peaks at the Il17-Il17f gene locus. d Binding of RORγt and STAT3 to the Il17-Il17f gene locus in WT and Trim28 −/ − Th17 cells cultured at TGF-β plus IL-6 condition. e Overexpression of RORγt in WT or TRIM28 KO CD4 + T cells polarized under neutral (Th0) or Th17 (TGF-β plus IL-6) conditions. d , e The experiments were repeated 2–3 times with consistent results, and Student’s t test was used for the statistical test (ns = not significant; * p

    Journal: Nature Communications

    Article Title: Epigenetic activation during T helper 17 cell differentiation is mediated by Tripartite motif containing 28

    doi: 10.1038/s41467-018-03852-2

    Figure Lengend Snippet: TRIM28 functions as a cofactor for RORγt and STAT3. a Overlay of TRIM28 binding peaks with that of RORγt and STAT3 in Th17 cells. b Genome-wide distributions of binding peaks of RORγt, STAT3, and p300 at TRIM28 binding sites. c IGV browser view of RORγt, STAT3, and TRIM28 binding peaks at the Il17-Il17f gene locus. d Binding of RORγt and STAT3 to the Il17-Il17f gene locus in WT and Trim28 −/ − Th17 cells cultured at TGF-β plus IL-6 condition. e Overexpression of RORγt in WT or TRIM28 KO CD4 + T cells polarized under neutral (Th0) or Th17 (TGF-β plus IL-6) conditions. d , e The experiments were repeated 2–3 times with consistent results, and Student’s t test was used for the statistical test (ns = not significant; * p

    Article Snippet: The following antibodies were used for immunoblotting: anti-TRIM28 antibody (CST, catalog 4124), anti-RORγt (ebioscience, 14-6988-82), anti-STAT3 (CST, 12640).

    Techniques: Binding Assay, Genome Wide, Cell Culture, Over Expression

    Cytokine signaling regulated TRIM28 recruitment. a Expression of TRIM28 in different T-cell subsets and naive CD4 + T cells. b TRIM28 ChIP-qPCR results in WT Th0, WT Th17, STAT3 KO Th17 or RORγt KO Th17 cells. c RORγt overexpression in WT or STAT3 KO CD4 + T cells polarized under neutral (Th0) condition. d Overlay of p300 binding peaks in WT/STAT3KO(Upper) or WT/RORγKO (lower) Th17 cells over Th17-specific SEs with decreased p300 intensity. e . f . Those experiments were repeated twice with consistent results, and Student’s t test was used for the statistical test (ns = not significant; * p

    Journal: Nature Communications

    Article Title: Epigenetic activation during T helper 17 cell differentiation is mediated by Tripartite motif containing 28

    doi: 10.1038/s41467-018-03852-2

    Figure Lengend Snippet: Cytokine signaling regulated TRIM28 recruitment. a Expression of TRIM28 in different T-cell subsets and naive CD4 + T cells. b TRIM28 ChIP-qPCR results in WT Th0, WT Th17, STAT3 KO Th17 or RORγt KO Th17 cells. c RORγt overexpression in WT or STAT3 KO CD4 + T cells polarized under neutral (Th0) condition. d Overlay of p300 binding peaks in WT/STAT3KO(Upper) or WT/RORγKO (lower) Th17 cells over Th17-specific SEs with decreased p300 intensity. e . f . Those experiments were repeated twice with consistent results, and Student’s t test was used for the statistical test (ns = not significant; * p

    Article Snippet: The following antibodies were used for immunoblotting: anti-TRIM28 antibody (CST, catalog 4124), anti-RORγt (ebioscience, 14-6988-82), anti-STAT3 (CST, 12640).

    Techniques: Expressing, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Over Expression, Binding Assay

    Epha2 on oral epithelial cells binds β-glucan and primes the cells for an inflammatory response ( Left panel ) EphA2 (blue) and dectin-1 (green) bind to exposed β-glucan on the fungal surface. Binding to EphA2 is independent of Ca 2+ and activates mitogen-activated protein kinase (MAPK) and signal transducer and activator of transcription 3 (Stat3). Binding to dectin-1 requires Ca 2+ and activates nuclear factor ‘kappa-light-chain-enhancer’ of activated B-cells (NF-κB). ( Right panel ) During fungal proliferation, prolonged activation of EphA2 via EGFR (grey) induces the endocytosis of C. albicans and a pro-inflammatory response in the epithelial cells. EphA2-EGFR induces endocytosis and triggers MAPK signaling. EphA2 also activates Stat3 Activation of the Stat3 and MAPK pathways leads to the release of alarmins, cytokines, chemokines, and host defense peptides (HDPs, orange helix).

    Journal: Nature microbiology

    Article Title: EphA2 is an epithelial cell pattern recognition receptor for fungal β-glucans

    doi: 10.1038/s41564-017-0059-5

    Figure Lengend Snippet: Epha2 on oral epithelial cells binds β-glucan and primes the cells for an inflammatory response ( Left panel ) EphA2 (blue) and dectin-1 (green) bind to exposed β-glucan on the fungal surface. Binding to EphA2 is independent of Ca 2+ and activates mitogen-activated protein kinase (MAPK) and signal transducer and activator of transcription 3 (Stat3). Binding to dectin-1 requires Ca 2+ and activates nuclear factor ‘kappa-light-chain-enhancer’ of activated B-cells (NF-κB). ( Right panel ) During fungal proliferation, prolonged activation of EphA2 via EGFR (grey) induces the endocytosis of C. albicans and a pro-inflammatory response in the epithelial cells. EphA2-EGFR induces endocytosis and triggers MAPK signaling. EphA2 also activates Stat3 Activation of the Stat3 and MAPK pathways leads to the release of alarmins, cytokines, chemokines, and host defense peptides (HDPs, orange helix).

    Article Snippet: The lysates were separated by SDS/PAGE, and the phosphorylated proteins were detected by immunoblotting with phospho-specific antibodies, including anti-phospho-EphA2 (Cell signaling; #6347), anti-phospho-Stat3 (Cell signaling; #9134), anti-phospho-c-Fos (Cell signaling; #5348), anti-phospho-MEK1/2 (Cell signaling; #9154), anti-phospho-p65 (Cell signaling; # 3033).

    Techniques: Binding Assay, Activation Assay

    EphA2 signaling regulates the inflammatory response ( a ) Immunoblot demonstrating that C. albicans infection induces phosphorylation of Stat3. ( b ) Effects of the EphA2 depletion with siRNA on C. albicans -induced phosphorylation of Stat3. ( c . ( d ) Oral epithelial cells were incubated with inhibitors of EphA2 and Stat3 and then infected with C. albicans for 5 h, after which chemokines and the S100a8 alarmin mRNA levels were determined by real-time PCR. Box whisker plots show median and range of 2 experiments, each performed in triplicate and are presented as fold induction relative to uninfected epithelial cells. ( e ) EphA2 depletion with siRNA reduces epithelial cell production of human β defensin 2, cytokines and chemokines in response to 8 h of C. albicans infection. Box whisker plots show median and range of 3 experiments, each performed in duplicate. ( f ) Regulation of the oral epithelial cell pro-inflammatory response to C. albicans by Stat3 and dectin-1. Box whisker plots show median and range of 3 experiments, each performed in duplicate. ANT, EphA2 antagonist; ctrl, control; DAS, dasatinib; hBD2, human β defensin 2; MOI, multiplicity of infection; Stat3 INH, Stat3 inhibitor; UNINF, uninfected. ** P

    Journal: Nature microbiology

    Article Title: EphA2 is an epithelial cell pattern recognition receptor for fungal β-glucans

    doi: 10.1038/s41564-017-0059-5

    Figure Lengend Snippet: EphA2 signaling regulates the inflammatory response ( a ) Immunoblot demonstrating that C. albicans infection induces phosphorylation of Stat3. ( b ) Effects of the EphA2 depletion with siRNA on C. albicans -induced phosphorylation of Stat3. ( c . ( d ) Oral epithelial cells were incubated with inhibitors of EphA2 and Stat3 and then infected with C. albicans for 5 h, after which chemokines and the S100a8 alarmin mRNA levels were determined by real-time PCR. Box whisker plots show median and range of 2 experiments, each performed in triplicate and are presented as fold induction relative to uninfected epithelial cells. ( e ) EphA2 depletion with siRNA reduces epithelial cell production of human β defensin 2, cytokines and chemokines in response to 8 h of C. albicans infection. Box whisker plots show median and range of 3 experiments, each performed in duplicate. ( f ) Regulation of the oral epithelial cell pro-inflammatory response to C. albicans by Stat3 and dectin-1. Box whisker plots show median and range of 3 experiments, each performed in duplicate. ANT, EphA2 antagonist; ctrl, control; DAS, dasatinib; hBD2, human β defensin 2; MOI, multiplicity of infection; Stat3 INH, Stat3 inhibitor; UNINF, uninfected. ** P

    Article Snippet: The lysates were separated by SDS/PAGE, and the phosphorylated proteins were detected by immunoblotting with phospho-specific antibodies, including anti-phospho-EphA2 (Cell signaling; #6347), anti-phospho-Stat3 (Cell signaling; #9134), anti-phospho-c-Fos (Cell signaling; #5348), anti-phospho-MEK1/2 (Cell signaling; #9154), anti-phospho-p65 (Cell signaling; # 3033).

    Techniques: Infection, Incubation, Real-time Polymerase Chain Reaction, Whisker Assay

    Higher fungal inoculum induces stronger host response ( a ) Immunoblots showing the effects of increasing C. albicans . ( b ) Effects of C. albicans inoculum on epithelial cell secretion of IL-8 and hBD2. Box whisker plots show median and range of 3 independent experiments in duplicates. ctrl, control; hBD2, human β defensin 2; MOI, multiplicity of infection; Stat3 INH, Stat3 inhibitor; UNINF, uninfected. * P

    Journal: Nature microbiology

    Article Title: EphA2 is an epithelial cell pattern recognition receptor for fungal β-glucans

    doi: 10.1038/s41564-017-0059-5

    Figure Lengend Snippet: Higher fungal inoculum induces stronger host response ( a ) Immunoblots showing the effects of increasing C. albicans . ( b ) Effects of C. albicans inoculum on epithelial cell secretion of IL-8 and hBD2. Box whisker plots show median and range of 3 independent experiments in duplicates. ctrl, control; hBD2, human β defensin 2; MOI, multiplicity of infection; Stat3 INH, Stat3 inhibitor; UNINF, uninfected. * P

    Article Snippet: The lysates were separated by SDS/PAGE, and the phosphorylated proteins were detected by immunoblotting with phospho-specific antibodies, including anti-phospho-EphA2 (Cell signaling; #6347), anti-phospho-Stat3 (Cell signaling; #9134), anti-phospho-c-Fos (Cell signaling; #5348), anti-phospho-MEK1/2 (Cell signaling; #9154), anti-phospho-p65 (Cell signaling; # 3033).

