spacer2 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs bsm ai
    The ITS2 region was PCR amplified with universal fungal primers ITS3 and ITS4, and the products were digested with restriction enzymes <t>Bsm</t> AI ( C. dubliniensis specific) (A) and <t>Nsp</t> BII ( C. albicans specific) (B). The restriction fragments were run on a 1.2% agarose gel and stained with GelStar (FMC Bioproducts). ∗, C. dubliniensis strains.
    Bsm Ai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 48 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsm ai/product/New England Biolabs
    Average 99 stars, based on 48 article reviews
    Price from $9.99 to $1999.99
    bsm ai - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    ATCC its1 its2 regions
    The ITS2 region was PCR amplified with universal fungal primers ITS3 and ITS4, and the products were digested with restriction enzymes <t>Bsm</t> AI ( C. dubliniensis specific) (A) and <t>Nsp</t> BII ( C. albicans specific) (B). The restriction fragments were run on a 1.2% agarose gel and stained with GelStar (FMC Bioproducts). ∗, C. dubliniensis strains.
    Its1 Its2 Regions, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its1 its2 regions/product/ATCC
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    its1 its2 regions - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    88
    Biotechnology Information spacer 2
    The ITS2 region was PCR amplified with universal fungal primers ITS3 and ITS4, and the products were digested with restriction enzymes <t>Bsm</t> AI ( C. dubliniensis specific) (A) and <t>Nsp</t> BII ( C. albicans specific) (B). The restriction fragments were run on a 1.2% agarose gel and stained with GelStar (FMC Bioproducts). ∗, C. dubliniensis strains.
    Spacer 2, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 88/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/spacer 2/product/Biotechnology Information
    Average 88 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    spacer 2 - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    94
    Illumina Inc its2
    Sanger sequencing success depending on the abundance of the second most abundant photobiont for the full ITS (left) and <t>ITS2</t> (right) data sets. Abundance categories based on Illumina ITS2 metabarcording 24 are defined as follows: cat. 1 : only a single photobiont present; cat. 2 : secondary photobiont accounts for up to 10% of sequence reads; cat. 3 : secondary photobiont accounts for 10–20% of reads; cat. 4 : secondary photobiont accounts for 20–30% of reads; cat. 5 : secondary photobiont represented by more than 30% of sequence reads.
    Its2, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 143 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2/product/Illumina Inc
    Average 94 stars, based on 143 article reviews
    Price from $9.99 to $1999.99
    its2 - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    85
    Amazon ribosomal internal transcribed spacer 2 region
    Sanger sequencing success depending on the abundance of the second most abundant photobiont for the full ITS (left) and <t>ITS2</t> (right) data sets. Abundance categories based on Illumina ITS2 metabarcording 24 are defined as follows: cat. 1 : only a single photobiont present; cat. 2 : secondary photobiont accounts for up to 10% of sequence reads; cat. 3 : secondary photobiont accounts for 10–20% of reads; cat. 4 : secondary photobiont accounts for 20–30% of reads; cat. 5 : secondary photobiont represented by more than 30% of sequence reads.
    Ribosomal Internal Transcribed Spacer 2 Region, supplied by Amazon, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ribosomal internal transcribed spacer 2 region/product/Amazon
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    ribosomal internal transcribed spacer 2 region - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    84
    Thermo Fisher spacer 2 2 fmoc aminoethoxy ethoxy acetic acid fmoc aeea oh
    Sanger sequencing success depending on the abundance of the second most abundant photobiont for the full ITS (left) and <t>ITS2</t> (right) data sets. Abundance categories based on Illumina ITS2 metabarcording 24 are defined as follows: cat. 1 : only a single photobiont present; cat. 2 : secondary photobiont accounts for up to 10% of sequence reads; cat. 3 : secondary photobiont accounts for 10–20% of reads; cat. 4 : secondary photobiont accounts for 20–30% of reads; cat. 5 : secondary photobiont represented by more than 30% of sequence reads.
    Spacer 2 2 Fmoc Aminoethoxy Ethoxy Acetic Acid Fmoc Aeea Oh, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 84/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/spacer 2 2 fmoc aminoethoxy ethoxy acetic acid fmoc aeea oh/product/Thermo Fisher
    Average 84 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    spacer 2 2 fmoc aminoethoxy ethoxy acetic acid fmoc aeea oh - by Bioz Stars, 2020-04
    84/100 stars
      Buy from Supplier

