signal joint trec numbers Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher viia 7 real time pcr system
    Viia 7 Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 14540 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/viia 7 real time pcr system/product/Thermo Fisher
    Average 99 stars, based on 14540 article reviews
    Price from $9.99 to $1999.99
    viia 7 real time pcr system - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    94
    Thermo Fisher pcr2 1 topo vector
    Pcr2 1 Topo Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 15098 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr2 1 topo vector/product/Thermo Fisher
    Average 94 stars, based on 15098 article reviews
    Price from $9.99 to $1999.99
    pcr2 1 topo vector - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    94
    Roche lightcycler
    Lightcycler, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 18512 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lightcycler/product/Roche
    Average 94 stars, based on 18512 article reviews
    Price from $9.99 to $1999.99
    lightcycler - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    93
    Bio-Rad sybr green real time pcr
    Sybr Green Real Time Pcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 590 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr green real time pcr/product/Bio-Rad
    Average 93 stars, based on 590 article reviews
    Price from $9.99 to $1999.99
    sybr green real time pcr - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    85
    Bio-Rad icycler quantitative rt pcr system
    Icycler Quantitative Rt Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 85/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/icycler quantitative rt pcr system/product/Bio-Rad
    Average 85 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    icycler quantitative rt pcr system - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    99
    Thermo Fisher real time pcr
    Real Time Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 46832 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time pcr/product/Thermo Fisher
    Average 99 stars, based on 46832 article reviews
    Price from $9.99 to $1999.99
    real time pcr - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher trizol reagent
    Trizol Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 604295 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trizol reagent/product/Thermo Fisher
    Average 99 stars, based on 604295 article reviews
    Price from $9.99 to $1999.99
    trizol reagent - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    93
    Roche light cycler 2 0
    Light Cycler 2 0, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 1321 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/light cycler 2 0/product/Roche
    Average 93 stars, based on 1321 article reviews
    Price from $9.99 to $1999.99
    light cycler 2 0 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    91
    Thermo Fisher abi prism 7700 system
    Abi Prism 7700 System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 771 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi prism 7700 system/product/Thermo Fisher
    Average 91 stars, based on 771 article reviews
    Price from $9.99 to $1999.99
    abi prism 7700 system - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    94
    Roche pcr reaction
    Pcr Reaction, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 4809 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr reaction/product/Roche
    Average 94 stars, based on 4809 article reviews
    Price from $9.99 to $1999.99
    pcr reaction - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    92
    Roche real time polymerase chain reaction pcr
    Real Time Polymerase Chain Reaction Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 1359 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time polymerase chain reaction pcr/product/Roche
    Average 92 stars, based on 1359 article reviews
    Price from $9.99 to $1999.99
    real time polymerase chain reaction pcr - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    85
    Millipore fam gcaggtttttgtaaaggtgctcacttct bhq
    Fam Gcaggtttttgtaaaggtgctcacttct Bhq, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam gcaggtttttgtaaaggtgctcacttct bhq/product/Millipore
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    fam gcaggtttttgtaaaggtgctcacttct bhq - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    99
    Qiagen qiaamp dna mini kit
    Qiaamp Dna Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 48891 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaamp dna mini kit/product/Qiagen
    Average 99 stars, based on 48891 article reviews
    Price from $9.99 to $1999.99
    qiaamp dna mini kit - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    94
    STEMCELL Technologies Inc cd4
    Rarefaction analysis of TCR species in CD31 + naïve <t>CD4</t> + T-cells
    Cd4, supplied by STEMCELL Technologies Inc, used in various techniques. Bioz Stars score: 94/100, based on 690 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cd4/product/STEMCELL Technologies Inc
    Average 94 stars, based on 690 article reviews
    Price from $9.99 to $1999.99
    cd4 - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    99
    Qiagen qiaamp blood kit
    Rarefaction analysis of TCR species in CD31 + naïve <t>CD4</t> + T-cells
    Qiaamp Blood Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 3126 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaamp blood kit/product/Qiagen
    Average 99 stars, based on 3126 article reviews
    Price from $9.99 to $1999.99
    qiaamp blood kit - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    Qiagen qiamp dna micro kit
    Rarefaction analysis of TCR species in CD31 + naïve <t>CD4</t> + T-cells
    Qiamp Dna Micro Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 787 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiamp dna micro kit/product/Qiagen
    Average 99 stars, based on 787 article reviews
    Price from $9.99 to $1999.99
    qiamp dna micro kit - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    94
    Roche genomic dna
    Rarefaction analysis of TCR species in CD31 + naïve <t>CD4</t> + T-cells
    Genomic Dna, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 10355 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna/product/Roche
    Average 94 stars, based on 10355 article reviews
    Price from $9.99 to $1999.99
    genomic dna - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    94
    Roche cell lysis
    Rarefaction analysis of TCR species in CD31 + naïve <t>CD4</t> + T-cells
    Cell Lysis, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 3373 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cell lysis/product/Roche
    Average 94 stars, based on 3373 article reviews
    Price from $9.99 to $1999.99
    cell lysis - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    89
    Santa Cruz Biotechnology anti cd3ζ
    MA5.8 cells transduced with patient mutant <t>CD3ζ</t> cDNA do not express detectable CD3ζ protein and fail to assemble complete TCR complexes. MA5.8 hybridoma cells retrovirally transduced with the indicated human CD3ζ cDNAs or pMiG
    Anti Cd3ζ, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 89/100, based on 93 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti cd3ζ/product/Santa Cruz Biotechnology
    Average 89 stars, based on 93 article reviews
    Price from $9.99 to $1999.99
    anti cd3ζ - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    Image Search Results