    Techniques: Western Blot, Whisker Assay, Infection

    SDHB and IDH 2 protein levels are associated with Gleason grade SDHB protein expression levels in a TMA ( n = 83) detected by immunohistochemistry (IHC). Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q, adj. P ‐value; n.s., not significant. TMA, tissue microarray. Representative IHC staining of SDHB in normal prostate glands and Gleason grade (GL) 3–5 PCa glands. Scale bar = 100 μm. IDH2 protein expression levels in a TMA ( n = 83) detected by IHC. Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q, adj. P ‐value; n.s., not significant. Representative IHC staining of IDH2 in normal prostate glands and GL 3–5 PCa glands. Scale bar = 100 μm. Nuclear (N) and cytoplasmic (C) STAT3 protein expression levels in a TMA ( n = 83) detected by IHC. Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q = adj. P ‐value; n.s., not significant. Source data are available online for this figure.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: SDHB and IDH 2 protein levels are associated with Gleason grade SDHB protein expression levels in a TMA ( n = 83) detected by immunohistochemistry (IHC). Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q, adj. P ‐value; n.s., not significant. TMA, tissue microarray. Representative IHC staining of SDHB in normal prostate glands and Gleason grade (GL) 3–5 PCa glands. Scale bar = 100 μm. IDH2 protein expression levels in a TMA ( n = 83) detected by IHC. Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q, adj. P ‐value; n.s., not significant. Representative IHC staining of IDH2 in normal prostate glands and GL 3–5 PCa glands. Scale bar = 100 μm. Nuclear (N) and cytoplasmic (C) STAT3 protein expression levels in a TMA ( n = 83) detected by IHC. Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q = adj. P ‐value; n.s., not significant. Source data are available online for this figure.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques: Expressing, Immunohistochemistry, Microarray, Staining

    Scheme of down‐regulated KEGG pathways in low STAT 3 TCGA samples KEGG representation of the JAK‐STAT signaling pathway in low STAT3 versus high STAT3 TCGA samples after testing for signaling KEGG pathways. STAT3 and c‐Myc are encircled in yellow. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation. KEGG representation of the HIF‐1 signaling pathway in low STAT3 versus high STAT3 TCGA samples after testing for signaling KEGG pathways. STAT3 and HIF‐1α are encircled in yellow. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Scheme of down‐regulated KEGG pathways in low STAT 3 TCGA samples KEGG representation of the JAK‐STAT signaling pathway in low STAT3 versus high STAT3 TCGA samples after testing for signaling KEGG pathways. STAT3 and c‐Myc are encircled in yellow. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation. KEGG representation of the HIF‐1 signaling pathway in low STAT3 versus high STAT3 TCGA samples after testing for signaling KEGG pathways. STAT3 and HIF‐1α are encircled in yellow. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques:

    Low PDK 4 is significantly associated with earlier disease recurrence in PC a Simplified scheme of upstream regulation of the TCA cycle. Arrows indicate activation, and bar indicates repression. PDC, pyruvate dehydrogenase complex; PDK, pyruvate dehydrogenase kinase; TCA, tricarboxylic acid cycle. Genes of the hallmark gene set “Oxidative phosphorylation” that are differentially expressed in low STAT3 versus high STAT3 TCGA‐PRAD tumors. Dotted lines show Log2‐FC = ± 1 ( x ‐axis) and adj. P ‐value = −log10(0.05; y ‐axis). Orange, up‐regulated genes; green, down‐regulated genes. DE, differentially expressed. Kaplan–Meier plots showing time to biochemical recurrence in months for PDK4 in primary tumors (C) and in primary and metastatic tumors combined (D) in the MSKCC PCa GSE21032 data set. Groups were generated by a median split. P ‐values were estimated by log‐rank test (C, D) and adjusted with Benjamini–Hochberg method (D). + = censored.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Low PDK 4 is significantly associated with earlier disease recurrence in PC a Simplified scheme of upstream regulation of the TCA cycle. Arrows indicate activation, and bar indicates repression. PDC, pyruvate dehydrogenase complex; PDK, pyruvate dehydrogenase kinase; TCA, tricarboxylic acid cycle. Genes of the hallmark gene set “Oxidative phosphorylation” that are differentially expressed in low STAT3 versus high STAT3 TCGA‐PRAD tumors. Dotted lines show Log2‐FC = ± 1 ( x ‐axis) and adj. P ‐value = −log10(0.05; y ‐axis). Orange, up‐regulated genes; green, down‐regulated genes. DE, differentially expressed. Kaplan–Meier plots showing time to biochemical recurrence in months for PDK4 in primary tumors (C) and in primary and metastatic tumors combined (D) in the MSKCC PCa GSE21032 data set. Groups were generated by a median split. P ‐values were estimated by log‐rank test (C, D) and adjusted with Benjamini–Hochberg method (D). + = censored.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques: Activation Assay, Generated

    Correlation of PDK 4 with STAT 3 and STAT 3 target signatures Pearson correlation of PDK4 log counts per million (cpm) with STAT3 log cpm in three prostate cancer data sets. P ‐values were adjusted with Benjamini–Hochberg method. P . adj., adjusted P ‐value. NCI, The Netherlands Cancer Institute; VPC, The Vancouver Prostate Center; RAS, The Russian Academy of Science. Pearson correlation of PDK4 log cpm with “AZARE STAT3 TARGETS” gene signatures in three prostate cancer data sets. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. Pearson correlation of PDK4 log cpm with “AZARE STAT3 TARGETS” (left) and “STAT3 TARGETS UP” gene signatures (right) in TCGA PRAD. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. P . adj., adjusted P ‐value. Source data are available online for this figure.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Correlation of PDK 4 with STAT 3 and STAT 3 target signatures Pearson correlation of PDK4 log counts per million (cpm) with STAT3 log cpm in three prostate cancer data sets. P ‐values were adjusted with Benjamini–Hochberg method. P . adj., adjusted P ‐value. NCI, The Netherlands Cancer Institute; VPC, The Vancouver Prostate Center; RAS, The Russian Academy of Science. Pearson correlation of PDK4 log cpm with “AZARE STAT3 TARGETS” gene signatures in three prostate cancer data sets. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. Pearson correlation of PDK4 log cpm with “AZARE STAT3 TARGETS” (left) and “STAT3 TARGETS UP” gene signatures (right) in TCGA PRAD. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. P . adj., adjusted P ‐value. Source data are available online for this figure.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques:

    PDK 4 as putative STAT 3 target STAT3‐ and PDK4 ‐stratified subgroups were generated by median splits in MSKCC PCa GSE21032 data set. Pearson correlation between STAT3 and PDK4 is shown. Kaplan–Meier plot shows stratified subgroups. P ‐values were estimated by log‐rank test and adjusted with Benjamini–Hochberg method. Hi, high; lo, low. Western blot of STAT3, PDK4, and β‐TUBULIN proteins in 22Rv1 cells with or without knockdown of STAT3. Ctrl, scrambled control; shSTAT3, short hairpin knockdown of STAT3 . ChIP assay from IL‐6‐stimulated or non‐stimulated 22Rv1 cells with or without knockdown of STAT3 was immunoprecipitated with a STAT3‐specific antibody (blue shades) and IgG antibody as a negative control (orange shades) followed by qPCR with a promoter‐specific primer pair for the PDK4 gene. Bars represent mean ± SD from two technical replicates. Precipitated DNA is presented as % of input. One representative experiment is shown. Result of qPCR using primer pair 2 is shown. Ctrl = scrambled control; shSTAT3 = short hairpin knockdown of STAT3; +IL‐6 = IL‐6‐stimulated. Correlation of STAT3, c‐MYC , and HIF‐1α with PDK1‐4 , PDC genes ( PDHA1, PDHB, PDHX, DLAT, DLD ) and TCA/OXPHOS genes (CS, IDH2, IDH3A, SDHB, SDHC, ATP5A1, NDUFS1) in MSKCC PCa (GSE21032). Dot colors represent Pearson correlation (1 = red; −1 = blue); dot sizes represent adj. P ‐values ≤ 0.05. Only significant correlations are shown. P ‐values were adjusted with Benjamini–Hochberg method. Source data are available online for this figure.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: PDK 4 as putative STAT 3 target STAT3‐ and PDK4 ‐stratified subgroups were generated by median splits in MSKCC PCa GSE21032 data set. Pearson correlation between STAT3 and PDK4 is shown. Kaplan–Meier plot shows stratified subgroups. P ‐values were estimated by log‐rank test and adjusted with Benjamini–Hochberg method. Hi, high; lo, low. Western blot of STAT3, PDK4, and β‐TUBULIN proteins in 22Rv1 cells with or without knockdown of STAT3. Ctrl, scrambled control; shSTAT3, short hairpin knockdown of STAT3 . ChIP assay from IL‐6‐stimulated or non‐stimulated 22Rv1 cells with or without knockdown of STAT3 was immunoprecipitated with a STAT3‐specific antibody (blue shades) and IgG antibody as a negative control (orange shades) followed by qPCR with a promoter‐specific primer pair for the PDK4 gene. Bars represent mean ± SD from two technical replicates. Precipitated DNA is presented as % of input. One representative experiment is shown. Result of qPCR using primer pair 2 is shown. Ctrl = scrambled control; shSTAT3 = short hairpin knockdown of STAT3; +IL‐6 = IL‐6‐stimulated. Correlation of STAT3, c‐MYC , and HIF‐1α with PDK1‐4 , PDC genes ( PDHA1, PDHB, PDHX, DLAT, DLD ) and TCA/OXPHOS genes (CS, IDH2, IDH3A, SDHB, SDHC, ATP5A1, NDUFS1) in MSKCC PCa (GSE21032). Dot colors represent Pearson correlation (1 = red; −1 = blue); dot sizes represent adj. P ‐values ≤ 0.05. Only significant correlations are shown. P ‐values were adjusted with Benjamini–Hochberg method. Source data are available online for this figure.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques: Generated, Western Blot, Chromatin Immunoprecipitation, Immunoprecipitation, Negative Control, Real-time Polymerase Chain Reaction

    Identification of STAT 3‐associated pathways in prostate cancer Overview of transcriptomic (top) and proteomic (bottom) analyses. Overexpression analysis of enriched KEGG pathways of significantly differentially expressed genes between low STAT3 versus high STAT3 groups in TCGA PRAD. Dotted line: adj. P ‐value = −log10(0.05).

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Identification of STAT 3‐associated pathways in prostate cancer Overview of transcriptomic (top) and proteomic (bottom) analyses. Overexpression analysis of enriched KEGG pathways of significantly differentially expressed genes between low STAT3 versus high STAT3 groups in TCGA PRAD. Dotted line: adj. P ‐value = −log10(0.05).

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques: Over Expression

    Kaplan–Meier curves of additional candidate genes Time to BCR in months for STAT3 (A), HIF‐1α (B), c‐MYC (C), CNOT1 (D), IDH2 (E), and SDHB (F) in the MSKCC PCa GSE21032 data set. Groups were generated by a median split. P ‐values were estimated by log‐rank test and adjusted with Benjamini–Hochberg method. + = censored.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Kaplan–Meier curves of additional candidate genes Time to BCR in months for STAT3 (A), HIF‐1α (B), c‐MYC (C), CNOT1 (D), IDH2 (E), and SDHB (F) in the MSKCC PCa GSE21032 data set. Groups were generated by a median split. P ‐values were estimated by log‐rank test and adjusted with Benjamini–Hochberg method. + = censored.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques: Generated

    Correlation of STAT 3 with STAT 3 target, ribosome, and OXPHOS signatures Pearson correlation of STAT3 log counts per million (cpm) with tyrosine‐phosphorylated (pY) STAT3 Reverse Phase Protein Array (RPPA) protein levels (left, z ‐scored), “AZARE STAT3 TARGETS” (middle), and “STAT3 TARGETS UP” gene signatures (right) in TCGA PRAD. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. P . adj., adjusted P ‐value. Pearson correlation of STAT3 log cpm with KEGG “OXPHOS” gene signature in three prostate cancer data sets. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. NCI, The Netherlands Cancer Institute; VPC, The Vancouver Prostate Center; RAS, The Russian Academy of Science. Pearson correlation of STAT3 log cpm with KEGG “Ribosome” gene signature in three prostate cancer data sets. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. Source data are available online for this figure.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Correlation of STAT 3 with STAT 3 target, ribosome, and OXPHOS signatures Pearson correlation of STAT3 log counts per million (cpm) with tyrosine‐phosphorylated (pY) STAT3 Reverse Phase Protein Array (RPPA) protein levels (left, z ‐scored), “AZARE STAT3 TARGETS” (middle), and “STAT3 TARGETS UP” gene signatures (right) in TCGA PRAD. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. P . adj., adjusted P ‐value. Pearson correlation of STAT3 log cpm with KEGG “OXPHOS” gene signature in three prostate cancer data sets. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. NCI, The Netherlands Cancer Institute; VPC, The Vancouver Prostate Center; RAS, The Russian Academy of Science. Pearson correlation of STAT3 log cpm with KEGG “Ribosome” gene signature in three prostate cancer data sets. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. Source data are available online for this figure.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques: Protein Array

    Proteomics show TCA / OXPHOS up‐regulation in low STAT 3 human FFPE PC a STAT3 immunohistochemistry staining of low STAT3 and high STAT3 PCa samples. Red arrows indicate transformed PCa glands; black arrows indicate pre‐transformed normal prostate glands. Scale bar = 100 μm. #, sample‐IDs. Significantly enriched KEGG pathways in low STAT3 versus high STAT3 groups. Dotted line: adj. P ‐value = ‐log10(0.05). Significantly enriched hallmark gene sets in low STAT3 versus high STAT3 groups. Dotted line: adj. P ‐value = ‐log10(0.05). Red = up‐regulated; blue = down‐regulated. Simplified scheme of the TCA cycle and associated metabolic pathways. TCA cycle, tricarboxylic acid cycle; PDC, pyruvate dehydrogenase complex; PDK, pyruvate dehydrogenase kinase. Graphic adapted from Gray et al , 2014 and Jang et al , 2013 .