    91
    Thermo Fisher internal transcribed spacer 2 its2 ion torrent personal genome machine
    Sanger sequencing success depending on the abundance of the second most abundant photobiont for the full ITS (left) and <t>ITS2</t> (right) data sets. Abundance categories based on Illumina ITS2 metabarcording 24 are defined as follows: cat. 1 : only a single photobiont present; cat. 2 : secondary photobiont accounts for up to 10% of sequence reads; cat. 3 : secondary photobiont accounts for 10–20% of reads; cat. 4 : secondary photobiont accounts for 20–30% of reads; cat. 5 : secondary photobiont represented by more than 30% of sequence reads.
    Internal Transcribed Spacer 2 Its2 Ion Torrent Personal Genome Machine, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/internal transcribed spacer 2 its2 ion torrent personal genome machine/product/Thermo Fisher
    Average 91 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    internal transcribed spacer 2 its2 ion torrent personal genome machine - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    92
    TIB MOLBIOL its2
    Sanger sequencing success depending on the abundance of the second most abundant photobiont for the full ITS (left) and <t>ITS2</t> (right) data sets. Abundance categories based on Illumina ITS2 metabarcording 24 are defined as follows: cat. 1 : only a single photobiont present; cat. 2 : secondary photobiont accounts for up to 10% of sequence reads; cat. 3 : secondary photobiont accounts for 10–20% of reads; cat. 4 : secondary photobiont accounts for 20–30% of reads; cat. 5 : secondary photobiont represented by more than 30% of sequence reads.
    Its2, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 92/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2/product/TIB MOLBIOL
    Average 92 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    its2 - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    87
    Data MATRIX its2 datamatrix
    One of the most-parsimonious trees, randomly selected from > 100 000 trees, and obtained from analysis of the data matrix of <t>ITS2</t> sequences (299 OTUs). Tree length = 458, consistency index (CI) = 0·55, rescaled consistency index (RC) =
    Its2 Datamatrix, supplied by Data MATRIX, used in various techniques. Bioz Stars score: 87/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2 datamatrix/product/Data MATRIX
    Average 87 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    its2 datamatrix - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    94
    PrimerDesign Inc lsu primers
    One of the most-parsimonious trees, randomly selected from > 100 000 trees, and obtained from analysis of the data matrix of <t>ITS2</t> sequences (299 OTUs). Tree length = 458, consistency index (CI) = 0·55, rescaled consistency index (RC) =
    Lsu Primers, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lsu primers/product/PrimerDesign Inc
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    lsu primers - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    its2  (Roche)
    91
    Roche its2
    PCR amplification of <t>ITS2</t> using DNA extracted by different methods PCR without DNA template was served as the negative control, which was provided at the right-most column. The DNA ladder is 100 bp DNA ladder.
    Its2, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2/product/Roche
    Average 91 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    its2 - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    91
    Biotechnology Information its2
    Majority rule consensus tree from Bayesian analysis of internal transcribed spacer region 2 <t>(ITS2)</t> sequences of anopheline specimens collected in the Kenyan highlands. Bayesian posterior probabilities are shown above branches. The ITS2 sequence groups
    Its2, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 91/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2/product/Biotechnology Information
    Average 91 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    its2 - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    93
    Illumina Inc its2 amplicons
    Majority rule consensus tree from Bayesian analysis of internal transcribed spacer region 2 <t>(ITS2)</t> sequences of anopheline specimens collected in the Kenyan highlands. Bayesian posterior probabilities are shown above branches. The ITS2 sequence groups
    Its2 Amplicons, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 93/100, based on 57 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2 amplicons/product/Illumina Inc
    Average 93 stars, based on 57 article reviews
    Price from $9.99 to $1999.99
    its2 amplicons - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    85
    Data MATRIX its2
    Majority rule consensus tree from Bayesian analysis of internal transcribed spacer region 2 <t>(ITS2)</t> sequences of anopheline specimens collected in the Kenyan highlands. Bayesian posterior probabilities are shown above branches. The ITS2 sequence groups
    Its2, supplied by Data MATRIX, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2/product/Data MATRIX
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    its2 - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    93
    Illumina Inc its2 primers
    Majority rule consensus tree from Bayesian analysis of internal transcribed spacer region 2 <t>(ITS2)</t> sequences of anopheline specimens collected in the Kenyan highlands. Bayesian posterior probabilities are shown above branches. The ITS2 sequence groups
    Its2 Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2 primers/product/Illumina Inc
    Average 93 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    its2 primers - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    95
    Bioedit Company its2 region
    a. <t>ITS1-5.8S-ITS2</t> (split frequency σ = 0.003) and b. ITS1 (split frequency σ = 0.003) phylogenetic trees reconstructed by Bayesian inference. Posterior Probability (PP) is reported at each node. Thickness of branches represents PP. Scale bar represents 0.2 substitutions per site. The species name and the GenBank identification number of the corresponding sequence are reported. GoN = Gulf of Naples, i.e. sequences produced in the present work.
    Its2 Region, supplied by Bioedit Company, used in various techniques. Bioz Stars score: 95/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2 region/product/Bioedit Company
    Average 95 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    its2 region - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    90
    PrimerDesign Inc its2
    Sequence alignment of the <t>ITS2</t> of C. sativus and its adulterants. The six ITS2 sequences of the adulterants are aligned against C. sativus . The sequences in coloured boxes indicate the regions that share the specifically designed LAMP primer sequences. The arrow symbols indicate the direction of DNA polymerization from the LAMP primers.
    Its2, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2/product/PrimerDesign Inc
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    its2 - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    88
    Macrogen its2
    Graphs depicting the results of the mismatch distribution analysis for the sequences of rDNA based on the differences between pairs of sequences. (a) Intergenic spacer of rDNA (ITS1), (b) 5.8S gene of rDNA, (c) intergenic spacer of rDNA <t>(ITS2)</t> and (d) intergenic spacer of rDNA (ITS). The parameter for raggdness (r) is given. The observed frequencies were represented by red dotted line. The solid green line corresponds to the frequency expected (Exp) under the hypothesis of population expansion model. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
    Its2, supplied by Macrogen, used in various techniques. Bioz Stars score: 88/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2/product/Macrogen
    Average 88 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    its2 - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    93
    CT International kronaplot its2 ww2 ct int r3
    Graphs depicting the results of the mismatch distribution analysis for the sequences of rDNA based on the differences between pairs of sequences. (a) Intergenic spacer of rDNA (ITS1), (b) 5.8S gene of rDNA, (c) intergenic spacer of rDNA <t>(ITS2)</t> and (d) intergenic spacer of rDNA (ITS). The parameter for raggdness (r) is given. The observed frequencies were represented by red dotted line. The solid green line corresponds to the frequency expected (Exp) under the hypothesis of population expansion model. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
    Kronaplot Its2 Ww2 Ct Int R3, supplied by CT International, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kronaplot its2 ww2 ct int r3/product/CT International
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    kronaplot its2 ww2 ct int r3 - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    93
    Illumina Inc fungal its2 region