    Rarefaction analysis of TCR species in CD31 + naïve CD4 + T-cells

    Journal: AIDS (London, England)

    Article Title: Supranormal Thymic Output Up to Two Decades After HIV-1 Infection

    doi: 10.1097/QAD.0000000000001010

    Figure Lengend Snippet: Rarefaction analysis of TCR species in CD31 + naïve CD4 + T-cells

    Article Snippet: TREC were measured using isolated CD4+ T-cells (Rosette-Sep beads, StemCell Technologies, Vancouver, Canada) for most participants.

    Techniques:

    The long term survivors of perinatally HIV-1 infection exhibit increased CD4+ T-cell receptor diversity and breadth

    Journal: AIDS (London, England)

    Article Title: Supranormal Thymic Output Up to Two Decades After HIV-1 Infection

    doi: 10.1097/QAD.0000000000001010

    Figure Lengend Snippet: The long term survivors of perinatally HIV-1 infection exhibit increased CD4+ T-cell receptor diversity and breadth

    Article Snippet: TREC were measured using isolated CD4+ T-cells (Rosette-Sep beads, StemCell Technologies, Vancouver, Canada) for most participants.

    Techniques: Infection

    Relationship of immune activation to memory CD4 + T-cell loss, and resulting homeostatic proliferation of CD4 + T-cells

    Journal: AIDS (London, England)

    Article Title: Supranormal Thymic Output Up to Two Decades After HIV-1 Infection

    doi: 10.1097/QAD.0000000000001010

    Figure Lengend Snippet: Relationship of immune activation to memory CD4 + T-cell loss, and resulting homeostatic proliferation of CD4 + T-cells

    Article Snippet: TREC were measured using isolated CD4+ T-cells (Rosette-Sep beads, StemCell Technologies, Vancouver, Canada) for most participants.

    Techniques: Activation Assay

    Schematic model of CD4 + T-cell homeostasis in long term survivors of perinatal HIV-1-infection

    Journal: AIDS (London, England)

    Article Title: Supranormal Thymic Output Up to Two Decades After HIV-1 Infection

    doi: 10.1097/QAD.0000000000001010

    Figure Lengend Snippet: Schematic model of CD4 + T-cell homeostasis in long term survivors of perinatal HIV-1-infection

    Article Snippet: TREC were measured using isolated CD4+ T-cells (Rosette-Sep beads, StemCell Technologies, Vancouver, Canada) for most participants.