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Proteomics show TCA / OXPHOS up‐regulation in low STAT 3 human FFPE PC a STAT3 immunohistochemistry staining of low STAT3 and high STAT3 PCa samples. Red arrows indicate transformed PCa glands; black arrows indicate pre‐transformed normal prostate glands. Scale bar = 100 μm. #, sample‐IDs. Significantly enriched KEGG pathways in low STAT3 versus high STAT3 groups. Dotted line: adj. P ‐value = ‐log10(0.05). Significantly enriched hallmark gene sets in low STAT3 versus high STAT3 groups. Dotted line: adj. P ‐value = ‐log10(0.05). Red = up‐regulated; blue = down‐regulated. Simplified scheme of the TCA cycle and associated metabolic pathways. TCA cycle, tricarboxylic acid cycle; PDC, pyruvate dehydrogenase complex; PDK, pyruvate dehydrogenase kinase. Graphic adapted from Gray et al , 2014 and Jang et al , 2013 .

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques: Formalin-fixed Paraffin-Embedded, Immunohistochemistry, Staining, Transformation Assay

    Scheme of up‐regulated KEGG pathways in low STAT 3 TCGA samples KEGG representation of the ribosome in low STAT3 versus high STAT3 TCGA samples after testing for signaling KEGG pathways. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation. KEGG representation of oxidative phosphorylation in low STAT3 versus high STAT3 TCGA samples after testing for metabolic KEGG pathways. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Scheme of up‐regulated KEGG pathways in low STAT 3 TCGA samples KEGG representation of the ribosome in low STAT3 versus high STAT3 TCGA samples after testing for signaling KEGG pathways. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation. KEGG representation of oxidative phosphorylation in low STAT3 versus high STAT3 TCGA samples after testing for metabolic KEGG pathways. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques:

    MPA induces Stat3 binding to the high-affinity mutant of the SIE from the human c- fos promoter. C4HD cells were treated for 15 min at 37°C with MPA or MPA-RU486 or were left untreated growing in ChFCS. Twenty micrograms of protein from nuclear extracts was incubated for 20 min at room temperature with 1 ng of 32 P-labeled double-stranded DNA containing the high-affinity mutant of the SIE from the human c- fos promoter (5′GTGCATTTCCCGTAAATCTTGTCTACA3′) (m67) used as a probe and analyzed by EMSA. The specificity of the Stat3-DNA complexes is shown by competition with 25- and 100-fold mass excesses unlabeled m67 oligonucleotide and by the lack of competition with a 100-fold mass excess of mutant m67 (100xm67 mut). The right panel shows a supershift analysis that was performed by including either anti-Stat3 or anti-Stat1 antibodies. An equivalent amount of preimmune rabbit serum was used as a control in the EMSA reaction mixture (NRS [normal rabbit serum]). This experiment was repeated six times with similar results. wt, wild type.

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: MPA induces Stat3 binding to the high-affinity mutant of the SIE from the human c- fos promoter. C4HD cells were treated for 15 min at 37°C with MPA or MPA-RU486 or were left untreated growing in ChFCS. Twenty micrograms of protein from nuclear extracts was incubated for 20 min at room temperature with 1 ng of 32 P-labeled double-stranded DNA containing the high-affinity mutant of the SIE from the human c- fos promoter (5′GTGCATTTCCCGTAAATCTTGTCTACA3′) (m67) used as a probe and analyzed by EMSA. The specificity of the Stat3-DNA complexes is shown by competition with 25- and 100-fold mass excesses unlabeled m67 oligonucleotide and by the lack of competition with a 100-fold mass excess of mutant m67 (100xm67 mut). The right panel shows a supershift analysis that was performed by including either anti-Stat3 or anti-Stat1 antibodies. An equivalent amount of preimmune rabbit serum was used as a control in the EMSA reaction mixture (NRS [normal rabbit serum]). This experiment was repeated six times with similar results. wt, wild type.

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Binding Assay, Mutagenesis, Incubation, Labeling

    MPA induces Stat3 nuclear translocation. C4HD cells were treated with 10 nM MPA for the time indicated or were pretreated with PP2 before MPA stimulation. Nuclear (nuc) and cytosolic (cyt) fractions were prepared, and 30 μg of protein from cell extracts was analyzed by Western blot assay for Stat3 expression level. Membranes were then stripped and hybridized with an anti-p85 PI-3K subunit antibody (middle) or an anti-retinoblastoma (Rb) antibody (bottom) in order to control cellular fractionation efficiency. W, Western blot assay.

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: MPA induces Stat3 nuclear translocation. C4HD cells were treated with 10 nM MPA for the time indicated or were pretreated with PP2 before MPA stimulation. Nuclear (nuc) and cytosolic (cyt) fractions were prepared, and 30 μg of protein from cell extracts was analyzed by Western blot assay for Stat3 expression level. Membranes were then stripped and hybridized with an anti-p85 PI-3K subunit antibody (middle) or an anti-retinoblastoma (Rb) antibody (bottom) in order to control cellular fractionation efficiency. W, Western blot assay.

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Translocation Assay, Western Blot, Expressing, Cell Fractionation

    MPA induces tyrosine phosphorylation by Stat3, Jak1, and Jak2. Cultures of C4HD (A) and T47D (B) cells were treated with 10 nM MPA or MPA-10 nM RU486 for the indicated times. Fifty micrograms of protein from cell lysates was electrophoresed, and Western blot assays were performed with antiphosphotyrosine 705 Stat3, antiphosphotyrosine 701 Stat1, antiphosphotyrosine 1022/1023 Jak1, and antiphosphotyrosine 1007/1008 Jak2 antibodies. Membranes were then stripped and hybridized with anti-Stat3, -Stat1, -Jak1, and -Jak2 antibodies. This experiment was repeated six times for C4HD cells and three times for T47D cells with similar results. LM3 (C) or T47D-Y (D) cells were transfected with PRB or with the empty pSG5 plasmidor remained untreated. Cells were then stimulated for 5 min with MPA or pretreated with RU486 before MPA stimulation. LM3 cells were also treated with heregulin for 10 min. Fifty micrograms of protein from cell lysates was electrophoresed, and Western blot assays were performed with antiphosphotyrosine 705 Stat3 (upper parts of panels C and D). Membranes were then stripped and hybridized with anti-Stat3 (middle panes of parts C and D) and anti-PR (lower parts of panels C and D) antibodies. This experiment was repeated three times with similar results. W, Western blot assay.

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: MPA induces tyrosine phosphorylation by Stat3, Jak1, and Jak2. Cultures of C4HD (A) and T47D (B) cells were treated with 10 nM MPA or MPA-10 nM RU486 for the indicated times. Fifty micrograms of protein from cell lysates was electrophoresed, and Western blot assays were performed with antiphosphotyrosine 705 Stat3, antiphosphotyrosine 701 Stat1, antiphosphotyrosine 1022/1023 Jak1, and antiphosphotyrosine 1007/1008 Jak2 antibodies. Membranes were then stripped and hybridized with anti-Stat3, -Stat1, -Jak1, and -Jak2 antibodies. This experiment was repeated six times for C4HD cells and three times for T47D cells with similar results. LM3 (C) or T47D-Y (D) cells were transfected with PRB or with the empty pSG5 plasmidor remained untreated. Cells were then stimulated for 5 min with MPA or pretreated with RU486 before MPA stimulation. LM3 cells were also treated with heregulin for 10 min. Fifty micrograms of protein from cell lysates was electrophoresed, and Western blot assays were performed with antiphosphotyrosine 705 Stat3 (upper parts of panels C and D). Membranes were then stripped and hybridized with anti-Stat3 (middle panes of parts C and D) and anti-PR (lower parts of panels C and D) antibodies. This experiment was repeated three times with similar results. W, Western blot assay.

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Western Blot, Transfection

    Stat3 is involved in MPA-induced proliferation of C4HD cells. (A) C4HD cells were transiently transfected with 2 μg DN Stat3 expression vector, Stat3Y705-F, with 2 μg constitutively activated Stat3 mutant, Stat3-C, or with 2 μg empty pRc/CMV vector, as a control, for 48 h. Cells were treated with MPA for another 48 h or remained untreated and were then stained with PI and analyzed for cell cycle distribution by flow cytometry. The percentages of total cells in the cell cycle phases are indicated. (B) C4HD cells were transiently transfected with 2 μg DN Stat3 expression vector or with 2 μg empty pRc/CMV vector, as a control, for 48 h. Cells were treated as described for panel A, and cell surface Annexin V binding was measured by flow cytometry. (C) Fifty micrograms of protein from lysates of cells transfected with Stat3Y705-F, Stat3-C, and empty pRc/CMV plasmids and from nontransfected cells, treated with MPA for 48 h or left untreated, was electrophoresed, and Western blot assays were performed with an anti Bcl-x L antibody (upper part). Membrane was then stripped and hybridized with an antiactin antibody (lower part). (D) Fifty micrograms of protein from lysates of cells treated as described for panel C and stimulated or not with MPA for 5 min was electrophoresed, and Western blot assays were performed with an anti-FLAG M2 antibody (upper part). Membrane was then stripped and hybridized with an anti-Stat3 antibody (lower part). (E) Fifty micrograms of protein from C4HD cells transfected with 2 μg Stat3Y705-F vector or with empty pRc/CMV plasmid and subsequently left untreated treated or with MPA for 5 min was electrophoresed, and Western blot assays were performed with antiphosphotyrosine Stat3 antibody (upper part). Membranes were then stripped and hybridized with anti-Stat3 antibodies (lower part). (F) Fifty micrograms of protein from C4HD cells transfected with 2 μg Stat3Y705-F vector and then treated with MPA for 5 min or left untreated was electrophoresed, and Western blot assays were performed with antiphosphotyrosine 701 Stat1 antibody (upper part). Membrane was then stripped and hybridized with anti-Stat1 antibody (lower part). Experiments described in panels A to F were repeated three times with similar results. W, Western blot assay. (G) C4HD cells were transiently transfected with 2 μg/well of the m67-Luc reporter plasmid and with 1 μg/well of a CMV-βgal expression vector as an internal control. In the indicated lanes, C4HD cells were cotransfected with either Stat3Y705-F or Stat3-C plasmid. The total amount of transfected DNA was standardized by adding the empty vector. After transfection, cells were treated when indicated with MPA for 48 h and were then harvested and lysed. Luciferase and β-galactosidase activities were measured as described in Materials and Methods. Results are presented as n -fold induction of luciferase activity with respect to cells growing in ChFCS. Data shown represent the mean of two independent experiments ± the standard error of the mean. For b versus a and c versus b, P

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: Stat3 is involved in MPA-induced proliferation of C4HD cells. (A) C4HD cells were transiently transfected with 2 μg DN Stat3 expression vector, Stat3Y705-F, with 2 μg constitutively activated Stat3 mutant, Stat3-C, or with 2 μg empty pRc/CMV vector, as a control, for 48 h. Cells were treated with MPA for another 48 h or remained untreated and were then stained with PI and analyzed for cell cycle distribution by flow cytometry. The percentages of total cells in the cell cycle phases are indicated. (B) C4HD cells were transiently transfected with 2 μg DN Stat3 expression vector or with 2 μg empty pRc/CMV vector, as a control, for 48 h. Cells were treated as described for panel A, and cell surface Annexin V binding was measured by flow cytometry. (C) Fifty micrograms of protein from lysates of cells transfected with Stat3Y705-F, Stat3-C, and empty pRc/CMV plasmids and from nontransfected cells, treated with MPA for 48 h or left untreated, was electrophoresed, and Western blot assays were performed with an anti Bcl-x L antibody (upper part). Membrane was then stripped and hybridized with an antiactin antibody (lower part). (D) Fifty micrograms of protein from lysates of cells treated as described for panel C and stimulated or not with MPA for 5 min was electrophoresed, and Western blot assays were performed with an anti-FLAG M2 antibody (upper part). Membrane was then stripped and hybridized with an anti-Stat3 antibody (lower part). (E) Fifty micrograms of protein from C4HD cells transfected with 2 μg Stat3Y705-F vector or with empty pRc/CMV plasmid and subsequently left untreated treated or with MPA for 5 min was electrophoresed, and Western blot assays were performed with antiphosphotyrosine Stat3 antibody (upper part). Membranes were then stripped and hybridized with anti-Stat3 antibodies (lower part). (F) Fifty micrograms of protein from C4HD cells transfected with 2 μg Stat3Y705-F vector and then treated with MPA for 5 min or left untreated was electrophoresed, and Western blot assays were performed with antiphosphotyrosine 701 Stat1 antibody (upper part). Membrane was then stripped and hybridized with anti-Stat1 antibody (lower part). Experiments described in panels A to F were repeated three times with similar results. W, Western blot assay. (G) C4HD cells were transiently transfected with 2 μg/well of the m67-Luc reporter plasmid and with 1 μg/well of a CMV-βgal expression vector as an internal control. In the indicated lanes, C4HD cells were cotransfected with either Stat3Y705-F or Stat3-C plasmid. The total amount of transfected DNA was standardized by adding the empty vector. After transfection, cells were treated when indicated with MPA for 48 h and were then harvested and lysed. Luciferase and β-galactosidase activities were measured as described in Materials and Methods. Results are presented as n -fold induction of luciferase activity with respect to cells growing in ChFCS. Data shown represent the mean of two independent experiments ± the standard error of the mean. For b versus a and c versus b, P

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Transfection, Expressing, Plasmid Preparation, Mutagenesis, Staining, Flow Cytometry, Cytometry, Binding Assay, Western Blot, Luciferase, Activity Assay

    MPA up-regulates Stat3 protein expression. Primary cultures of C4HD cells were treated for 48 h in medium with ChFCS supplemented with 10 nM MPA or MPA-10 nM RU486. Fifty micrograms of protein from cell lysates was electrophoresed and immunoblotted for Stat3 and Stat1. A Western blot assay using an antiactin antibody was carried out using identical protein lysates as a control for the specificity of the effect of MPA. This is a representative experiment of a total of four in which the standard error of the mean was within 10%. W, Western blot assay.