    Graphs depicting the results of the mismatch distribution analysis for the sequences of rDNA based on the differences between pairs of sequences. (a) Intergenic spacer of rDNA (ITS1), (b) 5.8S gene of rDNA, (c) intergenic spacer of rDNA <t>(ITS2)</t> and (d) intergenic spacer of rDNA (ITS). The parameter for raggdness (r) is given. The observed frequencies were represented by red dotted line. The solid green line corresponds to the frequency expected (Exp) under the hypothesis of population expansion model. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
    Fungal Its2 Region, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 93/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fungal its2 region/product/Illumina Inc
    Average 93 stars, based on 32 article reviews
    Price from $9.99 to $1999.99
    fungal its2 region - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    90
    Thermo Fisher its2 ion torrent pgm data
    Graphs depicting the results of the mismatch distribution analysis for the sequences of rDNA based on the differences between pairs of sequences. (a) Intergenic spacer of rDNA (ITS1), (b) 5.8S gene of rDNA, (c) intergenic spacer of rDNA <t>(ITS2)</t> and (d) intergenic spacer of rDNA (ITS). The parameter for raggdness (r) is given. The observed frequencies were represented by red dotted line. The solid green line corresponds to the frequency expected (Exp) under the hypothesis of population expansion model. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
    Its2 Ion Torrent Pgm Data, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2 ion torrent pgm data/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    its2 ion torrent pgm data - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    90
    Red Sea its2
    Haplowebs of Stylophora morphospecies belonging to clade 4 based on nuclear rDNA. ( A ) ITS1, ( B ) <t>ITS2.</t> Each circle represents a haplotype and its size is proportional to its total frequency. Coloured lines connect haplotypes of heterozygotes individuals and colours denote Stylophora morphospecies as indicated by the embedded key. Small grey circles represent missing haplotypes and small orange circles represent a single nucleotide change.
    Its2, supplied by Red Sea, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2/product/Red Sea
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    its2 - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    92
    Illumina Inc illumina its2 metabarcording
    Haplowebs of Stylophora morphospecies belonging to clade 4 based on nuclear rDNA. ( A ) ITS1, ( B ) <t>ITS2.</t> Each circle represents a haplotype and its size is proportional to its total frequency. Coloured lines connect haplotypes of heterozygotes individuals and colours denote Stylophora morphospecies as indicated by the embedded key. Small grey circles represent missing haplotypes and small orange circles represent a single nucleotide change.
    Illumina Its2 Metabarcording, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina its2 metabarcording/product/Illumina Inc
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    illumina its2 metabarcording - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    95
    Illumina Inc its2 illumina sequencing
    Haplowebs of Stylophora morphospecies belonging to clade 4 based on nuclear rDNA. ( A ) ITS1, ( B ) <t>ITS2.</t> Each circle represents a haplotype and its size is proportional to its total frequency. Coloured lines connect haplotypes of heterozygotes individuals and colours denote Stylophora morphospecies as indicated by the embedded key. Small grey circles represent missing haplotypes and small orange circles represent a single nucleotide change.
    Its2 Illumina Sequencing, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 95/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2 illumina sequencing/product/Illumina Inc
    Average 95 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    its2 illumina sequencing - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    87
    Red Sea its2 type a1
    Haplowebs of Stylophora morphospecies belonging to clade 4 based on nuclear rDNA. ( A ) ITS1, ( B ) <t>ITS2.</t> Each circle represents a haplotype and its size is proportional to its total frequency. Coloured lines connect haplotypes of heterozygotes individuals and colours denote Stylophora morphospecies as indicated by the embedded key. Small grey circles represent missing haplotypes and small orange circles represent a single nucleotide change.
    Its2 Type A1, supplied by Red Sea, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2 type a1/product/Red Sea
    Average 87 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    its2 type a1 - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    94
    Illumina Inc spacer its2 region
    Haplowebs of Stylophora morphospecies belonging to clade 4 based on nuclear rDNA. ( A ) ITS1, ( B ) <t>ITS2.</t> Each circle represents a haplotype and its size is proportional to its total frequency. Coloured lines connect haplotypes of heterozygotes individuals and colours denote Stylophora morphospecies as indicated by the embedded key. Small grey circles represent missing haplotypes and small orange circles represent a single nucleotide change.
    Spacer Its2 Region, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/spacer its2 region/product/Illumina Inc
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    spacer its2 region - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    91
    Horizon Discovery its2 nucleotides 26 60 ugagugauacucuuuggaguuaacuugaaauugcu
    Nop15 recognizes the structure of <t>ITS2</t> III.A, promoting the ring conformation of ITS2 over the hairpin conformation and preventing misfolding into other energetically equivalent forms. Nucleotides 26–60 in each RNA conformation are indicated by grey shading. The cartoons of misfolded ITS2 RNAs were based on four predicted energy equivalent conformations ( 23 ).
    Its2 Nucleotides 26 60 Ugagugauacucuuuggaguuaacuugaaauugcu, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2 nucleotides 26 60 ugagugauacucuuuggaguuaacuugaaauugcu/product/Horizon Discovery
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    its2 nucleotides 26 60 ugagugauacucuuuggaguuaacuugaaauugcu - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    94
    Illumina Inc its1f2 its2
    Nop15 recognizes the structure of <t>ITS2</t> III.A, promoting the ring conformation of ITS2 over the hairpin conformation and preventing misfolding into other energetically equivalent forms. Nucleotides 26–60 in each RNA conformation are indicated by grey shading. The cartoons of misfolded ITS2 RNAs were based on four predicted energy equivalent conformations ( 23 ).
    Its1f2 Its2, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its1f2 its2/product/Illumina Inc
    Average 94 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    its1f2 its2 - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    86
    Biotechnology Information rrna its2 sequences
    Bayesian phylogenetic tree of several members of the family Trichomonadinae based on <t>ITS1-5.8S-rRNA-ITS2</t> sequences. The values at the nodes are posterior percentage probabilities obtained by using 10 6 generations. GenBank accession numbers are shown in
    Rrna Its2 Sequences, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rrna its2 sequences/product/Biotechnology Information
    Average 86 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    rrna its2 sequences - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    85
    Red Sea s microadriaticum
    Bayesian phylogenetic tree of several members of the family Trichomonadinae based on <t>ITS1-5.8S-rRNA-ITS2</t> sequences. The values at the nodes are posterior percentage probabilities obtained by using 10 6 generations. GenBank accession numbers are shown in
    S Microadriaticum, supplied by Red Sea, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/s microadriaticum/product/Red Sea
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    s microadriaticum - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    90
    Illumina Inc its2 metabarcoding raw illumina fastq files
    Bayesian phylogenetic tree of several members of the family Trichomonadinae based on <t>ITS1-5.8S-rRNA-ITS2</t> sequences. The values at the nodes are posterior percentage probabilities obtained by using 10 6 generations. GenBank accession numbers are shown in
    Its2 Metabarcoding Raw Illumina Fastq Files, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2 metabarcoding raw illumina fastq files/product/Illumina Inc
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    its2 metabarcoding raw illumina fastq files - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    85
    Data MATRIX noncoding renal region
    Bayesian phylogenetic tree of several members of the family Trichomonadinae based on <t>ITS1-5.8S-rRNA-ITS2</t> sequences. The values at the nodes are posterior percentage probabilities obtained by using 10 6 generations. GenBank accession numbers are shown in
    Noncoding Renal Region, supplied by Data MATRIX, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/noncoding renal region/product/Data MATRIX
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    noncoding renal region - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    Image Search Results