    Techniques: Infection

    MA5.8 cells transduced with patient mutant CD3ζ cDNA do not express detectable CD3ζ protein and fail to assemble complete TCR complexes. MA5.8 hybridoma cells retrovirally transduced with the indicated human CD3ζ cDNAs or pMiG

    Journal:

    Article Title: T−B+NK+ severe combined immunodeficiency caused by complete deficiency of the CD3? subunit of the T-cell antigen receptor complex

    doi: 10.1182/blood-2006-08-043166

    Figure Lengend Snippet: MA5.8 cells transduced with patient mutant CD3ζ cDNA do not express detectable CD3ζ protein and fail to assemble complete TCR complexes. MA5.8 hybridoma cells retrovirally transduced with the indicated human CD3ζ cDNAs or pMiG

    Article Snippet: Anti-CD3ζ (clone 6B10.2; Santa Cruz Biotechnology, Santa Cruz, CA) recognizing amino acids 36-54 of the molecule was used for flow cytometric detection of CD3ζ in fixed and permeabilized cells as described.

    Techniques: Transduction, Mutagenesis

    Diagram of patient CD3ζ mutation. The extracellular (EC), transmembrane (TM), and 3 intracellular ITAMs of wild-type CD3ζ protein are depicted along with the location of the homozygous patient mutation and the recognition site of the anti-CD3ζ

    Journal:

    Article Title: T−B+NK+ severe combined immunodeficiency caused by complete deficiency of the CD3? subunit of the T-cell antigen receptor complex

    doi: 10.1182/blood-2006-08-043166

    Figure Lengend Snippet: Diagram of patient CD3ζ mutation. The extracellular (EC), transmembrane (TM), and 3 intracellular ITAMs of wild-type CD3ζ protein are depicted along with the location of the homozygous patient mutation and the recognition site of the anti-CD3ζ

    Article Snippet: Anti-CD3ζ (clone 6B10.2; Santa Cruz Biotechnology, Santa Cruz, CA) recognizing amino acids 36-54 of the molecule was used for flow cytometric detection of CD3ζ in fixed and permeabilized cells as described.

    Techniques: Mutagenesis

    Analysis of CD3ζ protein and mRNA expression in patient T cells. (A) Patient and healthy volunteer sorted CD3ε + PBMCs were lysed in digitonin lysis buffer and either sequentially immunoprecipitated with 2 rounds of anti-CD3ε Ab

    Journal:

    Article Title: T−B+NK+ severe combined immunodeficiency caused by complete deficiency of the CD3? subunit of the T-cell antigen receptor complex

    doi: 10.1182/blood-2006-08-043166

    Figure Lengend Snippet: Analysis of CD3ζ protein and mRNA expression in patient T cells. (A) Patient and healthy volunteer sorted CD3ε + PBMCs were lysed in digitonin lysis buffer and either sequentially immunoprecipitated with 2 rounds of anti-CD3ε Ab

    Article Snippet: Anti-CD3ζ (clone 6B10.2; Santa Cruz Biotechnology, Santa Cruz, CA) recognizing amino acids 36-54 of the molecule was used for flow cytometric detection of CD3ζ in fixed and permeabilized cells as described.

    Techniques: Expressing, Lysis, Immunoprecipitation

    Patient mutant CD3ζ fails to rescue TCR expression in retrovirally-transduced CD3ζ-deficient MA5.8 cells. (A) MA5.8 cells were transduced with individual retroviral vectors containing one of the following human CD3ζ cDNAs: hsCD3ζWT

    Journal:

    Article Title: T−B+NK+ severe combined immunodeficiency caused by complete deficiency of the CD3? subunit of the T-cell antigen receptor complex

    doi: 10.1182/blood-2006-08-043166

    Figure Lengend Snippet: Patient mutant CD3ζ fails to rescue TCR expression in retrovirally-transduced CD3ζ-deficient MA5.8 cells. (A) MA5.8 cells were transduced with individual retroviral vectors containing one of the following human CD3ζ cDNAs: hsCD3ζWT

    Article Snippet: Anti-CD3ζ (clone 6B10.2; Santa Cruz Biotechnology, Santa Cruz, CA) recognizing amino acids 36-54 of the molecule was used for flow cytometric detection of CD3ζ in fixed and permeabilized cells as described.

    Techniques: Mutagenesis, Expressing, Transduction