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: MPA up-regulates Stat3 protein expression. Primary cultures of C4HD cells were treated for 48 h in medium with ChFCS supplemented with 10 nM MPA or MPA-10 nM RU486. Fifty micrograms of protein from cell lysates was electrophoresed and immunoblotted for Stat3 and Stat1. A Western blot assay using an antiactin antibody was carried out using identical protein lysates as a control for the specificity of the effect of MPA. This is a representative experiment of a total of four in which the standard error of the mean was within 10%. W, Western blot assay.

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Expressing, Western Blot

    Jak1 and Jak2 are involved in MPA-induced Stat3 phosphorylation. C4HD cells were transiently transfected with 2 μg of DN Jak1 or DN Jak2 vector and then treated with MPA for 5 min or left untreated. Fifty micrograms of protein from cell lysates was electrophoresed, and Western blot assays were performed with antiphosphotyrosine Jak1 (A, upper part) or antiphosphotyrosine Jak2 (B, upper part) antibodies. Membranes were then stripped and hybridized with anti-Jak1 (A, lower part) and anti-Jak2 (B, lower part) antibodies. (C) Fifty micrograms of protein from cells transfected with the DN Jak1 (left part) or the DN Jak2 (right part) vector and subsequentlytreated with MPA for 5 min or left untreated was electrophoresed, and Western blot assays were performed with antiphosphotyrosine Stat3 (upper parts). Membranes were then stripped and hybridized with anti-Stat3 (lower parts) antibodies. (D) C4HD cells were treated with MPA for the indicated times or preincubated with the selective Src family kinase inhibitor PP2 or RU486 for 90 min and then treated with MPA. Fifty micrograms of protein from cell lysates was electrophoresed and immunoblotted with an antiphosphotyrosine c-Src antibody (upper part). Membrane was then stripped and hybridized with anti-c-Src antibody (lower part). (E) C4HD cells were preincubated with the selective Src family kinase inhibitor PP2 for 90 min and then treated with MPA for 5 min. Fifty micrograms of protein from cell lysates was electrophoresed and immunoblotted with antiphosphotyrosine Stat3, antiphosphotyrosine Jak1, and antiphosphotyrosine Jak2 antibodies. Membranes were then stripped and hybridized with anti-Stat3, anti-Jak1, and anti-Jak2 antibodies, respectively. These experiments were repeated three times with similar results. W, Western blot assay.

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: Jak1 and Jak2 are involved in MPA-induced Stat3 phosphorylation. C4HD cells were transiently transfected with 2 μg of DN Jak1 or DN Jak2 vector and then treated with MPA for 5 min or left untreated. Fifty micrograms of protein from cell lysates was electrophoresed, and Western blot assays were performed with antiphosphotyrosine Jak1 (A, upper part) or antiphosphotyrosine Jak2 (B, upper part) antibodies. Membranes were then stripped and hybridized with anti-Jak1 (A, lower part) and anti-Jak2 (B, lower part) antibodies. (C) Fifty micrograms of protein from cells transfected with the DN Jak1 (left part) or the DN Jak2 (right part) vector and subsequentlytreated with MPA for 5 min or left untreated was electrophoresed, and Western blot assays were performed with antiphosphotyrosine Stat3 (upper parts). Membranes were then stripped and hybridized with anti-Stat3 (lower parts) antibodies. (D) C4HD cells were treated with MPA for the indicated times or preincubated with the selective Src family kinase inhibitor PP2 or RU486 for 90 min and then treated with MPA. Fifty micrograms of protein from cell lysates was electrophoresed and immunoblotted with an antiphosphotyrosine c-Src antibody (upper part). Membrane was then stripped and hybridized with anti-c-Src antibody (lower part). (E) C4HD cells were preincubated with the selective Src family kinase inhibitor PP2 for 90 min and then treated with MPA for 5 min. Fifty micrograms of protein from cell lysates was electrophoresed and immunoblotted with antiphosphotyrosine Stat3, antiphosphotyrosine Jak1, and antiphosphotyrosine Jak2 antibodies. Membranes were then stripped and hybridized with anti-Stat3, anti-Jak1, and anti-Jak2 antibodies, respectively. These experiments were repeated three times with similar results. W, Western blot assay.

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Transfection, Plasmid Preparation, Western Blot

    MPA induces association of Stat3 with PR. (A) C4HD cells were treated with 10 nM MPA for the indicated times or preincubated with PP2 before MPA treatment for 5 min, and PR was immunoprecipitated from 500 μg of protein extracts. As a control, lysates were also immunoprecipitated with normal mouse serum (NMS). Immunocomplexes were subjected to SDS-PAGE and analyzed by Western blotting with an anti-Stat3 antibody (upper part). Twenty micrograms of protein from cell extracts was directly immunoblotted with the Stat3 antibody (last lane, upper part). Identical aliquots of each immunoprecipitate were subjected to immunoblot analysis with anti-PR antibody to verify that nearly equal amounts of immunoprecipitated proteins were loaded (lower part). (B) Protein lysates (500 μg) from cells treated as indicated in panel A were immunoprecipitated with an anti-Stat3 antibody or with normal rabbit serum (NRS). Immunocomplexes were subjected to SDS-PAGE and analyzed by Western blotting with an anti-PR antibody (upper part). Twenty micrograms of protein from cell extracts was directly immunoblotted with the PR antibody (last lane, upper part). Identical aliquots of each immunoprecipitate were subjected to immunoblot analysis with anti-Stat3 antibody to verify that nearly equal amounts of immunoprecipitated proteins were loaded (lower part). This is a representative experiment out of a total of three. W, Western blot assay; IP, immunoprecipitation.

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: MPA induces association of Stat3 with PR. (A) C4HD cells were treated with 10 nM MPA for the indicated times or preincubated with PP2 before MPA treatment for 5 min, and PR was immunoprecipitated from 500 μg of protein extracts. As a control, lysates were also immunoprecipitated with normal mouse serum (NMS). Immunocomplexes were subjected to SDS-PAGE and analyzed by Western blotting with an anti-Stat3 antibody (upper part). Twenty micrograms of protein from cell extracts was directly immunoblotted with the Stat3 antibody (last lane, upper part). Identical aliquots of each immunoprecipitate were subjected to immunoblot analysis with anti-PR antibody to verify that nearly equal amounts of immunoprecipitated proteins were loaded (lower part). (B) Protein lysates (500 μg) from cells treated as indicated in panel A were immunoprecipitated with an anti-Stat3 antibody or with normal rabbit serum (NRS). Immunocomplexes were subjected to SDS-PAGE and analyzed by Western blotting with an anti-PR antibody (upper part). Twenty micrograms of protein from cell extracts was directly immunoblotted with the PR antibody (last lane, upper part). Identical aliquots of each immunoprecipitate were subjected to immunoblot analysis with anti-Stat3 antibody to verify that nearly equal amounts of immunoprecipitated proteins were loaded (lower part). This is a representative experiment out of a total of three. W, Western blot assay; IP, immunoprecipitation.

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Immunoprecipitation, SDS Page, Western Blot

    MPA induces Stat3 transcriptional activation. C4HD (A) and T47D (B) cells were transiently transfected with 2 μg/well of a luciferase reporter plasmid containing four copies of the m67 high-affinity binding site and with 1 μg/well of a CMV-βgal expression vector as an internal control. In the indicated lanes, C4HD cells were cotransfected with the DN Jak1 and DN Jak2 expression vectors or pretreated with PP2. Cells were also transfected with a pTATA-Luc reporter lacking the m67 insertion. The total amount of transfected DNA was standardized by adding the empty vector. After transfection, cells were treated with MPA and MPA-RU486 at 37°C for 48 h or left untreated growing in ChFCS. C4HD cells were then harvested and lysed. Luciferase and β-galactosidase activities were measured as described in Materials and Methods. Results are presented as n -fold induction of luciferase activity with respect to cells growing in ChFCS. The data shown represent the mean of six independent experiments ± the standard error of the mean. For b versus a and c versus b, P

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: MPA induces Stat3 transcriptional activation. C4HD (A) and T47D (B) cells were transiently transfected with 2 μg/well of a luciferase reporter plasmid containing four copies of the m67 high-affinity binding site and with 1 μg/well of a CMV-βgal expression vector as an internal control. In the indicated lanes, C4HD cells were cotransfected with the DN Jak1 and DN Jak2 expression vectors or pretreated with PP2. Cells were also transfected with a pTATA-Luc reporter lacking the m67 insertion. The total amount of transfected DNA was standardized by adding the empty vector. After transfection, cells were treated with MPA and MPA-RU486 at 37°C for 48 h or left untreated growing in ChFCS. C4HD cells were then harvested and lysed. Luciferase and β-galactosidase activities were measured as described in Materials and Methods. Results are presented as n -fold induction of luciferase activity with respect to cells growing in ChFCS. The data shown represent the mean of six independent experiments ± the standard error of the mean. For b versus a and c versus b, P

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Activation Assay, Transfection, Luciferase, Plasmid Preparation, Binding Assay, Expressing, Activity Assay

    Nuclear translocation of STAT3 was suppressed by ursolic acid in HCT116 cells. The localization of STAT3 (red) and 4,6-diamidino-2-phenylindole (DAPI) (blue) in HCT116 cells. HCT116 cells were treated by ursolic acid for 24 h. STAT3 was probed with primary antibody and labelled using secondary antibody conjugated. Scale bar = 40 μm. Corresponding zoomed images of the STAT3, DAPI, and Merge (indicated by the yellow box).

    Journal: International Journal of Molecular Sciences

    Article Title: Ursolic Acid Induces Apoptosis in Colorectal Cancer Cells Partially via Upregulation of MicroRNA-4500 and Inhibition of JAK2/STAT3 Phosphorylation

    doi: 10.3390/ijms20010114

    Figure Lengend Snippet: Nuclear translocation of STAT3 was suppressed by ursolic acid in HCT116 cells. The localization of STAT3 (red) and 4,6-diamidino-2-phenylindole (DAPI) (blue) in HCT116 cells. HCT116 cells were treated by ursolic acid for 24 h. STAT3 was probed with primary antibody and labelled using secondary antibody conjugated. Scale bar = 40 μm. Corresponding zoomed images of the STAT3, DAPI, and Merge (indicated by the yellow box).

    Article Snippet: Fixed cells were incubated with the specific primary antibody of STAT3 antibody (Cell signaling, Boston, MA, USA) overnight at 4 °C.