    The ITS2 region was PCR amplified with universal fungal primers ITS3 and ITS4, and the products were digested with restriction enzymes Bsm AI ( C. dubliniensis specific) (A) and Nsp BII ( C. albicans specific) (B). The restriction fragments were run on a 1.2% agarose gel and stained with GelStar (FMC Bioproducts). ∗, C. dubliniensis strains.

    Journal: Journal of Clinical Microbiology

    Article Title: Rapid Identification of Candida dubliniensis Using a Species-Specific Molecular Beacon

    doi:

    Figure Lengend Snippet: The ITS2 region was PCR amplified with universal fungal primers ITS3 and ITS4, and the products were digested with restriction enzymes Bsm AI ( C. dubliniensis specific) (A) and Nsp BII ( C. albicans specific) (B). The restriction fragments were run on a 1.2% agarose gel and stained with GelStar (FMC Bioproducts). ∗, C. dubliniensis strains.

    Article Snippet: The PCR amplification products (∼500 ng) were digested with 1 μl of restriction enzymes Nsp BII ( C. albicans ITS2 specific) (AP Biotech, Piscataway, N.J.) and Bsm AI ( C. dubliniensis ITS2 specific) (New England Biolabs, Beverly, Mass.) for 1 h and were analyzed by gel electrophoresis in a 1.5% agarose gel.

    Techniques: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Staining

    Sanger sequencing success depending on the abundance of the second most abundant photobiont for the full ITS (left) and ITS2 (right) data sets. Abundance categories based on Illumina ITS2 metabarcording 24 are defined as follows: cat. 1 : only a single photobiont present; cat. 2 : secondary photobiont accounts for up to 10% of sequence reads; cat. 3 : secondary photobiont accounts for 10–20% of reads; cat. 4 : secondary photobiont accounts for 20–30% of reads; cat. 5 : secondary photobiont represented by more than 30% of sequence reads.

    Journal: Scientific Reports

    Article Title: Comparing Sanger sequencing and high-throughput metabarcoding for inferring photobiont diversity in lichens

    doi: 10.1038/s41598-018-26947-8

    Figure Lengend Snippet: Sanger sequencing success depending on the abundance of the second most abundant photobiont for the full ITS (left) and ITS2 (right) data sets. Abundance categories based on Illumina ITS2 metabarcording 24 are defined as follows: cat. 1 : only a single photobiont present; cat. 2 : secondary photobiont accounts for up to 10% of sequence reads; cat. 3 : secondary photobiont accounts for 10–20% of reads; cat. 4 : secondary photobiont accounts for 20–30% of reads; cat. 5 : secondary photobiont represented by more than 30% of sequence reads.

    Article Snippet: In the set of Sanger sequences amplified with the metabarcoding primers covering only ITS2, 99% of sequences were also clearly assignable to a single Illumina metabarcoding OTU.

    Techniques: Sequencing

    Characterization of Mycobiome Leading up to Mucromycosis Onset. (A) Longitudinal analysis of the patient’s oral mycobiome leading up to the onset of M . velutinosus infection. Buccal swabs were collected from the patient twice weekly and analyzed via sequencing of the internal transcribed spacer 2 (ITS2) region. Fungal genera/species that comprised at least 1% of mapped reads are depicted. (B) Data are as for panel A except that stool specimens were analyzed.

    Journal: PLoS ONE

    Article Title: Implementation of a Pan-Genomic Approach to Investigate Holobiont-Infecting Microbe Interaction: A Case Report of a Leukemic Patient with Invasive Mucormycosis

    doi: 10.1371/journal.pone.0139851

    Figure Lengend Snippet: Characterization of Mycobiome Leading up to Mucromycosis Onset. (A) Longitudinal analysis of the patient’s oral mycobiome leading up to the onset of M . velutinosus infection. Buccal swabs were collected from the patient twice weekly and analyzed via sequencing of the internal transcribed spacer 2 (ITS2) region. Fungal genera/species that comprised at least 1% of mapped reads are depicted. (B) Data are as for panel A except that stool specimens were analyzed.

    Article Snippet: For mycobiome analysis, the Internal Transcribed Spacer 2 (ITS2) region was targeted for amplification using primers ITS3 and ITS4 [ ] and amplicons were sequenced in the Illumina MiSeq platform using the 2x300 bp paired-end protocol.

    Techniques: Infection, Sequencing

    One of the most-parsimonious trees, randomly selected from > 100 000 trees, and obtained from analysis of the data matrix of ITS2 sequences (299 OTUs). Tree length = 458, consistency index (CI) = 0·55, rescaled consistency index (RC) =

    Journal: Annals of Botany

    Article Title: Reticulate evolution in North American black-fruited hawthorns (Crataegus section Douglasia; Rosaceae): evidence from nuclear ITS2 and plastid sequences

    doi: 10.1093/aob/mcu116

    Figure Lengend Snippet: One of the most-parsimonious trees, randomly selected from > 100 000 trees, and obtained from analysis of the data matrix of ITS2 sequences (299 OTUs). Tree length = 458, consistency index (CI) = 0·55, rescaled consistency index (RC) =

    Article Snippet: The aligned ITS2 data matrix comprised 369 positions (including 23 coded characters for indels) of which 198 were variable, including outgroups (194 excluding outgroups), and 120 were potentially parsimony informative over the entire sample (93 for the ingroup alone).

    Techniques:

    The predicted secondary structure of ITS2 for one accession of ribotypes of triploid C. suksdorfii

    Journal: Annals of Botany

    Article Title: Reticulate evolution in North American black-fruited hawthorns (Crataegus section Douglasia; Rosaceae): evidence from nuclear ITS2 and plastid sequences

    doi: 10.1093/aob/mcu116

    Figure Lengend Snippet: The predicted secondary structure of ITS2 for one accession of ribotypes of triploid C. suksdorfii

    Article Snippet: The aligned ITS2 data matrix comprised 369 positions (including 23 coded characters for indels) of which 198 were variable, including outgroups (194 excluding outgroups), and 120 were potentially parsimony informative over the entire sample (93 for the ingroup alone).

    Techniques:

    The distribution of ribotypes in C. sections Douglasia and Coccineae and C. monogyna , C. × ninae-celottiae and C. × cogswellii in clades A2 (black), E (white), F (red) and H (green) on the ITS2 phylogenetic tree (Fig. ). All proportions

    Journal: Annals of Botany

    Article Title: Reticulate evolution in North American black-fruited hawthorns (Crataegus section Douglasia; Rosaceae): evidence from nuclear ITS2 and plastid sequences

    doi: 10.1093/aob/mcu116

    Figure Lengend Snippet: The distribution of ribotypes in C. sections Douglasia and Coccineae and C. monogyna , C. × ninae-celottiae and C. × cogswellii in clades A2 (black), E (white), F (red) and H (green) on the ITS2 phylogenetic tree (Fig. ). All proportions

    Article Snippet: The aligned ITS2 data matrix comprised 369 positions (including 23 coded characters for indels) of which 198 were variable, including outgroups (194 excluding outgroups), and 120 were potentially parsimony informative over the entire sample (93 for the ingroup alone).

    Techniques:

    A summary model of intersectional hybridization and polyploid formation in Crataegus section Douglasia , based on our analyses of ITS2 and plastid DNA sequences. This diagram thus does not include the way in which C. douglasii has contributed to the formation

    Journal: Annals of Botany

    Article Title: Reticulate evolution in North American black-fruited hawthorns (Crataegus section Douglasia; Rosaceae): evidence from nuclear ITS2 and plastid sequences

    doi: 10.1093/aob/mcu116

    Figure Lengend Snippet: A summary model of intersectional hybridization and polyploid formation in Crataegus section Douglasia , based on our analyses of ITS2 and plastid DNA sequences. This diagram thus does not include the way in which C. douglasii has contributed to the formation

    Article Snippet: The aligned ITS2 data matrix comprised 369 positions (including 23 coded characters for indels) of which 198 were variable, including outgroups (194 excluding outgroups), and 120 were potentially parsimony informative over the entire sample (93 for the ingroup alone).

    Techniques: Hybridization

    Bayesian tree based on ITS2 dataset including 158 specimens. Individual terminal taxa have been replaced with species names, while full taxon clade structure is retained. Colors represent different species based on morphology. See Fig. S2 for bootstrap support values.

    Journal: PeerJ

    Article Title: DNA-barcoding of forensically important blow flies (Diptera: Calliphoridae) in the Caribbean Region

    doi: 10.7717/peerj.3516

    Figure Lengend Snippet: Bayesian tree based on ITS2 dataset including 158 specimens. Individual terminal taxa have been replaced with species names, while full taxon clade structure is retained. Colors represent different species based on morphology. See Fig. S2 for bootstrap support values.

    Article Snippet: 10.7717/peerj.3516/supp-5 Data Matrix ITS2 Click here for additional data file.

    Techniques:

    Summary of the Bayesian tree based on the COI dataset including 442 individuals, with the results of four different species delimitation approaches in addition to morphology, genetic distances of > 2% mtDNA, ITS2 and the concatenated matrix. See Fig. S1 for bootstrap support values.

    Journal: PeerJ

    Article Title: DNA-barcoding of forensically important blow flies (Diptera: Calliphoridae) in the Caribbean Region

    doi: 10.7717/peerj.3516

    Figure Lengend Snippet: Summary of the Bayesian tree based on the COI dataset including 442 individuals, with the results of four different species delimitation approaches in addition to morphology, genetic distances of > 2% mtDNA, ITS2 and the concatenated matrix. See Fig. S1 for bootstrap support values.

    Article Snippet: 10.7717/peerj.3516/supp-5 Data Matrix ITS2 Click here for additional data file.

    Techniques:

    PCR amplification of ITS2 using DNA extracted by different methods PCR without DNA template was served as the negative control, which was provided at the right-most column. The DNA ladder is 100 bp DNA ladder.

    Journal: Genomics, Proteomics & Bioinformatics

    Article Title: DNA Extraction Protocol for Biological Ingredient Analysis of Liuwei Dihuang Wan

    doi: 10.1016/j.gpb.2014.03.002

    Figure Lengend Snippet: PCR amplification of ITS2 using DNA extracted by different methods PCR without DNA template was served as the negative control, which was provided at the right-most column. The DNA ladder is 100 bp DNA ladder.

    Article Snippet: ITS2 and trnL amplicons were sequenced by a Roche 454 GS FLX Titanium sequencer with default parameters (XLR70 sequence kit, 2 × 200 cycles).

    Techniques: Polymerase Chain Reaction, Amplification, Negative Control

    The length distribution of sequencing reads for LDW samples The length distributions for ITS2 and trnL are shown in panel A and panel B, respectively.

    Journal: Genomics, Proteomics & Bioinformatics

    Article Title: DNA Extraction Protocol for Biological Ingredient Analysis of Liuwei Dihuang Wan

    doi: 10.1016/j.gpb.2014.03.002

    Figure Lengend Snippet: The length distribution of sequencing reads for LDW samples The length distributions for ITS2 and trnL are shown in panel A and panel B, respectively.

    Article Snippet: ITS2 and trnL amplicons were sequenced by a Roche 454 GS FLX Titanium sequencer with default parameters (XLR70 sequence kit, 2 × 200 cycles).

    Techniques: Sequencing

    (A) Frequency distribution of sequence reads for the 10 most common ITS2 copies from isoclonal culture samples. (B) Rarefaction curve illustrating ITS2 sequence diversity distribution in isoclonal cultures.

    Journal: Molecular Ecology

    Article Title: Assessing Symbiodinium diversity in scleractinian corals via next-generation sequencing-based genotyping of the ITS2 rDNA region

    doi: 10.1111/mec.12869

    Figure Lengend Snippet: (A) Frequency distribution of sequence reads for the 10 most common ITS2 copies from isoclonal culture samples. (B) Rarefaction curve illustrating ITS2 sequence diversity distribution in isoclonal cultures.

    Article Snippet: It should be noted that the application of high-throughput sequencing of the ITS2 region is not limited to the Roche 454 platform.

    Techniques: Sequencing

    Reproducibility of pyrosequencing rDNA variants for replicated PCRs (using the same DNA extract) of isoclonal cultures (A) CCMP2467 and (B) rt-147 taking the top 10 most abundant sequence variants into account. The sizes of the circles represent relative abundance; circles with an asterisk represent distinct ITS2 variants.

    Journal: Molecular Ecology

    Article Title: Assessing Symbiodinium diversity in scleractinian corals via next-generation sequencing-based genotyping of the ITS2 rDNA region

    doi: 10.1111/mec.12869

    Figure Lengend Snippet: Reproducibility of pyrosequencing rDNA variants for replicated PCRs (using the same DNA extract) of isoclonal cultures (A) CCMP2467 and (B) rt-147 taking the top 10 most abundant sequence variants into account. The sizes of the circles represent relative abundance; circles with an asterisk represent distinct ITS2 variants.

    Article Snippet: It should be noted that the application of high-throughput sequencing of the ITS2 region is not limited to the Roche 454 platform.

    Techniques: Sequencing

    Comparison of top 10 most common variants found from pyrosequencing ITS2 from (A) culture rt-152 ( Symbiodinium goreaui or type C1 ) and several field-collected samples representing clade C Symbiodinium : (B) C1c (sample P.Waj.D7), (C) C1h (sample P.Maq.R2.19) and (D) C41 (sample A.Af.B6). The size of the circles represents relative abundance, and numbers in circles represent order of distinct ITS2 variants for a given sample. Shared ITS2 variants are depicted in a black outer circle representing ITS2 type C1 , and a grey outer circle representing ITS2 subtype c .