    Techniques: Translocation Assay

    Down-regulation of miR-4500 attenuated cytotoxic and anti-proliferative effects of ursolic acid in HCT116 and HT29 cells. ( a ) Matched sequence (yellow box) of with mature miR-4500 and the STAT3. ( b ) Effect of ursolic acid on mRNA level of miR-4500 in HCT117 cells by qRT-PCR. ( c ) Effect of miR-4500 inhibitor on the cytotoxicity of ursolic acid in HCT116 and HT29 cells. The miR-4500 inhibitor and control plasmids were transfected into HCT116 and HT29 cells for 48 h and then exposed to ursolic acid for 24 h. Cell viability was determined by MTT assay. ( d ) Effect of miR-4500 on antiproliferative effect of ursolic acid by colony formation in HCT116 and HT29 cells for 2 weeks and colony formation assay was performed. ** p

    Journal: International Journal of Molecular Sciences

    Article Title: Ursolic Acid Induces Apoptosis in Colorectal Cancer Cells Partially via Upregulation of MicroRNA-4500 and Inhibition of JAK2/STAT3 Phosphorylation

    doi: 10.3390/ijms20010114

    Figure Lengend Snippet: Down-regulation of miR-4500 attenuated cytotoxic and anti-proliferative effects of ursolic acid in HCT116 and HT29 cells. ( a ) Matched sequence (yellow box) of with mature miR-4500 and the STAT3. ( b ) Effect of ursolic acid on mRNA level of miR-4500 in HCT117 cells by qRT-PCR. ( c ) Effect of miR-4500 inhibitor on the cytotoxicity of ursolic acid in HCT116 and HT29 cells. The miR-4500 inhibitor and control plasmids were transfected into HCT116 and HT29 cells for 48 h and then exposed to ursolic acid for 24 h. Cell viability was determined by MTT assay. ( d ) Effect of miR-4500 on antiproliferative effect of ursolic acid by colony formation in HCT116 and HT29 cells for 2 weeks and colony formation assay was performed. ** p

    Article Snippet: Fixed cells were incubated with the specific primary antibody of STAT3 antibody (Cell signaling, Boston, MA, USA) overnight at 4 °C.

    Techniques: Sequencing, Quantitative RT-PCR, Transfection, MTT Assay, Colony Assay

    Critical role of miR-4500 in apoptotic effect of ursolic acid in HCT116 cells. ( a ) Effect of miR-4500 inhibitor on the number of TUNEL positive cells in ursolic acid treated HCT116 cells by TUNEL assay. Scale bar = 40 μm. Bar graphs showed quantification of TUNEL-positive cells (%). ( b ) Effect of miR-4500 inhibitor on PARP, p-STAT3, and STAT3 in ursolic acid treated HCT116 cells. ( c ). * p

    Journal: International Journal of Molecular Sciences

    Article Title: Ursolic Acid Induces Apoptosis in Colorectal Cancer Cells Partially via Upregulation of MicroRNA-4500 and Inhibition of JAK2/STAT3 Phosphorylation

    doi: 10.3390/ijms20010114

    Figure Lengend Snippet: Critical role of miR-4500 in apoptotic effect of ursolic acid in HCT116 cells. ( a ) Effect of miR-4500 inhibitor on the number of TUNEL positive cells in ursolic acid treated HCT116 cells by TUNEL assay. Scale bar = 40 μm. Bar graphs showed quantification of TUNEL-positive cells (%). ( b ) Effect of miR-4500 inhibitor on PARP, p-STAT3, and STAT3 in ursolic acid treated HCT116 cells. ( c ). * p

    Article Snippet: Fixed cells were incubated with the specific primary antibody of STAT3 antibody (Cell signaling, Boston, MA, USA) overnight at 4 °C.

    Techniques: TUNEL Assay

    Activation of STAT3 is significantly impaired in the SCG and DRG of low and high dose diabetic mice. Cell counts were performed in the SCG ( a,b ) and DRG ( c,d ) for low dose ( a,c ) and high dose ( b,d ) diabetic mice. The percentage of HuD/C-positive neurons displaying positive staining for phosphorylated STAT3 in the nucleus was calculated. n=5–7/group. * = p

    Journal: Experimental neurology

    Article Title: Injury-Induced gp130 Cytokine Signaling in Peripheral Ganglia is Reduced in Diabetes Mellitus

    doi: 10.1016/j.expneurol.2017.06.020

    Figure Lengend Snippet: Activation of STAT3 is significantly impaired in the SCG and DRG of low and high dose diabetic mice. Cell counts were performed in the SCG ( a,b ) and DRG ( c,d ) for low dose ( a,c ) and high dose ( b,d ) diabetic mice. The percentage of HuD/C-positive neurons displaying positive staining for phosphorylated STAT3 in the nucleus was calculated. n=5–7/group. * = p

    Article Snippet: For quantification of STAT3, a rabbit monoclonal antibody to phosphorylated STAT3 (Y705; 1:100; Cell Signaling Technology, Danvers, MA, USA) was incubated with tissue sections overnight at room temperature.

    Techniques: Activation Assay, Mouse Assay, Staining

    FEZF1-AS1 promotes STAT3 expression. ( A ) FEZF1-AS1 knockdown inhibited the protein levels of p-STAT3 and STAT3 in ES2 cells. ( B ) Expression correlation between STAT3 and FEZF1-AS1 was determined by qRT-PCR in ovarian cancer tissues. * P

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    Article Title: Long Noncoding RNA FEZF1-AS1 Promotes Proliferation and Inhibits Apoptosis in Ovarian Cancer by Activation of JAK-STAT3 Pathway

    doi: 10.12659/MSM.911194

    Figure Lengend Snippet: FEZF1-AS1 promotes STAT3 expression. ( A ) FEZF1-AS1 knockdown inhibited the protein levels of p-STAT3 and STAT3 in ES2 cells. ( B ) Expression correlation between STAT3 and FEZF1-AS1 was determined by qRT-PCR in ovarian cancer tissues. * P

    Article Snippet: Then, the membranes were blocked with 5% nonfat milk and incubated with primary antibody against STAT3 (1: 2000, CST, #12460S), p-STAT3 (1: 2000, CST, #9145S) or GAPDH (1: 1,000; cat. no. sc-293335).

    Techniques: Expressing, Quantitative RT-PCR

    STAT3 knockdown suppresses ovarian cancer cell proliferation and induced apoptosis. ( A ) Western blot result indicated that STAT3 was effectively downregulated in ES2 cells transfected with siSTAT3. ( B ) CCK8 assays showed that STAT3 knockdown inhibited ES2 cell proliferation. ( C ) Cell cycle distribution was determined by FACS in ES2 cells transfected with siSTAT3 or control siRNA (NC). ( D ) STAT3 knockdown significantly promoted ES2 cell apoptosis. Cells were stained with Annexin V/PI. * P

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    Article Title: Long Noncoding RNA FEZF1-AS1 Promotes Proliferation and Inhibits Apoptosis in Ovarian Cancer by Activation of JAK-STAT3 Pathway

    doi: 10.12659/MSM.911194

    Figure Lengend Snippet: STAT3 knockdown suppresses ovarian cancer cell proliferation and induced apoptosis. ( A ) Western blot result indicated that STAT3 was effectively downregulated in ES2 cells transfected with siSTAT3. ( B ) CCK8 assays showed that STAT3 knockdown inhibited ES2 cell proliferation. ( C ) Cell cycle distribution was determined by FACS in ES2 cells transfected with siSTAT3 or control siRNA (NC). ( D ) STAT3 knockdown significantly promoted ES2 cell apoptosis. Cells were stained with Annexin V/PI. * P

    Article Snippet: Then, the membranes were blocked with 5% nonfat milk and incubated with primary antibody against STAT3 (1: 2000, CST, #12460S), p-STAT3 (1: 2000, CST, #9145S) or GAPDH (1: 1,000; cat. no. sc-293335).

    Techniques: Western Blot, Transfection, FACS, Staining

    Effect of expression STAT3-KD and expression of WT- STAT3 on GBMX10 GIC tumorigenicity GBMX10 iSTAT3-KD GICs (10 6 cells) transduced with luciferase-encoding lentivirus were injected into the flanks of NSG mice. After tumor induction was validated, Dox was delivered by oral gavage twice daily, and tumor development was monitored by live animal imaging. Representative bioluminescent images of mice injected with X10 iSTAT3-KD cells and then treated with Dox (X10 STAT3-KD) and rescued with WT-STAT3 (X10 STAT3 rescue) or not Dox-Treated (X10) at 21 days post-injection.

    Journal: Oncotarget

    Article Title: The critical role that STAT3 plays in glioma-initiating cells: STAT3 addiction in glioma

    doi: 10.18632/oncotarget.25188

    Figure Lengend Snippet: Effect of expression STAT3-KD and expression of WT- STAT3 on GBMX10 GIC tumorigenicity GBMX10 iSTAT3-KD GICs (10 6 cells) transduced with luciferase-encoding lentivirus were injected into the flanks of NSG mice. After tumor induction was validated, Dox was delivered by oral gavage twice daily, and tumor development was monitored by live animal imaging. Representative bioluminescent images of mice injected with X10 iSTAT3-KD cells and then treated with Dox (X10 STAT3-KD) and rescued with WT-STAT3 (X10 STAT3 rescue) or not Dox-Treated (X10) at 21 days post-injection.

    Article Snippet: Protein extracts (50μg) were separated by SDS-PAGE, transferred to polyvinylidene difluoride membranes (Millipore, Burlington, MA), and immunoblotted with the following antibodies: STAT3 and pS727-STAT3 (BD Biosciences, San Jose, CA), pY705-STAT3 (Abcam, Cambridge, A), STAT1 and STAT5 (Cell Signaling, Danvers, MA), and Actin (Santa Cruz Biotechnology, Dallas, TX).

    Techniques: Expressing, Transduction, Luciferase, Injection, Mouse Assay, Imaging

    Effect of STAT3-KD on gene expression as determined by RNA-Seq RNA-Seq analysis was performed on RNA prepared from GBMX16 GICs not treated with Dox, GBMX16 GICs treated with Dox (STAT3-KD GICs), and WT-STAT3 rescued STAT3-KD GICs. (A) Concordance plot of genes positively (green) and negatively (red) regulated by STAT3 using a 1.5-fold cut-off. (B) Heat maps of STAT3-regulated genes involved in the cell cycle, TGFβ pathway, hypoxia response, and extracellular matrix.

    Journal: Oncotarget

    Article Title: The critical role that STAT3 plays in glioma-initiating cells: STAT3 addiction in glioma

    doi: 10.18632/oncotarget.25188

    Figure Lengend Snippet: Effect of STAT3-KD on gene expression as determined by RNA-Seq RNA-Seq analysis was performed on RNA prepared from GBMX16 GICs not treated with Dox, GBMX16 GICs treated with Dox (STAT3-KD GICs), and WT-STAT3 rescued STAT3-KD GICs. (A) Concordance plot of genes positively (green) and negatively (red) regulated by STAT3 using a 1.5-fold cut-off. (B) Heat maps of STAT3-regulated genes involved in the cell cycle, TGFβ pathway, hypoxia response, and extracellular matrix.

    Article Snippet: Protein extracts (50μg) were separated by SDS-PAGE, transferred to polyvinylidene difluoride membranes (Millipore, Burlington, MA), and immunoblotted with the following antibodies: STAT3 and pS727-STAT3 (BD Biosciences, San Jose, CA), pY705-STAT3 (Abcam, Cambridge, A), STAT1 and STAT5 (Cell Signaling, Danvers, MA), and Actin (Santa Cruz Biotechnology, Dallas, TX).

    Techniques: Expressing, RNA Sequencing Assay

    Effect of STAT3-KD on gene expression as determined by Nanostring array panels Total RNA was prepared from STAT3-KD and control GBMX16 GICs and gene expression profiling was conducted on the nCounter Analysis System using the PanCancer Progression, Neuropathology the PanCancer Immune Profiling Panels. Heat maps of STAT3-regulated genes are shown.

    Journal: Oncotarget

    Article Title: The critical role that STAT3 plays in glioma-initiating cells: STAT3 addiction in glioma

    doi: 10.18632/oncotarget.25188

    Figure Lengend Snippet: Effect of STAT3-KD on gene expression as determined by Nanostring array panels Total RNA was prepared from STAT3-KD and control GBMX16 GICs and gene expression profiling was conducted on the nCounter Analysis System using the PanCancer Progression, Neuropathology the PanCancer Immune Profiling Panels. Heat maps of STAT3-regulated genes are shown.

    Article Snippet: Protein extracts (50μg) were separated by SDS-PAGE, transferred to polyvinylidene difluoride membranes (Millipore, Burlington, MA), and immunoblotted with the following antibodies: STAT3 and pS727-STAT3 (BD Biosciences, San Jose, CA), pY705-STAT3 (Abcam, Cambridge, A), STAT1 and STAT5 (Cell Signaling, Danvers, MA), and Actin (Santa Cruz Biotechnology, Dallas, TX).

    Techniques: Expressing

    Identification of downstream effectors of STAT3 in GBM tumor specimens The expression of STAT3 and its targeted genes identified in the GBMX16 GICs by RNA-seq was examined in 528 GBM specimens included in the TCGA database. (A) Expression levels of STAT3 mRNA in GBM tumors and adjacent normal tissues. (B) Survival curves of GBM with high or low expression of STAT3. (C) Correlation between STAT3 expression and averaged expression level of STAT3-activated genes in GBM as listed in the inserted table. (D) Survival curves of GBM with high or low expression of STAT3-activated genes. (E) Outcome parameters from correlation analysis of the expression levels of STAT3-target genes and STAT3, and outcome parameters from survival curve comparison of GBM with high (top 25%) and low (bottom 25%) expression of STAT3 or its target genes.

    Journal: Oncotarget

    Article Title: The critical role that STAT3 plays in glioma-initiating cells: STAT3 addiction in glioma

    doi: 10.18632/oncotarget.25188

    Figure Lengend Snippet: Identification of downstream effectors of STAT3 in GBM tumor specimens The expression of STAT3 and its targeted genes identified in the GBMX16 GICs by RNA-seq was examined in 528 GBM specimens included in the TCGA database. (A) Expression levels of STAT3 mRNA in GBM tumors and adjacent normal tissues. (B) Survival curves of GBM with high or low expression of STAT3. (C) Correlation between STAT3 expression and averaged expression level of STAT3-activated genes in GBM as listed in the inserted table. (D) Survival curves of GBM with high or low expression of STAT3-activated genes. (E) Outcome parameters from correlation analysis of the expression levels of STAT3-target genes and STAT3, and outcome parameters from survival curve comparison of GBM with high (top 25%) and low (bottom 25%) expression of STAT3 or its target genes.

    Article Snippet: Protein extracts (50μg) were separated by SDS-PAGE, transferred to polyvinylidene difluoride membranes (Millipore, Burlington, MA), and immunoblotted with the following antibodies: STAT3 and pS727-STAT3 (BD Biosciences, San Jose, CA), pY705-STAT3 (Abcam, Cambridge, A), STAT1 and STAT5 (Cell Signaling, Danvers, MA), and Actin (Santa Cruz Biotechnology, Dallas, TX).

    Techniques: Expressing, RNA Sequencing Assay

    STAT3 phosphorylation and tumorigenicity of GICs and GICs induced to differentiate GICs were grown under stem cell conditions or induced to differentiate in the presence of serum. (A) Protein lysates were immunoblotted for pY705-STAT3, pS727-STAT3 and total STAT3. (B) Tumorigenicity was assessed by injection of 10 6 tumor cells into the flanks of NSG mice and tumors were palpated every week.

    Journal: Oncotarget

    Article Title: The critical role that STAT3 plays in glioma-initiating cells: STAT3 addiction in glioma

    doi: 10.18632/oncotarget.25188

    Figure Lengend Snippet: STAT3 phosphorylation and tumorigenicity of GICs and GICs induced to differentiate GICs were grown under stem cell conditions or induced to differentiate in the presence of serum. (A) Protein lysates were immunoblotted for pY705-STAT3, pS727-STAT3 and total STAT3. (B) Tumorigenicity was assessed by injection of 10 6 tumor cells into the flanks of NSG mice and tumors were palpated every week.

    Article Snippet: Protein extracts (50μg) were separated by SDS-PAGE, transferred to polyvinylidene difluoride membranes (Millipore, Burlington, MA), and immunoblotted with the following antibodies: STAT3 and pS727-STAT3 (BD Biosciences, San Jose, CA), pY705-STAT3 (Abcam, Cambridge, A), STAT1 and STAT5 (Cell Signaling, Danvers, MA), and Actin (Santa Cruz Biotechnology, Dallas, TX).

    Techniques: Injection, Mouse Assay

    The effect of STAT3-KD and expression of STAT3 phosphorylation-defective mutants on STAT3 phosphorylation and GIC proliferation GBMX10 and GBMX16 GICs were transduced with a lentiviral vector containing a Dox-inducible shRNA against STAT3, and then transduced with wild type (WT) and mutant (Y705F and S727A) STAT3 constructs to restore STAT3 expression. (A) Cell lysates were analyzed by immunoblotting for pY705-STAT3, pS727-STAT3 and total STAT3. (B) Proliferation of control and STAT3-KD GBMX10 and GBMX16 GICs was determined CellTiter-Glo assays. (C) CellTiter-Glo based proliferation assays with the GBMX16 GICs harboring the STAT3 mutants and WT-STAT3 in the iSTAT3-KD background.

    Journal: Oncotarget

    Article Title: The critical role that STAT3 plays in glioma-initiating cells: STAT3 addiction in glioma

    doi: 10.18632/oncotarget.25188

    Figure Lengend Snippet: The effect of STAT3-KD and expression of STAT3 phosphorylation-defective mutants on STAT3 phosphorylation and GIC proliferation GBMX10 and GBMX16 GICs were transduced with a lentiviral vector containing a Dox-inducible shRNA against STAT3, and then transduced with wild type (WT) and mutant (Y705F and S727A) STAT3 constructs to restore STAT3 expression. (A) Cell lysates were analyzed by immunoblotting for pY705-STAT3, pS727-STAT3 and total STAT3. (B) Proliferation of control and STAT3-KD GBMX10 and GBMX16 GICs was determined CellTiter-Glo assays. (C) CellTiter-Glo based proliferation assays with the GBMX16 GICs harboring the STAT3 mutants and WT-STAT3 in the iSTAT3-KD background.

    Article Snippet: Protein extracts (50μg) were separated by SDS-PAGE, transferred to polyvinylidene difluoride membranes (Millipore, Burlington, MA), and immunoblotted with the following antibodies: STAT3 and pS727-STAT3 (BD Biosciences, San Jose, CA), pY705-STAT3 (Abcam, Cambridge, A), STAT1 and STAT5 (Cell Signaling, Danvers, MA), and Actin (Santa Cruz Biotechnology, Dallas, TX).

    Techniques: Expressing, Transduction, Plasmid Preparation, shRNA, Mutagenesis, Construct

    Effect of STAT3-KD on GBMX16 GIC tumorigenicity GBMX16 iSTAT3-KD GICs (10 6 cells) transduced with luciferase-encoding lentivirus were injected into the flanks of NSG mice. After tumor induction was validated, Dox was delivered by oral gavage twice daily, and tumor development was monitored by bioluminescence imaging (BLI). (A) Schematic of xenograft mouse experiments. (B) Representative bioluminescent images of mice injected with X16 iSTAT3-KD cells or harboring WT-STAT3, and then treated with Dox (X16 STAT-KD or X16 WT-STAT3) or not Dox-Treated (X16) at 21 days post-injection. (C) Photographs of the tumors extracted from the mice on the day of the sacrifice. (D) Quantification of the bioluminescence signal detected at 1, 2 and 3 weeks post-injection. (E) H E and Ki67 staining of tumor tissue at necropsy.

    Journal: Oncotarget

    Article Title: The critical role that STAT3 plays in glioma-initiating cells: STAT3 addiction in glioma

    doi: 10.18632/oncotarget.25188

    Figure Lengend Snippet: Effect of STAT3-KD on GBMX16 GIC tumorigenicity GBMX16 iSTAT3-KD GICs (10 6 cells) transduced with luciferase-encoding lentivirus were injected into the flanks of NSG mice. After tumor induction was validated, Dox was delivered by oral gavage twice daily, and tumor development was monitored by bioluminescence imaging (BLI). (A) Schematic of xenograft mouse experiments. (B) Representative bioluminescent images of mice injected with X16 iSTAT3-KD cells or harboring WT-STAT3, and then treated with Dox (X16 STAT-KD or X16 WT-STAT3) or not Dox-Treated (X16) at 21 days post-injection. (C) Photographs of the tumors extracted from the mice on the day of the sacrifice. (D) Quantification of the bioluminescence signal detected at 1, 2 and 3 weeks post-injection. (E) H E and Ki67 staining of tumor tissue at necropsy.

    Article Snippet: Protein extracts (50μg) were separated by SDS-PAGE, transferred to polyvinylidene difluoride membranes (Millipore, Burlington, MA), and immunoblotted with the following antibodies: STAT3 and pS727-STAT3 (BD Biosciences, San Jose, CA), pY705-STAT3 (Abcam, Cambridge, A), STAT1 and STAT5 (Cell Signaling, Danvers, MA), and Actin (Santa Cruz Biotechnology, Dallas, TX).

    Techniques: Transduction, Luciferase, Injection, Mouse Assay, Imaging, Staining

    Effect of expression of STAT3 mutants on GBMX16 STAT3-KD GIC tumorigenicity Xenograft study was performed as in Figure 4 with GBMX16 iSTAT3-KD GICs rescued with Y705F-STAT3 or S727A-STAT3. (A) Representative bioluminescent images of mice at 21 days post-injection. (B) Quantification of the bioluminescence signal detected at 1, 2 and 3 weeks post-injection. (C) Photographs of the tumors extracted from the mice at necropsy. (D) H E and Ki67 staining of tumor tissue at necropsy.

    Journal: Oncotarget

    Article Title: The critical role that STAT3 plays in glioma-initiating cells: STAT3 addiction in glioma

    doi: 10.18632/oncotarget.25188

    Figure Lengend Snippet: Effect of expression of STAT3 mutants on GBMX16 STAT3-KD GIC tumorigenicity Xenograft study was performed as in Figure 4 with GBMX16 iSTAT3-KD GICs rescued with Y705F-STAT3 or S727A-STAT3. (A) Representative bioluminescent images of mice at 21 days post-injection. (B) Quantification of the bioluminescence signal detected at 1, 2 and 3 weeks post-injection. (C) Photographs of the tumors extracted from the mice at necropsy. (D) H E and Ki67 staining of tumor tissue at necropsy.

    Article Snippet: Protein extracts (50μg) were separated by SDS-PAGE, transferred to polyvinylidene difluoride membranes (Millipore, Burlington, MA), and immunoblotted with the following antibodies: STAT3 and pS727-STAT3 (BD Biosciences, San Jose, CA), pY705-STAT3 (Abcam, Cambridge, A), STAT1 and STAT5 (Cell Signaling, Danvers, MA), and Actin (Santa Cruz Biotechnology, Dallas, TX).

    Techniques: Expressing, Mouse Assay, Injection, Staining

    Role of STAT3 on MT330 GBM cell proliferation and tumorigenicity MT330 cells were transduced with empty vector (EV), STAT3 was deleted by CRISPR/Cas9 gene editing (STAT3-KO cells) and STAT3-KO cells were rescued with enforced expression of WT-STAT3. (A) Cell lysates were analyzed by immunoblotting for pY705-STAT3 and total STAT3. (B) Cell proliferation was determined CellTiter-Glo assays. (C) Tumorigenicity was assessed by injection of 10 6 tumor cells into the brains of NSG mice and live animal imaging was performed at 21 days post-injection.

    Journal: Oncotarget

    Article Title: The critical role that STAT3 plays in glioma-initiating cells: STAT3 addiction in glioma

    doi: 10.18632/oncotarget.25188

    Figure Lengend Snippet: Role of STAT3 on MT330 GBM cell proliferation and tumorigenicity MT330 cells were transduced with empty vector (EV), STAT3 was deleted by CRISPR/Cas9 gene editing (STAT3-KO cells) and STAT3-KO cells were rescued with enforced expression of WT-STAT3. (A) Cell lysates were analyzed by immunoblotting for pY705-STAT3 and total STAT3. (B) Cell proliferation was determined CellTiter-Glo assays. (C) Tumorigenicity was assessed by injection of 10 6 tumor cells into the brains of NSG mice and live animal imaging was performed at 21 days post-injection.

    Article Snippet: Protein extracts (50μg) were separated by SDS-PAGE, transferred to polyvinylidene difluoride membranes (Millipore, Burlington, MA), and immunoblotted with the following antibodies: STAT3 and pS727-STAT3 (BD Biosciences, San Jose, CA), pY705-STAT3 (Abcam, Cambridge, A), STAT1 and STAT5 (Cell Signaling, Danvers, MA), and Actin (Santa Cruz Biotechnology, Dallas, TX).