    Journal: Molecular Ecology

    Article Title: Assessing Symbiodinium diversity in scleractinian corals via next-generation sequencing-based genotyping of the ITS2 rDNA region

    doi: 10.1111/mec.12869

    Figure Lengend Snippet: Comparison of top 10 most common variants found from pyrosequencing ITS2 from (A) culture rt-152 ( Symbiodinium goreaui or type C1 ) and several field-collected samples representing clade C Symbiodinium : (B) C1c (sample P.Waj.D7), (C) C1h (sample P.Maq.R2.19) and (D) C41 (sample A.Af.B6). The size of the circles represents relative abundance, and numbers in circles represent order of distinct ITS2 variants for a given sample. Shared ITS2 variants are depicted in a black outer circle representing ITS2 type C1 , and a grey outer circle representing ITS2 subtype c .

    Article Snippet: It should be noted that the application of high-throughput sequencing of the ITS2 region is not limited to the Roche 454 platform.

    Techniques:

    Majority rule consensus tree from Bayesian analysis of internal transcribed spacer region 2 (ITS2) sequences of anopheline specimens collected in the Kenyan highlands. Bayesian posterior probabilities are shown above branches. The ITS2 sequence groups

    Journal: The American Journal of Tropical Medicine and Hygiene

    Article Title: Molecular Characterization Reveals Diverse and Unknown Malaria Vectors in the Western Kenyan Highlands

    doi: 10.4269/ajtmh.15-0562

    Figure Lengend Snippet: Majority rule consensus tree from Bayesian analysis of internal transcribed spacer region 2 (ITS2) sequences of anopheline specimens collected in the Kenyan highlands. Bayesian posterior probabilities are shown above branches. The ITS2 sequence groups

    Article Snippet: There are approximately 200 Anopheles species represented by ITS2 and CO1 sequences in GenBank (National Center for Biotechnology Information [NCBI]), despite almost 500 recognized species in the genus.

    Techniques: Sequencing

    Phylogenetic tree of green microalgae constructed from sequence data spanning ribosomal regions ITS1, 5.8S, and ITS2. Numbers represent clade credibility values and branch length represents substitutions per site. Species lightly shaded have been shown to be capable of producing H 2 and those darkly shaded have been tested and not observed to produce H 2 . Species in both shades appear to have strains that can produce H 2 and strains that cannot.

    Journal: Journal of Experimental Botany

    Article Title: Phylogenetic and molecular analysis of hydrogen-producing green algae

    doi: 10.1093/jxb/erp052

    Figure Lengend Snippet: Phylogenetic tree of green microalgae constructed from sequence data spanning ribosomal regions ITS1, 5.8S, and ITS2. Numbers represent clade credibility values and branch length represents substitutions per site. Species lightly shaded have been shown to be capable of producing H 2 and those darkly shaded have been tested and not observed to produce H 2 . Species in both shades appear to have strains that can produce H 2 and strains that cannot.

    Article Snippet: From these 21 cultures, five species were found that were able to produce H2 under our test conditions, four of which represent new species based on morphological characteristics and by sequence comparison of ribosomal ITS1, 5.8S, and ITS2 regions to data available at the National Center for Biotechnology Information (NCBI).

    Techniques: Construct, Sequencing

    a. ITS1-5.8S-ITS2 (split frequency σ = 0.003) and b. ITS1 (split frequency σ = 0.003) phylogenetic trees reconstructed by Bayesian inference. Posterior Probability (PP) is reported at each node. Thickness of branches represents PP. Scale bar represents 0.2 substitutions per site. The species name and the GenBank identification number of the corresponding sequence are reported. GoN = Gulf of Naples, i.e. sequences produced in the present work.

    Journal: PLoS ONE

    Article Title: Molecular phylogeny of Oncaeidae (Copepoda) using nuclear ribosomal internal transcribed spacer (ITS rDNA)

    doi: 10.1371/journal.pone.0175662

    Figure Lengend Snippet: a. ITS1-5.8S-ITS2 (split frequency σ = 0.003) and b. ITS1 (split frequency σ = 0.003) phylogenetic trees reconstructed by Bayesian inference. Posterior Probability (PP) is reported at each node. Thickness of branches represents PP. Scale bar represents 0.2 substitutions per site. The species name and the GenBank identification number of the corresponding sequence are reported. GoN = Gulf of Naples, i.e. sequences produced in the present work.

    Article Snippet: ITS2 alignment and phylogeny Based on secondary structure reconstructions, the ITS2 region of all the sequences available were manually aligned in BioEdit and then ML (Hasegawa-Kishino-Yano (HKY [ ]) +G model, 10,000 bootstrap replications) and Bayesian inference were carried out.

    Techniques: Sequencing, Produced

    CBC analysis of ITS2 secondary structure for: a. Oncaea venusta and O . curta ( O . venusta structure shown). b. O . media and O . venusta ( O . media structure shown). c. O . mediterranea and O . curta ( O . mediterranea structure shown).

    Journal: PLoS ONE

    Article Title: Molecular phylogeny of Oncaeidae (Copepoda) using nuclear ribosomal internal transcribed spacer (ITS rDNA)

    doi: 10.1371/journal.pone.0175662

    Figure Lengend Snippet: CBC analysis of ITS2 secondary structure for: a. Oncaea venusta and O . curta ( O . venusta structure shown). b. O . media and O . venusta ( O . media structure shown). c. O . mediterranea and O . curta ( O . mediterranea structure shown).

    Article Snippet: ITS2 alignment and phylogeny Based on secondary structure reconstructions, the ITS2 region of all the sequences available were manually aligned in BioEdit and then ML (Hasegawa-Kishino-Yano (HKY [ ]) +G model, 10,000 bootstrap replications) and Bayesian inference were carried out.

    Techniques:

    ITS2 stem phylogeny based on Bayesian inference (split frequency σ = 0.002). Posterior Probability (PP) is reported at each node. Thickness of branches represents PP. Scale bar represents 0.2 substitutions per site. ITS2 secondary structure reconstructions are reported for each species. Full-size pictures of secondary structures are reported in S4 Fig .

    Journal: PLoS ONE

    Article Title: Molecular phylogeny of Oncaeidae (Copepoda) using nuclear ribosomal internal transcribed spacer (ITS rDNA)

    doi: 10.1371/journal.pone.0175662

    Figure Lengend Snippet: ITS2 stem phylogeny based on Bayesian inference (split frequency σ = 0.002). Posterior Probability (PP) is reported at each node. Thickness of branches represents PP. Scale bar represents 0.2 substitutions per site. ITS2 secondary structure reconstructions are reported for each species. Full-size pictures of secondary structures are reported in S4 Fig .