    Techniques: Transduction, Plasmid Preparation, CRISPR, Expressing, Injection, Mouse Assay, Imaging

    The inhibition of the STAT1/STAT3 signaling reverses the kynurenine-dependent immunosuppression in multidrug resistant cells. A549/dx cells were grown for 48 h in fresh medium (CTRL), treated with a non-targeting scrambled siRNA (scr) or with a specific siRNAs pool targeting STAT1 or STAT3, respectively (si STAT1, si STAT3). Untreated chemosensitive A549 cells were used as control. A . The expression of STAT1, STAT3, IDO1, IDO2 and TDO was measured in whole cell lysates by Western blotting, 48 h after the transfection. The β-tubulin expression was used as control of equal protein loading. The figure is representative of 3 experiments with similar results. B . The kynurenine levels in the cell culture supernatants were measured spectrophotometrically. Data are presented as means ± SD (n = 4). * p

    Journal: PLoS ONE

    Article Title: An Autocrine Cytokine/JAK/STAT-Signaling Induces Kynurenine Synthesis in Multidrug Resistant Human Cancer Cells

    doi: 10.1371/journal.pone.0126159

    Figure Lengend Snippet: The inhibition of the STAT1/STAT3 signaling reverses the kynurenine-dependent immunosuppression in multidrug resistant cells. A549/dx cells were grown for 48 h in fresh medium (CTRL), treated with a non-targeting scrambled siRNA (scr) or with a specific siRNAs pool targeting STAT1 or STAT3, respectively (si STAT1, si STAT3). Untreated chemosensitive A549 cells were used as control. A . The expression of STAT1, STAT3, IDO1, IDO2 and TDO was measured in whole cell lysates by Western blotting, 48 h after the transfection. The β-tubulin expression was used as control of equal protein loading. The figure is representative of 3 experiments with similar results. B . The kynurenine levels in the cell culture supernatants were measured spectrophotometrically. Data are presented as means ± SD (n = 4). * p

    Article Snippet: 20 μg of proteins from cell lysates were subjected to Western blotting and probed with the following antibodies against: IDO1 (rabbit polyclonal, diluted 1:2,000, AG-25A-0029, Adipogen, San Diego, CA); IDO2 (mouse monoclonal, diluted 1:500, SAB3701447, Sigma Chemical Co.); TDO (rabbit polyclonal, diluted 1:1,000, SAB2102400, Sigma Chemical Co.); phospho(Tyr 1022/1023)-JAK1 (rabbit polyclonal, diluted 1:1,000, #3331, Cell Signaling Technology, Danvers, MA); JAK1 (rabbit polyclonal, diluted 1:1,000, #3344, Cell Signaling Technology); phospho(Tyr701)-STAT1 (rabbit polyclonal, diluted 1:1,000, #9167, Cell Signaling Technology); STAT1 (mouse monoclonal, diluted 1:1,000, clone 15H3, Thermo Scientific, Rockford, IL); phospho(Tyr705)-STAT3 (rabbit polyclonal, diluted 1:2,000, #9145, Cell Signaling Technology); STAT3 (mouse monoclonal, diluted 1:5,000, clone 9D8, Thermo Scientific); Pgp (rabbit polyclonal, diluted 1:250, sc-8313, Santa Cruz Biotechnology Inc.); MRP1 (mouse monoclonal, diluted 1:100, ab32574, Abcam, Cambridge, UK); MRP2 (mouse monoclonal, diluted 1:100, ab3373, Abcam); MRP3 (goat polyclonal, diluted 1:250, sc-5776, Santa Cruz Biotechnology Inc.); MRP4 (goat polyclonal, diluted 1:250, ab77184, Abcam); MRP5 (goat polyclonal, diluted 1:250, sc-5781, Santa Cruz Biotechnology Inc.); BCRP (rabbit polyclonal, diluted 1:500, sc-25882, Santa Cruz Biotechnology Inc.); β-tubulin (mouse monoclonal, diluted 1:500, sc-5274, Santa Cruz Biotechnology Inc.), followed by a secondary peroxidase-conjugated antibody (Bio-Rad Laboratories).

    Techniques: Inhibition, Expressing, Western Blot, Transfection, Cell Culture

    Multidrug resistant cells have a higher activity of IL-6/STAT3 signaling than chemosensitive cells. A. The cDNA from A549 and A549/dx cells was analyzed by a PCR array specific for IL-6/STAT3 signaling, as reported under Materials and methods. The fold regulation of the 83 genes analyzed, expressed in logarithmic scale, was represented in a colorimetric scale. The figure is the mean of 4 experiments. B. The levels of IL-6, IL-4, IL-1β, IL-13, CD40L, IFN-γ were measured in the cell culture supernatants by specific ELISAs. Data are presented as means ± SD (n = 3). * p

    Journal: PLoS ONE

    Article Title: An Autocrine Cytokine/JAK/STAT-Signaling Induces Kynurenine Synthesis in Multidrug Resistant Human Cancer Cells

    doi: 10.1371/journal.pone.0126159

    Figure Lengend Snippet: Multidrug resistant cells have a higher activity of IL-6/STAT3 signaling than chemosensitive cells. A. The cDNA from A549 and A549/dx cells was analyzed by a PCR array specific for IL-6/STAT3 signaling, as reported under Materials and methods. The fold regulation of the 83 genes analyzed, expressed in logarithmic scale, was represented in a colorimetric scale. The figure is the mean of 4 experiments. B. The levels of IL-6, IL-4, IL-1β, IL-13, CD40L, IFN-γ were measured in the cell culture supernatants by specific ELISAs. Data are presented as means ± SD (n = 3). * p

    Article Snippet: 20 μg of proteins from cell lysates were subjected to Western blotting and probed with the following antibodies against: IDO1 (rabbit polyclonal, diluted 1:2,000, AG-25A-0029, Adipogen, San Diego, CA); IDO2 (mouse monoclonal, diluted 1:500, SAB3701447, Sigma Chemical Co.); TDO (rabbit polyclonal, diluted 1:1,000, SAB2102400, Sigma Chemical Co.); phospho(Tyr 1022/1023)-JAK1 (rabbit polyclonal, diluted 1:1,000, #3331, Cell Signaling Technology, Danvers, MA); JAK1 (rabbit polyclonal, diluted 1:1,000, #3344, Cell Signaling Technology); phospho(Tyr701)-STAT1 (rabbit polyclonal, diluted 1:1,000, #9167, Cell Signaling Technology); STAT1 (mouse monoclonal, diluted 1:1,000, clone 15H3, Thermo Scientific, Rockford, IL); phospho(Tyr705)-STAT3 (rabbit polyclonal, diluted 1:2,000, #9145, Cell Signaling Technology); STAT3 (mouse monoclonal, diluted 1:5,000, clone 9D8, Thermo Scientific); Pgp (rabbit polyclonal, diluted 1:250, sc-8313, Santa Cruz Biotechnology Inc.); MRP1 (mouse monoclonal, diluted 1:100, ab32574, Abcam, Cambridge, UK); MRP2 (mouse monoclonal, diluted 1:100, ab3373, Abcam); MRP3 (goat polyclonal, diluted 1:250, sc-5776, Santa Cruz Biotechnology Inc.); MRP4 (goat polyclonal, diluted 1:250, ab77184, Abcam); MRP5 (goat polyclonal, diluted 1:250, sc-5781, Santa Cruz Biotechnology Inc.); BCRP (rabbit polyclonal, diluted 1:500, sc-25882, Santa Cruz Biotechnology Inc.); β-tubulin (mouse monoclonal, diluted 1:500, sc-5274, Santa Cruz Biotechnology Inc.), followed by a secondary peroxidase-conjugated antibody (Bio-Rad Laboratories).

    Techniques: Activity Assay, Polymerase Chain Reaction, Cell Culture

    Multidrug resistant cells have a higher activity of JAK/STAT signaling than chemosensitive cells. A. The cDNA from A549 and A549/dx cells was analyzed by a PCR array specific for JAK/STAT signaling, as reported under Materials and methods. The fold regulation of the 83 genes analyzed, expressed in logarithmic scale, is represented in a colorimetric scale. The figure is the mean of 4 experiments. B. The cells were lysed and subjected to the Western blot analysis for phospho(Tyr 1022/1023)-JAK1, JAK1, phospho(Tyr701)-STAT1, STAT1, phospho(Tyr705)-STAT3, STAT3. The β-tubulin expression was used as control of equal protein loading. The figure is representative of 3 experiments with similar results. C. The expression of PIAS1, PIAS3, phospho(Tyr701)-STAT1, STAT1, phospho(Tyr705)-STAT3, STAT3 in nuclear extracts was measured by Western blotting. The TBP expression was used as control of equal protein loading. The figure is representative of 3 experiments with similar results.

    Journal: PLoS ONE

    Article Title: An Autocrine Cytokine/JAK/STAT-Signaling Induces Kynurenine Synthesis in Multidrug Resistant Human Cancer Cells

    doi: 10.1371/journal.pone.0126159

    Figure Lengend Snippet: Multidrug resistant cells have a higher activity of JAK/STAT signaling than chemosensitive cells. A. The cDNA from A549 and A549/dx cells was analyzed by a PCR array specific for JAK/STAT signaling, as reported under Materials and methods. The fold regulation of the 83 genes analyzed, expressed in logarithmic scale, is represented in a colorimetric scale. The figure is the mean of 4 experiments. B. The cells were lysed and subjected to the Western blot analysis for phospho(Tyr 1022/1023)-JAK1, JAK1, phospho(Tyr701)-STAT1, STAT1, phospho(Tyr705)-STAT3, STAT3. The β-tubulin expression was used as control of equal protein loading. The figure is representative of 3 experiments with similar results. C. The expression of PIAS1, PIAS3, phospho(Tyr701)-STAT1, STAT1, phospho(Tyr705)-STAT3, STAT3 in nuclear extracts was measured by Western blotting. The TBP expression was used as control of equal protein loading. The figure is representative of 3 experiments with similar results.

    Article Snippet: 20 μg of proteins from cell lysates were subjected to Western blotting and probed with the following antibodies against: IDO1 (rabbit polyclonal, diluted 1:2,000, AG-25A-0029, Adipogen, San Diego, CA); IDO2 (mouse monoclonal, diluted 1:500, SAB3701447, Sigma Chemical Co.); TDO (rabbit polyclonal, diluted 1:1,000, SAB2102400, Sigma Chemical Co.); phospho(Tyr 1022/1023)-JAK1 (rabbit polyclonal, diluted 1:1,000, #3331, Cell Signaling Technology, Danvers, MA); JAK1 (rabbit polyclonal, diluted 1:1,000, #3344, Cell Signaling Technology); phospho(Tyr701)-STAT1 (rabbit polyclonal, diluted 1:1,000, #9167, Cell Signaling Technology); STAT1 (mouse monoclonal, diluted 1:1,000, clone 15H3, Thermo Scientific, Rockford, IL); phospho(Tyr705)-STAT3 (rabbit polyclonal, diluted 1:2,000, #9145, Cell Signaling Technology); STAT3 (mouse monoclonal, diluted 1:5,000, clone 9D8, Thermo Scientific); Pgp (rabbit polyclonal, diluted 1:250, sc-8313, Santa Cruz Biotechnology Inc.); MRP1 (mouse monoclonal, diluted 1:100, ab32574, Abcam, Cambridge, UK); MRP2 (mouse monoclonal, diluted 1:100, ab3373, Abcam); MRP3 (goat polyclonal, diluted 1:250, sc-5776, Santa Cruz Biotechnology Inc.); MRP4 (goat polyclonal, diluted 1:250, ab77184, Abcam); MRP5 (goat polyclonal, diluted 1:250, sc-5781, Santa Cruz Biotechnology Inc.); BCRP (rabbit polyclonal, diluted 1:500, sc-25882, Santa Cruz Biotechnology Inc.); β-tubulin (mouse monoclonal, diluted 1:500, sc-5274, Santa Cruz Biotechnology Inc.), followed by a secondary peroxidase-conjugated antibody (Bio-Rad Laboratories).

    Techniques: Activity Assay, Polymerase Chain Reaction, Western Blot, Expressing

    The gemcitabine-erlotinib (E+G) combination group inhibits the activity of the JAK-STAT pathway, as well as the expression of downstream HIF-1α, cyclin D1 and p53. (A and B) The protein levels of phosphorylated STAT3 Tyr 705 (p-STAT3 Tyr 705 ), HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells were analyzed by western blotting, respectively. (C and D) The protein expression of p-STAT3 Tyr 705 , HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells was calculated using one-way ANOVA. *P

    Journal: Oncology Reports

    Article Title: Combination of gemcitabine and erlotinib inhibits recurrent pancreatic cancer growth in mice via the JAK-STAT pathway

    doi: 10.3892/or.2018.6198

    Figure Lengend Snippet: The gemcitabine-erlotinib (E+G) combination group inhibits the activity of the JAK-STAT pathway, as well as the expression of downstream HIF-1α, cyclin D1 and p53. (A and B) The protein levels of phosphorylated STAT3 Tyr 705 (p-STAT3 Tyr 705 ), HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells were analyzed by western blotting, respectively. (C and D) The protein expression of p-STAT3 Tyr 705 , HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells was calculated using one-way ANOVA. *P

    Article Snippet: The following primary antibodies were used: anti-JAK1 (rabbit polyclonal; cat. no. AF5012), phospho-JAK1 (Tyr1022 ) (rabbit polyclonal; cat. no. AF2012), anti-JAK2 (rabbit polyclonal; cat. no. AF6022), phospho-JAK2 (Tyr221 ) (rabbit polyclonal; cat. no. AF3023), anti-JAK3 (mouse monoclonal; cat. no. BF0256), phospho-JAK3 (Tyr981 ) (rabbit polyclonal; cat. no. AF8160), phospho-STAT1 (Tyr701 ) (rabbit polyclonal; cat. no. AF3300) and anti-STAT1 (rabbit polyclonal; cat. no. AF6300) were all purchased from Affinity Biosciences (Cambridge, UK); anti-STAT3 (rabbit monoclonal; cat. no. ab76315), and anti-pSTAT3 Try705 (rabbit monoclonal; cat. no. ab68153) were obtained from Abcam (Cambridge, MA, USA); anti-HIF-1α (rabbit polyclonal; cat. no. BS3514) and anti-cyclin D1 (rabbit polyclonal; cat. no. BS6532) were purchased from Bioworld Technology Co., Ltd. (Nanjing, China); anti-p53 (rabbit, monoclonal; cat. no. 2527) was acquired from Cell Signaling Technology, Inc. (Danvers, MA, USA); while GAPDH was purchased from EarthOx Life Sciences (Millbrae, CA, USA).

    Techniques: Activity Assay, Expressing, Western Blot

    Schematic representation indicates that gemcitabine-erlotinib combination inhibits recurrent pancreatic tumor growth via JAK/STAT signaling. The gemcitabine-erlotinib combination significantly suppressed the phosphorylation levels of JAK1, JAK2, JAK3 as well as downstream STAT3 and STAT1 and eventually inhibited the growth of recurrent pancreatic tumors.

    Journal: Oncology Reports

    Article Title: Combination of gemcitabine and erlotinib inhibits recurrent pancreatic cancer growth in mice via the JAK-STAT pathway

    doi: 10.3892/or.2018.6198

    Figure Lengend Snippet: Schematic representation indicates that gemcitabine-erlotinib combination inhibits recurrent pancreatic tumor growth via JAK/STAT signaling. The gemcitabine-erlotinib combination significantly suppressed the phosphorylation levels of JAK1, JAK2, JAK3 as well as downstream STAT3 and STAT1 and eventually inhibited the growth of recurrent pancreatic tumors.

    Article Snippet: The following primary antibodies were used: anti-JAK1 (rabbit polyclonal; cat. no. AF5012), phospho-JAK1 (Tyr1022 ) (rabbit polyclonal; cat. no. AF2012), anti-JAK2 (rabbit polyclonal; cat. no. AF6022), phospho-JAK2 (Tyr221 ) (rabbit polyclonal; cat. no. AF3023), anti-JAK3 (mouse monoclonal; cat. no. BF0256), phospho-JAK3 (Tyr981 ) (rabbit polyclonal; cat. no. AF8160), phospho-STAT1 (Tyr701 ) (rabbit polyclonal; cat. no. AF3300) and anti-STAT1 (rabbit polyclonal; cat. no. AF6300) were all purchased from Affinity Biosciences (Cambridge, UK); anti-STAT3 (rabbit monoclonal; cat. no. ab76315), and anti-pSTAT3 Try705 (rabbit monoclonal; cat. no. ab68153) were obtained from Abcam (Cambridge, MA, USA); anti-HIF-1α (rabbit polyclonal; cat. no. BS3514) and anti-cyclin D1 (rabbit polyclonal; cat. no. BS6532) were purchased from Bioworld Technology Co., Ltd. (Nanjing, China); anti-p53 (rabbit, monoclonal; cat. no. 2527) was acquired from Cell Signaling Technology, Inc. (Danvers, MA, USA); while GAPDH was purchased from EarthOx Life Sciences (Millbrae, CA, USA).

    Techniques:

    Tyrosine phosphorylation and activation of Etk upon coexpression with v-Src in 293 cells. 293 cells were transiently transfected with wild-type (WT) or kinase-defective (KD), T7-tagged Etk and/or v-Src as indicated above each lane. Two days later, cells were lysed and the cell lysates were used for immunoprecipitations with anti-T7 antibody. (A) As shown on the left, the immunocomplexes were subjected to in vitro kinase assays in the presence of [γ- 32 P]ATP and enolase as an exogenous substrate. Phosphorylated proteins were separated by SDS-PAGE and detected by autoradiography. Kinase assay products similar to those of lanes 2 and 3 of the blot shown on the left were separated on a longer gel and detected by autoradiography. The estimated migration of STAT3 protein is indicated by the asterisk. (B) Immunocomplexes (lanes are as described for panel A) were resolved by SDS-PAGE and subjected to Western blotting (WB) with antiphosphotyrosine antibody (anti-PY) or anti-Etk antibody.

    Journal: Molecular and Cellular Biology

    Article Title: Etk, a Btk Family Tyrosine Kinase, Mediates Cellular Transformation by Linking Src to STAT3 Activation

    doi:

    Figure Lengend Snippet: Tyrosine phosphorylation and activation of Etk upon coexpression with v-Src in 293 cells. 293 cells were transiently transfected with wild-type (WT) or kinase-defective (KD), T7-tagged Etk and/or v-Src as indicated above each lane. Two days later, cells were lysed and the cell lysates were used for immunoprecipitations with anti-T7 antibody. (A) As shown on the left, the immunocomplexes were subjected to in vitro kinase assays in the presence of [γ- 32 P]ATP and enolase as an exogenous substrate. Phosphorylated proteins were separated by SDS-PAGE and detected by autoradiography. Kinase assay products similar to those of lanes 2 and 3 of the blot shown on the left were separated on a longer gel and detected by autoradiography. The estimated migration of STAT3 protein is indicated by the asterisk. (B) Immunocomplexes (lanes are as described for panel A) were resolved by SDS-PAGE and subjected to Western blotting (WB) with antiphosphotyrosine antibody (anti-PY) or anti-Etk antibody.

    Article Snippet: Coimmunoprecipitation analysis showed that the PH domain deletion mutant could no longer associate with STAT3, suggesting that this domain is required for interacting with STAT3 (Fig. B).

    Techniques: Activation Assay, Transfection, In Vitro, SDS Page, Autoradiography, Kinase Assay, Migration, Western Blot

    ); PK, protein kinase domain. (B) Association of STAT3 with Etk or its deletion mutants. 293 cells were transfected with STAT3 and/or T7-tagged wild-type or mutant Etk as indicated. Cell lysates were immunoprecipitated with anti-T7 antibody, followed by Western blotting with anti-STAT3 antibody to detect Etk-bound STAT3 (top) or with anti-Etk antibody to demonstrate the expression of Etk and its mutants (middle). Similar cell lysates were subjected to Western blotting with anti-STAT3 antibody to detect the expression of STAT3 (bottom).

    Journal: Molecular and Cellular Biology

    Article Title: Etk, a Btk Family Tyrosine Kinase, Mediates Cellular Transformation by Linking Src to STAT3 Activation

    doi:

    Figure Lengend Snippet: ); PK, protein kinase domain. (B) Association of STAT3 with Etk or its deletion mutants. 293 cells were transfected with STAT3 and/or T7-tagged wild-type or mutant Etk as indicated. Cell lysates were immunoprecipitated with anti-T7 antibody, followed by Western blotting with anti-STAT3 antibody to detect Etk-bound STAT3 (top) or with anti-Etk antibody to demonstrate the expression of Etk and its mutants (middle). Similar cell lysates were subjected to Western blotting with anti-STAT3 antibody to detect the expression of STAT3 (bottom).

    Article Snippet: Coimmunoprecipitation analysis showed that the PH domain deletion mutant could no longer associate with STAT3, suggesting that this domain is required for interacting with STAT3 (Fig. B).

    Techniques: Transfection, Mutagenesis, Immunoprecipitation, Western Blot, Expressing

    Etk mediates the activation of STAT3 by v-Src. (A) The kinase-defective mutant of Etk (EtkKQ) functions as a dominant-negative mutant. The upper blot shows the expression levels of Etk and EtkKQ in parental WB cell and four stable cell lines as demonstrated by immunoblotting with anti-Etk antibody. The lower blot shows Etk kinase activities in WB and its stable lines. EtkKQ-M is a mixture of all four stable clones. Lysates of cells were immunoprecipitated with anti-Etk antibody, followed by in vitro kinase assays. The autophosphorylated Etk is shown. (B) Introducing v-Src into WB and its derivatives by recombinant retrovirus. WB and its derivatives were infected by retrovirus containing v-Src and the puromycin resistance gene. Lysates from equal numbers of puromycin resistant cells from each infection were used for Western blotting with antibody specific to v-Src. (C) EtkKQ blocks STAT3 DNA binding activity induced by v-Src. Nuclear extracts from WB and its derivatives as indicated were subjected to EMSA using a 32 P-labeled hSIE probe. A 133-fold molar excess of cold hSIE or a nonspecific oligonucleotide (NS) was used as the competitor, and supershifting (STAT3* indicates supershifted complex) was performed with anti-STAT3 antibody. The anti-STAT1 antibody was included as a control. (D) EtkKQ inhibits v-Src-induced tyrosine phosphorylation of STAT3. Lysates from cells as indicated were used for Western blotting with an antibody specific to STAT3 phosphorylated at position 705 (phospho-STAT) (upper blot) or the anti-STAT3 antibody (lower blot). (E) EtkKQ does not generally block tyrosine phosphorylation on v-Src targets. Lysates from cells as indicated were used for Western blotting with antiphosphotyrosine antibody (anti-pY) or antitubulin antibody.

    Journal: Molecular and Cellular Biology

    Article Title: Etk, a Btk Family Tyrosine Kinase, Mediates Cellular Transformation by Linking Src to STAT3 Activation

    doi:

    Figure Lengend Snippet: Etk mediates the activation of STAT3 by v-Src. (A) The kinase-defective mutant of Etk (EtkKQ) functions as a dominant-negative mutant. The upper blot shows the expression levels of Etk and EtkKQ in parental WB cell and four stable cell lines as demonstrated by immunoblotting with anti-Etk antibody. The lower blot shows Etk kinase activities in WB and its stable lines. EtkKQ-M is a mixture of all four stable clones. Lysates of cells were immunoprecipitated with anti-Etk antibody, followed by in vitro kinase assays. The autophosphorylated Etk is shown. (B) Introducing v-Src into WB and its derivatives by recombinant retrovirus. WB and its derivatives were infected by retrovirus containing v-Src and the puromycin resistance gene. Lysates from equal numbers of puromycin resistant cells from each infection were used for Western blotting with antibody specific to v-Src. (C) EtkKQ blocks STAT3 DNA binding activity induced by v-Src. Nuclear extracts from WB and its derivatives as indicated were subjected to EMSA using a 32 P-labeled hSIE probe. A 133-fold molar excess of cold hSIE or a nonspecific oligonucleotide (NS) was used as the competitor, and supershifting (STAT3* indicates supershifted complex) was performed with anti-STAT3 antibody. The anti-STAT1 antibody was included as a control. (D) EtkKQ inhibits v-Src-induced tyrosine phosphorylation of STAT3. Lysates from cells as indicated were used for Western blotting with an antibody specific to STAT3 phosphorylated at position 705 (phospho-STAT) (upper blot) or the anti-STAT3 antibody (lower blot). (E) EtkKQ does not generally block tyrosine phosphorylation on v-Src targets. Lysates from cells as indicated were used for Western blotting with antiphosphotyrosine antibody (anti-pY) or antitubulin antibody.

    Article Snippet: Coimmunoprecipitation analysis showed that the PH domain deletion mutant could no longer associate with STAT3, suggesting that this domain is required for interacting with STAT3 (Fig. B).

    Techniques: Activation Assay, Mutagenesis, Dominant Negative Mutation, Expressing, Western Blot, Stable Transfection, Clone Assay, Immunoprecipitation, In Vitro, Recombinant, Infection, Binding Assay, Activity Assay, Labeling, Blocking Assay