    Article Snippet: ITS2 alignment and phylogeny Based on secondary structure reconstructions, the ITS2 region of all the sequences available were manually aligned in BioEdit and then ML (Hasegawa-Kishino-Yano (HKY [ ]) +G model, 10,000 bootstrap replications) and Bayesian inference were carried out.

    Techniques:

    Sequence alignment of the ITS2 of C. sativus and its adulterants. The six ITS2 sequences of the adulterants are aligned against C. sativus . The sequences in coloured boxes indicate the regions that share the specifically designed LAMP primer sequences. The arrow symbols indicate the direction of DNA polymerization from the LAMP primers.

    Journal: Scientific Reports

    Article Title: Rapid authentication of the precious herb saffron by loop-mediated isothermal amplification (LAMP) based on internal transcribed spacer 2 (ITS2) sequence

    doi: 10.1038/srep25370

    Figure Lengend Snippet: Sequence alignment of the ITS2 of C. sativus and its adulterants. The six ITS2 sequences of the adulterants are aligned against C. sativus . The sequences in coloured boxes indicate the regions that share the specifically designed LAMP primer sequences. The arrow symbols indicate the direction of DNA polymerization from the LAMP primers.

    Article Snippet: These characteristics make ITS2 a good bar-code gene choice for LAMP-specific primer design .

    Techniques: Sequencing

    Graphs depicting the results of the mismatch distribution analysis for the sequences of rDNA based on the differences between pairs of sequences. (a) Intergenic spacer of rDNA (ITS1), (b) 5.8S gene of rDNA, (c) intergenic spacer of rDNA (ITS2) and (d) intergenic spacer of rDNA (ITS). The parameter for raggdness (r) is given. The observed frequencies were represented by red dotted line. The solid green line corresponds to the frequency expected (Exp) under the hypothesis of population expansion model. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

    Journal: Meta Gene

    Article Title: Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA

    doi: 10.1016/j.mgene.2015.11.006

    Figure Lengend Snippet: Graphs depicting the results of the mismatch distribution analysis for the sequences of rDNA based on the differences between pairs of sequences. (a) Intergenic spacer of rDNA (ITS1), (b) 5.8S gene of rDNA, (c) intergenic spacer of rDNA (ITS2) and (d) intergenic spacer of rDNA (ITS). The parameter for raggdness (r) is given. The observed frequencies were represented by red dotted line. The solid green line corresponds to the frequency expected (Exp) under the hypothesis of population expansion model. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

    Article Snippet: The PCR amplified product approximately 750 bp corresponding to 18S partial, ITS1, 5.8S, ITS2 and 26S partial sequence were sequenced at the Macrogen Inc. (Seoul, Korea).

    Techniques:

    Spectrum of frequencies of sites at the ribosomal DNA sequences in Naga King Chili. (a) Intergenic spacer of ribosomal DNA (ITS1), (b) 5.8S gene of ribosomal DNA, (c) intergenic spacer of ribosomal DNA (ITS2) and (d) intergenic spacer of ribosomal DNA (ITS). The solid lines in the spectrum indicate the distributions under neutrality and balance (mutation–drift). The index value of Fu is given.

    Journal: Meta Gene

    Article Title: Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA

    doi: 10.1016/j.mgene.2015.11.006

    Figure Lengend Snippet: Spectrum of frequencies of sites at the ribosomal DNA sequences in Naga King Chili. (a) Intergenic spacer of ribosomal DNA (ITS1), (b) 5.8S gene of ribosomal DNA, (c) intergenic spacer of ribosomal DNA (ITS2) and (d) intergenic spacer of ribosomal DNA (ITS). The solid lines in the spectrum indicate the distributions under neutrality and balance (mutation–drift). The index value of Fu is given.

    Article Snippet: The PCR amplified product approximately 750 bp corresponding to 18S partial, ITS1, 5.8S, ITS2 and 26S partial sequence were sequenced at the Macrogen Inc. (Seoul, Korea).

    Techniques: Mutagenesis

    Aligned nrDNA ITS sequence (ITS1-5.8S-ITS2) of Capsicum sp. The polymorphic sites in all accessions of Naga King Chili in comparison with other species are shown with ( ⁎ ). Sites deletion of 10 bp, 5 bp and 13 bp are shown with arrow.

    Journal: Meta Gene

    Article Title: Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA

    doi: 10.1016/j.mgene.2015.11.006

    Figure Lengend Snippet: Aligned nrDNA ITS sequence (ITS1-5.8S-ITS2) of Capsicum sp. The polymorphic sites in all accessions of Naga King Chili in comparison with other species are shown with ( ⁎ ). Sites deletion of 10 bp, 5 bp and 13 bp are shown with arrow.

    Article Snippet: The PCR amplified product approximately 750 bp corresponding to 18S partial, ITS1, 5.8S, ITS2 and 26S partial sequence were sequenced at the Macrogen Inc. (Seoul, Korea).

    Techniques: Sequencing

    PCR of the ITS2 region of members of the An. funestus group and three examples of the Shingwedzi (South Africa) specimens. PCR amplification from the specimens produced an amplicon of ~ 550 bp, which is similar to the An. rivulorum size fragment. Lanes 1 and 11: 100 bp DNA ladder; lane 2: An. funestus ; lane 3: An. leesoni ; lane 4: An. parensis ; lane 5: An. rivulorum ; lane 6: An. vaneedeni ; lane 7: negative control; lanes 8–10: three specimens from Shingwedzi

    Journal: Malaria Journal

    Article Title: Detection of Anopheles rivulorum-like, a member of the Anopheles funestus group, in South Africa

    doi: 10.1186/s12936-018-2353-y

    Figure Lengend Snippet: PCR of the ITS2 region of members of the An. funestus group and three examples of the Shingwedzi (South Africa) specimens. PCR amplification from the specimens produced an amplicon of ~ 550 bp, which is similar to the An. rivulorum size fragment. Lanes 1 and 11: 100 bp DNA ladder; lane 2: An. funestus ; lane 3: An. leesoni ; lane 4: An. parensis ; lane 5: An. rivulorum ; lane 6: An. vaneedeni ; lane 7: negative control; lanes 8–10: three specimens from Shingwedzi

    Article Snippet: Subsequently, the PCR products of the ITS2 region from the three specimens were purified and sequenced by Macrogen Inc.

    Techniques: Polymerase Chain Reaction, Amplification, Produced, Negative Control

    Haplowebs of Stylophora morphospecies belonging to clade 4 based on nuclear rDNA. ( A ) ITS1, ( B ) ITS2. Each circle represents a haplotype and its size is proportional to its total frequency. Coloured lines connect haplotypes of heterozygotes individuals and colours denote Stylophora morphospecies as indicated by the embedded key. Small grey circles represent missing haplotypes and small orange circles represent a single nucleotide change.

    Journal: Scientific Reports

    Article Title: Recent origin and semi-permeable species boundaries in the scleractinian coral genus Stylophora from the Red Sea

    doi: 10.1038/srep34612

    Figure Lengend Snippet: Haplowebs of Stylophora morphospecies belonging to clade 4 based on nuclear rDNA. ( A ) ITS1, ( B ) ITS2. Each circle represents a haplotype and its size is proportional to its total frequency. Coloured lines connect haplotypes of heterozygotes individuals and colours denote Stylophora morphospecies as indicated by the embedded key. Small grey circles represent missing haplotypes and small orange circles represent a single nucleotide change.

    Article Snippet: Although ITS1 , ITS2 , and HSP70 ( ) resolved S. pistillata as a complex of four deeply divergent clades, the nuclear loci grouped the Stylophora morphospecies colonies from the Red Sea in a single lineage (clade 4) ( and ).

    Techniques:

    Multi-locus time-calibrated phylogeny reconstruction of the genus Stylophora inferred from the concatenated dataset (COI, CR, ORF, ITS1, ITS2, and HSP70) analysed using BEAST. The orange circle marks the node that was time-constrained with fossil (the first appearance of S. octophyllia in Santonian and Oman) as described in the text. Values above nodes are mean node ages and orange bars display the 95% highest posterior density (HPD) interval of node ages. Values under nodes are posterior probabilities ( > 0.9). Clade numbers refer to 14 . Colours in the map are the same as used in the time-calibrated phylogeny on the left. The map was created using Natural Earth ( http://www.naturalearthdata.com ) and QuantumGIS 2.12 (Quantum GIS Development Team, www.qgis.org ).

    Journal: Scientific Reports

    Article Title: Recent origin and semi-permeable species boundaries in the scleractinian coral genus Stylophora from the Red Sea

    doi: 10.1038/srep34612

    Figure Lengend Snippet: Multi-locus time-calibrated phylogeny reconstruction of the genus Stylophora inferred from the concatenated dataset (COI, CR, ORF, ITS1, ITS2, and HSP70) analysed using BEAST. The orange circle marks the node that was time-constrained with fossil (the first appearance of S. octophyllia in Santonian and Oman) as described in the text. Values above nodes are mean node ages and orange bars display the 95% highest posterior density (HPD) interval of node ages. Values under nodes are posterior probabilities ( > 0.9). Clade numbers refer to 14 . Colours in the map are the same as used in the time-calibrated phylogeny on the left. The map was created using Natural Earth ( http://www.naturalearthdata.com ) and QuantumGIS 2.12 (Quantum GIS Development Team, www.qgis.org ).

    Article Snippet: Although ITS1 , ITS2 , and HSP70 ( ) resolved S. pistillata as a complex of four deeply divergent clades, the nuclear loci grouped the Stylophora morphospecies colonies from the Red Sea in a single lineage (clade 4) ( and ).

    Techniques:

    Composition of dominant Symbiodinium clades at all sites from north (1) to south (6) in summer (S, Sep11) and winter (W, Mar12). The rare and new ITS2 sequence found at 1-MAQ named “C85” is not included in the graph.

    Journal: PLoS ONE

    Article Title: Spatio-Temporal Analyses of Symbiodinium Physiology of the Coral Pocillopora verrucosa along Large-Scale Nutrient and Temperature Gradients in the Red Sea

    doi: 10.1371/journal.pone.0103179

    Figure Lengend Snippet: Composition of dominant Symbiodinium clades at all sites from north (1) to south (6) in summer (S, Sep11) and winter (W, Mar12). The rare and new ITS2 sequence found at 1-MAQ named “C85” is not included in the graph.

    Article Snippet: ITS2 types of clade C occurred mainly in the northernmost part of the Red Sea (1-MAQ) with mainly type C1h, but also type C1 (S. goreaui , ).

    Techniques: Sequencing

    Nop15 recognizes the structure of ITS2 III.A, promoting the ring conformation of ITS2 over the hairpin conformation and preventing misfolding into other energetically equivalent forms. Nucleotides 26–60 in each RNA conformation are indicated by grey shading. The cartoons of misfolded ITS2 RNAs were based on four predicted energy equivalent conformations ( 23 ).

    Journal: Nucleic Acids Research

    Article Title: Structural analysis reveals the flexible C-terminus of Nop15 undergoes rearrangement to recognize a pre-ribosomal RNA folding intermediate

    doi: 10.1093/nar/gkw961

    Figure Lengend Snippet: Nop15 recognizes the structure of ITS2 III.A, promoting the ring conformation of ITS2 over the hairpin conformation and preventing misfolding into other energetically equivalent forms. Nucleotides 26–60 in each RNA conformation are indicated by grey shading. The cartoons of misfolded ITS2 RNAs were based on four predicted energy equivalent conformations ( 23 ).

    Article Snippet: RNA preparation 5΄ Fluorescein-labeled RNAs corresponding to ITS2 nucleotides 26–60 (UGAGUGAUACUCUUUGGAGUUAACUUGAAAUUGCU) and its variants, were purchased from Dharmacon (Thermo Scientific), de-protected using 400 μl 100 mM acetic acid (pH adjusted to 3.8 by TEMED) at 60°C for 30 min, and used without further purification.

    Techniques:

    Bayesian phylogenetic tree of several members of the family Trichomonadinae based on ITS1-5.8S-rRNA-ITS2 sequences. The values at the nodes are posterior percentage probabilities obtained by using 10 6 generations. GenBank accession numbers are shown in

    Journal: Journal of Clinical Microbiology

    Article Title: New Tetratrichomonas Species in Two Patients with Pleural Empyema

    doi: 10.1128/JCM.01056-13

    Figure Lengend Snippet: Bayesian phylogenetic tree of several members of the family Trichomonadinae based on ITS1-5.8S-rRNA-ITS2 sequences. The values at the nodes are posterior percentage probabilities obtained by using 10 6 generations. GenBank accession numbers are shown in

    Article Snippet: These sequences were compared with 181 trichomonad ITS1-5.8S rRNA-ITS2 sequences available in the National Center for Biotechnology Information database.

    Techniques: