shrna Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen sirna shrna
    eIF4G1 is required for cell growth, colony formation, expression of EMT genes and cell migration in PCa Cells: Loss of Function studies following knockdown of eIF4G1 using <t>siRNA</t> ( a , b ). Cell viability was measured by crystal violet assay at 48–96 h with siControl and sieIF4G1, the graph showed absorbance at 560 nm for LNCaP ( a ) and C4-2B ( b ). ( c ) Cell proliferation assay for LNCaP and C4-2B ( d ) done by MTT assay at 24–96 h with siControl and sieIF4G1. ( e ) Colony formation for LNCaP and C4-2B ( f ) siControl and sieIF4G1, Lower panels: Colonies were counted using an ImageJ software. Error bar represents ± SD. ( g ) Representative image of immunoblotting for LNCaP and C4-2B for N-Cadherin Snail 1 with siControl and sieIF4G1. ( h ) Representative image and graph of Transwell cell migration assays on LNCaP ( h ) C4-2B ( i ) with Vector Control (VC) sheIF4G1. p-values are indicated as *
    Sirna Shrna, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna shrna/product/Qiagen
    Average 99 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    sirna shrna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore sirna shnr2e3
    NR2E3 regulates ESR1 function in breast cancer cells A-B. MCF-7 cells were stably transfected with <t>shNR2E3</t> or control shRNA (shCon). Total RNA from indicated cell extracted and analysed by qRT-PCR with indicated probe. C-D. T47D cells were stably transfected with shNR2E3 or shCon. Total RNA and protein from indicated cell extracts were analysed by qRT-PCR with indicated probes. E. MCF-7 cells were stably transfected with shNR2E3 or control shRNA (shCon). Total protein from indicated cell extracted and analysed by Western blot with indicated antibody. F. Stably transfected MCF-7 with shNR2E3 or with shCon were transfected with ESR1 promoter construct, and the cells were harvested for luciferase assay. Values indicated relatively normalized luciferase activity. G-H. MCF-7 cells were transiently transfected with indicated <t>siRNA,</t> and cell lysates were used for Western blot ( G ) or for qRT-PCR ( H ). All results are shown as mean plus standard deviation (SD) from three-independent replicates (* p
    Sirna Shnr2e3, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 168 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna shnr2e3/product/Millipore
    Average 99 stars, based on 168 article reviews
    Price from $9.99 to $1999.99
    sirna shnr2e3 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore shrna sirnas
    NOTCH inhibition suppresses p21 without reducing p53 activity a , qPCR analysis of p53-dependent genes in human neonatal keratinocytes 3 days after transduction of GFP or OCT4 and SOX2 . b , Western blot of p53 levels in human neonatal keratinocytes with DMSO or 10 μM DAPT treatment for 3 days. Full blot shown in Supplementary Figure 7g . c , qPCR analysis of p53-dependent genes after 10 μM DAPT or 2 μM DBZ treatment for 3 days in OCT4, SOX2 -transduced human keratinocytes. d , The efficiency of NANOG+/TRA-1-81+ iPSC generation in OCT4, SOX2, KLF4 , and CMYC -transduced human neonatal keratinocytes transduced with p53DD or GFP with or without exposure to UV irradiation. e , γH2AX immunostaining in human neonatal keratinocytes 10 days after transduction with OCT4, SOX2, KLF4 , and CMYC and treatment with DAPT, p53DD, or p53 <t>shRNA.</t> Scale bars = 50 μm. f , The percentage of TUNEL-positive cells in human neonatal keratinocyte reprogramming cultures with active or inactive p53 (p53DD expression) 10 days after transduction with OCT4, SOX2, KLF4 , and CMYC . g , The number of insertions or deletions (indels) per iPSC line derived under normal, DAPT, or p53DD conditions, as determined by array CGH. For all experiments, error bars represent the standard deviation between two biological replicates and statistical significance was determined using a two-tailed homoscedastic Student's t-test. * denotes significance p-value
    Shrna Sirnas, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 366 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna sirnas/product/Millipore
    Average 99 stars, based on 366 article reviews
    Price from $9.99 to $1999.99
    shrna sirnas - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    84
    Horizon Discovery shrna mkp1 sirna
    Regulation of the MAPK response to pore-formation is <t>MKP1</t> independent. (A) A549 cells were transfected with 2.5 µg of MKP1 or scrambled <t>siRNA</t> per 1×10 6 cells and stimulated 24 hrs post-transfection with 200 ng/ml of purified Ply for the indicated times. Transfection with MKP1 siRNA inhibited MKP1 expression but did not have an effect on Ply-induced MAPK phosphorylation.
    Shrna Mkp1 Sirna, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 84/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna mkp1 sirna/product/Horizon Discovery
    Average 84 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    shrna mkp1 sirna - by Bioz Stars, 2020-04
    84/100 stars
      Buy from Supplier

    93
    Arraystar hg19 pirna array
    Regulation of the MAPK response to pore-formation is <t>MKP1</t> independent. (A) A549 cells were transfected with 2.5 µg of MKP1 or scrambled <t>siRNA</t> per 1×10 6 cells and stimulated 24 hrs post-transfection with 200 ng/ml of purified Ply for the indicated times. Transfection with MKP1 siRNA inhibited MKP1 expression but did not have an effect on Ply-induced MAPK phosphorylation.
    Hg19 Pirna Array, supplied by Arraystar, used in various techniques. Bioz Stars score: 93/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hg19 pirna array/product/Arraystar
    Average 93 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    hg19 pirna array - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    85
    Solexa pirnas
    Regulation of the MAPK response to pore-formation is <t>MKP1</t> independent. (A) A549 cells were transfected with 2.5 µg of MKP1 or scrambled <t>siRNA</t> per 1×10 6 cells and stimulated 24 hrs post-transfection with 200 ng/ml of purified Ply for the indicated times. Transfection with MKP1 siRNA inhibited MKP1 expression but did not have an effect on Ply-induced MAPK phosphorylation.
    Pirnas, supplied by Solexa, used in various techniques. Bioz Stars score: 85/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pirnas/product/Solexa
    Average 85 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    pirnas - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    86
    Horizon Discovery shrna sirna smart pools
    Accelerated Cell-Cycle Progression in Cks2 −/− MEFs (A) Time-lapse microscopy of asynchronously growing wild-type, Cks2 −/− and Cks1 −/− MEFs. MEFs were immortalized using <t>shRNA</t> against p53. Wild-type MEFs were infected with a retrovirus expressing histone H2B-GFP, Cks2 −/− and Cks1 −/− MEFs expressed histone H2B-mCherry. Wild-type and knockout MEFs were mixed and imaged. The time between two successive anaphases was recorded for at least 50 cells of each genotype; the mean is shown. An example of a wild-type and Cks2 −/− cell is shown. Alternatively, MEFs were immortalized using the 3T3 protocol, and cell cycle duration was measured as the duration from one cytokinesis to the next for at least 50 cells per genotype. (B) FACS analysis of DNA content to generate cell cycle profiles of asynchronously proliferating wild-type, Cks2 −/− and Cks1 −/− MEFs. (C) Quantification of the cell cycle populations by FACS. (D) Experimental design and example of the FACS pattern of wild-type MEFs at time 0, depicting the G1, BrdU-positive and G2 gates. The ratio of BrdU-positive cells with a G1 DNA content (labeled “early S”) over unlabeled G1 cells was followed over a 24 hr chase.
    Shrna Sirna Smart Pools, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 86/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna sirna smart pools/product/Horizon Discovery
    Average 86 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    shrna sirna smart pools - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    99
    Millipore sirna
    <t>SDC4</t> enhances TGF-β1 stimulated cellular restitution, chemotaxis and proliferation. A, Scratched restitution assay. Cells were seeded in 24-well culture plates at 2×10 4 cells/well. Forty-eight hours after transfection with indicated <t>siRNA,</t> a scratch was made using 200-μl micropipette tip. Upper: 0 and 20 h after wounding. Black dotted lines indicate the wound edge. Lower: Percentage (%) change in migration as determined by comparing the difference in wound width ( n =3). Each bar represents means ±SEM; ※, p
    Sirna, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 5178 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna/product/Millipore
    Average 99 stars, based on 5178 article reviews
    Price from $9.99 to $1999.99
    sirna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    92
    GenePharma Company shrna sirnas
    <t>SDC4</t> enhances TGF-β1 stimulated cellular restitution, chemotaxis and proliferation. A, Scratched restitution assay. Cells were seeded in 24-well culture plates at 2×10 4 cells/well. Forty-eight hours after transfection with indicated <t>siRNA,</t> a scratch was made using 200-μl micropipette tip. Upper: 0 and 20 h after wounding. Black dotted lines indicate the wound edge. Lower: Percentage (%) change in migration as determined by comparing the difference in wound width ( n =3). Each bar represents means ±SEM; ※, p
    Shrna Sirnas, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna sirnas/product/GenePharma Company
    Average 92 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    shrna sirnas - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    94
    Ribobio pirna microarray
    <t>SDC4</t> enhances TGF-β1 stimulated cellular restitution, chemotaxis and proliferation. A, Scratched restitution assay. Cells were seeded in 24-well culture plates at 2×10 4 cells/well. Forty-eight hours after transfection with indicated <t>siRNA,</t> a scratch was made using 200-μl micropipette tip. Upper: 0 and 20 h after wounding. Black dotted lines indicate the wound edge. Lower: Percentage (%) change in migration as determined by comparing the difference in wound width ( n =3). Each bar represents means ±SEM; ※, p
    Pirna Microarray, supplied by Ribobio, used in various techniques. Bioz Stars score: 94/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pirna microarray/product/Ribobio
    Average 94 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    pirna microarray - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    87
    Waters Corporation pirna biogenesis
    <t>SDC4</t> enhances TGF-β1 stimulated cellular restitution, chemotaxis and proliferation. A, Scratched restitution assay. Cells were seeded in 24-well culture plates at 2×10 4 cells/well. Forty-eight hours after transfection with indicated <t>siRNA,</t> a scratch was made using 200-μl micropipette tip. Upper: 0 and 20 h after wounding. Black dotted lines indicate the wound edge. Lower: Percentage (%) change in migration as determined by comparing the difference in wound width ( n =3). Each bar represents means ±SEM; ※, p
    Pirna Biogenesis, supplied by Waters Corporation, used in various techniques. Bioz Stars score: 87/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pirna biogenesis/product/Waters Corporation
    Average 87 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    pirna biogenesis - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    86
    GenePharma Company shrnas targeting tmprss4
    <t>SDC4</t> enhances TGF-β1 stimulated cellular restitution, chemotaxis and proliferation. A, Scratched restitution assay. Cells were seeded in 24-well culture plates at 2×10 4 cells/well. Forty-eight hours after transfection with indicated <t>siRNA,</t> a scratch was made using 200-μl micropipette tip. Upper: 0 and 20 h after wounding. Black dotted lines indicate the wound edge. Lower: Percentage (%) change in migration as determined by comparing the difference in wound width ( n =3). Each bar represents means ±SEM; ※, p
    Shrnas Targeting Tmprss4, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 86/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrnas targeting tmprss4/product/GenePharma Company
    Average 86 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    shrnas targeting tmprss4 - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    95
    GenePharma Company sirna shrna
    PD-L2 knockdown-induced inhibition of autophagy attenuates migration and invasion of osteosarcoma cells. a Representative TEM images depict ultrastructures present during autophagy in KHOS and U2OS cells transfected with PD-L2 <t>shRNA</t> or shNC. Images show autophagic vacuoles (arrows) observed in control cells (the picture in the right is a zoom of the picture in the left). No or few autophagic vacuoles were observed in PD-L2 knockdown cells. b Cells after PD-L2 knockdown exhibited a punctate pattern of LC3-II fluorescence, with reduced LC3-II compared with autophagosomes. KHOS and U2OS cells were incubated with or without CQ. c Expression of LC3, p62, and beclin-1 was evaluated by western blot. KHOS and U2OS cells were incubated in the presence or absence of CQ
    Sirna Shrna, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 95/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna shrna/product/GenePharma Company
    Average 95 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    sirna shrna - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    99
    Millipore shrnas
    hVps34 and <t>PLD1</t> regulate cell size. (A) HEK293 cells were transduced with lentiviruses expressing <t>shRNAs</t> for raptor, hVps34, or PLD1, puromycin selected, and then subjected to cell size measurement of median forward scatter-height. The result of overnight treatment with 100 nM rapamycin is included as a control. Representative histograms are also shown, with cell counts in arbitrary units. (B) Cells were transfected with wt- or ΔPX-PLD1 together in pCDNA3 (vector), selected with G418 for 3 d, and then subjected to cell size measurement as described in A. A one-sample t test was performed to compare each data with the control. Three independent experiments were performed, and the results of mean ± SD are shown in the graphs. *, P
    Shrnas, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 2732 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrnas/product/Millipore
    Average 99 stars, based on 2732 article reviews
    Price from $9.99 to $1999.99
    shrnas - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    91
    Thermo Fisher shrna targeting stat3
    <t>Stat3</t> is overexpressed and regulates Jab1 levels in NPC cells (A) Whole-cell lysates were prepared from the cells as indicated. β-actin was used as a control for protein loading and integrity. The relative p-Stat3, T-Stat3, and Jab1 intensities for six samples are shown. (B) Ectopic Stat3 increased Jab1 expression in NPC cells. NPC cells were transfected by incubation with the Flag-Stat3 plasmid for 48 hours. The cells were then lysed and subjected to Western blotting for detection of Flag and Jab1 protein levels. (C) Knockdown of Stat3 downregulated endogenous Stat3 levels in NPC cell lines. Lysates were prepared from Stat3 <t>siRNA-infected</t> cells. (D) NPC cells were transfected with increasing [10 pM (+) and 40 pM (++)] doses of Stat3 siRNA for 48 hours, and Stat3 and Jab1 RNA levels were examined via quantitative PCR. (E) NPC cells with stable knockdown of Stat3 were established, and two clones for each cell line were selected for Stat3 and Jab1 detection. (F) NPC cells were exposed to CYT387 at the indicated concentration for 48 ho, and then were detected for p-Stat3 and Jab1 protein expression by western blotting. (G) Progressive deletions of the 5′ region of the Jab1 promoter in luciferase (Luc) constructs were transfected into NP460 and CNE1 cells and subjected to luciferase reporter assays. Promoter activity was higher in CNE1 cells than in NP460 cells. Deletion of the region −472 to −344 containing Stat3 binding site (−446/−423) 30 resulted in a loss of promoter activity in CNE1 cells. (H) ChIP assay was carried out using Stat3 and immunoglobulin G (IgG) antibodies, and the extracted DNA was amplified by real-time PCR. The data are the means with standard deviations for three independent experiments. ** P
    Shrna Targeting Stat3, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna targeting stat3/product/Thermo Fisher
    Average 91 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    shrna targeting stat3 - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    94
    Santa Cruz Biotechnology shrna targeting tpd54
    <t>Stat3</t> is overexpressed and regulates Jab1 levels in NPC cells (A) Whole-cell lysates were prepared from the cells as indicated. β-actin was used as a control for protein loading and integrity. The relative p-Stat3, T-Stat3, and Jab1 intensities for six samples are shown. (B) Ectopic Stat3 increased Jab1 expression in NPC cells. NPC cells were transfected by incubation with the Flag-Stat3 plasmid for 48 hours. The cells were then lysed and subjected to Western blotting for detection of Flag and Jab1 protein levels. (C) Knockdown of Stat3 downregulated endogenous Stat3 levels in NPC cell lines. Lysates were prepared from Stat3 <t>siRNA-infected</t> cells. (D) NPC cells were transfected with increasing [10 pM (+) and 40 pM (++)] doses of Stat3 siRNA for 48 hours, and Stat3 and Jab1 RNA levels were examined via quantitative PCR. (E) NPC cells with stable knockdown of Stat3 were established, and two clones for each cell line were selected for Stat3 and Jab1 detection. (F) NPC cells were exposed to CYT387 at the indicated concentration for 48 ho, and then were detected for p-Stat3 and Jab1 protein expression by western blotting. (G) Progressive deletions of the 5′ region of the Jab1 promoter in luciferase (Luc) constructs were transfected into NP460 and CNE1 cells and subjected to luciferase reporter assays. Promoter activity was higher in CNE1 cells than in NP460 cells. Deletion of the region −472 to −344 containing Stat3 binding site (−446/−423) 30 resulted in a loss of promoter activity in CNE1 cells. (H) ChIP assay was carried out using Stat3 and immunoglobulin G (IgG) antibodies, and the extracted DNA was amplified by real-time PCR. The data are the means with standard deviations for three independent experiments. ** P
    Shrna Targeting Tpd54, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna targeting tpd54/product/Santa Cruz Biotechnology
    Average 94 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    shrna targeting tpd54 - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    86
    Thermo Fisher foxc2 short hairpin rna shrna
    BSTA is essential for adipocyte differentiation. ( A ) 3T3 L1 preadipocytes treated as indicated were immunoblotted for BSTA and extracellular signal–regulated kinase (ERK). Total <t>RNA</t> from a second set of cells was used for qPCR analysis of bsta expression (graph), and averages and SDs obtained from three independent experiments are shown. ( B ) 3T3 L1 preadipocytes electroporated with scrambled (scr) or BSTA <t>siRNA</t> were differentiated with insulin/IBMX/dexamethasone (Dex) and stained with oil Red O. Scale bar, 100 μm. n = 5 experiments. ( C ) Primary human preadipocytes were electroporated with siRNA, induced to differentiate, and either immunoblotted to determine the phosphorylation status of Akt at Ser 473 (right) or differentiated further and stained. Scale bar, 100 μm. n = 2 experiments. ( D and E ) 3T3 L1 cells expressing a control vector (pMX) or human bsta (pMX-BSTA) were electroporated with siRNA and either immunoblotted with the indicated antibodies (D) or differentiated further (E). Endogenous murine BSTA is less mobile than exogenous (human) protein. Densitometric data ( n = 3 experiments) showing pAkt/Akt ratios (means ± SD; * P
    Foxc2 Short Hairpin Rna Shrna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/foxc2 short hairpin rna shrna/product/Thermo Fisher
    Average 86 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    foxc2 short hairpin rna shrna - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    85
    DOE Systems Biology Knowledgebase minimum pirna density
    BSTA is essential for adipocyte differentiation. ( A ) 3T3 L1 preadipocytes treated as indicated were immunoblotted for BSTA and extracellular signal–regulated kinase (ERK). Total <t>RNA</t> from a second set of cells was used for qPCR analysis of bsta expression (graph), and averages and SDs obtained from three independent experiments are shown. ( B ) 3T3 L1 preadipocytes electroporated with scrambled (scr) or BSTA <t>siRNA</t> were differentiated with insulin/IBMX/dexamethasone (Dex) and stained with oil Red O. Scale bar, 100 μm. n = 5 experiments. ( C ) Primary human preadipocytes were electroporated with siRNA, induced to differentiate, and either immunoblotted to determine the phosphorylation status of Akt at Ser 473 (right) or differentiated further and stained. Scale bar, 100 μm. n = 2 experiments. ( D and E ) 3T3 L1 cells expressing a control vector (pMX) or human bsta (pMX-BSTA) were electroporated with siRNA and either immunoblotted with the indicated antibodies (D) or differentiated further (E). Endogenous murine BSTA is less mobile than exogenous (human) protein. Densitometric data ( n = 3 experiments) showing pAkt/Akt ratios (means ± SD; * P
    Minimum Pirna Density, supplied by DOE Systems Biology Knowledgebase, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/minimum pirna density/product/DOE Systems Biology Knowledgebase
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    minimum pirna density - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    84
    Thermo Fisher pirna producing transcripts
    Preferred production of piRNAs from 3' UTRs. (A) Normalized <t>piRNA</t> read density amongst the transcript features of 5’ UTRs, CDS and 3’ UTRs in genes with > 50 piRNAs from <t>OSS</t> cells. Values greater than 1 indicate enrichment of piRNAs, values less than 1 indicate a depletion (see Methods). The box plot on the left shows the distribution of read density values amongst the group of genes with > 50 piRNAs, and a breakdown of genes enriched in certain features. The 3’ UTR feature contains the majority of genes and the greatest overall enrichment values. The bar graph on the right shows the enrichment of piRNAs in the 3’ UTR of tj and brat . 5’ UTRs, CDS and 3’ UTRs features are represented by blue, dark grey, and red colors, respectively. (B,C) Example of 3' UTR-directed piRNA production from the traffic jam and brat transcripts. (D) Comparison of proportions of 3’ UTR piRNAs in small RNA libraries from heterozygous and homozygous Drosophila mutants. 3’ UTR levels in homozygotes were normalized to the levels in the corresponding heterozygotes. (E) Normalized 3' UTR piRNA reads per million in wild type and Piwi-class mutants. piwi heterozygous ovaries exhibit substantially lower 3' UTR piRNAs than to aub or AGO3 heterozygotes.
    Pirna Producing Transcripts, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 84/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pirna producing transcripts/product/Thermo Fisher
    Average 84 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    pirna producing transcripts - by Bioz Stars, 2020-04
    84/100 stars
      Buy from Supplier

    94
    Santa Cruz Biotechnology shrna orai shrna
    Tumorigenicity of high salt passaged breast cancer cells following <t>shRNA</t> knock down of Orai1 expression ( A ) Temporal changes in the tumor volume following injection of 5 × 10 5 MCF-7 and MCF-7s cells into Nu/J ( n = 6) mice. ( B – E ) The mRNA expression of <t>Orai</t> (B), STIM1 (C), P-glycoprotein (D) and SIK3 (E). Data were represented as mean ± SEM, n = 6 per cohort, p
    Shrna Orai Shrna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna orai shrna/product/Santa Cruz Biotechnology
    Average 94 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    shrna orai shrna - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    eIF4G1 is required for cell growth, colony formation, expression of EMT genes and cell migration in PCa Cells: Loss of Function studies following knockdown of eIF4G1 using siRNA ( a , b ). Cell viability was measured by crystal violet assay at 48–96 h with siControl and sieIF4G1, the graph showed absorbance at 560 nm for LNCaP ( a ) and C4-2B ( b ). ( c ) Cell proliferation assay for LNCaP and C4-2B ( d ) done by MTT assay at 24–96 h with siControl and sieIF4G1. ( e ) Colony formation for LNCaP and C4-2B ( f ) siControl and sieIF4G1, Lower panels: Colonies were counted using an ImageJ software. Error bar represents ± SD. ( g ) Representative image of immunoblotting for LNCaP and C4-2B for N-Cadherin Snail 1 with siControl and sieIF4G1. ( h ) Representative image and graph of Transwell cell migration assays on LNCaP ( h ) C4-2B ( i ) with Vector Control (VC) sheIF4G1. p-values are indicated as *

    Journal: Scientific Reports

    Article Title: Eukaryotic Translation Initiation Factor 4 Gamma 1 (eIF4G1) is upregulated during Prostate cancer progression and modulates cell growth and metastasis

    doi: 10.1038/s41598-018-25798-7

    Figure Lengend Snippet: eIF4G1 is required for cell growth, colony formation, expression of EMT genes and cell migration in PCa Cells: Loss of Function studies following knockdown of eIF4G1 using siRNA ( a , b ). Cell viability was measured by crystal violet assay at 48–96 h with siControl and sieIF4G1, the graph showed absorbance at 560 nm for LNCaP ( a ) and C4-2B ( b ). ( c ) Cell proliferation assay for LNCaP and C4-2B ( d ) done by MTT assay at 24–96 h with siControl and sieIF4G1. ( e ) Colony formation for LNCaP and C4-2B ( f ) siControl and sieIF4G1, Lower panels: Colonies were counted using an ImageJ software. Error bar represents ± SD. ( g ) Representative image of immunoblotting for LNCaP and C4-2B for N-Cadherin Snail 1 with siControl and sieIF4G1. ( h ) Representative image and graph of Transwell cell migration assays on LNCaP ( h ) C4-2B ( i ) with Vector Control (VC) sheIF4G1. p-values are indicated as *

    Article Snippet: Transfection of this siRNA/shRNA was performed in six-well plates using the HiPerFect transfection reagent (Qiagen, CA)/Lipofectamine 2000 reagents (Life Technologies, Invitrogen) respectively as per manufacturer’s protocol.

    Techniques: Expressing, Migration, Crystal Violet Assay, Proliferation Assay, MTT Assay, Software, Plasmid Preparation

    NR2E3 regulates ESR1 function in breast cancer cells A-B. MCF-7 cells were stably transfected with shNR2E3 or control shRNA (shCon). Total RNA from indicated cell extracted and analysed by qRT-PCR with indicated probe. C-D. T47D cells were stably transfected with shNR2E3 or shCon. Total RNA and protein from indicated cell extracts were analysed by qRT-PCR with indicated probes. E. MCF-7 cells were stably transfected with shNR2E3 or control shRNA (shCon). Total protein from indicated cell extracted and analysed by Western blot with indicated antibody. F. Stably transfected MCF-7 with shNR2E3 or with shCon were transfected with ESR1 promoter construct, and the cells were harvested for luciferase assay. Values indicated relatively normalized luciferase activity. G-H. MCF-7 cells were transiently transfected with indicated siRNA, and cell lysates were used for Western blot ( G ) or for qRT-PCR ( H ). All results are shown as mean plus standard deviation (SD) from three-independent replicates (* p

    Journal: EMBO Molecular Medicine

    Article Title: Reconstruction of nuclear receptor network reveals that NR2E3 is a novel upstream regulator of ESR1 in breast cancer

    doi: 10.1002/emmm.201100187

    Figure Lengend Snippet: NR2E3 regulates ESR1 function in breast cancer cells A-B. MCF-7 cells were stably transfected with shNR2E3 or control shRNA (shCon). Total RNA from indicated cell extracted and analysed by qRT-PCR with indicated probe. C-D. T47D cells were stably transfected with shNR2E3 or shCon. Total RNA and protein from indicated cell extracts were analysed by qRT-PCR with indicated probes. E. MCF-7 cells were stably transfected with shNR2E3 or control shRNA (shCon). Total protein from indicated cell extracted and analysed by Western blot with indicated antibody. F. Stably transfected MCF-7 with shNR2E3 or with shCon were transfected with ESR1 promoter construct, and the cells were harvested for luciferase assay. Values indicated relatively normalized luciferase activity. G-H. MCF-7 cells were transiently transfected with indicated siRNA, and cell lysates were used for Western blot ( G ) or for qRT-PCR ( H ). All results are shown as mean plus standard deviation (SD) from three-independent replicates (* p

    Article Snippet: shRNA and siRNA shNR2E3 (SHCLND-NM_014249) and shControl (SHC002) clones were purchased from Sigma (St. Louis, MO).

    Techniques: Stable Transfection, Transfection, shRNA, Quantitative RT-PCR, Western Blot, Construct, Luciferase, Activity Assay, Standard Deviation

    BRD4-SWI/SNF interaction maintains NRG1 expression and is necessary for BRD4-mediated transformation. (A) Summary of IOSE proteomics experiment. (B) Gene-ontology analysis of BRD4 short-isoform proteomics hits. (C) Immunoprecipitations were carried out using FLAG (left) or BRD4 (right) antibodies in IOSE cells expressing BRD4 long and short isoforms. Western blot analysis of the resulting immuno-complexes was carried out to determine the association between BRD4 isoforms and members of the SWI/SNF complex. CDK9, a component of the pTEFb complex that interacts with the long isoform of BRD4, is used as a positive control. (D) shRNA-mediated SMARCA4 knockdown in BRD4-short expressing IOSE cells. (E) Soft-agar colony formation of shSMARCA4 expressing BRD4 short isoform-expressing IOSE cells. (F) Proliferation of shSMARCA4 expressing BRD4 short isoform-expressing IOSE cells. (G) qPCR analysis of NRG1 levels in IOSE cells overexpressing BRD4 isoforms after 4 days of siRNA-mediated SMARCA4 knockdown.

    Journal: PLoS ONE

    Article Title: BRD4 amplification facilitates an oncogenic gene expression program in high-grade serous ovarian cancer and confers sensitivity to BET inhibitors

    doi: 10.1371/journal.pone.0200826

    Figure Lengend Snippet: BRD4-SWI/SNF interaction maintains NRG1 expression and is necessary for BRD4-mediated transformation. (A) Summary of IOSE proteomics experiment. (B) Gene-ontology analysis of BRD4 short-isoform proteomics hits. (C) Immunoprecipitations were carried out using FLAG (left) or BRD4 (right) antibodies in IOSE cells expressing BRD4 long and short isoforms. Western blot analysis of the resulting immuno-complexes was carried out to determine the association between BRD4 isoforms and members of the SWI/SNF complex. CDK9, a component of the pTEFb complex that interacts with the long isoform of BRD4, is used as a positive control. (D) shRNA-mediated SMARCA4 knockdown in BRD4-short expressing IOSE cells. (E) Soft-agar colony formation of shSMARCA4 expressing BRD4 short isoform-expressing IOSE cells. (F) Proliferation of shSMARCA4 expressing BRD4 short isoform-expressing IOSE cells. (G) qPCR analysis of NRG1 levels in IOSE cells overexpressing BRD4 isoforms after 4 days of siRNA-mediated SMARCA4 knockdown.

    Article Snippet: shRNA and siRNA-mediated protein knockdown shRNA lentiviral viral particles targeting NRG1 (#SHCLND-NM_004495) and SMARCA4 (#SHCLNV-NM_003072) were obtained from Sigma-Aldrich.

    Techniques: Expressing, Transformation Assay, Western Blot, Positive Control, shRNA, Real-time Polymerase Chain Reaction

    Recruitment of KDM3B to the lmo2 promoter. (A) 293T cells were transfected with the pGL-lmo2 promoter reporter and the indicated DNA constructs and sh-RNAs, and their cell extracts were assayed for luciferase activity. Luciferase activities were normalized

    Journal: Molecular and Cellular Biology

    Article Title: KDM3B Is the H3K9 Demethylase Involved in Transcriptional Activation of lmo2 in Leukemia

    doi: 10.1128/MCB.00133-12

    Figure Lengend Snippet: Recruitment of KDM3B to the lmo2 promoter. (A) 293T cells were transfected with the pGL-lmo2 promoter reporter and the indicated DNA constructs and sh-RNAs, and their cell extracts were assayed for luciferase activity. Luciferase activities were normalized

    Article Snippet: Short hairpin RNA (shRNA) against human KDM3B (SHCLNG-NM-016604) and small interfering RNA (siRNA) against human KDM3B (L-020378-01-0010) were purchased from Sigma and Dharmacon, respectively.

    Techniques: Transfection, Construct, Luciferase, Activity Assay

    KDM3B regulates lmo2 transcription via interaction with CBP. (A and B) 293T cells were transiently transfected with the lmo2 promoter reporter plasmid along with KDM3B, sh-KDM3Bs, and CBP (A) or PCAF constructs (B). The results are representative of at

    Journal: Molecular and Cellular Biology

    Article Title: KDM3B Is the H3K9 Demethylase Involved in Transcriptional Activation of lmo2 in Leukemia

    doi: 10.1128/MCB.00133-12

    Figure Lengend Snippet: KDM3B regulates lmo2 transcription via interaction with CBP. (A and B) 293T cells were transiently transfected with the lmo2 promoter reporter plasmid along with KDM3B, sh-KDM3Bs, and CBP (A) or PCAF constructs (B). The results are representative of at

    Article Snippet: Short hairpin RNA (shRNA) against human KDM3B (SHCLNG-NM-016604) and small interfering RNA (siRNA) against human KDM3B (L-020378-01-0010) were purchased from Sigma and Dharmacon, respectively.

    Techniques: Transfection, Plasmid Preparation, Construct

    KDM3B is an H3K9-specific demethylase. (A) Phylogenetic analysis based on protein sequence data of human, rat, and mouse KDM3 families. (B) Schematic representations of KDM3B with functional domains and the deletion mutants are shown. (C) 293T cells were

    Journal: Molecular and Cellular Biology

    Article Title: KDM3B Is the H3K9 Demethylase Involved in Transcriptional Activation of lmo2 in Leukemia

    doi: 10.1128/MCB.00133-12

    Figure Lengend Snippet: KDM3B is an H3K9-specific demethylase. (A) Phylogenetic analysis based on protein sequence data of human, rat, and mouse KDM3 families. (B) Schematic representations of KDM3B with functional domains and the deletion mutants are shown. (C) 293T cells were

    Article Snippet: Short hairpin RNA (shRNA) against human KDM3B (SHCLNG-NM-016604) and small interfering RNA (siRNA) against human KDM3B (L-020378-01-0010) were purchased from Sigma and Dharmacon, respectively.

    Techniques: Sequencing, Functional Assay

    KDM3B activates the transcription of lmo2. (A) HL-60 cells were treated with ATRA or DMSO. After 48 h, real-time PCR was performed to compare the expression levels of the target genes. (B) The expression levels of KDM3B and lmo2 in HL-60 and 293T cells

    Journal: Molecular and Cellular Biology

    Article Title: KDM3B Is the H3K9 Demethylase Involved in Transcriptional Activation of lmo2 in Leukemia

    doi: 10.1128/MCB.00133-12

    Figure Lengend Snippet: KDM3B activates the transcription of lmo2. (A) HL-60 cells were treated with ATRA or DMSO. After 48 h, real-time PCR was performed to compare the expression levels of the target genes. (B) The expression levels of KDM3B and lmo2 in HL-60 and 293T cells

    Article Snippet: Short hairpin RNA (shRNA) against human KDM3B (SHCLNG-NM-016604) and small interfering RNA (siRNA) against human KDM3B (L-020378-01-0010) were purchased from Sigma and Dharmacon, respectively.

    Techniques: Real-time Polymerase Chain Reaction, Expressing

    Identification of KDM3B as an H3K9-me2 target gene in ATRA-treated HL-60 cells. (A) Morphological observation of Giemsa-stained cells treated for 48 h with 1 μM ATRA. (B) The KDM3B locus from chromosome 5 is shown in 5′ to 3′ orientation.

    Journal: Molecular and Cellular Biology

    Article Title: KDM3B Is the H3K9 Demethylase Involved in Transcriptional Activation of lmo2 in Leukemia

    doi: 10.1128/MCB.00133-12

    Figure Lengend Snippet: Identification of KDM3B as an H3K9-me2 target gene in ATRA-treated HL-60 cells. (A) Morphological observation of Giemsa-stained cells treated for 48 h with 1 μM ATRA. (B) The KDM3B locus from chromosome 5 is shown in 5′ to 3′ orientation.

    Article Snippet: Short hairpin RNA (shRNA) against human KDM3B (SHCLNG-NM-016604) and small interfering RNA (siRNA) against human KDM3B (L-020378-01-0010) were purchased from Sigma and Dharmacon, respectively.

    Techniques: Staining

    Identification of the H3K9-me2 target gene KDM3B during differentiation of a leukemia cell line by ATRA.

    Journal: Molecular and Cellular Biology

    Article Title: KDM3B Is the H3K9 Demethylase Involved in Transcriptional Activation of lmo2 in Leukemia

    doi: 10.1128/MCB.00133-12

    Figure Lengend Snippet: Identification of the H3K9-me2 target gene KDM3B during differentiation of a leukemia cell line by ATRA.

    Article Snippet: Short hairpin RNA (shRNA) against human KDM3B (SHCLNG-NM-016604) and small interfering RNA (siRNA) against human KDM3B (L-020378-01-0010) were purchased from Sigma and Dharmacon, respectively.

    Techniques:

    KDM3B was overexpressed in ALL-type leukemia patient samples. (A and B) Each individual spot of KDM3B (A) and lmo2 (B) expression in total cells extracted from blood cells of healthy individuals and leukemia patients. Western blots were analyzed quantitatively

    Journal: Molecular and Cellular Biology

    Article Title: KDM3B Is the H3K9 Demethylase Involved in Transcriptional Activation of lmo2 in Leukemia

    doi: 10.1128/MCB.00133-12

    Figure Lengend Snippet: KDM3B was overexpressed in ALL-type leukemia patient samples. (A and B) Each individual spot of KDM3B (A) and lmo2 (B) expression in total cells extracted from blood cells of healthy individuals and leukemia patients. Western blots were analyzed quantitatively

    Article Snippet: Short hairpin RNA (shRNA) against human KDM3B (SHCLNG-NM-016604) and small interfering RNA (siRNA) against human KDM3B (L-020378-01-0010) were purchased from Sigma and Dharmacon, respectively.

    Techniques: Expressing, Western Blot

    KDM3B induces leukemic transformation. (A to C) Granulocytic differentiation was analyzed by FACS 72 h after ATRA treatment. Percentages of CD11b-positive cells in HL-60 cells after transfection with KDM3B or sh-KDM3B as follows: ATRA (A), KDM3B with

    Journal: Molecular and Cellular Biology

    Article Title: KDM3B Is the H3K9 Demethylase Involved in Transcriptional Activation of lmo2 in Leukemia

    doi: 10.1128/MCB.00133-12

    Figure Lengend Snippet: KDM3B induces leukemic transformation. (A to C) Granulocytic differentiation was analyzed by FACS 72 h after ATRA treatment. Percentages of CD11b-positive cells in HL-60 cells after transfection with KDM3B or sh-KDM3B as follows: ATRA (A), KDM3B with

    Article Snippet: Short hairpin RNA (shRNA) against human KDM3B (SHCLNG-NM-016604) and small interfering RNA (siRNA) against human KDM3B (L-020378-01-0010) were purchased from Sigma and Dharmacon, respectively.

    Techniques: Transformation Assay, FACS, Transfection

    aPKCι is required for the survival and maintenance of human CML CD34 + cells. a Schematic diagram of shRNA mediated knockdown of aPKCι in CML patient-derived CD34 + cells followed by in vitro culture as well as in vivo transplantation into NSG-S mice. b Q-RT-PCR showing shRNA mediated knockdown of aPKCι in CML CD34 + cells. c Colony forming unit (CFU) cell assay showing reduced clonogenic efficiency of aPKCι deficient CML CD34 + cells. d Liquid culture expansion of control and aPKCι deficient CML CD34 + cells. e FACS quantification of CD34 − /CD11b + cells derived from control and aPKCι knocked down CML CD34 + cells grown in liquid culture medium. f FACS quantification of annexin V-binding of control/aPKCι knocked down CML CD34 + cells growing in liquid culture expansion medium. g hCD45 + /EGFP + chimera in NSG-S mice transplanted with CML CD34 + cells transduced with control/aPKCι shRNA lentiviruses. h , i Quantification of BrDU uptake ( h ) and annexin V-binding ( i ) of hCD45 + /EGFP + chimera in the bone marrow (BM) of NSG-S mice transplanted with control/aPKCι shRNA transduced CML CD34 + cells. j hCD45 + /hCD11b + on EGFP + chimera in NSG-S mice transplanted with CML CD34 + cells transduced with control/aPKCι shRNA lentiviruses. k Schematic diagram of pharmacological administration of imatinib and a pan-PKC inhibitor (Ro-31-8200) to NSG-S mice transplanted with CML CD34 + cells and T315I p210 BCR-ABL transduced CB CD34 + cells. l FACS quantification of human CD45 + cell engraftment in the BM of NSG-S mice transplanted with CML CD34 + cells and treated with either control vehicle, imatinib, Ro-31-8200 or a combination of imatinib and Ro-31-8200. Imatinib and Ro-31-8200 administration led to a similar decrease of human CML burden in the BM of NSG-S mice. m FACS quantification of hCD45 + /EGFP + chimera in the BM of NSG-S mice transplanted with T315I transduced CB CD34 + cells and treated with control vehicle, imatinib or R0-31-8200. Mice treated with the PKC inhibitor show reduced levels of human CD45 + /EGFP + chimera in the BM, whereas imatinib treatment has no effect. Cont: Control. Data are presented as mean ± SD of a minimum of two independent experiments.* p

    Journal: Nature Communications

    Article Title: The signaling axis atypical protein kinase C λ/ι-Satb2 mediates leukemic transformation of B-cell progenitors

    doi: 10.1038/s41467-018-07846-y

    Figure Lengend Snippet: aPKCι is required for the survival and maintenance of human CML CD34 + cells. a Schematic diagram of shRNA mediated knockdown of aPKCι in CML patient-derived CD34 + cells followed by in vitro culture as well as in vivo transplantation into NSG-S mice. b Q-RT-PCR showing shRNA mediated knockdown of aPKCι in CML CD34 + cells. c Colony forming unit (CFU) cell assay showing reduced clonogenic efficiency of aPKCι deficient CML CD34 + cells. d Liquid culture expansion of control and aPKCι deficient CML CD34 + cells. e FACS quantification of CD34 − /CD11b + cells derived from control and aPKCι knocked down CML CD34 + cells grown in liquid culture medium. f FACS quantification of annexin V-binding of control/aPKCι knocked down CML CD34 + cells growing in liquid culture expansion medium. g hCD45 + /EGFP + chimera in NSG-S mice transplanted with CML CD34 + cells transduced with control/aPKCι shRNA lentiviruses. h , i Quantification of BrDU uptake ( h ) and annexin V-binding ( i ) of hCD45 + /EGFP + chimera in the bone marrow (BM) of NSG-S mice transplanted with control/aPKCι shRNA transduced CML CD34 + cells. j hCD45 + /hCD11b + on EGFP + chimera in NSG-S mice transplanted with CML CD34 + cells transduced with control/aPKCι shRNA lentiviruses. k Schematic diagram of pharmacological administration of imatinib and a pan-PKC inhibitor (Ro-31-8200) to NSG-S mice transplanted with CML CD34 + cells and T315I p210 BCR-ABL transduced CB CD34 + cells. l FACS quantification of human CD45 + cell engraftment in the BM of NSG-S mice transplanted with CML CD34 + cells and treated with either control vehicle, imatinib, Ro-31-8200 or a combination of imatinib and Ro-31-8200. Imatinib and Ro-31-8200 administration led to a similar decrease of human CML burden in the BM of NSG-S mice. m FACS quantification of hCD45 + /EGFP + chimera in the BM of NSG-S mice transplanted with T315I transduced CB CD34 + cells and treated with control vehicle, imatinib or R0-31-8200. Mice treated with the PKC inhibitor show reduced levels of human CD45 + /EGFP + chimera in the BM, whereas imatinib treatment has no effect. Cont: Control. Data are presented as mean ± SD of a minimum of two independent experiments.* p

    Article Snippet: The lentiviral vectors for aPKCι shRNA (pLKO.1-CMV-tGFP shRNA plasmid DNA, catalog SHCLND 10141531MN) and control shRNA (pLKO.1-puro-CMV-TurboGFP+ control plasmid DNA, catalog SHC003 02101412MN) were obtained from Sigma-Aldrich.

    Techniques: shRNA, Derivative Assay, In Vitro, In Vivo, Transplantation Assay, Mouse Assay, Reverse Transcription Polymerase Chain Reaction, FACS, Binding Assay, Transduction

    SMAC mimetics promote cell death via the formation of a CASP8-activating platform. ( A ) HIV-T CM simultaneous transduced with ATG2A and ATG2B shRNA (sh ATG2A/B ), ATG5 shRNA (sh ATG5) , ATG7 (sh ATG7 ), RUBCN (sh RUBCN ), SQSTM1 (sh SQSTM1 ), ULK1 (sh ULK1 ), or scrambled shRNA (shNS) were incubated with 100 nM birinapant, 100 nM GDC-0152, 10 μ M embelin, or vehicle. Cell death was measured after 24 h using a cell death ELISA. n . ( B ) HIV-T CM were pretreated with vehicle, bafilomycin A 1 ( Baf A 1 ), or chloroquine ( CQ ) before incubation with 100 nM birinapant, 100 nM GDC-0152 or 10 μ M embelin for 24 h. Cell death was measured using a cell death ELISA. n . ( C ) T CM and HIV-T CM were treated with 100 nM birinapant, 100 nM GDC-0152 or 10 μ M embelin for 24 h. Cells were lysed and CASP8 was immunoprecipitated (IP). The presence of ATG7, ATG12–ATG5, FADD, MLKL, cleaved RIPK1 (cRIPK1), RIPK3, cleaved RIPK3 (cRIPK3), and SQSTM1 and CASP8 was assayed by western blot. Left , representative western blots. Right , densitometric analysis of blots. n = 4.

    Journal: Cell host & microbe

    Article Title: SMAC mimetics induce autophagy-dependent apoptosis of HIV-1-infected resting memory CD4+ T cells

    doi: 10.1016/j.chom.2018.09.007

    Figure Lengend Snippet: SMAC mimetics promote cell death via the formation of a CASP8-activating platform. ( A ) HIV-T CM simultaneous transduced with ATG2A and ATG2B shRNA (sh ATG2A/B ), ATG5 shRNA (sh ATG5) , ATG7 (sh ATG7 ), RUBCN (sh RUBCN ), SQSTM1 (sh SQSTM1 ), ULK1 (sh ULK1 ), or scrambled shRNA (shNS) were incubated with 100 nM birinapant, 100 nM GDC-0152, 10 μ M embelin, or vehicle. Cell death was measured after 24 h using a cell death ELISA. n . ( B ) HIV-T CM were pretreated with vehicle, bafilomycin A 1 ( Baf A 1 ), or chloroquine ( CQ ) before incubation with 100 nM birinapant, 100 nM GDC-0152 or 10 μ M embelin for 24 h. Cell death was measured using a cell death ELISA. n . ( C ) T CM and HIV-T CM were treated with 100 nM birinapant, 100 nM GDC-0152 or 10 μ M embelin for 24 h. Cells were lysed and CASP8 was immunoprecipitated (IP). The presence of ATG7, ATG12–ATG5, FADD, MLKL, cleaved RIPK1 (cRIPK1), RIPK3, cleaved RIPK3 (cRIPK3), and SQSTM1 and CASP8 was assayed by western blot. Left , representative western blots. Right , densitometric analysis of blots. n = 4.

    Article Snippet: Lentiviral transduction with MISSION lentiviral particles containing short hairpin RNA (shRNA) targeting ATG2A (SHCLNV- /TRCN0000168420), ATG2B (SHCLNV- /TRCN0000150114), ATG5 (SHCLNV- /TRCN0000151963), ATG7 (SHCLNV- /TRCN0000007584), RUBCN (SHCLNV- /TRCN0000235638), SQSTM1 (SHCLNV- /TRCN0000007237), ULK1 (SHCLNV- /TRCN0000000835), or scrambled non-target negative control (SHC002V) was performed according to the manufacturer's protocol (Sigma).

    Techniques: Transduction, shRNA, Incubation, Enzyme-linked Immunosorbent Assay, Immunoprecipitation, Western Blot

    HDACi-mediated decrease of HIV p24 antigen release from macrophages requires ATG7. A, macrophages transduced with ATG7 shRNA (TRCN0000007584 or TRCN0000435480) or scrambled shRNA ( shNS ) were incubated with HDACi for 24 h before HIV infection under continuous

    Journal: The Journal of Biological Chemistry

    Article Title: Autophagy Induction by Histone Deacetylase Inhibitors Inhibits HIV Type 1 *

    doi: 10.1074/jbc.M114.605428

    Figure Lengend Snippet: HDACi-mediated decrease of HIV p24 antigen release from macrophages requires ATG7. A, macrophages transduced with ATG7 shRNA (TRCN0000007584 or TRCN0000435480) or scrambled shRNA ( shNS ) were incubated with HDACi for 24 h before HIV infection under continuous

    Article Snippet: Lentiviral transduction of macrophages with MISSION lentiviral particles containing shRNAs targeting ATG5 (SHCLNV- /TRCN0000150940 and TRCN0000151963), ATG7 (SHCLNV- /TRCN0000007584 and TRCN0000435480), or scrambled nontarget negative control (SHC002V) was performed according to the manufacturer's protocol (Sigma).

    Techniques: Transduction, shRNA, Incubation, Infection

    Role of Sox8 and Wnt signaling in meiotic progression and commitment of spermatogonial cells. (A) Sox8 binding site in the 1-kb upstream promoters of important premeiotic and meiotic marker genes. (B) Expression analysis of Sox8 by RT-qPCR and Western blotting upon Sox8 silencing by shRNA. (C) Expression analysis of premeiotic markers ( Stra8 , Lhx8 , and c- kit ) and meiotic markers ( Mtl5 and Hspa2 ) upon Wnt signaling activation as well as upon Sox8 silencing in control and Wnt3A conditioned medium-treated Gc1-Spg cells. (D) Change in global chromatin architecture in mouse spermatogonial Gc1-Spg cells upon treatment with Wnt3A conditioned medium for different time durations (2, 4, and 6 days). (E) Apoptosis assay of Gc1-Spg cells upon prolonged Wnt3A treatment (24, 48, 72, and 96 h). PE, R -phycoerythrin.

    Journal: Molecular and Cellular Biology

    Article Title: Mrhl Long Noncoding RNA Mediates Meiotic Commitment of Mouse Spermatogonial Cells by Regulating Sox8 Expression

    doi: 10.1128/MCB.00632-16

    Figure Lengend Snippet: Role of Sox8 and Wnt signaling in meiotic progression and commitment of spermatogonial cells. (A) Sox8 binding site in the 1-kb upstream promoters of important premeiotic and meiotic marker genes. (B) Expression analysis of Sox8 by RT-qPCR and Western blotting upon Sox8 silencing by shRNA. (C) Expression analysis of premeiotic markers ( Stra8 , Lhx8 , and c- kit ) and meiotic markers ( Mtl5 and Hspa2 ) upon Wnt signaling activation as well as upon Sox8 silencing in control and Wnt3A conditioned medium-treated Gc1-Spg cells. (D) Change in global chromatin architecture in mouse spermatogonial Gc1-Spg cells upon treatment with Wnt3A conditioned medium for different time durations (2, 4, and 6 days). (E) Apoptosis assay of Gc1-Spg cells upon prolonged Wnt3A treatment (24, 48, 72, and 96 h). PE, R -phycoerythrin.

    Article Snippet: Sox8 shRNA (SHCLNG- ) and Myc-shRNA (SHCLNG- ) were obtained from Sigma.

    Techniques: Binding Assay, Marker, Expressing, Quantitative RT-PCR, Western Blot, shRNA, Activation Assay, Apoptosis Assay

    CCR1 is required for FOXP1 -mediated effect. (a and b) OD values of A549 (a) and PC9 (b) cells at 24h, 48h, and 72h after siFOXP1, siCCR1, or siFOXP1+ siCCR1 treatment. Upper panels are Western blot images showing the FOXP1 and CCR1 expression 48 hrs after the treatment of different siRNAs. Actin serves as loading control. (c and d) Bar graphs show the relative invasion of A549 (c) and PC9 (d) cells 48 hrs after siFOXP1, siCCR1, or siFOXP1+ siCCR1 treatment. (e) RT-PCR shows the expression levels of ADCY5, GNG7 and VAV3 but not PLCB1 48 hrs after the overexpression of CCR1 . Inset is the gel picture of Western blot examining the expression of CCR1 in overexpressed cells. (f and g) Bar graphs show the luciferase activity in A549 (f) and PC9 (g) cells after 36 hrs of FOXP1 siRNA treatment. * p

    Journal: Cancer Biology & Therapy

    Article Title: Knockdown of FOXP1 promotes the development of lung adenocarcinoma

    doi: 10.1080/15384047.2018.1537999

    Figure Lengend Snippet: CCR1 is required for FOXP1 -mediated effect. (a and b) OD values of A549 (a) and PC9 (b) cells at 24h, 48h, and 72h after siFOXP1, siCCR1, or siFOXP1+ siCCR1 treatment. Upper panels are Western blot images showing the FOXP1 and CCR1 expression 48 hrs after the treatment of different siRNAs. Actin serves as loading control. (c and d) Bar graphs show the relative invasion of A549 (c) and PC9 (d) cells 48 hrs after siFOXP1, siCCR1, or siFOXP1+ siCCR1 treatment. (e) RT-PCR shows the expression levels of ADCY5, GNG7 and VAV3 but not PLCB1 48 hrs after the overexpression of CCR1 . Inset is the gel picture of Western blot examining the expression of CCR1 in overexpressed cells. (f and g) Bar graphs show the luciferase activity in A549 (f) and PC9 (g) cells after 36 hrs of FOXP1 siRNA treatment. * p

    Article Snippet: ShRNA-FOXP1 (Sigma, SHCLNV- > TRCN0000015664) and ShRNA-CCR1 (Sigma, SHCLNV- > TRCN0000027778) were introduced to cell using Lentiviral system

    Techniques: Western Blot, Expressing, Reverse Transcription Polymerase Chain Reaction, Over Expression, Luciferase, Activity Assay

    Chemokine signaling pathways are involved in FOXP1 -mediated effect. (a) Hierarchical clustering analysis reveals the alterations of transcripts in A549 cells treated with control or FOXP1 siRNA. (b) KEGG analysis of those significantly changed genes shows their enrichment in chemokine signaling pathway. (c and d) The heatmap of representative genes (c) and the RT-PCR validations (d), showing the alterations of CCR1, ADCY5, GNG7, VAV3 , and PLCB1 after the knockdown of FOXP1 . * p

    Journal: Cancer Biology & Therapy

    Article Title: Knockdown of FOXP1 promotes the development of lung adenocarcinoma

    doi: 10.1080/15384047.2018.1537999

    Figure Lengend Snippet: Chemokine signaling pathways are involved in FOXP1 -mediated effect. (a) Hierarchical clustering analysis reveals the alterations of transcripts in A549 cells treated with control or FOXP1 siRNA. (b) KEGG analysis of those significantly changed genes shows their enrichment in chemokine signaling pathway. (c and d) The heatmap of representative genes (c) and the RT-PCR validations (d), showing the alterations of CCR1, ADCY5, GNG7, VAV3 , and PLCB1 after the knockdown of FOXP1 . * p

    Article Snippet: ShRNA-FOXP1 (Sigma, SHCLNV- > TRCN0000015664) and ShRNA-CCR1 (Sigma, SHCLNV- > TRCN0000027778) were introduced to cell using Lentiviral system

    Techniques: Reverse Transcription Polymerase Chain Reaction

    NMT1 is necessary for cilia formation in Pan02 cells ( A ) Pan02 lines expressing control non-targeting shRNA or NMT1 shRNA were cultured for 20 h and processed for detection of cilia by acetylated tubulin staining. (A) Percent of cells forming cilia was quantified in at least 250 cells per condition in three independent experiments. The graph shows average ± S.E.M. for the percent of cells forming cilia in a representative experiment out of three independent experiments. (*) p

    Journal: Oncotarget

    Article Title: Tris DBA palladium is highly effective against growth and metastasis of pancreatic cancer in an orthotopic model

    doi: 10.18632/oncotarget.10514

    Figure Lengend Snippet: NMT1 is necessary for cilia formation in Pan02 cells ( A ) Pan02 lines expressing control non-targeting shRNA or NMT1 shRNA were cultured for 20 h and processed for detection of cilia by acetylated tubulin staining. (A) Percent of cells forming cilia was quantified in at least 250 cells per condition in three independent experiments. The graph shows average ± S.E.M. for the percent of cells forming cilia in a representative experiment out of three independent experiments. (*) p

    Article Snippet: Generation of NMT1 deficient Pan02 cell lines Pan02 cells were infected with lentiviral particles generated from pLKO.1 puro CMV-turbo GFP constructs expressing either control non-targeting shRNA (SHC003, Sigma) or NMT1 shRNA (SHCLNV-NM_008707, TRCN0000055163, Sigma).

    Techniques: Expressing, shRNA, Cell Culture, Staining

    TBL1 controls PI3 kinase signaling by direct transcriptional regulation Gene expression microarray from Capan-1 cells transfected with siRNA. Heatmap shows genes annotated to KEGG pathway hsa04110 “Cell Cycle” and/or gene ontology cluster GO:0007049 “Cell Cycle”. Protein expression of Panc02 cells with stable shRNA expression prior to implantation into mice. Chromatin immunoprecipitation from Capan-1 cells with or without siRNA-mediated knockdown of TBL1. IgG and primers for PIK3CA coding region served as a negative control; histone H3 served as a positive control. Proliferation time course assay in control and TBL1 shRNA-transfected Panc02 cells overexpressing constitutively active PI3K p100α mutant E545K. Cells were stained with crystal violet, and absorbance was measured at 595 nm. n = 9 cell culture wells per group; statistically significant at P

    Journal: EMBO Molecular Medicine

    Article Title: Transcriptional co-factor Transducin beta-like (TBL) 1 acts as a checkpoint in pancreatic cancer malignancy

    doi: 10.15252/emmm.201404837

    Figure Lengend Snippet: TBL1 controls PI3 kinase signaling by direct transcriptional regulation Gene expression microarray from Capan-1 cells transfected with siRNA. Heatmap shows genes annotated to KEGG pathway hsa04110 “Cell Cycle” and/or gene ontology cluster GO:0007049 “Cell Cycle”. Protein expression of Panc02 cells with stable shRNA expression prior to implantation into mice. Chromatin immunoprecipitation from Capan-1 cells with or without siRNA-mediated knockdown of TBL1. IgG and primers for PIK3CA coding region served as a negative control; histone H3 served as a positive control. Proliferation time course assay in control and TBL1 shRNA-transfected Panc02 cells overexpressing constitutively active PI3K p100α mutant E545K. Cells were stained with crystal violet, and absorbance was measured at 595 nm. n = 9 cell culture wells per group; statistically significant at P

    Article Snippet: Lentivirus transduction HEK293T cells were transfected with 1 μg of lentiviral pLKO.1 vector with TBL1-specific shRNA (SHCLNG-NM_02 0601, Sigma) or scrambled shRNA (Addgene, #1864), 1 μg psPAX2 (Addgene, #12260) and 100 ng pMD2.G (Addgene, #12259) in a 6-well format using Lipofectamine 2000 according to manufacturer’s instructions.

    Techniques: Expressing, Microarray, Transfection, shRNA, Mouse Assay, Chromatin Immunoprecipitation, Negative Control, Positive Control, Mutagenesis, Staining, Cell Culture

    TBL1 controls pancreatic cancer cell growth and metabolic adaptations Left panel: EdU incorporation in siRNA-transfected Capan-1 cells (72 h post-transfection), n = 6 cell culture wells per group; significantly different ( P

    Journal: EMBO Molecular Medicine

    Article Title: Transcriptional co-factor Transducin beta-like (TBL) 1 acts as a checkpoint in pancreatic cancer malignancy

    doi: 10.15252/emmm.201404837

    Figure Lengend Snippet: TBL1 controls pancreatic cancer cell growth and metabolic adaptations Left panel: EdU incorporation in siRNA-transfected Capan-1 cells (72 h post-transfection), n = 6 cell culture wells per group; significantly different ( P

    Article Snippet: Lentivirus transduction HEK293T cells were transfected with 1 μg of lentiviral pLKO.1 vector with TBL1-specific shRNA (SHCLNG-NM_02 0601, Sigma) or scrambled shRNA (Addgene, #1864), 1 μg psPAX2 (Addgene, #12260) and 100 ng pMD2.G (Addgene, #12259) in a 6-well format using Lipofectamine 2000 according to manufacturer’s instructions.

    Techniques: Transfection, Cell Culture

    TBL1-depletion leads to reduction in PI3 kinase p110α and cell cycle-associated proteins Panc02 cells with stable expression of shRNA were implanted subcutaneously into C57Bl6/N mice. Seven days later, mice were treated with 20 mg/kg gemcitabine delivered by intraperitoneal injection. After 21 days, mice were sacrificed, tumors were removed and proteins were extracted and immunoblotted.

    Journal: EMBO Molecular Medicine

    Article Title: Transcriptional co-factor Transducin beta-like (TBL) 1 acts as a checkpoint in pancreatic cancer malignancy

    doi: 10.15252/emmm.201404837

    Figure Lengend Snippet: TBL1-depletion leads to reduction in PI3 kinase p110α and cell cycle-associated proteins Panc02 cells with stable expression of shRNA were implanted subcutaneously into C57Bl6/N mice. Seven days later, mice were treated with 20 mg/kg gemcitabine delivered by intraperitoneal injection. After 21 days, mice were sacrificed, tumors were removed and proteins were extracted and immunoblotted.

    Article Snippet: Lentivirus transduction HEK293T cells were transfected with 1 μg of lentiviral pLKO.1 vector with TBL1-specific shRNA (SHCLNG-NM_02 0601, Sigma) or scrambled shRNA (Addgene, #1864), 1 μg psPAX2 (Addgene, #12260) and 100 ng pMD2.G (Addgene, #12259) in a 6-well format using Lipofectamine 2000 according to manufacturer’s instructions.

    Techniques: Expressing, shRNA, Mouse Assay, Injection

    TBL1 reverses and prevents tumor growth in vivo and sensitizes toward chemotherapy A–D Panc02 cells with stable expression of luciferase were implanted subcutaneously into C57Bl6/N mice. Six days later, tumors were injected three times per week with 10 8 ifu of adenovirus encoding shRNA. (A–C): Data plotted as mean ± SEM; n = 4 animals in control (shNC) group and n = 3 animals in knockdown (shTBL1) group; significantly different ( P

    Journal: EMBO Molecular Medicine

    Article Title: Transcriptional co-factor Transducin beta-like (TBL) 1 acts as a checkpoint in pancreatic cancer malignancy

    doi: 10.15252/emmm.201404837

    Figure Lengend Snippet: TBL1 reverses and prevents tumor growth in vivo and sensitizes toward chemotherapy A–D Panc02 cells with stable expression of luciferase were implanted subcutaneously into C57Bl6/N mice. Six days later, tumors were injected three times per week with 10 8 ifu of adenovirus encoding shRNA. (A–C): Data plotted as mean ± SEM; n = 4 animals in control (shNC) group and n = 3 animals in knockdown (shTBL1) group; significantly different ( P

    Article Snippet: Lentivirus transduction HEK293T cells were transfected with 1 μg of lentiviral pLKO.1 vector with TBL1-specific shRNA (SHCLNG-NM_02 0601, Sigma) or scrambled shRNA (Addgene, #1864), 1 μg psPAX2 (Addgene, #12260) and 100 ng pMD2.G (Addgene, #12259) in a 6-well format using Lipofectamine 2000 according to manufacturer’s instructions.

    Techniques: In Vivo, Expressing, Luciferase, Mouse Assay, Injection, shRNA

    Silencing of the remodelled G3BP1 partners impacts on MNV replication. Transient silencing of factors interacting with G3BP1 in MNV-infected cells lead to a decreased viral replication. BV2 cells were transduced with lentiviral particles carrying shRNA coding sequence for 48h prior MNV infection at MOI 10 and total RNA extracted at t = 0 and 9h p.i. qRT-PCR results show the mean ± SD (n = 3) level of MNV genomic RNA at 9h p.i,. normalised by the level of GAPDH mRNA and presented as percentage of the control shRNA in cells silenced for TIAL-1, Rbm25, SF3B1 and RPL7. Statistical significance given above the bars, *, P

    Journal: PLoS Pathogens

    Article Title: Norovirus infection results in eIF2α independent host translation shut-off and remodels the G3BP1 interactome evading stress granule formation

    doi: 10.1371/journal.ppat.1008250

    Figure Lengend Snippet: Silencing of the remodelled G3BP1 partners impacts on MNV replication. Transient silencing of factors interacting with G3BP1 in MNV-infected cells lead to a decreased viral replication. BV2 cells were transduced with lentiviral particles carrying shRNA coding sequence for 48h prior MNV infection at MOI 10 and total RNA extracted at t = 0 and 9h p.i. qRT-PCR results show the mean ± SD (n = 3) level of MNV genomic RNA at 9h p.i,. normalised by the level of GAPDH mRNA and presented as percentage of the control shRNA in cells silenced for TIAL-1, Rbm25, SF3B1 and RPL7. Statistical significance given above the bars, *, P

    Article Snippet: Silencing of gene expression in BV2 cells was performed using MISSION shRNA lentiviral vectors from Sigma: shRNA RBM25 (SHCLNG-NM_027349), shRNA TIAL-1 (SHCLNG-NM_009383), shRNA SF3B1 (SHCLNG-NM_031179), shRNA Rpl7 (SHCLNG-NM_011291) and non-target control shRNA (SHCLNG-NM_019472) in the pLKO.1-puro vector backbone.

    Techniques: Infection, Transduction, shRNA, Sequencing, Quantitative RT-PCR

    Effects of SIRT6 depletion on HCC cell growth. (A) The expression of SIRT6 in HCC cell lines and normal liver lysate was assessed by western blotting using actin as a loading control. (B) Band intensities were measured by densitometry using Image J. SIRT6 band intensities were normalized to those of actin. (C) Upregulation of SIRT6 mRNA was assessed in HCC tumors relative to normal adjacent tissues by RT-PCR. (D) Hep3B, Huh-7, SNU475, and SNU449 cells were incubated with lentiviral particles containing plasmids with either negative control (NC) or SIRT6 shRNA. Five different lentiviral particles (C1–C5) targeting different sequences were used to delete the SIRT6 gene. HCC cells were harvested 5 days after viral transduction, followed by western blotting to compare the knockdown efficiency of SIRT6. (E) HCC cells transduced by lentiviral particles were seeded into 6-well plates at a density of 500 cells per well. Transduced HCC cells were selected in the growth medium supplemented with 2 μg/ml of puromycin. Cells were fixed and stained with crystal violet after 15 days. Representative images of plates were obtained using a digital camera. (F) The dye was extracted from stained colonies by 20% acetic acid to quantify the colony-forming ability; the extracted dye was quantified by measuring the absorbance at 595 nm with the percentage of the absorbance being calculated relative to that of NC (100%). (G) Hep3B and Huh-7 cells, transduced by the respective lentiviruses containing NC and shSIRT6, were cultured in soft agar with DMEM for 16 and 19 days, respectively. The representative micrographs were obtained using the iSolution Lite program. (H) Colonies larger than the indicated bar on the colony image were counted. The number of colonies (%) was calculated relative to that of NC, which was set to 100%. All data are representative of three independent experiments. (** P

    Journal: PLoS ONE

    Article Title: SIRT6 Depletion Suppresses Tumor Growth by Promoting Cellular Senescence Induced by DNA Damage in HCC

    doi: 10.1371/journal.pone.0165835

    Figure Lengend Snippet: Effects of SIRT6 depletion on HCC cell growth. (A) The expression of SIRT6 in HCC cell lines and normal liver lysate was assessed by western blotting using actin as a loading control. (B) Band intensities were measured by densitometry using Image J. SIRT6 band intensities were normalized to those of actin. (C) Upregulation of SIRT6 mRNA was assessed in HCC tumors relative to normal adjacent tissues by RT-PCR. (D) Hep3B, Huh-7, SNU475, and SNU449 cells were incubated with lentiviral particles containing plasmids with either negative control (NC) or SIRT6 shRNA. Five different lentiviral particles (C1–C5) targeting different sequences were used to delete the SIRT6 gene. HCC cells were harvested 5 days after viral transduction, followed by western blotting to compare the knockdown efficiency of SIRT6. (E) HCC cells transduced by lentiviral particles were seeded into 6-well plates at a density of 500 cells per well. Transduced HCC cells were selected in the growth medium supplemented with 2 μg/ml of puromycin. Cells were fixed and stained with crystal violet after 15 days. Representative images of plates were obtained using a digital camera. (F) The dye was extracted from stained colonies by 20% acetic acid to quantify the colony-forming ability; the extracted dye was quantified by measuring the absorbance at 595 nm with the percentage of the absorbance being calculated relative to that of NC (100%). (G) Hep3B and Huh-7 cells, transduced by the respective lentiviruses containing NC and shSIRT6, were cultured in soft agar with DMEM for 16 and 19 days, respectively. The representative micrographs were obtained using the iSolution Lite program. (H) Colonies larger than the indicated bar on the colony image were counted. The number of colonies (%) was calculated relative to that of NC, which was set to 100%. All data are representative of three independent experiments. (** P

    Article Snippet: Briefly, control and SIRT6-depleted cell lines were established utilizing lentivirus particles containing non-target shRNA (SHC016V) and SIRT6-target shRNA (SHCLNV-NM_016539) which were purchased from Sigma (USA).

    Techniques: Expressing, Western Blot, Reverse Transcription Polymerase Chain Reaction, Incubation, Negative Control, shRNA, Transduction, Staining, Cell Culture

    Effect of SIRT6 depletion on tumor growth in a xenograft mouse model (A) Hep3B cells were transduced with a lentiviral vector containing NC- or SIRT6-shRNA sequences. Hep3B cells were harvested 4 days after viral transduction, and 1 × 10 6 cells were subcutaneously injected into mice. Tumor sizes in 21 mice were measured every 4 days after the injection and are shown as means ± SEM. (B) Photographs of mice injected with Hep3B cells were taken after sacrifice. (C) Tumors were obtained from the sacrificed mice, and their sizes were compared. (D) Tumor weights from sacrificed mice are shown as means ± SEM. (E) The expression of Ki-67 was immunohistochemically examined by confocal microscopy, and Ki-67-positive cells were counted in randomly obtained images. The scale bar indicates 50 μM. (* P

    Journal: PLoS ONE

    Article Title: SIRT6 Depletion Suppresses Tumor Growth by Promoting Cellular Senescence Induced by DNA Damage in HCC

    doi: 10.1371/journal.pone.0165835

    Figure Lengend Snippet: Effect of SIRT6 depletion on tumor growth in a xenograft mouse model (A) Hep3B cells were transduced with a lentiviral vector containing NC- or SIRT6-shRNA sequences. Hep3B cells were harvested 4 days after viral transduction, and 1 × 10 6 cells were subcutaneously injected into mice. Tumor sizes in 21 mice were measured every 4 days after the injection and are shown as means ± SEM. (B) Photographs of mice injected with Hep3B cells were taken after sacrifice. (C) Tumors were obtained from the sacrificed mice, and their sizes were compared. (D) Tumor weights from sacrificed mice are shown as means ± SEM. (E) The expression of Ki-67 was immunohistochemically examined by confocal microscopy, and Ki-67-positive cells were counted in randomly obtained images. The scale bar indicates 50 μM. (* P

    Article Snippet: Briefly, control and SIRT6-depleted cell lines were established utilizing lentivirus particles containing non-target shRNA (SHC016V) and SIRT6-target shRNA (SHCLNV-NM_016539) which were purchased from Sigma (USA).

    Techniques: Transduction, Plasmid Preparation, shRNA, Injection, Mouse Assay, Expressing, Confocal Microscopy

    TNFAIP8 v2 depletion induces p53 binding and p53 target expression. ( a ) Immunoblot of v2 and actin (control) in whole-cell lysates of A549 cells treated with TNFAIP8 (TP8i) or scrambled (scri) shRNA. ( b ) Immunoblot of p53 from nuclear and whole-cell extracts of cells under indicated treatments. ( c ) Immunoblot of acetylated p53-K382 (‘p53-ac') and total p53 in chromatin-bound nuclear extracts of p53+ or p53-silenced A549 cells treated with scri or TP8i. Histone 3 (‘H3') and actin are loading controls. ( d ) p53 ChIP-PCR of promoter regions of indicated target genes in TP8i and scri cells. IgG serves as negative control. ( e and f ) mRNA expression of p21 and Gadd45a (RT-PCR) ( e ) and FAS and 14-3-3 σ (Nanostring) ( f ) was measured in p53+ or p53-silenced A549 cells treated with scri or TP8i. ( g ) v2 mRNA expression (normalized to GusB ) and ( h ) p53 binding to the indicated target genes was measured with RT-PCR and ChIP-PCR, respectively, in A549 cells transiently transfected with an empty vector (‘empty') or a v2 expression vector (‘v2'). Results are representative of three or more independent experiments. * P

    Journal: Cell Death and Differentiation

    Article Title: The novel p53 target TNFAIP8 variant 2 is increased in cancer and offsets p53-dependent tumor suppression

    doi: 10.1038/cdd.2016.130

    Figure Lengend Snippet: TNFAIP8 v2 depletion induces p53 binding and p53 target expression. ( a ) Immunoblot of v2 and actin (control) in whole-cell lysates of A549 cells treated with TNFAIP8 (TP8i) or scrambled (scri) shRNA. ( b ) Immunoblot of p53 from nuclear and whole-cell extracts of cells under indicated treatments. ( c ) Immunoblot of acetylated p53-K382 (‘p53-ac') and total p53 in chromatin-bound nuclear extracts of p53+ or p53-silenced A549 cells treated with scri or TP8i. Histone 3 (‘H3') and actin are loading controls. ( d ) p53 ChIP-PCR of promoter regions of indicated target genes in TP8i and scri cells. IgG serves as negative control. ( e and f ) mRNA expression of p21 and Gadd45a (RT-PCR) ( e ) and FAS and 14-3-3 σ (Nanostring) ( f ) was measured in p53+ or p53-silenced A549 cells treated with scri or TP8i. ( g ) v2 mRNA expression (normalized to GusB ) and ( h ) p53 binding to the indicated target genes was measured with RT-PCR and ChIP-PCR, respectively, in A549 cells transiently transfected with an empty vector (‘empty') or a v2 expression vector (‘v2'). Results are representative of three or more independent experiments. * P

    Article Snippet: Cells were transduced with either lentiviral scramble shRNA or a validated TNFAIP8-directed shRNA (Cat. no. SHCLND- , TRC:TRCN0000116159, Sigma-Aldrich; 24 h).

    Techniques: Binding Assay, Expressing, shRNA, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Negative Control, Reverse Transcription Polymerase Chain Reaction, Transfection, Plasmid Preparation

    TNFAIP8 v2 depletion stalls DNA replication and induces p53-dependent cell cycle arrest. ( a ) TNFAIP8 v2 mRNA levels were quantified in p53+ and p53-silenced (p53i) A549 cells untransduced (‘−') or transduced with scramble (‘scri') or TNFAIP8-directed (‘TP8i') shRNA. At right, an immunoblot of v2 under the same conditions is shown. ( b ) 5-Bromo-2'-deoxyuridine (BrdU) incorporation and 7AAD staining were quantified using flow cytometry in p53+ and p53i A549 cells transduced with scri or TP8i shRNA. BrdU+ cells (S phase), yellow; G1, green; G2, purple. ( c ) Quantification of BrdU intensity of cells in ( b ). ( d ) Cell cycle profile based on 7AAD staining of cells in ( a ). G2-phase cells (purple) are defined as cells with double the nuclear 7AAD stain intensity compared with G1-phase cells (green). S-phase cells are BrdU+ (yellow). ( e and f ) mRNA levels of PCNA (RT-PCR) ( e ) and cyclins D1, E1, and E2 (Nanostring) ( f ) of cells under indicated treatments. ( g ) p21 quantified by RT-PCR and immunoblot in p53+ A549 cells transduced with either scri or TP8i shRNA, followed by transfection of scramble (‘scri') or p21 (‘p21i') siRNA. ( h ) Cell cycle analysis of cells described in ( g ). Results are representative of three or more independent experiments. * P

    Journal: Cell Death and Differentiation

    Article Title: The novel p53 target TNFAIP8 variant 2 is increased in cancer and offsets p53-dependent tumor suppression

    doi: 10.1038/cdd.2016.130

    Figure Lengend Snippet: TNFAIP8 v2 depletion stalls DNA replication and induces p53-dependent cell cycle arrest. ( a ) TNFAIP8 v2 mRNA levels were quantified in p53+ and p53-silenced (p53i) A549 cells untransduced (‘−') or transduced with scramble (‘scri') or TNFAIP8-directed (‘TP8i') shRNA. At right, an immunoblot of v2 under the same conditions is shown. ( b ) 5-Bromo-2'-deoxyuridine (BrdU) incorporation and 7AAD staining were quantified using flow cytometry in p53+ and p53i A549 cells transduced with scri or TP8i shRNA. BrdU+ cells (S phase), yellow; G1, green; G2, purple. ( c ) Quantification of BrdU intensity of cells in ( b ). ( d ) Cell cycle profile based on 7AAD staining of cells in ( a ). G2-phase cells (purple) are defined as cells with double the nuclear 7AAD stain intensity compared with G1-phase cells (green). S-phase cells are BrdU+ (yellow). ( e and f ) mRNA levels of PCNA (RT-PCR) ( e ) and cyclins D1, E1, and E2 (Nanostring) ( f ) of cells under indicated treatments. ( g ) p21 quantified by RT-PCR and immunoblot in p53+ A549 cells transduced with either scri or TP8i shRNA, followed by transfection of scramble (‘scri') or p21 (‘p21i') siRNA. ( h ) Cell cycle analysis of cells described in ( g ). Results are representative of three or more independent experiments. * P

    Article Snippet: Cells were transduced with either lentiviral scramble shRNA or a validated TNFAIP8-directed shRNA (Cat. no. SHCLND- , TRC:TRCN0000116159, Sigma-Aldrich; 24 h).

    Techniques: Transduction, shRNA, BrdU Incorporation Assay, Staining, Flow Cytometry, Cytometry, Reverse Transcription Polymerase Chain Reaction, Transfection, Cell Cycle Assay

    p53 regulates DOX-induced TNFAIP8 v2. ( a ) v2 and p21 mRNA expression in A459 cells after nutlin-3 or DMSO (vehicle) treatment (24 h). ( b ) v2 and p21 expression after DOX treatment in A549 cells stably expressing scramble shRNA (‘scri') or p53 shRNA (‘p53i'). Fold change is displayed as the ratio of DOX-treated over nontreated (NT) cells. ( c ) Immunoblotting of p53 and actin (loading control) in parental (‘−'), scri, and p53i A549 cells following no treatment (NT) or DOX. ( d ) DOX-induced v2 mRNA expression in U2OS cells stably expressing scri or p53i. ( e ) v2 and p53 protein levels are shown in untreated and DOX-treated U2OS cells stably expressing scramble control shRNA (‘cont') or two different p53-directed shRNAs (‘p53i-55' and ‘p53i-56'). ( f ) v2 and p21 mRNA expression in untreated or DOX-treated p53-proficient and p53-null HCT116 cells. ( g ) v2 and p21 mRNA expression was measured with Nanostring technology in indicated cell types, untreated (‘NT') or treated with DOX for durations shown. Results are representative of three or more independent experiments. * P

    Journal: Cell Death and Differentiation

    Article Title: The novel p53 target TNFAIP8 variant 2 is increased in cancer and offsets p53-dependent tumor suppression

    doi: 10.1038/cdd.2016.130

    Figure Lengend Snippet: p53 regulates DOX-induced TNFAIP8 v2. ( a ) v2 and p21 mRNA expression in A459 cells after nutlin-3 or DMSO (vehicle) treatment (24 h). ( b ) v2 and p21 expression after DOX treatment in A549 cells stably expressing scramble shRNA (‘scri') or p53 shRNA (‘p53i'). Fold change is displayed as the ratio of DOX-treated over nontreated (NT) cells. ( c ) Immunoblotting of p53 and actin (loading control) in parental (‘−'), scri, and p53i A549 cells following no treatment (NT) or DOX. ( d ) DOX-induced v2 mRNA expression in U2OS cells stably expressing scri or p53i. ( e ) v2 and p53 protein levels are shown in untreated and DOX-treated U2OS cells stably expressing scramble control shRNA (‘cont') or two different p53-directed shRNAs (‘p53i-55' and ‘p53i-56'). ( f ) v2 and p21 mRNA expression in untreated or DOX-treated p53-proficient and p53-null HCT116 cells. ( g ) v2 and p21 mRNA expression was measured with Nanostring technology in indicated cell types, untreated (‘NT') or treated with DOX for durations shown. Results are representative of three or more independent experiments. * P

    Article Snippet: Cells were transduced with either lentiviral scramble shRNA or a validated TNFAIP8-directed shRNA (Cat. no. SHCLND- , TRC:TRCN0000116159, Sigma-Aldrich; 24 h).

    Techniques: Expressing, Stable Transfection, shRNA

    p53 binds to an intragenic enhancer region in TNFAIP8 . ( a ) ChIP-seq analysis in U2OS cells untreated or treated with DOX shows p53 enrichment in the v2 intronic region of TNFAIP8 ( b ) Validation of p53 binding to v2 intronic region was tested by p53 ChIP-PCR (or IgG control) in untreated and DOX-treated U2OS cells (depicted as % of total input DNA). p53 binding to the p21 promoter is shown as positive control. ( c ) Luciferase activity was measured in untreated or DOX-treated U2OS cells stably expressing scramble (‘scri') or p53-directed shRNA (‘p53i') and transfected with firefly luciferase reporter constructs without (‘empty') or with a 600 bp region encompassing the intronic p53RE region. ‘p53+' is a p53RE-driven luciferase construct (positive control). ( d ) H3K4me1, H3K27ac, and H3K4me3 ChIP-PCR is shown for the intronic p53RE region (‘v2 p53RE') and the v2 promoter (‘V2P') in untreated and DOX-treated U2OS cells (‘Ab' (antibody)). ( e ) Schematic showing the 6 EcoRI sites that were used for a three-dimensional chromosome looping assay, as they relate to the v2 promoter region and the intronic p53RE. PCR was performed using the indicated primer pairs in untreated U2OS cells. Results are representative of three or more independent experiments. * P

    Journal: Cell Death and Differentiation

    Article Title: The novel p53 target TNFAIP8 variant 2 is increased in cancer and offsets p53-dependent tumor suppression

    doi: 10.1038/cdd.2016.130

    Figure Lengend Snippet: p53 binds to an intragenic enhancer region in TNFAIP8 . ( a ) ChIP-seq analysis in U2OS cells untreated or treated with DOX shows p53 enrichment in the v2 intronic region of TNFAIP8 ( b ) Validation of p53 binding to v2 intronic region was tested by p53 ChIP-PCR (or IgG control) in untreated and DOX-treated U2OS cells (depicted as % of total input DNA). p53 binding to the p21 promoter is shown as positive control. ( c ) Luciferase activity was measured in untreated or DOX-treated U2OS cells stably expressing scramble (‘scri') or p53-directed shRNA (‘p53i') and transfected with firefly luciferase reporter constructs without (‘empty') or with a 600 bp region encompassing the intronic p53RE region. ‘p53+' is a p53RE-driven luciferase construct (positive control). ( d ) H3K4me1, H3K27ac, and H3K4me3 ChIP-PCR is shown for the intronic p53RE region (‘v2 p53RE') and the v2 promoter (‘V2P') in untreated and DOX-treated U2OS cells (‘Ab' (antibody)). ( e ) Schematic showing the 6 EcoRI sites that were used for a three-dimensional chromosome looping assay, as they relate to the v2 promoter region and the intronic p53RE. PCR was performed using the indicated primer pairs in untreated U2OS cells. Results are representative of three or more independent experiments. * P

    Article Snippet: Cells were transduced with either lentiviral scramble shRNA or a validated TNFAIP8-directed shRNA (Cat. no. SHCLND- , TRC:TRCN0000116159, Sigma-Aldrich; 24 h).

    Techniques: Chromatin Immunoprecipitation, Binding Assay, Polymerase Chain Reaction, Positive Control, Luciferase, Activity Assay, Stable Transfection, Expressing, shRNA, Transfection, Construct

    TNFAIP8 v2 depletion enhances damage-induced apoptosis. ( a ) Annexin V and propidium iodide (PI) staining were quantified by flow cytometry in p53+ and p53i A549 cells transduced with a scramble (‘Scri') or TNFAIP8-directed (‘TP8i') shRNA and untreated or treated with DOX. ( b and c ) The percentage of Annexin V+ cells was quantified in untreated and DOX-treated cells ( b ), and in DMSO-treated cells (vehicle control) and staurosporine (‘Stauro')-treated cells ( c ). ( d ) The fold change in caspase 3/7 activity is shown in the cells described in ( b and c ) after DOX or Stauro treatment. DOX and Stauro values are normalized to untreated or DMSO-treated values, respectively. Results are representative of three or more independent experiments. * P

    Journal: Cell Death and Differentiation

    Article Title: The novel p53 target TNFAIP8 variant 2 is increased in cancer and offsets p53-dependent tumor suppression

    doi: 10.1038/cdd.2016.130

    Figure Lengend Snippet: TNFAIP8 v2 depletion enhances damage-induced apoptosis. ( a ) Annexin V and propidium iodide (PI) staining were quantified by flow cytometry in p53+ and p53i A549 cells transduced with a scramble (‘Scri') or TNFAIP8-directed (‘TP8i') shRNA and untreated or treated with DOX. ( b and c ) The percentage of Annexin V+ cells was quantified in untreated and DOX-treated cells ( b ), and in DMSO-treated cells (vehicle control) and staurosporine (‘Stauro')-treated cells ( c ). ( d ) The fold change in caspase 3/7 activity is shown in the cells described in ( b and c ) after DOX or Stauro treatment. DOX and Stauro values are normalized to untreated or DMSO-treated values, respectively. Results are representative of three or more independent experiments. * P

    Article Snippet: Cells were transduced with either lentiviral scramble shRNA or a validated TNFAIP8-directed shRNA (Cat. no. SHCLND- , TRC:TRCN0000116159, Sigma-Aldrich; 24 h).

    Techniques: Staining, Flow Cytometry, Cytometry, Transduction, shRNA, Activity Assay

    NME1 suppresses motile and invasive potential of WM1158 melanoma cells by upregulating ITGβ3 expression. (a) Expression of NME1 and ITGβ3 proteins was measured by immunoblot analysis in cells receiving the indicated combinations of forced NME1 expression and shRNAs directed to ITGβ3. shRNA treatments consisted a non-targeting control shRNA (−) or one of two shRNAs specific for ITGβ3 (“a” or “b”). (b) Representative images of wound/scratch assays were acquired 24 h after wound induction in cells receiving the indicated combinations of forced NME1 expression and shRNA-mediated silencing of ITGβ3. Dotted boxes depict borders of original wounds. (c) Graph provides a quantitative analysis of individual cells migrating into wounds. Closed circles and error bars represent means (+/− SEM) derived from 3– 4 independent experiments. Asterisks denote means that are significantly different (*p≤0.05 by ANOVA with Holm-Sidak pairwise testing). (d) Expression of ITGβ3 mRNA was measured in cells used for measurement of single cell invasion activity in 3-dimensional sphere assays after the indicated combination of forced NME1 expression and shRNA sequences (-, non-targeting control; ITGβ3-directed shRNAs “c” and “a”). The shRNA sequence “c” was employed instead of sequence “b” used in panel a, as sequence “b” strongly disrupted spheroid formation. Cultures were co-infected with a lentiviral vector for expression of eGFP for enhanced imaging of invading cells. *, comparison between vector- and NME1-treated; †, denotes significant silencing of ITGβ3 RNA in absence of forced NME1 expression (black bars); ‡, denotes significant silencing of ITGβ3 RNA in presence of forced NME1 expression (white bars). p

    Journal: Experimental cell research

    Article Title: The metastasis suppressor NME1 inhibits melanoma cell motility via direct transcriptional induction of the integrin beta-3 gene

    doi: 10.1016/j.yexcr.2018.11.010

    Figure Lengend Snippet: NME1 suppresses motile and invasive potential of WM1158 melanoma cells by upregulating ITGβ3 expression. (a) Expression of NME1 and ITGβ3 proteins was measured by immunoblot analysis in cells receiving the indicated combinations of forced NME1 expression and shRNAs directed to ITGβ3. shRNA treatments consisted a non-targeting control shRNA (−) or one of two shRNAs specific for ITGβ3 (“a” or “b”). (b) Representative images of wound/scratch assays were acquired 24 h after wound induction in cells receiving the indicated combinations of forced NME1 expression and shRNA-mediated silencing of ITGβ3. Dotted boxes depict borders of original wounds. (c) Graph provides a quantitative analysis of individual cells migrating into wounds. Closed circles and error bars represent means (+/− SEM) derived from 3– 4 independent experiments. Asterisks denote means that are significantly different (*p≤0.05 by ANOVA with Holm-Sidak pairwise testing). (d) Expression of ITGβ3 mRNA was measured in cells used for measurement of single cell invasion activity in 3-dimensional sphere assays after the indicated combination of forced NME1 expression and shRNA sequences (-, non-targeting control; ITGβ3-directed shRNAs “c” and “a”). The shRNA sequence “c” was employed instead of sequence “b” used in panel a, as sequence “b” strongly disrupted spheroid formation. Cultures were co-infected with a lentiviral vector for expression of eGFP for enhanced imaging of invading cells. *, comparison between vector- and NME1-treated; †, denotes significant silencing of ITGβ3 RNA in absence of forced NME1 expression (black bars); ‡, denotes significant silencing of ITGβ3 RNA in presence of forced NME1 expression (white bars). p

    Article Snippet: RNA knockdown was achieved by lentiviral delivery of Mission shRNA (Sigma-Aldrich) against ITGβ3 (TRCN0000003236, ITGβ3 shRNA-a; TRCN0000318546, ITGβ3 shRNA-b; TRCN0000003235, ITGβ3 shRNA-c) or a non-targeted shRNA (SHC002, Sigma-Aldrich) as a negative control.

    Techniques: Expressing, shRNA, Derivative Assay, Activity Assay, Sequencing, Infection, Plasmid Preparation, Imaging

    NOTCH inhibition suppresses p21 without reducing p53 activity a , qPCR analysis of p53-dependent genes in human neonatal keratinocytes 3 days after transduction of GFP or OCT4 and SOX2 . b , Western blot of p53 levels in human neonatal keratinocytes with DMSO or 10 μM DAPT treatment for 3 days. Full blot shown in Supplementary Figure 7g . c , qPCR analysis of p53-dependent genes after 10 μM DAPT or 2 μM DBZ treatment for 3 days in OCT4, SOX2 -transduced human keratinocytes. d , The efficiency of NANOG+/TRA-1-81+ iPSC generation in OCT4, SOX2, KLF4 , and CMYC -transduced human neonatal keratinocytes transduced with p53DD or GFP with or without exposure to UV irradiation. e , γH2AX immunostaining in human neonatal keratinocytes 10 days after transduction with OCT4, SOX2, KLF4 , and CMYC and treatment with DAPT, p53DD, or p53 shRNA. Scale bars = 50 μm. f , The percentage of TUNEL-positive cells in human neonatal keratinocyte reprogramming cultures with active or inactive p53 (p53DD expression) 10 days after transduction with OCT4, SOX2, KLF4 , and CMYC . g , The number of insertions or deletions (indels) per iPSC line derived under normal, DAPT, or p53DD conditions, as determined by array CGH. For all experiments, error bars represent the standard deviation between two biological replicates and statistical significance was determined using a two-tailed homoscedastic Student's t-test. * denotes significance p-value

    Journal: Nature chemical biology

    Article Title: Notch inhibition allows oncogene independent generation of iPS cells

    doi: 10.1038/nchembio.1552

    Figure Lengend Snippet: NOTCH inhibition suppresses p21 without reducing p53 activity a , qPCR analysis of p53-dependent genes in human neonatal keratinocytes 3 days after transduction of GFP or OCT4 and SOX2 . b , Western blot of p53 levels in human neonatal keratinocytes with DMSO or 10 μM DAPT treatment for 3 days. Full blot shown in Supplementary Figure 7g . c , qPCR analysis of p53-dependent genes after 10 μM DAPT or 2 μM DBZ treatment for 3 days in OCT4, SOX2 -transduced human keratinocytes. d , The efficiency of NANOG+/TRA-1-81+ iPSC generation in OCT4, SOX2, KLF4 , and CMYC -transduced human neonatal keratinocytes transduced with p53DD or GFP with or without exposure to UV irradiation. e , γH2AX immunostaining in human neonatal keratinocytes 10 days after transduction with OCT4, SOX2, KLF4 , and CMYC and treatment with DAPT, p53DD, or p53 shRNA. Scale bars = 50 μm. f , The percentage of TUNEL-positive cells in human neonatal keratinocyte reprogramming cultures with active or inactive p53 (p53DD expression) 10 days after transduction with OCT4, SOX2, KLF4 , and CMYC . g , The number of insertions or deletions (indels) per iPSC line derived under normal, DAPT, or p53DD conditions, as determined by array CGH. For all experiments, error bars represent the standard deviation between two biological replicates and statistical significance was determined using a two-tailed homoscedastic Student's t-test. * denotes significance p-value

    Article Snippet: shRNA/siRNA knockdown experiments shRNAs and siRNAs were purchased from Sigma and added to reprogramming cultures within 1 day after addition of the reprogramming retroviruses. shRNAs (TRCN0000003753, p53 and TRCN0000287021, p21) were expressed in the pLKO.1 lentiviral backbone. siRNAs were used at 80nM and were transfected into reprogramming cultures using RNAiMAX (Life Technologies).

    Techniques: Inhibition, Activity Assay, Real-time Polymerase Chain Reaction, Transduction, Western Blot, Irradiation, Immunostaining, shRNA, TUNEL Assay, Expressing, Derivative Assay, Standard Deviation, Two Tailed Test

    Notch inhibition promotes keratinocyte reprogramming by suppressing p21 a , Schematic of the DAPT treatment time course on human neonatal keratinocytes. b , Efficiency of NANOG+/TRA-1-81+ iPSC generation from human neonatal keratinocytes transduced with OCT4, SOX2, KLF4 , and CMYC and treated with intervals of 10 μM DAPT or c , 2 μM DBZ. d , Western blot for p21 in human neonatal keratinocytes transduced with OCT4 and SOX2 and treated with DMSO or 10 μM DAPT. Full blot shown in Supplementary Figure 7c . e , Western blot for INVOLUCRIN in human neonatal keratinocytes treated with DMSO, 10 μM DAPT, or 1.2 mM calcium chloride for 6 days. Calcium was used as a positive control to induce keratinocyte differentiation. Full blot shown in Supplementary Figure 7d . f , Efficiency of NANOG+/TRA-1-81+ iPSC generation from human neonatal keratinocytes transduced with OCT4, KLF4, SOX2 , and CMYC and a scrambled shRNA or a p21 shRNA at day 0 of reprogramming. DAPT was added at 10 μM. g , Efficiency of NANOG+/TRA-1-81+ iPSC generation from human neonatal keratinocytes transduced with OCT4 and SOX2 and a scrambled shRNA control or a p21 shRNA at day 0 of reprogramming. DAPT was added at 2.5 μM. h , Efficiency of NANOG+/TRA-1-81+ iPSC generation from human neonatal keratinocytes transduced with OCT, SOX2, KLF4 , and CMYC and GFP or p21 and treated with DMSO or 10 μM DAPT from days 1-18 post-transduction. For all experiments, error bars represent the standard deviation between two-three biological replicates and statistical significance was determined using a two-tailed homoscedastic Student's t-test.

    Journal: Nature chemical biology

    Article Title: Notch inhibition allows oncogene independent generation of iPS cells

    doi: 10.1038/nchembio.1552

    Figure Lengend Snippet: Notch inhibition promotes keratinocyte reprogramming by suppressing p21 a , Schematic of the DAPT treatment time course on human neonatal keratinocytes. b , Efficiency of NANOG+/TRA-1-81+ iPSC generation from human neonatal keratinocytes transduced with OCT4, SOX2, KLF4 , and CMYC and treated with intervals of 10 μM DAPT or c , 2 μM DBZ. d , Western blot for p21 in human neonatal keratinocytes transduced with OCT4 and SOX2 and treated with DMSO or 10 μM DAPT. Full blot shown in Supplementary Figure 7c . e , Western blot for INVOLUCRIN in human neonatal keratinocytes treated with DMSO, 10 μM DAPT, or 1.2 mM calcium chloride for 6 days. Calcium was used as a positive control to induce keratinocyte differentiation. Full blot shown in Supplementary Figure 7d . f , Efficiency of NANOG+/TRA-1-81+ iPSC generation from human neonatal keratinocytes transduced with OCT4, KLF4, SOX2 , and CMYC and a scrambled shRNA or a p21 shRNA at day 0 of reprogramming. DAPT was added at 10 μM. g , Efficiency of NANOG+/TRA-1-81+ iPSC generation from human neonatal keratinocytes transduced with OCT4 and SOX2 and a scrambled shRNA control or a p21 shRNA at day 0 of reprogramming. DAPT was added at 2.5 μM. h , Efficiency of NANOG+/TRA-1-81+ iPSC generation from human neonatal keratinocytes transduced with OCT, SOX2, KLF4 , and CMYC and GFP or p21 and treated with DMSO or 10 μM DAPT from days 1-18 post-transduction. For all experiments, error bars represent the standard deviation between two-three biological replicates and statistical significance was determined using a two-tailed homoscedastic Student's t-test.

    Article Snippet: shRNA/siRNA knockdown experiments shRNAs and siRNAs were purchased from Sigma and added to reprogramming cultures within 1 day after addition of the reprogramming retroviruses. shRNAs (TRCN0000003753, p53 and TRCN0000287021, p21) were expressed in the pLKO.1 lentiviral backbone. siRNAs were used at 80nM and were transfected into reprogramming cultures using RNAiMAX (Life Technologies).

    Techniques: Inhibition, Transduction, Western Blot, Positive Control, shRNA, Standard Deviation, Two Tailed Test

    Establishment of an ADAM17-knockdown cell line using a lentiviral expression system ( A ) ADAM17 mRNA expression in Huh7 CD133+ and Huh7 CD133− cells at 24 h determined by RT-PCR following transfection of ADAM17 siRNA. ( B ) Transwell migration assays of Huh7 CD133+ , Huh7 CD133− , scram siRNA Huh7 CD133+ and ADAM17 siRNA Huh7 CD133+ cells after 15- Gy irradiation. Images were captured at 48 h under × 40 magnification. The numbers of migrated Huh7 CD133+ , Huh7 CD133− , scram siRNA Huh7 CD133+ and ADAM17 siRNA Huh7 CD133+ cells were compared. ** P

    Journal: Oncotarget

    Article Title: Role of ADAM17 in invasion and migration of CD133-expressing liver cancer stem cells after irradiation

    doi: 10.18632/oncotarget.8112

    Figure Lengend Snippet: Establishment of an ADAM17-knockdown cell line using a lentiviral expression system ( A ) ADAM17 mRNA expression in Huh7 CD133+ and Huh7 CD133− cells at 24 h determined by RT-PCR following transfection of ADAM17 siRNA. ( B ) Transwell migration assays of Huh7 CD133+ , Huh7 CD133− , scram siRNA Huh7 CD133+ and ADAM17 siRNA Huh7 CD133+ cells after 15- Gy irradiation. Images were captured at 48 h under × 40 magnification. The numbers of migrated Huh7 CD133+ , Huh7 CD133− , scram siRNA Huh7 CD133+ and ADAM17 siRNA Huh7 CD133+ cells were compared. ** P

    Article Snippet: ADAM17 knockdown with stable short-hairpin siRNA (shRNA) To establish a stable Huh7 cell line depleted of ADAM17 expression, cells were infected using a short-hairpin RNA (shRNA)-lentiviral infection system (Sigma-Aldrich Co.).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Transfection, Migration, Irradiation

    IKKβ-mediated IκBα degradation is blocked by S298A AEG-1. ( a ) MCF-7 cells were transfected with AEG-1 siRNA. Forty-eight hours later, cells were starved for 12 h and fixed in 4% PFA for 15 min at room temperature. Cells were immunostained using anti-AEG-1 and anti-IκBα antibodies. ( b ) Cells stained in a were imaged using epi-fluorescence microscope and cell borders were marked using ImageJ. Staining intensity was analysed using ImageJ and normalized to the cell area. Plots show the mean values of at least nine cells per condition from two independent experiments±s.d. Data were analysed by Student's t -test, ** P

    Journal: Nature Communications

    Article Title: Quantitative analysis of the TNF-α-induced phosphoproteome reveals AEG-1/MTDH/LYRIC as an IKKβ substrate

    doi: 10.1038/ncomms7658

    Figure Lengend Snippet: IKKβ-mediated IκBα degradation is blocked by S298A AEG-1. ( a ) MCF-7 cells were transfected with AEG-1 siRNA. Forty-eight hours later, cells were starved for 12 h and fixed in 4% PFA for 15 min at room temperature. Cells were immunostained using anti-AEG-1 and anti-IκBα antibodies. ( b ) Cells stained in a were imaged using epi-fluorescence microscope and cell borders were marked using ImageJ. Staining intensity was analysed using ImageJ and normalized to the cell area. Plots show the mean values of at least nine cells per condition from two independent experiments±s.d. Data were analysed by Student's t -test, ** P

    Article Snippet: shRNA/siRNA/primers Human AEG-1 shRNAs (TRCN0000350650, TRCN0000322947, TRCN0000322949, TRCN0000322872 and TRCN0000151467) and mouse AEG-1 shRNAs (TRCN0000313386, TRCN0000312351, TRCN0000312352, TRCN0000312360 and TRCN0000312291 were purchased from SIGMA, siRNAs (SI00625793, SI04315605, SI05006421 and SI05006428) were purchased from QIAGEN.

    Techniques: Transfection, Staining, Fluorescence, Microscopy

    Effective knockdown of ADAMTS5 in SW982 synovial fibroblasts cells transduced with ADAMTS5 targeting shRNA lentiviral particles. SW982 cells were untransduced (unt), or transduced with non-targeting shRNA (Ctl) or with two distinct ADAMTS5-targeting shRNA (denoted #3 or #5). Post-transduction the cells were treated in the presence or absence of IL-1β (1ng/ml, 16h) to induce ADAMTS5 expression. Subsequently, a western blot of whole cell extracts from these cells were run and probed with anti-ADAMTS5 or anti-GAPDH antibodies as indicated. GAPDH abundance was used as a loading control reference. A representative blot is shown.

    Journal: PLoS ONE

    Article Title: Connexin43 Mediated Delivery of ADAMTS5 Targeting siRNAs from Mesenchymal Stem Cells to Synovial Fibroblasts

    doi: 10.1371/journal.pone.0129999

    Figure Lengend Snippet: Effective knockdown of ADAMTS5 in SW982 synovial fibroblasts cells transduced with ADAMTS5 targeting shRNA lentiviral particles. SW982 cells were untransduced (unt), or transduced with non-targeting shRNA (Ctl) or with two distinct ADAMTS5-targeting shRNA (denoted #3 or #5). Post-transduction the cells were treated in the presence or absence of IL-1β (1ng/ml, 16h) to induce ADAMTS5 expression. Subsequently, a western blot of whole cell extracts from these cells were run and probed with anti-ADAMTS5 or anti-GAPDH antibodies as indicated. GAPDH abundance was used as a loading control reference. A representative blot is shown.

    Article Snippet: Lentiviral transduction and siRNA transfection shRNA lentiviral particles were purchased from Sigma-Aldrich (St Louis, MO), and siRNAs were purchased from Thermo Scientific (Waltham, MA).

    Techniques: Transduction, shRNA, CTL Assay, Expressing, Western Blot

    Knockdown of Mp1 in E14T ES cells resembles Nanog overexpression or growth in the presence of LIF. (A) Growth curves (left) of ES cells infected with shMp1, the negative control shGFP, or the positive control shMbd3 when grown in LDM for 3 wk. After 3 wk, colonies were stained for AP. Additional positive controls were transfection with pCAG-Nanog or addition of LIF. Knockdown of Mbd3, as measured with qPCR, is shown below the Mbd3 growth curve. (B) AP staining shows that knockdown of Mp1 in two other ES cell lines, E14/Tg2a and F1V6.5, inhibits differentiation when these cells were grown in LDM for 2 wk. Knockdown was performed using the shRNA identified from the library (shMp1-Lib) and an additional shRNA indicated by shMp1-G. Negative controls were shGFP and a shRNA containing a random sequence (shRnd1). Western blot analysis shows the knockdown levels of Mp1 in these cell lines (right). Data represent at least two independent experiments. Error bars, standard deviation. Bar, 100 µm.

    Journal: The Journal of Experimental Medicine

    Article Title: A genome-wide RNAi screen in mouse embryonic stem cells identifies Mp1 as a key mediator of differentiation

    doi: 10.1084/jem.20102037

    Figure Lengend Snippet: Knockdown of Mp1 in E14T ES cells resembles Nanog overexpression or growth in the presence of LIF. (A) Growth curves (left) of ES cells infected with shMp1, the negative control shGFP, or the positive control shMbd3 when grown in LDM for 3 wk. After 3 wk, colonies were stained for AP. Additional positive controls were transfection with pCAG-Nanog or addition of LIF. Knockdown of Mbd3, as measured with qPCR, is shown below the Mbd3 growth curve. (B) AP staining shows that knockdown of Mp1 in two other ES cell lines, E14/Tg2a and F1V6.5, inhibits differentiation when these cells were grown in LDM for 2 wk. Knockdown was performed using the shRNA identified from the library (shMp1-Lib) and an additional shRNA indicated by shMp1-G. Negative controls were shGFP and a shRNA containing a random sequence (shRnd1). Western blot analysis shows the knockdown levels of Mp1 in these cell lines (right). Data represent at least two independent experiments. Error bars, standard deviation. Bar, 100 µm.

    Article Snippet: To differentiate NCC-IT cells , which are considered equivalent to a stage intermediate between Sem and embryonal carcinoma, cells were transfected with a stealth siRNA against MP1 or a mock siRNA using Lipofectamine, or cells were infected with an shRNA against MP1 (Sigma-Aldrich) or a mock shRNA vector (SHC002; Sigma-Aldrich).

    Techniques: Over Expression, Infection, Negative Control, Positive Control, Staining, Transfection, Real-time Polymerase Chain Reaction, shRNA, Sequencing, Western Blot, Standard Deviation

    Knockdown of Mp1 inhibits differentiation and stimulates proliferation in ES cells. (A) FACS plot of E14T-Nanog-GFP reporter ES cells containing a randomly targeted Nanog promoter fragment that drives GFP expression. Reporter activity was assayed after growing the cells in LDM for 4 d after knockdown of Mp1 or after using a control shRNA containing a random sequence (shRnd1). Knockdown was performed using the shRNA identified from the library (shMp1-Lib) and an additional shRNA indicated by shMp1-G. Positive control cells were grown in the presence of LIF for 4 d. Knockdown of Mp1 was confirmed by qPCR (bottom) and Western blotting (middle right). Knockdown of Mp1 in the absence of Bmp4 maintains OCT3/4 expression (positive fraction is shown in red) while suppressing Nestin expression (positive fraction is shown in green). Positive controls were: undifferentiated ES cells and subventricular zone neural stem cells. (B) Knockdown of Mp1 gives a proliferation advantage in the absence (top) and presence (middle) of LIF in the total population of seeded cells, but also in Nanog-GFP–positive ES cells that were cultured 4 d without LIF (bottom). Error bars, standard deviation. Data represent two independent experiments.

    Journal: The Journal of Experimental Medicine

    Article Title: A genome-wide RNAi screen in mouse embryonic stem cells identifies Mp1 as a key mediator of differentiation

    doi: 10.1084/jem.20102037

    Figure Lengend Snippet: Knockdown of Mp1 inhibits differentiation and stimulates proliferation in ES cells. (A) FACS plot of E14T-Nanog-GFP reporter ES cells containing a randomly targeted Nanog promoter fragment that drives GFP expression. Reporter activity was assayed after growing the cells in LDM for 4 d after knockdown of Mp1 or after using a control shRNA containing a random sequence (shRnd1). Knockdown was performed using the shRNA identified from the library (shMp1-Lib) and an additional shRNA indicated by shMp1-G. Positive control cells were grown in the presence of LIF for 4 d. Knockdown of Mp1 was confirmed by qPCR (bottom) and Western blotting (middle right). Knockdown of Mp1 in the absence of Bmp4 maintains OCT3/4 expression (positive fraction is shown in red) while suppressing Nestin expression (positive fraction is shown in green). Positive controls were: undifferentiated ES cells and subventricular zone neural stem cells. (B) Knockdown of Mp1 gives a proliferation advantage in the absence (top) and presence (middle) of LIF in the total population of seeded cells, but also in Nanog-GFP–positive ES cells that were cultured 4 d without LIF (bottom). Error bars, standard deviation. Data represent two independent experiments.

    Article Snippet: To differentiate NCC-IT cells , which are considered equivalent to a stage intermediate between Sem and embryonal carcinoma, cells were transfected with a stealth siRNA against MP1 or a mock siRNA using Lipofectamine, or cells were infected with an shRNA against MP1 (Sigma-Aldrich) or a mock shRNA vector (SHC002; Sigma-Aldrich).

    Techniques: FACS, Expressing, Activity Assay, shRNA, Sequencing, Positive Control, Real-time Polymerase Chain Reaction, Western Blot, Cell Culture, Standard Deviation

    Positive regulation of STAT3 in the proliferation of Caco-2 cells. (a) Growth curve of blank Caco-2 cells (as blank control), Caco-2 cells which were transfected with sh-STAT3 (STAT3 (KD)), or control shRNA (control (KD)), and the cell number was counted in each group after an incubation of 24, 48, or 72 hours; (b) colony forming assay of blank, STAT3 (KD), and control (KD) Caco-2 cells after 48-hour incubation; (c) colony counting of the three groups of Caco-2 cells. Results were repeated in triplicate independently, ∗∗ represented p

    Journal: Gastroenterology Research and Practice

    Article Title: Annexin A2 Coordinates STAT3 to Regulate the Invasion and Migration of Colorectal Cancer Cells In Vitro

    doi: 10.1155/2016/3521453

    Figure Lengend Snippet: Positive regulation of STAT3 in the proliferation of Caco-2 cells. (a) Growth curve of blank Caco-2 cells (as blank control), Caco-2 cells which were transfected with sh-STAT3 (STAT3 (KD)), or control shRNA (control (KD)), and the cell number was counted in each group after an incubation of 24, 48, or 72 hours; (b) colony forming assay of blank, STAT3 (KD), and control (KD) Caco-2 cells after 48-hour incubation; (c) colony counting of the three groups of Caco-2 cells. Results were repeated in triplicate independently, ∗∗ represented p

    Article Snippet: Annexin A2 knockdown and STAT3 knockdown were conducted by using siRNAi-Annexin A2 (5′-CAAGCCCCTGTATTTTGCTGAT-3′) (for Annexin A2 silence) and scramble RNA (as control siRNA, 5′-UUCUCAGAACGUGUGACGU-3′) and shRNA STAT3/Puro (SIGMA-Aldrich) (for STAT3 knockdown, targeting sequence: 5′-GCGTCCAGTTCACTACTAAAG-3′) lentiviral vectors, respectively, with shRNAi MISSION Non-Target shRNA Control/Puro (SIGMA Aldrich, St. Louis, MO, USA) performed as negative control of gene knockdown.

    Techniques: Transfection, shRNA, Incubation

    Knockdown of endogenous ULK1 prevents Raptor phosphorylation and increases mTORC1 signaling. (A) Endogenous ULK1 expression was knocked down using shRNA and the phosphorylation of endogenous mTORC1 substrates was determined using phospho-specific antibodies

    Journal: Autophagy

    Article Title: ULK1 inhibits mTORC1 signaling, promotes multisite Raptor phosphorylation and hinders substrate binding

    doi: 10.4161/auto.7.7.15491

    Figure Lengend Snippet: Knockdown of endogenous ULK1 prevents Raptor phosphorylation and increases mTORC1 signaling. (A) Endogenous ULK1 expression was knocked down using shRNA and the phosphorylation of endogenous mTORC1 substrates was determined using phospho-specific antibodies

    Article Snippet: Lipofectamine transfection mixtures containing 2.5 µg scrambled shRNA or ULK1 shRNA (MISSION shRNA 1-1064slcl, Sigma) were prepared according to the manufacturer's protocol.

    Techniques: Expressing, shRNA

    Provision of exogenous reduced HMGB1 increases autophagy in cancer cells (A) Relative amounts of oxidized Cys106 (as Cys sulfonic acid) in Lilly Pool #2 and #3. MALDI-TOF Mass Spectrum of tryptic fragments of Lilly Pool #2 (top) and Pool #3 (bottom). The Cys106 containing fragment is amino acids 97–112. The free sulfhydryl (-SH) of total reducible cysteine is at a mass of 1944.9 Da. The monoxide is faintly seen at a mass of 1960.9 Da. The di- and tri- oxides are at masses of 1976.9 Da and 1992.9 Da, respectively. The peak at 1962.9 Da is the free sulfhydryl of the 13–28 fragments, used as an internal standard to verify the DTT reduction went to completion. (B) Reduced HMGB1 protein induces autophagy and oxidized HMGB1 mildly induces apoptosis. Panc2.03 and HCT116 cancer cells were treated with oxidized HMGB1 (“O”, 10 μg/ml) or reduced HMGB1 (“R”, 10 μg/ml) for 24 h, and then assayed for apoptosis by FACS using Annexin V/PI stain and autophagy by quantification of the percentage of cells with GFP-LC3 dots as described in methods. (C) Western analysis of LC3 processing in the presence or absence of lysosomal protease inhibitors pepstatin A (10 μg/ml) and E64D (10 μg/ml) and degradation of p62 by autophagy after HMGB1 or HMGB1 C106S mutant treatment. (D) Reduced HMGB1 protein regulates Beclin1/Bcl-2 complex formation in autophagy. Panc2.03 cells were treated with oxidized HMGB1 (“O”, 10 μg/ml) or reduced HMGB1 (“R”, 10 μg/ml), for 6 h, then cell lysates were prepared for IP with anti-Beclin1/-Bcl-2 or IgG. The resulting immune complexes and inputs were analyzed by western blotting as indicated. Representative western blotting analysis of protein levels is presented. (E) RAGE/Beclin1 but not TLR4 is required for HMGB1 mediated autophagy. Cells were transfected with the indicated shRNA for 48 h and then were treated with reduced HMGB1 (“R”, 10 μg/ml) for 24 h. Representative western blotting analysis of protein levels is presented. In parallel, autophagy was assayed by the percentage of cells with GFP-LC3 dots (N=3, * p

    Journal: Oncogene

    Article Title: HMGB1 Release and Redox Regulates Autophagy and Apoptosis in Cancer Cells

    doi: 10.1038/onc.2010.261

    Figure Lengend Snippet: Provision of exogenous reduced HMGB1 increases autophagy in cancer cells (A) Relative amounts of oxidized Cys106 (as Cys sulfonic acid) in Lilly Pool #2 and #3. MALDI-TOF Mass Spectrum of tryptic fragments of Lilly Pool #2 (top) and Pool #3 (bottom). The Cys106 containing fragment is amino acids 97–112. The free sulfhydryl (-SH) of total reducible cysteine is at a mass of 1944.9 Da. The monoxide is faintly seen at a mass of 1960.9 Da. The di- and tri- oxides are at masses of 1976.9 Da and 1992.9 Da, respectively. The peak at 1962.9 Da is the free sulfhydryl of the 13–28 fragments, used as an internal standard to verify the DTT reduction went to completion. (B) Reduced HMGB1 protein induces autophagy and oxidized HMGB1 mildly induces apoptosis. Panc2.03 and HCT116 cancer cells were treated with oxidized HMGB1 (“O”, 10 μg/ml) or reduced HMGB1 (“R”, 10 μg/ml) for 24 h, and then assayed for apoptosis by FACS using Annexin V/PI stain and autophagy by quantification of the percentage of cells with GFP-LC3 dots as described in methods. (C) Western analysis of LC3 processing in the presence or absence of lysosomal protease inhibitors pepstatin A (10 μg/ml) and E64D (10 μg/ml) and degradation of p62 by autophagy after HMGB1 or HMGB1 C106S mutant treatment. (D) Reduced HMGB1 protein regulates Beclin1/Bcl-2 complex formation in autophagy. Panc2.03 cells were treated with oxidized HMGB1 (“O”, 10 μg/ml) or reduced HMGB1 (“R”, 10 μg/ml), for 6 h, then cell lysates were prepared for IP with anti-Beclin1/-Bcl-2 or IgG. The resulting immune complexes and inputs were analyzed by western blotting as indicated. Representative western blotting analysis of protein levels is presented. (E) RAGE/Beclin1 but not TLR4 is required for HMGB1 mediated autophagy. Cells were transfected with the indicated shRNA for 48 h and then were treated with reduced HMGB1 (“R”, 10 μg/ml) for 24 h. Representative western blotting analysis of protein levels is presented. In parallel, autophagy was assayed by the percentage of cells with GFP-LC3 dots (N=3, * p

    Article Snippet: RNAi by shRNA RAGE-shRNA, Beclin1-shRNA, ATG-5 shRNA, HMGB1-shRNA, TLR4 shRNA, and control shRNA (from Sigma, USA) were transfected into cells using Lipofectamine 2000 reagent (Invitrogen, San Diego, CA, USA) according to the manufacturer’s instructions.

    Techniques: FACS, Staining, Western Blot, Mutagenesis, Transfection, shRNA

    Figure 5. Generation and characterization of stable knockdown cells of RECQ1. ( A ) Stable depletion of RECQ1 was performed in HeLa cells by using the two independent and dose-dependent lentiviral shRNA, shRECQ1–1 and shRECQ1–2. ( B ) Growth assays were performed to assess the cell proliferation and cell growth for RECQ1 stable knockdown cells over a period for 5 d. MTT cell proliferation experiments were performed to evaluate the cell proliferation in the increasing concentrations of hydroxyurea ( C ), camptothecin ( D ) and 8-methoxypsoralen ( E ).

    Journal: Cell Cycle

    Article Title: RECQ1 is required for cellular resistance to replication stress and catalyzes strand exchange on stalled replication fork structures

    doi: 10.4161/cc.22581

    Figure Lengend Snippet: Figure 5. Generation and characterization of stable knockdown cells of RECQ1. ( A ) Stable depletion of RECQ1 was performed in HeLa cells by using the two independent and dose-dependent lentiviral shRNA, shRECQ1–1 and shRECQ1–2. ( B ) Growth assays were performed to assess the cell proliferation and cell growth for RECQ1 stable knockdown cells over a period for 5 d. MTT cell proliferation experiments were performed to evaluate the cell proliferation in the increasing concentrations of hydroxyurea ( C ), camptothecin ( D ) and 8-methoxypsoralen ( E ).

    Article Snippet: Here, we generate stable knockdown cells of RECQ1 by using similar approach of lentiviral transduction. pLKO.1 vector harboring either of the two lentiviral shRNA targeting the coding region of human RECQ1 were purchased from Sigma Aldrich and used for lentiviral transduction.

    Techniques: shRNA, MTT Assay

    VEGF-C regulates canonical VEGFR2 survival signaling. (A) WB analysis of downstream VEGFR2 signaling in CPH017 glioblastoma cells starved for 24 h followed by stimulation with VEGF-A (40 ng/mL) or VEGF-C (0.2 µg/mL). (B) Quantitative RT-PCR analysis of VEGF-C expression in glioblastoma cells 48 h following transfection with either siCtrl (nontargeting control) or siVEGF-C (VEGF-C targeting siRNA). Data are represented as mean ± SEM; n = 3 or 4. Significance determined with 1-sample t -tests setting the hypothetical value to 1. (C) WB for VEGF-C and tubulin in CPH017 cells 72 h following siCtrl or siVEGF-C transfection. (D) Quantitative RT-PCR analysis of VEGF-A expression in CPH017 and IN1123 cells 48 h following siCtrl or siVEGF-C transfection. Data are represented as mean ± SEM; n = 3 or 4. Significance determined with 1-sample t -tests setting the hypothetical value to 1. (E) ELISA quantification of VEGF-A in conditioned media from CPH017 glioblastoma cells transfected with siCtrl or siVEGF-C. Data are represented as mean ± SEM; n = 2. Significance determined by 1-way ANOVA with Dunnett’s post-test correction. (F) Viability of CPH017 and IN1123 glioblastoma cells transfected with siCtrl or siVEGF-C. Data are represented as mean ± SEM; n = 3–5. Significance determined by 2-way ANOVA with Bonferroni post-test correction. (G) WB of pro- and cleaved (Cl.) caspase-3 and tubulin in CPH017 and IN1123 glioblastoma cells 72 h following siCtrl or siVEGF-C transfection. (H) Viability of CPH017 and IN1123 glioblastoma cells 5 days after transfection with siCtrl or siVEGF-C alone and combined treatment with 0.5 mg/mL bevacizumab (Bev). Data are represented as mean ± SEM; n = 3. Significance determined by 1-way ANOVA with Dunnett’s post-test correction. * P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001; **** P ≤ 0.0001.

    Journal: Neuro-Oncology

    Article Title: VEGF-C sustains VEGFR2 activation under bevacizumab therapy and promotes glioblastoma maintenance

    doi: 10.1093/neuonc/noy103

    Figure Lengend Snippet: VEGF-C regulates canonical VEGFR2 survival signaling. (A) WB analysis of downstream VEGFR2 signaling in CPH017 glioblastoma cells starved for 24 h followed by stimulation with VEGF-A (40 ng/mL) or VEGF-C (0.2 µg/mL). (B) Quantitative RT-PCR analysis of VEGF-C expression in glioblastoma cells 48 h following transfection with either siCtrl (nontargeting control) or siVEGF-C (VEGF-C targeting siRNA). Data are represented as mean ± SEM; n = 3 or 4. Significance determined with 1-sample t -tests setting the hypothetical value to 1. (C) WB for VEGF-C and tubulin in CPH017 cells 72 h following siCtrl or siVEGF-C transfection. (D) Quantitative RT-PCR analysis of VEGF-A expression in CPH017 and IN1123 cells 48 h following siCtrl or siVEGF-C transfection. Data are represented as mean ± SEM; n = 3 or 4. Significance determined with 1-sample t -tests setting the hypothetical value to 1. (E) ELISA quantification of VEGF-A in conditioned media from CPH017 glioblastoma cells transfected with siCtrl or siVEGF-C. Data are represented as mean ± SEM; n = 2. Significance determined by 1-way ANOVA with Dunnett’s post-test correction. (F) Viability of CPH017 and IN1123 glioblastoma cells transfected with siCtrl or siVEGF-C. Data are represented as mean ± SEM; n = 3–5. Significance determined by 2-way ANOVA with Bonferroni post-test correction. (G) WB of pro- and cleaved (Cl.) caspase-3 and tubulin in CPH017 and IN1123 glioblastoma cells 72 h following siCtrl or siVEGF-C transfection. (H) Viability of CPH017 and IN1123 glioblastoma cells 5 days after transfection with siCtrl or siVEGF-C alone and combined treatment with 0.5 mg/mL bevacizumab (Bev). Data are represented as mean ± SEM; n = 3. Significance determined by 1-way ANOVA with Dunnett’s post-test correction. * P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001; **** P ≤ 0.0001.

    Article Snippet: SiRNA Transfection/shRNA Transduction Cells were transfected using 75 pmol of either VEGF-C–small interfering (si)RNA (siVEGF-C-1: esiRNA pool/EHU013781, Sigma-Aldrich; siVEGF-C-2: single siRNA/HSS111277, ThermoFisher Scientific) or scrambled control siRNA (siCtrl: Stealth RNAi Negative Control Duplex Med CG, ThermoFisher Scientific).

    Techniques: Western Blot, Quantitative RT-PCR, Expressing, Transfection, Enzyme-linked Immunosorbent Assay

    A) Western blot of UMUC-3 cells transfected with pcDNA 3.1 vector, non-target control shRNA (NT-shRNA), HIF-1α shRNA, and CD24 overexpressed in HIF-1α shRNA transduced cells as explained in Methods. Bands were quantified as described in

    Journal: Cancer research

    Article Title: CD24 is an effector of HIF-1 driven primary tumor growth and metastasis

    doi: 10.1158/0008-5472.CAN-11-3666

    Figure Lengend Snippet: A) Western blot of UMUC-3 cells transfected with pcDNA 3.1 vector, non-target control shRNA (NT-shRNA), HIF-1α shRNA, and CD24 overexpressed in HIF-1α shRNA transduced cells as explained in Methods. Bands were quantified as described in

    Article Snippet: Short hairpin RNA (shRNA) expressing stable UMUC-3 cell lines were generated by transfecting CD24 shRNA or HIF-1α shRNA in PLKO1 vector (Sigma).

    Techniques: Western Blot, Transfection, Plasmid Preparation, shRNA

    A–B) Representative 0+ (%0 nuclear positivity) and 3+ ( > 50% nuclear positivity) staining of HIF-1α on tissue microarray cores of human urothelial carcinoma, respectively. C–D) Representative 1+ (weak intensity) and 3+ (diffuse,

    Journal: Cancer research

    Article Title: CD24 is an effector of HIF-1 driven primary tumor growth and metastasis

    doi: 10.1158/0008-5472.CAN-11-3666

    Figure Lengend Snippet: A–B) Representative 0+ (%0 nuclear positivity) and 3+ ( > 50% nuclear positivity) staining of HIF-1α on tissue microarray cores of human urothelial carcinoma, respectively. C–D) Representative 1+ (weak intensity) and 3+ (diffuse,

    Article Snippet: Short hairpin RNA (shRNA) expressing stable UMUC-3 cell lines were generated by transfecting CD24 shRNA or HIF-1α shRNA in PLKO1 vector (Sigma).

    Techniques: Staining, Microarray

    A) UMUC-3 cells transfected with pcDNA 3.1 vector, wild type HIF-1α and HIF-1α siRNA cells after exposure to 24 hours of hypoxia and mRNA expression of HIF-1α and CD24 assessed by quantitative realtime-PCR. * p

    Journal: Cancer research

    Article Title: CD24 is an effector of HIF-1 driven primary tumor growth and metastasis

    doi: 10.1158/0008-5472.CAN-11-3666

    Figure Lengend Snippet: A) UMUC-3 cells transfected with pcDNA 3.1 vector, wild type HIF-1α and HIF-1α siRNA cells after exposure to 24 hours of hypoxia and mRNA expression of HIF-1α and CD24 assessed by quantitative realtime-PCR. * p

    Article Snippet: Short hairpin RNA (shRNA) expressing stable UMUC-3 cell lines were generated by transfecting CD24 shRNA or HIF-1α shRNA in PLKO1 vector (Sigma).

    Techniques: Transfection, Plasmid Preparation, Expressing, Polymerase Chain Reaction

    A) Western blot of UMUC-3 cells transfected with pcDNA 3.1 vector, non-target control shRNA (NT-shRNA), HIF-1α overexpressing, and CD24 shRNA transduced in HIF-1α overexpressed cells as explained in Methods. Bands were quantified as described

    Journal: Cancer research

    Article Title: CD24 is an effector of HIF-1 driven primary tumor growth and metastasis

    doi: 10.1158/0008-5472.CAN-11-3666

    Figure Lengend Snippet: A) Western blot of UMUC-3 cells transfected with pcDNA 3.1 vector, non-target control shRNA (NT-shRNA), HIF-1α overexpressing, and CD24 shRNA transduced in HIF-1α overexpressed cells as explained in Methods. Bands were quantified as described

    Article Snippet: Short hairpin RNA (shRNA) expressing stable UMUC-3 cell lines were generated by transfecting CD24 shRNA or HIF-1α shRNA in PLKO1 vector (Sigma).

    Techniques: Western Blot, Transfection, Plasmid Preparation, shRNA

    LPA induces activation of RhoA through AMPK. A , SKOV3 cells were stimulated for the indicated times with 10 μ m LPA under serum-free conditions. B , SKOV3 cells were transfected with control and AMPKα1 siRNA for 48 h and then stimulated

    Journal: The Journal of Biological Chemistry

    Article Title: Activation of AMP-activated Protein Kinase Is Essential for Lysophosphatidic Acid-induced Cell Migration in Ovarian Cancer Cells *

    doi: 10.1074/jbc.M110.209908

    Figure Lengend Snippet: LPA induces activation of RhoA through AMPK. A , SKOV3 cells were stimulated for the indicated times with 10 μ m LPA under serum-free conditions. B , SKOV3 cells were transfected with control and AMPKα1 siRNA for 48 h and then stimulated

    Article Snippet: 293T cells were transfected with plasmids encoding control or AMPKα1 shRNA (sequence: CCGGCCTGGAAGTCACACAATAGAACTCGAGTTCTATTGTGTGACTTCCAGGTTTTT) in pLKO vectors (Sigma-Aldrich), vesicular stomatitis virus G and Δ 8.9 for 16 h, after which the medium was replaced.

    Techniques: Activation Assay, Transfection

    AMPK activates ERM proteins in LPA-induced cell migration. A and B , SKOV3 cells were pretreated with 10 μ m Y27632, a ROCK inhibitor, for 30 min before the addition of LPA. C and D , SKOV3 cells were transfected with control or AMPKα1 siRNA

    Journal: The Journal of Biological Chemistry

    Article Title: Activation of AMP-activated Protein Kinase Is Essential for Lysophosphatidic Acid-induced Cell Migration in Ovarian Cancer Cells *

    doi: 10.1074/jbc.M110.209908

    Figure Lengend Snippet: AMPK activates ERM proteins in LPA-induced cell migration. A and B , SKOV3 cells were pretreated with 10 μ m Y27632, a ROCK inhibitor, for 30 min before the addition of LPA. C and D , SKOV3 cells were transfected with control or AMPKα1 siRNA

    Article Snippet: 293T cells were transfected with plasmids encoding control or AMPKα1 shRNA (sequence: CCGGCCTGGAAGTCACACAATAGAACTCGAGTTCTATTGTGTGACTTCCAGGTTTTT) in pLKO vectors (Sigma-Aldrich), vesicular stomatitis virus G and Δ 8.9 for 16 h, after which the medium was replaced.

    Techniques: Migration, Transfection

    LPA-activated AMPK induces cell migration in ovarian cancer cells. SKOV3 cells were transfected with control or AMPKα1 siRNA for 48 h. A , the cells were used for a transwell migration assay after treatment with 1 μ m LPA for 4 h as described

    Journal: The Journal of Biological Chemistry

    Article Title: Activation of AMP-activated Protein Kinase Is Essential for Lysophosphatidic Acid-induced Cell Migration in Ovarian Cancer Cells *

    doi: 10.1074/jbc.M110.209908

    Figure Lengend Snippet: LPA-activated AMPK induces cell migration in ovarian cancer cells. SKOV3 cells were transfected with control or AMPKα1 siRNA for 48 h. A , the cells were used for a transwell migration assay after treatment with 1 μ m LPA for 4 h as described

    Article Snippet: 293T cells were transfected with plasmids encoding control or AMPKα1 shRNA (sequence: CCGGCCTGGAAGTCACACAATAGAACTCGAGTTCTATTGTGTGACTTCCAGGTTTTT) in pLKO vectors (Sigma-Aldrich), vesicular stomatitis virus G and Δ 8.9 for 16 h, after which the medium was replaced.

    Techniques: Migration, Transfection, Transwell Migration Assay

    Atg1, Atg5 and PI3KC3 are required for ATRA-induced autophagy. (A) Western blot analysis of Atg1, Atg5 and PI3KC3 expression in HL-60 or NB4 cells after treatment with ATRA (1 µM) for 48 h. (B) Western blot analysis of Atg1, Atg5 and PI3KC3 expression in HL-60 or NB4 cells after transfection with specific target shRNA for 48 h. (C) The indicated cells were treated with ATRA (1 µM) for 48 h, then autophagy was assayed by quantification of the average number of LC3 puncta per cell (HL-60 cells: n = 3, *p = 0.008, ATG1 shRNA group versus control shRNA group; p = 0.005, ATG5 shRNA group versus control shRNA group; p = 0.007, PI3KC3 shRNA group versus control shRNA group. NB4 cells: n = 3, *p = 0.01, ATG1 shRNA group versus control shRNA group; p = 0.005, ATG5 shRNA group versus control shRNA group; p = 0.008, PI3KC3 shRNA group versus control shRNA group). Representative images in HL-60 cells are shown in the right part. Bar = 20 µm. (D) HL-60 cells were treated as indicated with ATRA (1 µM) for 48 h and LC3-I/II protein expression was assayed by western blot. (E) Cells were treated as indicated with ATRA (1 µM) for 48 h, and then apoptosis was assayed by quantification of Annexin V-positive cells (HL-60 cells: n = 3, *p = 0.002, ATG1 shRNA group versus control shRNA group; p

    Journal: Autophagy

    Article Title: Autophagy regulates myeloid cell differentiation by p62/SQSTM1-mediated degradation of PML-RAR? oncoprotein

    doi: 10.4161/auto.7.4.14397

    Figure Lengend Snippet: Atg1, Atg5 and PI3KC3 are required for ATRA-induced autophagy. (A) Western blot analysis of Atg1, Atg5 and PI3KC3 expression in HL-60 or NB4 cells after treatment with ATRA (1 µM) for 48 h. (B) Western blot analysis of Atg1, Atg5 and PI3KC3 expression in HL-60 or NB4 cells after transfection with specific target shRNA for 48 h. (C) The indicated cells were treated with ATRA (1 µM) for 48 h, then autophagy was assayed by quantification of the average number of LC3 puncta per cell (HL-60 cells: n = 3, *p = 0.008, ATG1 shRNA group versus control shRNA group; p = 0.005, ATG5 shRNA group versus control shRNA group; p = 0.007, PI3KC3 shRNA group versus control shRNA group. NB4 cells: n = 3, *p = 0.01, ATG1 shRNA group versus control shRNA group; p = 0.005, ATG5 shRNA group versus control shRNA group; p = 0.008, PI3KC3 shRNA group versus control shRNA group). Representative images in HL-60 cells are shown in the right part. Bar = 20 µm. (D) HL-60 cells were treated as indicated with ATRA (1 µM) for 48 h and LC3-I/II protein expression was assayed by western blot. (E) Cells were treated as indicated with ATRA (1 µM) for 48 h, and then apoptosis was assayed by quantification of Annexin V-positive cells (HL-60 cells: n = 3, *p = 0.002, ATG1 shRNA group versus control shRNA group; p

    Article Snippet: Transfection with human Atg1-shRNA (SHCLN- ), Atg5-shRNA (SHCLN- ), PI3KC3-shRNA (SHCLN- ), p62-shRNA (SHCLN- ) and control shRNA (SHC001) from Sigma or pEGFPC1 control and pEGFPC1-p62 plasmids (a gift from Dr. Eileen White, The Cancer Institute of New Jersey, USA), were performed using the FuGENE® HD Transfection Reagent (Roche Applied Science, 04709705001) according to the manufacturer's instructions.,

    Techniques: Western Blot, Expressing, Transfection, shRNA

    3D migration is sensitive to lamin-A levels even in the absence of major proteomic changes. (A) Hypothesis for the impact of lamin-A levels on migration. Whereas moderate expression permits migration, cells with low levels cannot withstand the stress and high levels impede migration. Inset shows confocal image of a model lung tumor in an NSG mouse and a histogram of the measured pores filled with cytoplasm. (B) Schematic of a cell passing through a filter pore. (C) Wild-type 3D migration ( i ) and lamina parameters ( ii and iii ) for human-derived cancer cells (A549, U251) and adult stem cells (MSCs). ( n ≥ 3; ±SEM; *, P ≤ 0.05). (D) Lamin-A dependence of net cell migration to the filter bottom ( n ≥ 3; ±SEM). Normalization is done to scrambled siRNA-treated cells, with lamin-A level determined by immunoblot. Filters were pre-coated with fibronectin (+FN) unless indicated (−FN). Circles, siLMNA-treated cells; asterisk, shLMNA-treated cells, normalized against wild type; squares, wild type; triangle and diamond, A549 cells transduced with GFP-lamin-A with low and high levels, respectively. Based on analyses of individual cells, siLMNA ++ gave a monomodal, low variance population of cells and did not affect lamin-B ( Fig. S2 ). Inset plot: net migration results rescaled to absolute lamin-A levels with migration normalized to wild-type A549 cells ( Fig. 1 C i ). Slopes represent the 3D migration sensitivity to moderate lamin-A changes. (E) Net migration ratio with 8-µm pore filters shows no effects of knockdown regardless of fibronectin. ( n ≥ 3; ±SEM). (F) Negligible effect on the A549 proteome after ∼50% knockdown of lamin-A, C is evident in a narrow, log-normal distribution relative to wild type. (G) Immunoblot shows little to no change in lamin-B, HSP90, and β-actin after knockdown with two different siLMNAs (1 and 2) compared with scrambled (Scr).

    Journal: The Journal of Cell Biology

    Article Title: Nuclear lamin stiffness is a barrier to 3D migration, but softness can limit survival

    doi: 10.1083/jcb.201308029

    Figure Lengend Snippet: 3D migration is sensitive to lamin-A levels even in the absence of major proteomic changes. (A) Hypothesis for the impact of lamin-A levels on migration. Whereas moderate expression permits migration, cells with low levels cannot withstand the stress and high levels impede migration. Inset shows confocal image of a model lung tumor in an NSG mouse and a histogram of the measured pores filled with cytoplasm. (B) Schematic of a cell passing through a filter pore. (C) Wild-type 3D migration ( i ) and lamina parameters ( ii and iii ) for human-derived cancer cells (A549, U251) and adult stem cells (MSCs). ( n ≥ 3; ±SEM; *, P ≤ 0.05). (D) Lamin-A dependence of net cell migration to the filter bottom ( n ≥ 3; ±SEM). Normalization is done to scrambled siRNA-treated cells, with lamin-A level determined by immunoblot. Filters were pre-coated with fibronectin (+FN) unless indicated (−FN). Circles, siLMNA-treated cells; asterisk, shLMNA-treated cells, normalized against wild type; squares, wild type; triangle and diamond, A549 cells transduced with GFP-lamin-A with low and high levels, respectively. Based on analyses of individual cells, siLMNA ++ gave a monomodal, low variance population of cells and did not affect lamin-B ( Fig. S2 ). Inset plot: net migration results rescaled to absolute lamin-A levels with migration normalized to wild-type A549 cells ( Fig. 1 C i ). Slopes represent the 3D migration sensitivity to moderate lamin-A changes. (E) Net migration ratio with 8-µm pore filters shows no effects of knockdown regardless of fibronectin. ( n ≥ 3; ±SEM). (F) Negligible effect on the A549 proteome after ∼50% knockdown of lamin-A, C is evident in a narrow, log-normal distribution relative to wild type. (G) Immunoblot shows little to no change in lamin-B, HSP90, and β-actin after knockdown with two different siLMNAs (1 and 2) compared with scrambled (Scr).

    Article Snippet: For shRNA treatment, A549 cells were infected with lentiviral supernatants targeting lamin-A:C (TRCN000061833; Sigma-Aldrich) at a multiplicity of infection (MOI) of 10 in the presence of 80 µg/ml polybrene (Sigma-Aldrich), and cultured for 24 h. The cells were then selected by 2 µg/ml puromycin (Sigma-Aldrich) for 30 d. Knockdown efficiency was determined by Western blot following standard methods.

    Techniques: Migration, Expressing, Derivative Assay, Transduction

    The PCDH19 expression level affects inhibitory markers and surface GABA A R expression. ( A ) Western blot of cultured neurons infected at DIV1 with lentiviruses expressing PCDH19 control shRNA (Scramble), shRNA, PCDH19-V5 [at two different concentrations: 1X (1) and 2X (2), where the 1X concentration is sufficient to infect approximately 80-100% of cells], or shRNA plus PCDH19-V5 (Rescue1 and 2, according to the PCDH19-V5 virus concentration used, either 1X or 2X) and lysed at DIV8. Anti-PCDH19 detects both endogenous and lentivirally expressed protein, while anti-V5 detects exclusively the lentivirally expressed protein. Scramble and shRNA vectors express GFP protein. ( B ) Quantification of blots in (A) showing that PCDH19 and alpha 1 levels, normalized on GAPDH, vary accordingly (see Supplementary Material, Table S3 ). ( C ) Quantification (± SEM) of synaptic markers (GABA A R alpha 1, GAD65/67, gephyrin, NCAD and GluA2/3) normalized to GAPDH from western blots of neurons infected as in (A) with scramble, shRNA and PCDH19-V5 (2X concentration). PCDH19 overexpression increases inhibitory markers expression with respect to the control condition, but not NCAD and GluA2/3 expression. GAD65/67 expression was significantly reduced by PCDH19 shRNA (one-way ANOVA, post-hoc Tukey’s test, * P

    Journal: Human Molecular Genetics

    Article Title: The female epilepsy protein PCDH19 is a new GABAAR-binding partner that regulates GABAergic transmission as well as migration and morphological maturation of hippocampal neurons

    doi: 10.1093/hmg/ddy019

    Figure Lengend Snippet: The PCDH19 expression level affects inhibitory markers and surface GABA A R expression. ( A ) Western blot of cultured neurons infected at DIV1 with lentiviruses expressing PCDH19 control shRNA (Scramble), shRNA, PCDH19-V5 [at two different concentrations: 1X (1) and 2X (2), where the 1X concentration is sufficient to infect approximately 80-100% of cells], or shRNA plus PCDH19-V5 (Rescue1 and 2, according to the PCDH19-V5 virus concentration used, either 1X or 2X) and lysed at DIV8. Anti-PCDH19 detects both endogenous and lentivirally expressed protein, while anti-V5 detects exclusively the lentivirally expressed protein. Scramble and shRNA vectors express GFP protein. ( B ) Quantification of blots in (A) showing that PCDH19 and alpha 1 levels, normalized on GAPDH, vary accordingly (see Supplementary Material, Table S3 ). ( C ) Quantification (± SEM) of synaptic markers (GABA A R alpha 1, GAD65/67, gephyrin, NCAD and GluA2/3) normalized to GAPDH from western blots of neurons infected as in (A) with scramble, shRNA and PCDH19-V5 (2X concentration). PCDH19 overexpression increases inhibitory markers expression with respect to the control condition, but not NCAD and GluA2/3 expression. GAD65/67 expression was significantly reduced by PCDH19 shRNA (one-way ANOVA, post-hoc Tukey’s test, * P

    Article Snippet: DNA [4–6 μg/μl in water; pRNAT-U6.3/Hygro empty vector (Control), PCDH19 shRNA (shRNA), or shRNA plus PCDH19-V5 (Rescue)] together with the dye Fast Green (0.3 mg/ml; Sigma) was injected (5–6 μl) through the uterine wall into the lateral ventricles of each embryo.

    Techniques: Expressing, Western Blot, Cell Culture, Infection, shRNA, Concentration Assay, Over Expression

    PCDH19 downregulation in rats affects the migration, morphological maturation and orientation of hippocampal neurons and increases seizure susceptibility. ( A ) Confocal images of GFP fluorescence in coronal sections of rat hippocampus at P7 after in utero transfection (at E17.5) with pRNAT-U6.3/Hygro empty vector (Control), PCDH19 shRNA or shRNA plus PCDH19-V5 (Rescue). Slices were counterstained with the nuclear marker Hoechst for visualization of hippocampal layers (left). Scale bar, 50 μm. SO, stratum oriens ; SP, stratum pyramidale ; SR, stratum radiatum . ( B ) Quantification of the number of ectopic cells (± SEM) in control, shRNA and rescue conditions. Numbers are expressed as a percentage of the ectopic cells normalized to the total number of fluorescent cells in the same section. Asterisks: statistically significant difference (Student’s t -test, ** P

    Journal: Human Molecular Genetics

    Article Title: The female epilepsy protein PCDH19 is a new GABAAR-binding partner that regulates GABAergic transmission as well as migration and morphological maturation of hippocampal neurons

    doi: 10.1093/hmg/ddy019

    Figure Lengend Snippet: PCDH19 downregulation in rats affects the migration, morphological maturation and orientation of hippocampal neurons and increases seizure susceptibility. ( A ) Confocal images of GFP fluorescence in coronal sections of rat hippocampus at P7 after in utero transfection (at E17.5) with pRNAT-U6.3/Hygro empty vector (Control), PCDH19 shRNA or shRNA plus PCDH19-V5 (Rescue). Slices were counterstained with the nuclear marker Hoechst for visualization of hippocampal layers (left). Scale bar, 50 μm. SO, stratum oriens ; SP, stratum pyramidale ; SR, stratum radiatum . ( B ) Quantification of the number of ectopic cells (± SEM) in control, shRNA and rescue conditions. Numbers are expressed as a percentage of the ectopic cells normalized to the total number of fluorescent cells in the same section. Asterisks: statistically significant difference (Student’s t -test, ** P

    Article Snippet: DNA [4–6 μg/μl in water; pRNAT-U6.3/Hygro empty vector (Control), PCDH19 shRNA (shRNA), or shRNA plus PCDH19-V5 (Rescue)] together with the dye Fast Green (0.3 mg/ml; Sigma) was injected (5–6 μl) through the uterine wall into the lateral ventricles of each embryo.

    Techniques: Migration, Fluorescence, In Utero, Transfection, Plasmid Preparation, shRNA, Marker

    PCDH19 shRNA-mediated downregulation affects the miniature inhibitory post-synaptic currents (mIPSCs) frequency and kinetics. ( A ) Representative mIPSC recording (left) and population averages (right) from primary hippocampal pyramidal neurons expressing either PCDH19 control shRNA (Scramble), shRNA or shRNA plus PCDH19-V5 (Rescue). Neurons were transfected at DIV11 and recorded at DIV15. ( B ) Summary of mIPSC data (± SEM) showing that PCDH19 downregulation reduced the mIPSC frequency. Furthermore, mIPSCs of shRNA-expressing neurons were slower, as demonstrated by the increased decay time and area. Peak amplitude was not significantly affected by PCDH19 downregulation (one-way ANOVA, post-hoc Tukey’s test, * P

    Journal: Human Molecular Genetics

    Article Title: The female epilepsy protein PCDH19 is a new GABAAR-binding partner that regulates GABAergic transmission as well as migration and morphological maturation of hippocampal neurons

    doi: 10.1093/hmg/ddy019

    Figure Lengend Snippet: PCDH19 shRNA-mediated downregulation affects the miniature inhibitory post-synaptic currents (mIPSCs) frequency and kinetics. ( A ) Representative mIPSC recording (left) and population averages (right) from primary hippocampal pyramidal neurons expressing either PCDH19 control shRNA (Scramble), shRNA or shRNA plus PCDH19-V5 (Rescue). Neurons were transfected at DIV11 and recorded at DIV15. ( B ) Summary of mIPSC data (± SEM) showing that PCDH19 downregulation reduced the mIPSC frequency. Furthermore, mIPSCs of shRNA-expressing neurons were slower, as demonstrated by the increased decay time and area. Peak amplitude was not significantly affected by PCDH19 downregulation (one-way ANOVA, post-hoc Tukey’s test, * P

    Article Snippet: DNA [4–6 μg/μl in water; pRNAT-U6.3/Hygro empty vector (Control), PCDH19 shRNA (shRNA), or shRNA plus PCDH19-V5 (Rescue)] together with the dye Fast Green (0.3 mg/ml; Sigma) was injected (5–6 μl) through the uterine wall into the lateral ventricles of each embryo.

    Techniques: shRNA, Expressing, Transfection

    Silencing of FXR1 in cancer cells promotes cellular senescence. (A) After 72hrs of shRNA treatment, UMSCC74A and 74B FXR1 KD and control cells are fixed and stained with propidium Iodide (PI), and analyzed by fluorescence-activated cell sorting to evaluate the number of cells in different stages of cell cycles. (B) 72 hours post-transduction staining for SA-β-gal in FXR1 depleted UMSCC74A and 74B cells. Three independent fields for each experiment are used here for quantification. (C) Measurement of MUG conversion to 4-MU by senescence associated β-galactosidase in FXR1 depleted UMSCC74A and 74B cells. (D) Representative immunofluorescence images of pATM and γ-H2AX staining FXR1 depleted UMSCC74A and 74B cells compared to control. Quantification of foci containing cells is given under each cell lines. (* p

    Journal: PLoS Genetics

    Article Title: RNA-Binding Protein FXR1 Regulates p21 and TERC RNA to Bypass p53-Mediated Cellular Senescence in OSCC

    doi: 10.1371/journal.pgen.1006306

    Figure Lengend Snippet: Silencing of FXR1 in cancer cells promotes cellular senescence. (A) After 72hrs of shRNA treatment, UMSCC74A and 74B FXR1 KD and control cells are fixed and stained with propidium Iodide (PI), and analyzed by fluorescence-activated cell sorting to evaluate the number of cells in different stages of cell cycles. (B) 72 hours post-transduction staining for SA-β-gal in FXR1 depleted UMSCC74A and 74B cells. Three independent fields for each experiment are used here for quantification. (C) Measurement of MUG conversion to 4-MU by senescence associated β-galactosidase in FXR1 depleted UMSCC74A and 74B cells. (D) Representative immunofluorescence images of pATM and γ-H2AX staining FXR1 depleted UMSCC74A and 74B cells compared to control. Quantification of foci containing cells is given under each cell lines. (* p

    Article Snippet: Different shRNA constructs for FXR1 (TRCN0000158932 and TRCN0000159153) and p21 (TRCN0000287021) were obtained from Sigma Mission.

    Techniques: shRNA, Staining, Fluorescence, FACS, Transduction, Immunofluorescence

    FXR1 stabilizes TERC RNA. (A) FISH analysis of TERC DNA in a HNSCC TMA. Green indicates TERC DNA and red denotes control loci (scale bar 5μm). (B) Relative expression of TERC estimated by qRT-PCR in eight matched HNSCC and normal adjacent tissue samples. (C) Relative expression of FXR1 and TERC levels are simultaneously estimated in UMSCC74B cells under treatment of FXR1 shRNA for indicated time points. FXR1 and TERC levels in shControl treated UMSCC74B cells were taken as 100% for each time points. (D) The RNA decay rate of TERC as indicated in UMSCC74B cells by qRT-PCR after silencing FXR1 followed by transcription inhibition with actinomycin-D for mentioned time points in the graph. Actin serves as a control. Data here represents the mean of n = 3 experiments. (E) Forty-eight hours after transfection of UM74B FXR1 KD and control cells with empty 3’UTR luciferase plasmid, luciferase-fused GAPDH 3′UTR plasmid or two segments of TERC , the lysates were analyzed for luciferase activity using luminometer. The empty 3’UTR luciferase plasmid and luciferase-fused GAPDH 3′UTR served as a transfection and loading control. Values are the means ± SD from three independent experiments by using unpaired two sample t-test. (F) Association of FXR1 with the TERC and TERCmut RNAs. RNP IP was performed 48 h post-transfection of UMSCC74B cells with TERC and TERCmut fused to a luciferase reporter construct. Luciferase mRNA was detected using qRT-PCR. The luciferase gene in the empty-3′UTR was used as a transfection and qRT-PCR control. (G) TRAP assay is done on protein extracts (0.05μg) from FXR1 KD and control UMSCC74B cells. Heat inactivated controls; negative, positive, and loading controls are also shown in the figure. (H) Quantification of internal controls and telomerase activity bands (*) from FXR1 KD and control UMSCC74B cells. The values were normalized against the internal control bands from the heat inactivated samples from the above mentioned samples. P values are calculated from 4 independent experiments. (* p

    Journal: PLoS Genetics

    Article Title: RNA-Binding Protein FXR1 Regulates p21 and TERC RNA to Bypass p53-Mediated Cellular Senescence in OSCC

    doi: 10.1371/journal.pgen.1006306

    Figure Lengend Snippet: FXR1 stabilizes TERC RNA. (A) FISH analysis of TERC DNA in a HNSCC TMA. Green indicates TERC DNA and red denotes control loci (scale bar 5μm). (B) Relative expression of TERC estimated by qRT-PCR in eight matched HNSCC and normal adjacent tissue samples. (C) Relative expression of FXR1 and TERC levels are simultaneously estimated in UMSCC74B cells under treatment of FXR1 shRNA for indicated time points. FXR1 and TERC levels in shControl treated UMSCC74B cells were taken as 100% for each time points. (D) The RNA decay rate of TERC as indicated in UMSCC74B cells by qRT-PCR after silencing FXR1 followed by transcription inhibition with actinomycin-D for mentioned time points in the graph. Actin serves as a control. Data here represents the mean of n = 3 experiments. (E) Forty-eight hours after transfection of UM74B FXR1 KD and control cells with empty 3’UTR luciferase plasmid, luciferase-fused GAPDH 3′UTR plasmid or two segments of TERC , the lysates were analyzed for luciferase activity using luminometer. The empty 3’UTR luciferase plasmid and luciferase-fused GAPDH 3′UTR served as a transfection and loading control. Values are the means ± SD from three independent experiments by using unpaired two sample t-test. (F) Association of FXR1 with the TERC and TERCmut RNAs. RNP IP was performed 48 h post-transfection of UMSCC74B cells with TERC and TERCmut fused to a luciferase reporter construct. Luciferase mRNA was detected using qRT-PCR. The luciferase gene in the empty-3′UTR was used as a transfection and qRT-PCR control. (G) TRAP assay is done on protein extracts (0.05μg) from FXR1 KD and control UMSCC74B cells. Heat inactivated controls; negative, positive, and loading controls are also shown in the figure. (H) Quantification of internal controls and telomerase activity bands (*) from FXR1 KD and control UMSCC74B cells. The values were normalized against the internal control bands from the heat inactivated samples from the above mentioned samples. P values are calculated from 4 independent experiments. (* p

    Article Snippet: Different shRNA constructs for FXR1 (TRCN0000158932 and TRCN0000159153) and p21 (TRCN0000287021) were obtained from Sigma Mission.

    Techniques: Fluorescence In Situ Hybridization, Expressing, Quantitative RT-PCR, shRNA, Inhibition, Transfection, Luciferase, Plasmid Preparation, Activity Assay, Construct, TRAP Assay

    FXR1 destabilizes p21 mRNA. (A) FISH analysis of p21 in a HNSCC TMA. Green indicates p21 and red denotes the control loci (scale bar 5μm). (B) Relative p21 expression data obtained from cancer genome browser (N-43, T-521) ( S4 Table ). (C) Relative mRNA quantity of p21 in eight matched HNSCC tumor compared to normal adjacent tissue samples estimated using qRT-PCR. GAPDH serves as a control. (D) Immunoblot analysis of p21 protein from eight representative matched HNSCC tumor and normal adjacent samples. GAPDH is used as a loading control. (E) Relative quantity of FXR1 and p21 levels estimated by qRT-PCR in UMSCC74B cells after treatment with FXR1 shRNA. Cells were collected at indicated time points. FXR1 and p21 levels in shControl treated UMSCC74B cells were taken as 1 for each time points. (F) Immunoblot analysis of p21 protein at different time points, as, mentioned in Fig 4E. (G) The mRNA decay rate of p21 as indicated in UMSCC74B cells by qRT-PCR after silencing FXR1 followed by transcription inhibition with actinomycin-D for mentioned time points in the graph. Actin serves as a control. Data here represents the mean of n = 3 experiments. (H) Forty-eight hours after transfection of UM74B FXR1 KD and control cells with empty 3’UTR luciferase plasmid, luciferase-fused GAPDH 3′UTR plasmid or different segments of P21 3′UTR, the lysates were analyzed for luciferase activity using luminometer. The empty 3’UTR luciferase plasmid and luciferase-fused GAPDH 3′UTR served as a transfection and loading control. Values are the means ± SD from three independent experiments by using unpaired two sample t-test. (I) Binding of FXR1 with the 3′UTR of p21seg1 and p21seg2 RNAs at the G4 region. RNP IP was performed 48 h post-transfection of UMSCC74B cells with seg1 and seg2 3′UTR fused to a luciferase reporter construct. Luciferase mRNA was detected using qRT-PCR. The luciferase gene in the empty-3′UTR was used as a transfection and qRT-PCR control. (* p

    Journal: PLoS Genetics

    Article Title: RNA-Binding Protein FXR1 Regulates p21 and TERC RNA to Bypass p53-Mediated Cellular Senescence in OSCC

    doi: 10.1371/journal.pgen.1006306

    Figure Lengend Snippet: FXR1 destabilizes p21 mRNA. (A) FISH analysis of p21 in a HNSCC TMA. Green indicates p21 and red denotes the control loci (scale bar 5μm). (B) Relative p21 expression data obtained from cancer genome browser (N-43, T-521) ( S4 Table ). (C) Relative mRNA quantity of p21 in eight matched HNSCC tumor compared to normal adjacent tissue samples estimated using qRT-PCR. GAPDH serves as a control. (D) Immunoblot analysis of p21 protein from eight representative matched HNSCC tumor and normal adjacent samples. GAPDH is used as a loading control. (E) Relative quantity of FXR1 and p21 levels estimated by qRT-PCR in UMSCC74B cells after treatment with FXR1 shRNA. Cells were collected at indicated time points. FXR1 and p21 levels in shControl treated UMSCC74B cells were taken as 1 for each time points. (F) Immunoblot analysis of p21 protein at different time points, as, mentioned in Fig 4E. (G) The mRNA decay rate of p21 as indicated in UMSCC74B cells by qRT-PCR after silencing FXR1 followed by transcription inhibition with actinomycin-D for mentioned time points in the graph. Actin serves as a control. Data here represents the mean of n = 3 experiments. (H) Forty-eight hours after transfection of UM74B FXR1 KD and control cells with empty 3’UTR luciferase plasmid, luciferase-fused GAPDH 3′UTR plasmid or different segments of P21 3′UTR, the lysates were analyzed for luciferase activity using luminometer. The empty 3’UTR luciferase plasmid and luciferase-fused GAPDH 3′UTR served as a transfection and loading control. Values are the means ± SD from three independent experiments by using unpaired two sample t-test. (I) Binding of FXR1 with the 3′UTR of p21seg1 and p21seg2 RNAs at the G4 region. RNP IP was performed 48 h post-transfection of UMSCC74B cells with seg1 and seg2 3′UTR fused to a luciferase reporter construct. Luciferase mRNA was detected using qRT-PCR. The luciferase gene in the empty-3′UTR was used as a transfection and qRT-PCR control. (* p

    Article Snippet: Different shRNA constructs for FXR1 (TRCN0000158932 and TRCN0000159153) and p21 (TRCN0000287021) were obtained from Sigma Mission.

    Techniques: Fluorescence In Situ Hybridization, Expressing, Quantitative RT-PCR, shRNA, Inhibition, Transfection, Luciferase, Plasmid Preparation, Activity Assay, Binding Assay, Construct

    Arginase and iNOS levels in MDSCs isolated from spleen and tumor microenvironment following RA190 treatment or RPN13 knock down in vitro ( A and B ) MDSCs from spleens and ascites of ID8-Luc tumor-bearing mice were treated with or without RA190 (2 μM) in vitro for 24 hours. The levels of Arginase and iNOS were assessed by flow cytometry. (A) Bar graph showing arginase expression in CD11b + Gr1 + cells isolated from spleen and ascites. (B) Bar graph showing iNOS expression in CD11b + Gr1 + cells isolation from spleen and ascites. ( C and D ) Lentivirus expressing Rpn13 shRNA was used to infect MDSCs and knock down Rpn13 expression. Arginase and iNOS expression in MDSCs receiving no treatment, infected with lentivirus expressing control shRNA, infected with lentivirus expressing Rpn13 shRNA, or treated with RA190 (2 μM) were assessed by flow cytometry. (C) Bar graph showing the percentage of arginase expressing CD11b+Gr-1+ cells in different groups. (D) Bar graph showing the percentage of iNOS expressing CD11b+Gr-1+ cells in different groups. Values are shown as mean ± SD (* P = 0.05, ** P = 0.01, ns, not significant).

    Journal: Oncotarget

    Article Title: RPN13/ADRM1 inhibitor reverses immunosuppression by myeloid-derived suppressor cells

    doi: 10.18632/oncotarget.12095

    Figure Lengend Snippet: Arginase and iNOS levels in MDSCs isolated from spleen and tumor microenvironment following RA190 treatment or RPN13 knock down in vitro ( A and B ) MDSCs from spleens and ascites of ID8-Luc tumor-bearing mice were treated with or without RA190 (2 μM) in vitro for 24 hours. The levels of Arginase and iNOS were assessed by flow cytometry. (A) Bar graph showing arginase expression in CD11b + Gr1 + cells isolated from spleen and ascites. (B) Bar graph showing iNOS expression in CD11b + Gr1 + cells isolation from spleen and ascites. ( C and D ) Lentivirus expressing Rpn13 shRNA was used to infect MDSCs and knock down Rpn13 expression. Arginase and iNOS expression in MDSCs receiving no treatment, infected with lentivirus expressing control shRNA, infected with lentivirus expressing Rpn13 shRNA, or treated with RA190 (2 μM) were assessed by flow cytometry. (C) Bar graph showing the percentage of arginase expressing CD11b+Gr-1+ cells in different groups. (D) Bar graph showing the percentage of iNOS expressing CD11b+Gr-1+ cells in different groups. Values are shown as mean ± SD (* P = 0.05, ** P = 0.01, ns, not significant).

    Article Snippet: Lentiviral transfer and RPN13 knock down by shRNA RPN13 shRNA (TRC no. TRCN0000125944; sequence, CCGG-CATGCAGAACAATGCCAAAT- CTCGAG-ATTTGGCATTGTTCTGCATGG-TTTTTG) and the nontarget shRNA control vector (cat. no. SHC002; sequence, CCGGCGTGATCTTCACCGACAA GATCTCGAGATCTTGTCGGTGAAGATCACGTTTTT) were purchased from Sigma-Aldrich (St. Louis, MO).

    Techniques: Isolation, In Vitro, Mouse Assay, Flow Cytometry, Cytometry, Expressing, shRNA, Infection

    T cell proliferation after co-culturing with MDSCs treated with RA190 or RPN13 knock down in vitro . ( A and B ) OT-1 T cells stimulated by SIINFEKL peptide loaded on irradiated TC-1 cells were labeled with CFSE, and then co-cultured with RA190-treated MDSCs. (A) Representative flow cytometry of T cell proliferation as measured by CFSE dilution in unstimulated T cells, stimulated T cells, stimulated T cells co-cultured with MDSCs, and stimulated T cells co-cultured with RA190-treated MDSCs. (B) Bar graph depicting the percentage of proliferated OT-1 T cells. ( C and D ) OT-1 T cells stimulated by SIINFEKL peptide loaded on irradiated TC-1 cells were labeled with CFSE, and then co-cultured with Rpn13 knocked down MDSCs. (C) Representative flow cytometry of T cell proliferation measured by CFSE dilution in unstimulated T cells, stimulated T cells, stimulated T cells co-cultured with MDSCs infected with control shRNA, and stimulated T cells co-cultured with MDSCs infected with Rpn13 shRNA. (D) Bar graph showing the percentage of proliferated T cells in various treatment groups. Values are shown as mean ± SD (* P = 0.05, ** P = 0.01, ns, not significant).

    Journal: Oncotarget

    Article Title: RPN13/ADRM1 inhibitor reverses immunosuppression by myeloid-derived suppressor cells

    doi: 10.18632/oncotarget.12095

    Figure Lengend Snippet: T cell proliferation after co-culturing with MDSCs treated with RA190 or RPN13 knock down in vitro . ( A and B ) OT-1 T cells stimulated by SIINFEKL peptide loaded on irradiated TC-1 cells were labeled with CFSE, and then co-cultured with RA190-treated MDSCs. (A) Representative flow cytometry of T cell proliferation as measured by CFSE dilution in unstimulated T cells, stimulated T cells, stimulated T cells co-cultured with MDSCs, and stimulated T cells co-cultured with RA190-treated MDSCs. (B) Bar graph depicting the percentage of proliferated OT-1 T cells. ( C and D ) OT-1 T cells stimulated by SIINFEKL peptide loaded on irradiated TC-1 cells were labeled with CFSE, and then co-cultured with Rpn13 knocked down MDSCs. (C) Representative flow cytometry of T cell proliferation measured by CFSE dilution in unstimulated T cells, stimulated T cells, stimulated T cells co-cultured with MDSCs infected with control shRNA, and stimulated T cells co-cultured with MDSCs infected with Rpn13 shRNA. (D) Bar graph showing the percentage of proliferated T cells in various treatment groups. Values are shown as mean ± SD (* P = 0.05, ** P = 0.01, ns, not significant).

    Article Snippet: Lentiviral transfer and RPN13 knock down by shRNA RPN13 shRNA (TRC no. TRCN0000125944; sequence, CCGG-CATGCAGAACAATGCCAAAT- CTCGAG-ATTTGGCATTGTTCTGCATGG-TTTTTG) and the nontarget shRNA control vector (cat. no. SHC002; sequence, CCGGCGTGATCTTCACCGACAA GATCTCGAGATCTTGTCGGTGAAGATCACGTTTTT) were purchased from Sigma-Aldrich (St. Louis, MO).

    Techniques: In Vitro, Irradiation, Labeling, Cell Culture, Flow Cytometry, Cytometry, Infection, shRNA

    Impact of RA190 treatment or RPN13 knock down on P-Stat3 and Stat3 levels in MDSCs in vitro . ( A ) Immunoblot of P-Stat3 and Stat3 expression level of MDSCs treated with PBS, RA190 (2 μM), and the inactive analog RA190R (2 μM). ( B ) Expression of P-Stat3 and Stat3 in MDSCs treated with various doses of RA190 for 8 hours. ( C ) Time course of P-Stat3 and Stat3 expression in MDSCs following RA190 treatment. ( D ) Lentivirus expressing Rpn13 shRNA was used to infect MDSCs and knock down Rpn13 expression. Immunoblot showing Rpn13 protein expression in MDSCs treated with control shRNA and Rpn13 shRNA as well as expression level of P-Stat3 and Stat3.

    Journal: Oncotarget

    Article Title: RPN13/ADRM1 inhibitor reverses immunosuppression by myeloid-derived suppressor cells

    doi: 10.18632/oncotarget.12095

    Figure Lengend Snippet: Impact of RA190 treatment or RPN13 knock down on P-Stat3 and Stat3 levels in MDSCs in vitro . ( A ) Immunoblot of P-Stat3 and Stat3 expression level of MDSCs treated with PBS, RA190 (2 μM), and the inactive analog RA190R (2 μM). ( B ) Expression of P-Stat3 and Stat3 in MDSCs treated with various doses of RA190 for 8 hours. ( C ) Time course of P-Stat3 and Stat3 expression in MDSCs following RA190 treatment. ( D ) Lentivirus expressing Rpn13 shRNA was used to infect MDSCs and knock down Rpn13 expression. Immunoblot showing Rpn13 protein expression in MDSCs treated with control shRNA and Rpn13 shRNA as well as expression level of P-Stat3 and Stat3.

    Article Snippet: Lentiviral transfer and RPN13 knock down by shRNA RPN13 shRNA (TRC no. TRCN0000125944; sequence, CCGG-CATGCAGAACAATGCCAAAT- CTCGAG-ATTTGGCATTGTTCTGCATGG-TTTTTG) and the nontarget shRNA control vector (cat. no. SHC002; sequence, CCGGCGTGATCTTCACCGACAA GATCTCGAGATCTTGTCGGTGAAGATCACGTTTTT) were purchased from Sigma-Aldrich (St. Louis, MO).

    Techniques: In Vitro, Expressing, shRNA

    S100A4 is required for cell survival in leukemia cell lines. (a) Example western blot showing S100A4 expression in leukemia cells with S100A4 knocked down (KD; TRCN0000416498) compared to control (targeting non-mammalian gene) using shRNA. (b) Summary data showing growth of leukemia lines with S100A4 KD (TRCN0000416498) compared to control over 3 days of growth following infection (n=3; except KG1 (n=2). (c and d) Apoptosis was evaluated by flow cytometric analysis of APC-conjugated Annexin V binding, while simultaneously assessing membrane integrity by PI exclusion. (c) Example flow cytometric plots of S100A4 KD compared to control using OCI-AML2. Annexin V - and PI - negative (lower - left quadrant), annexin V + and PI - (lower - right quadrant) and both annexin V and PI positive (upper - right quadrant) cells were considered as the viable, early-phase apoptotic, late-phase apoptotic/necrotic cells, respectively. (d) Summary data showing the effect of S100A4 KD on Annexin V staining in leukemia cell lines following 48 hours post infection. Data indicates mean ± 1SD (n=3). Statistical significance is denoted by * P

    Journal: Leukemia

    Article Title: Integrated nuclear proteomics and transcriptomics identifies S100A4 as a therapeutic target in acute myeloid leukemia

    doi: 10.1038/s41375-019-0596-4

    Figure Lengend Snippet: S100A4 is required for cell survival in leukemia cell lines. (a) Example western blot showing S100A4 expression in leukemia cells with S100A4 knocked down (KD; TRCN0000416498) compared to control (targeting non-mammalian gene) using shRNA. (b) Summary data showing growth of leukemia lines with S100A4 KD (TRCN0000416498) compared to control over 3 days of growth following infection (n=3; except KG1 (n=2). (c and d) Apoptosis was evaluated by flow cytometric analysis of APC-conjugated Annexin V binding, while simultaneously assessing membrane integrity by PI exclusion. (c) Example flow cytometric plots of S100A4 KD compared to control using OCI-AML2. Annexin V - and PI - negative (lower - left quadrant), annexin V + and PI - (lower - right quadrant) and both annexin V and PI positive (upper - right quadrant) cells were considered as the viable, early-phase apoptotic, late-phase apoptotic/necrotic cells, respectively. (d) Summary data showing the effect of S100A4 KD on Annexin V staining in leukemia cell lines following 48 hours post infection. Data indicates mean ± 1SD (n=3). Statistical significance is denoted by * P

    Article Snippet: For knock down studies, Mission® shRNA vectors based on TRC(1)2-pLKO.5-puro (S100A4 shRNA and non-mammalian shRNA control) were purchased from Sigma-Aldrich, Dorset, U.K. CD34+ cells and cell lines were transduced and cultured as previously described [ , ].

    Techniques: Western Blot, Expressing, shRNA, Infection, Binding Assay, Staining

    Lentivirus-mediated knockdown of SIRT1 diminishes the basal and polyphenol-induced AMPK activation in HepG2 cells. HepG2 cells were infected without or with lentivirus expressing either an shRNA control or SIRT1 shRNA and then selected in 0.6 μg/ml

    Journal:

    Article Title: SIRT1 Regulates Hepatocyte Lipid Metabolism through Activating AMP-activated Protein Kinase *SIRT1 Regulates Hepatocyte Lipid Metabolism through Activating AMP-activated Protein Kinase * S⃞

    doi: 10.1074/jbc.M802187200

    Figure Lengend Snippet: Lentivirus-mediated knockdown of SIRT1 diminishes the basal and polyphenol-induced AMPK activation in HepG2 cells. HepG2 cells were infected without or with lentivirus expressing either an shRNA control or SIRT1 shRNA and then selected in 0.6 μg/ml

    Article Snippet: HepG2 cells were infected with fresh lentivirus expressing either control shRNA or SIRT1 shRNA in DMEM containing 8 μg/ml Polybrene (Sigma) for 24 h and cultured for an additional 72 h. The cells were selected for puromycin resistance (0.6 μg/ml, 7 days).

    Techniques: Activation Assay, Infection, Expressing, shRNA

    CBX8 inhibits EMT in ESCC cells. (A) TE-1 cells stably expressing NC or shRNA-CBX8 as indicated were analyzed by immunofluorescence assay for phalloidin (red) with DAPI (blue) counterstaining. (B, C) Relative expressions of the indicated molecules were detected by qRT-PCR (B) and Western blotting (C) in the indicated stable cell lines, respectively. The results are expressed as the mean ± SD of three independent experiments. * p

    Journal: Theranostics

    Article Title: CBX8 Suppresses Tumor Metastasis via Repressing Snail in Esophageal Squamous Cell Carcinoma

    doi: 10.7150/thno.20717

    Figure Lengend Snippet: CBX8 inhibits EMT in ESCC cells. (A) TE-1 cells stably expressing NC or shRNA-CBX8 as indicated were analyzed by immunofluorescence assay for phalloidin (red) with DAPI (blue) counterstaining. (B, C) Relative expressions of the indicated molecules were detected by qRT-PCR (B) and Western blotting (C) in the indicated stable cell lines, respectively. The results are expressed as the mean ± SD of three independent experiments. * p

    Article Snippet: Cell lines stably expressing negative control shRNA (NC), CBX8-shRNA, Snail-shRNA or both were established by the Sigma Addrich shRNA System according to the manufacturer's instructions.

    Techniques: Stable Transfection, Expressing, shRNA, Immunofluorescence, Quantitative RT-PCR, Western Blot

    EZH2 KD-induced neurite extension is canceled by the depletion of NTRK1. a , b NB-39-nu cells were infected with a mock- or shEZH2-1-expressing lentivirus 2 and 3 days after NTRK1 siRNA transfection. EZH2 and NTRK1 expression was assessed by semi-quantitative RT-PCR ( a ) and qPCR ( b ). c Images of EZH2 and/or NTRK1 knockdown NB-39-nu cells. The percentages of neurite-extending cells were counted. Data are presented as the mean ± s.d. from at least three independent experiments. d Photos of and percentages of neurite-extending NB-39-nu cells treated with shEZH2 lentivirus and/or NGF. Cells were infected with shEZH2 lentivirus, cultured for 2 days, and cultured for 3 more days after the addition of NGFbeta (100 ng/ml). Neurite extension was assessed as described in Methods, and NTRK1 expression was analyzed by semi-quantitative RT-PCR

    Journal: Oncogene

    Article Title: EZH2 regulates neuroblastoma cell differentiation via NTRK1 promoter epigenetic modifications

    doi: 10.1038/s41388-018-0133-3

    Figure Lengend Snippet: EZH2 KD-induced neurite extension is canceled by the depletion of NTRK1. a , b NB-39-nu cells were infected with a mock- or shEZH2-1-expressing lentivirus 2 and 3 days after NTRK1 siRNA transfection. EZH2 and NTRK1 expression was assessed by semi-quantitative RT-PCR ( a ) and qPCR ( b ). c Images of EZH2 and/or NTRK1 knockdown NB-39-nu cells. The percentages of neurite-extending cells were counted. Data are presented as the mean ± s.d. from at least three independent experiments. d Photos of and percentages of neurite-extending NB-39-nu cells treated with shEZH2 lentivirus and/or NGF. Cells were infected with shEZH2 lentivirus, cultured for 2 days, and cultured for 3 more days after the addition of NGFbeta (100 ng/ml). Neurite extension was assessed as described in Methods, and NTRK1 expression was analyzed by semi-quantitative RT-PCR

    Article Snippet: shRNA plasmids, including TRCN0000018365 (shEZH2-1), TRCN0000010475 (shEZH2-2), and the pLKO.1-puro control vector (shCont), were from the MISSION(TM) shRNA Library (Sigma-Aldrich).

    Techniques: Infection, Expressing, Transfection, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Cell Culture

    Knockdown of EZH2 promotes neurite extension and induces neuronal markers. Results are representative of at least three independent experiments. a Images of EZH2 KD NB-39-nu cells under a contrast microscope. NB-39-nu cells were infected with the shCont- or shEZH2-lentivirus, as described in the Materials and Methods. Images were obtained 8 days after infection. b The percentages of neurite-extending cells in shCont- or shEZH2-expressing lentivirus-infected cells were counted 8 and 11 days after infection. Neurite extension was analyzed as described in the Materials and Methods. Error bars represent the standard deviation obtained with triplicate samples. c EZH2 and H3K27me3 levels were assessed using western blotting. After the infection with the shCont- or shEZH2-lentivirus, cells were collected on days 3 and 4 and subjected to a western blotting analysis. d The upregulation of the neuronal markers GAP43 and NF68 was confirmed by RT-PCR. e Tumor development in BALB/c AJcl nu/nu mice following the injection of NB-39-nu cells stably infected with shRNA against the control (shCont) or EZH2 (shEZH2-1). Tumor volumes were measured every 4 days. Data are presented as the mean ± SE of tumors in four mice

    Journal: Oncogene

    Article Title: EZH2 regulates neuroblastoma cell differentiation via NTRK1 promoter epigenetic modifications

    doi: 10.1038/s41388-018-0133-3

    Figure Lengend Snippet: Knockdown of EZH2 promotes neurite extension and induces neuronal markers. Results are representative of at least three independent experiments. a Images of EZH2 KD NB-39-nu cells under a contrast microscope. NB-39-nu cells were infected with the shCont- or shEZH2-lentivirus, as described in the Materials and Methods. Images were obtained 8 days after infection. b The percentages of neurite-extending cells in shCont- or shEZH2-expressing lentivirus-infected cells were counted 8 and 11 days after infection. Neurite extension was analyzed as described in the Materials and Methods. Error bars represent the standard deviation obtained with triplicate samples. c EZH2 and H3K27me3 levels were assessed using western blotting. After the infection with the shCont- or shEZH2-lentivirus, cells were collected on days 3 and 4 and subjected to a western blotting analysis. d The upregulation of the neuronal markers GAP43 and NF68 was confirmed by RT-PCR. e Tumor development in BALB/c AJcl nu/nu mice following the injection of NB-39-nu cells stably infected with shRNA against the control (shCont) or EZH2 (shEZH2-1). Tumor volumes were measured every 4 days. Data are presented as the mean ± SE of tumors in four mice

    Article Snippet: shRNA plasmids, including TRCN0000018365 (shEZH2-1), TRCN0000010475 (shEZH2-2), and the pLKO.1-puro control vector (shCont), were from the MISSION(TM) shRNA Library (Sigma-Aldrich).

    Techniques: Microscopy, Infection, Expressing, Standard Deviation, Western Blot, Reverse Transcription Polymerase Chain Reaction, Mouse Assay, Injection, Stable Transfection, shRNA

    Knockdown of ATAD2 expression inhibits the proliferation and colony formation of GC cells. ( A ) The endogenous ATAD2 expression levels were detected by Western blot in SGC-7901 and MGC-803 cells transfected with pLV-ATAD2 shRNA or pLV-control for 48 hrs. ( B ) MTT cell viability assays were performed on days 1 to 5 after the transfection of SGC-7901 and MGC-803 cells with either pLV-ATAD2 shRNA or pLV-control. The data represents the mean ± SD of 3 independent experiments. (* P

    Journal: Cancer Management and Research

    Article Title: Knockdown of ATAD2 Inhibits Proliferation and Tumorigenicity Through the Rb-E2F1 Pathway and Serves as a Novel Prognostic Indicator in Gastric Cancer

    doi: 10.2147/CMAR.S228629

    Figure Lengend Snippet: Knockdown of ATAD2 expression inhibits the proliferation and colony formation of GC cells. ( A ) The endogenous ATAD2 expression levels were detected by Western blot in SGC-7901 and MGC-803 cells transfected with pLV-ATAD2 shRNA or pLV-control for 48 hrs. ( B ) MTT cell viability assays were performed on days 1 to 5 after the transfection of SGC-7901 and MGC-803 cells with either pLV-ATAD2 shRNA or pLV-control. The data represents the mean ± SD of 3 independent experiments. (* P

    Article Snippet: The transfection efficiency was monitored by fluorescence microscopy and cells transfected with pLV-ATAD2 shRNA or pLV-control were selected with puromycin (Sigma Aldrich, St Louis, MO, USA) at a concentration of 2 µg/mL for 1 week.

    Techniques: Expressing, Western Blot, Transfection, shRNA, MTT Assay

    Knockdown of ATAD2 suppresses tumour growth in vivo. ( A ) Tumour formation in nude mice 6 weeks after injection with SGC-7901 cells transfected with pLV-ATAD2 shRNA or pLV-control. ( B, C ) Weights of the generated tumours by SGC-7901 cells transfected with pLV-ATAD2 shRNA or pLV-control 6 weeks after the initial injection. Data was shown as means ± SD. ( D ) Growth curves of generated tumors by SGC-7901 cells transfected with pLV-ATAD2 shRNA or pLV-control. Volumes of the tumours were measured every 3 days for 6 weeks. ( E, F ) IHC analysis of 6 pLV-ATAD2 shRNA- and 6 pLV-control-generated tumours 6 weeks after injection. Representative fields are shown (×200). For each generated tumour, five fields were randomly selected according to semi-quantitative scales. ATAD2- and Ki67-positive cells per 1000 cells were counted by three independent experienced pathologists. The bar graph shows average expression levels of ATAD2 and Ki67 of pLV-ATAD2 shRNA- and pLV-control-generated tumours. Data were shown as means ± SD; (* P

    Journal: Cancer Management and Research

    Article Title: Knockdown of ATAD2 Inhibits Proliferation and Tumorigenicity Through the Rb-E2F1 Pathway and Serves as a Novel Prognostic Indicator in Gastric Cancer

    doi: 10.2147/CMAR.S228629

    Figure Lengend Snippet: Knockdown of ATAD2 suppresses tumour growth in vivo. ( A ) Tumour formation in nude mice 6 weeks after injection with SGC-7901 cells transfected with pLV-ATAD2 shRNA or pLV-control. ( B, C ) Weights of the generated tumours by SGC-7901 cells transfected with pLV-ATAD2 shRNA or pLV-control 6 weeks after the initial injection. Data was shown as means ± SD. ( D ) Growth curves of generated tumors by SGC-7901 cells transfected with pLV-ATAD2 shRNA or pLV-control. Volumes of the tumours were measured every 3 days for 6 weeks. ( E, F ) IHC analysis of 6 pLV-ATAD2 shRNA- and 6 pLV-control-generated tumours 6 weeks after injection. Representative fields are shown (×200). For each generated tumour, five fields were randomly selected according to semi-quantitative scales. ATAD2- and Ki67-positive cells per 1000 cells were counted by three independent experienced pathologists. The bar graph shows average expression levels of ATAD2 and Ki67 of pLV-ATAD2 shRNA- and pLV-control-generated tumours. Data were shown as means ± SD; (* P

    Article Snippet: The transfection efficiency was monitored by fluorescence microscopy and cells transfected with pLV-ATAD2 shRNA or pLV-control were selected with puromycin (Sigma Aldrich, St Louis, MO, USA) at a concentration of 2 µg/mL for 1 week.

    Techniques: In Vivo, Mouse Assay, Injection, Transfection, shRNA, Generated, Immunohistochemistry, Expressing

    Knockdown of ATAD2 induces apoptosis of GC cells. ( A, B ) Knockdown of ATAD2 significantly induced apoptosis after SGC-7901 cells were transfected with pLV-GRP78 shRNA or pLV-control for 48 hrs. ( C, D ) Knockdown of ATAD2 significantly induces apoptosis after MGC-803 cells were transfected with pLV-GRP78 shRNA or pLV-control for 48 hrs. Data were from three independent experiments and expressed as means ± SD; (* P

    Journal: Cancer Management and Research

    Article Title: Knockdown of ATAD2 Inhibits Proliferation and Tumorigenicity Through the Rb-E2F1 Pathway and Serves as a Novel Prognostic Indicator in Gastric Cancer

    doi: 10.2147/CMAR.S228629

    Figure Lengend Snippet: Knockdown of ATAD2 induces apoptosis of GC cells. ( A, B ) Knockdown of ATAD2 significantly induced apoptosis after SGC-7901 cells were transfected with pLV-GRP78 shRNA or pLV-control for 48 hrs. ( C, D ) Knockdown of ATAD2 significantly induces apoptosis after MGC-803 cells were transfected with pLV-GRP78 shRNA or pLV-control for 48 hrs. Data were from three independent experiments and expressed as means ± SD; (* P

    Article Snippet: The transfection efficiency was monitored by fluorescence microscopy and cells transfected with pLV-ATAD2 shRNA or pLV-control were selected with puromycin (Sigma Aldrich, St Louis, MO, USA) at a concentration of 2 µg/mL for 1 week.

    Techniques: Transfection, shRNA

    Knockdown of ATAD2 inhibits G1/S phase transition of GC cells. ( A, B ) Cell cycle profiles were analysed by flow cytometer after SGC-7901 cells were transfected with pLV-GRP78 shRNA or pLV-control for 48 hrs. ( C, D ) Cell cycle profiles were analysed by flow cytometer after MGC-803 cells were transfected with pLV-GRP78 shRNA or pLV-control for 48 hrs. Data were from three independent experiments and expressed as means ± SD; (* P

    Journal: Cancer Management and Research

    Article Title: Knockdown of ATAD2 Inhibits Proliferation and Tumorigenicity Through the Rb-E2F1 Pathway and Serves as a Novel Prognostic Indicator in Gastric Cancer

    doi: 10.2147/CMAR.S228629

    Figure Lengend Snippet: Knockdown of ATAD2 inhibits G1/S phase transition of GC cells. ( A, B ) Cell cycle profiles were analysed by flow cytometer after SGC-7901 cells were transfected with pLV-GRP78 shRNA or pLV-control for 48 hrs. ( C, D ) Cell cycle profiles were analysed by flow cytometer after MGC-803 cells were transfected with pLV-GRP78 shRNA or pLV-control for 48 hrs. Data were from three independent experiments and expressed as means ± SD; (* P

    Article Snippet: The transfection efficiency was monitored by fluorescence microscopy and cells transfected with pLV-ATAD2 shRNA or pLV-control were selected with puromycin (Sigma Aldrich, St Louis, MO, USA) at a concentration of 2 µg/mL for 1 week.

    Techniques: Sublimation, Flow Cytometry, Transfection, shRNA

    Knockdown of ATAD2 altered the expression of key cell-cycle regulatory and apoptosis-related proteins. ( A ) Western blot analysis of key cell-cycle regulatory proteins cyclin D1, phosphorylated Rb (ppRb), total Rb proteins (pRb), E2F1, cyclin E and cyclin A in SGC-7901 and MGC-803 cells transfected with either pLV-ATAD2 shRNA or pLV-control. ( B ) Western blot analysis of the apoptosis-related proteins cleaved-PARP, PARP, cleaved-Caspase 3, Caspase 3 in SGC-7901 and MGC-803 cells transfected with either pLV-ATAD2 shRNA or pLV-control. GAPDH was used as a loading control.

    Journal: Cancer Management and Research

    Article Title: Knockdown of ATAD2 Inhibits Proliferation and Tumorigenicity Through the Rb-E2F1 Pathway and Serves as a Novel Prognostic Indicator in Gastric Cancer

    doi: 10.2147/CMAR.S228629

    Figure Lengend Snippet: Knockdown of ATAD2 altered the expression of key cell-cycle regulatory and apoptosis-related proteins. ( A ) Western blot analysis of key cell-cycle regulatory proteins cyclin D1, phosphorylated Rb (ppRb), total Rb proteins (pRb), E2F1, cyclin E and cyclin A in SGC-7901 and MGC-803 cells transfected with either pLV-ATAD2 shRNA or pLV-control. ( B ) Western blot analysis of the apoptosis-related proteins cleaved-PARP, PARP, cleaved-Caspase 3, Caspase 3 in SGC-7901 and MGC-803 cells transfected with either pLV-ATAD2 shRNA or pLV-control. GAPDH was used as a loading control.

    Article Snippet: The transfection efficiency was monitored by fluorescence microscopy and cells transfected with pLV-ATAD2 shRNA or pLV-control were selected with puromycin (Sigma Aldrich, St Louis, MO, USA) at a concentration of 2 µg/mL for 1 week.

    Techniques: Expressing, Western Blot, Transfection, shRNA

    Lentiviral constructs reduce ABCA1 and ABCG1 protein levels in human THP-1 cells. (A) Monocytes were transduced by lentivirus with shRNA for ABCA1. Protein was isolated after 7 days of puromycin selection (10 μg/ml), and Western blot analysis

    Journal: Journal of Leukocyte Biology

    Article Title: A2A adenosine receptor stimulation decreases foam cell formation by enhancing ABCA1-dependent cholesterol efflux

    doi: 10.1189/jlb.0709513

    Figure Lengend Snippet: Lentiviral constructs reduce ABCA1 and ABCG1 protein levels in human THP-1 cells. (A) Monocytes were transduced by lentivirus with shRNA for ABCA1. Protein was isolated after 7 days of puromycin selection (10 μg/ml), and Western blot analysis

    Article Snippet: THP-1-derived macrophages suspended in medium (1×106 /ml) are treated with hexadimethrine bromide from Sigma Chemical Co. (8 ug/ml, final) and 108 transducing units of lentiviral particles corresponding to human ABCA1 shRNA (SHVRS 10030716MN), ABCG1 shRNA (SHVRS 09060701MN), or scrambled shRNA (SHC002V 05210717MN) with a puromycin selection marker (Sigma Chemical Co.).

    Techniques: Construct, shRNA, Isolation, Selection, Western Blot

    Amylo-α-1, 6-glucosidase, 4-α-glucanotransferase (AGL) expression and tumor growth in vivo . A) Nu/nu mice were injected subcutaneously on both flanks with UMUC3 expressing AGL short-hairpin RNA (shRNA) or the nontarget shRNA. Tumor volume

    Journal: JNCI Journal of the National Cancer Institute

    Article Title: Role in Tumor Growth of a Glycogen Debranching Enzyme Lost in Glycogen Storage Disease

    doi: 10.1093/jnci/dju062

    Figure Lengend Snippet: Amylo-α-1, 6-glucosidase, 4-α-glucanotransferase (AGL) expression and tumor growth in vivo . A) Nu/nu mice were injected subcutaneously on both flanks with UMUC3 expressing AGL short-hairpin RNA (shRNA) or the nontarget shRNA. Tumor volume

    Article Snippet: To evaluate this in cancer cells, we transduced UMUC3 and T24T cancer cells with a different AGL shRNA (TRCN0000035082, Sigma-Aldrich) than the one used in the screening library (TRCN0000035079, Sigma-Aldrich).

    Techniques: Expressing, In Vivo, Mouse Assay, Injection, shRNA

    AKR1C3 inhibition suppressed testosterone level and AR activity in prostate cancer A. C4-2B MDVR cells were transiently transfected with control shRNA or AKR1C3 shRNA (#561, #694) for 2 days. Total RNA was extracted and AKR1C3 mRNA level was examined by qRT-PCR. B. C4-2B MDVR cells were transiently transfected with control shRNA or AKR1C3 shRNA (#561, #694), Total RNA was extracted, PSA and NKX3.1 mRNA levels were examined by qRT-PCR, and the supernatants were collected and subjected to PSA ELISA. C. C4-2B MDVR cells were transiently transfected with control shRNA or AKR1C3 shRNA (#561, #694) with PSA-E/P-luc reporter. The luciferase activity was detected by dual luciferase reporter system (left) and whole cell lysates were subjected to ChIP assay (right). D. C4-2B MDVR cells were transiently transfected with PSA-E/P-luc reporter, followed by treatment with DMSO or 20 μM Indocin for 3 days. Luciferase activity was detected by dual luciferase reporter system (left) and whole cell lysates were subjected to ChIP assay (right). E. C4-2B MDVR (top) and CWR22Rv1 (bottom) cells were treated with DMSO or 20 μM Indocin in serum free, phenol red free RPMI1640 medium for 3 days. Fifty million cells were collected per treatment and testosterone level was examined by LC-MS. * p

    Journal: Molecular cancer therapeutics

    Article Title: Inhibition of AKR1C3 activation overcomes resistance to abiraterone in advanced prostate cancer

    doi: 10.1158/1535-7163.MCT-16-0186

    Figure Lengend Snippet: AKR1C3 inhibition suppressed testosterone level and AR activity in prostate cancer A. C4-2B MDVR cells were transiently transfected with control shRNA or AKR1C3 shRNA (#561, #694) for 2 days. Total RNA was extracted and AKR1C3 mRNA level was examined by qRT-PCR. B. C4-2B MDVR cells were transiently transfected with control shRNA or AKR1C3 shRNA (#561, #694), Total RNA was extracted, PSA and NKX3.1 mRNA levels were examined by qRT-PCR, and the supernatants were collected and subjected to PSA ELISA. C. C4-2B MDVR cells were transiently transfected with control shRNA or AKR1C3 shRNA (#561, #694) with PSA-E/P-luc reporter. The luciferase activity was detected by dual luciferase reporter system (left) and whole cell lysates were subjected to ChIP assay (right). D. C4-2B MDVR cells were transiently transfected with PSA-E/P-luc reporter, followed by treatment with DMSO or 20 μM Indocin for 3 days. Luciferase activity was detected by dual luciferase reporter system (left) and whole cell lysates were subjected to ChIP assay (right). E. C4-2B MDVR (top) and CWR22Rv1 (bottom) cells were treated with DMSO or 20 μM Indocin in serum free, phenol red free RPMI1640 medium for 3 days. Fifty million cells were collected per treatment and testosterone level was examined by LC-MS. * p

    Article Snippet: AKR1C3 shRNA (TRCN0000026561 and TRCN0000025694) were purchased from Sigma.

    Techniques: Inhibition, Activity Assay, Transfection, shRNA, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Luciferase, Chromatin Immunoprecipitation, Liquid Chromatography with Mass Spectroscopy

    Overexpression of AKR1C3 confers resistance to abiraterone A. AKR1C3 is involved in the canonical, 5-diol and backdoor pathways of androgen synthesis and activates AR. B. LNCaP-neo and LNCaP-AKR1C3 cells were treated with different concentrations of abiraterone for 2 days. Total cell numbers were counted and cell survival rate (%) was calculated. Whole cell lysates from LNCaP-neo and LNCaP-AKR1C3 cells were subjected to western blot (Inside panel). C. CWR22Rv1, C4-2B MDVR and VCaP cells were transiently transfected with AKR1C3 shRNA (#561 and #694). Following treatment with 10 μM abiraterone for 3 days, total cell numbers were counted and cell survival rate (%) was calculated. D. CWR22Rv1 cells, C4-2B MDVR and VCaP cells were transiently transfected with AKR1C3 shRNA (#561 and #694) for 3 days, AKR1C3, AR-V7 and AR expression were examined by western blot. * p

    Journal: Molecular cancer therapeutics

    Article Title: Inhibition of AKR1C3 activation overcomes resistance to abiraterone in advanced prostate cancer

    doi: 10.1158/1535-7163.MCT-16-0186

    Figure Lengend Snippet: Overexpression of AKR1C3 confers resistance to abiraterone A. AKR1C3 is involved in the canonical, 5-diol and backdoor pathways of androgen synthesis and activates AR. B. LNCaP-neo and LNCaP-AKR1C3 cells were treated with different concentrations of abiraterone for 2 days. Total cell numbers were counted and cell survival rate (%) was calculated. Whole cell lysates from LNCaP-neo and LNCaP-AKR1C3 cells were subjected to western blot (Inside panel). C. CWR22Rv1, C4-2B MDVR and VCaP cells were transiently transfected with AKR1C3 shRNA (#561 and #694). Following treatment with 10 μM abiraterone for 3 days, total cell numbers were counted and cell survival rate (%) was calculated. D. CWR22Rv1 cells, C4-2B MDVR and VCaP cells were transiently transfected with AKR1C3 shRNA (#561 and #694) for 3 days, AKR1C3, AR-V7 and AR expression were examined by western blot. * p

    Article Snippet: AKR1C3 shRNA (TRCN0000026561 and TRCN0000025694) were purchased from Sigma.

    Techniques: Over Expression, Western Blot, Transfection, shRNA, Expressing

    Abiraterone resistant prostate cancer cells express higher levels of AKR1C3 A. C4-2B parental cells and C4-2B AbiR cells were treated with different concentration of abiraterone acetate in RPMI 1640 media containing 10% FBS, total cell numbers were counted and cell survival rate was calculated on day 3. B. The clonogenic ability of C4-2B parental and C4-2B AbiR cells treated with 2.5 μM, 5 μM or 10 μM abiraterone acetate. The colonies were counted and results are presented as means ± SD of 2 experiments performed in duplicate, C. C4-2B parental cells and C4-2B MDVR cells were cultured in RPMI 1640 media containing 10% FBS for 3 days, total RNA was extracted and AKR1C3, CYP17A1, HSD3B2 and AR mRNA levels were analyzed by qRT-PCR. Whole cell lysates were immunoblotted with the indicated antibodies. D. C4-2B AbiR cells were transiently transfected with AKR1C3 shRNA (#561 and #694). Following treatment with 5 μM abiraterone acetate for 3 days, total cell numbers were counted and cell survival rate (%) was calculated. Knockdown effects were examined by western blot. Abi: Abiraterone. * P

    Journal: Molecular cancer therapeutics

    Article Title: Inhibition of AKR1C3 activation overcomes resistance to abiraterone in advanced prostate cancer

    doi: 10.1158/1535-7163.MCT-16-0186

    Figure Lengend Snippet: Abiraterone resistant prostate cancer cells express higher levels of AKR1C3 A. C4-2B parental cells and C4-2B AbiR cells were treated with different concentration of abiraterone acetate in RPMI 1640 media containing 10% FBS, total cell numbers were counted and cell survival rate was calculated on day 3. B. The clonogenic ability of C4-2B parental and C4-2B AbiR cells treated with 2.5 μM, 5 μM or 10 μM abiraterone acetate. The colonies were counted and results are presented as means ± SD of 2 experiments performed in duplicate, C. C4-2B parental cells and C4-2B MDVR cells were cultured in RPMI 1640 media containing 10% FBS for 3 days, total RNA was extracted and AKR1C3, CYP17A1, HSD3B2 and AR mRNA levels were analyzed by qRT-PCR. Whole cell lysates were immunoblotted with the indicated antibodies. D. C4-2B AbiR cells were transiently transfected with AKR1C3 shRNA (#561 and #694). Following treatment with 5 μM abiraterone acetate for 3 days, total cell numbers were counted and cell survival rate (%) was calculated. Knockdown effects were examined by western blot. Abi: Abiraterone. * P

    Article Snippet: AKR1C3 shRNA (TRCN0000026561 and TRCN0000025694) were purchased from Sigma.

    Techniques: Concentration Assay, Cell Culture, Quantitative RT-PCR, Transfection, shRNA, Western Blot

    ATF5 inhibits autophagy in BCR-ABL–transformed cells. (A) 32D/BCR-ABL or K562 cells treated with either a NS or ATF5 shRNA were monitored for expression of ATF5 and LC3B by immunoblot analysis. β-actin (ACTB) was monitored as a loading

    Journal: Blood

    Article Title: BCR-ABL suppresses autophagy through ATF5-mediated regulation of mTOR transcription

    doi: 10.1182/blood-2010-12-322537

    Figure Lengend Snippet: ATF5 inhibits autophagy in BCR-ABL–transformed cells. (A) 32D/BCR-ABL or K562 cells treated with either a NS or ATF5 shRNA were monitored for expression of ATF5 and LC3B by immunoblot analysis. β-actin (ACTB) was monitored as a loading

    Article Snippet: For bafilomycin A1 staining, K562 cells stably transduced with viruses expressing a NS or ATF5 shRNA were incubated in the medium in the presence or absence of 10nM bafilomycin A1 (Sigma-Aldrich) for 2 hours.

    Techniques: Transformation Assay, shRNA, Expressing

    mTOR , a master negative regulator of autophagy, is an ATF5 target gene. (A) qRT-PCR analysis monitoring expression of 62 autophagy-related genes in 32D/BCR-ABL cells after treatment with an ATF5 siRNA. Expression of Atf5 is shown as a positive control.

    Journal: Blood

    Article Title: BCR-ABL suppresses autophagy through ATF5-mediated regulation of mTOR transcription

    doi: 10.1182/blood-2010-12-322537

    Figure Lengend Snippet: mTOR , a master negative regulator of autophagy, is an ATF5 target gene. (A) qRT-PCR analysis monitoring expression of 62 autophagy-related genes in 32D/BCR-ABL cells after treatment with an ATF5 siRNA. Expression of Atf5 is shown as a positive control.

    Article Snippet: For bafilomycin A1 staining, K562 cells stably transduced with viruses expressing a NS or ATF5 shRNA were incubated in the medium in the presence or absence of 10nM bafilomycin A1 (Sigma-Aldrich) for 2 hours.

    Techniques: Quantitative RT-PCR, Expressing, Positive Control

    ATF5 suppresses cell death in normal but not BCR-ABL–transformed cells. (A) Cell viability analysis in 32D or 32D/BCR-ABL cells stably expressing a nonsilencing (NS) or ATF5 shRNA. Error bars represent SD. For each cell line, values were normalized

    Journal: Blood

    Article Title: BCR-ABL suppresses autophagy through ATF5-mediated regulation of mTOR transcription

    doi: 10.1182/blood-2010-12-322537

    Figure Lengend Snippet: ATF5 suppresses cell death in normal but not BCR-ABL–transformed cells. (A) Cell viability analysis in 32D or 32D/BCR-ABL cells stably expressing a nonsilencing (NS) or ATF5 shRNA. Error bars represent SD. For each cell line, values were normalized

    Article Snippet: For bafilomycin A1 staining, K562 cells stably transduced with viruses expressing a NS or ATF5 shRNA were incubated in the medium in the presence or absence of 10nM bafilomycin A1 (Sigma-Aldrich) for 2 hours.

    Techniques: Transformation Assay, Stable Transfection, Expressing, shRNA

    UVRAG inhibits BAX-induced apoptosis. ( A ) Control shRNA or UVRAG shRNA cells were transfected with BAX plasmid, and apoptosis was assayed ( n =3, * P

    Journal: EMBO Reports

    Article Title: UV irradiation resistance-associated gene suppresses apoptosis by interfering with BAX activation

    doi: 10.1038/embor.2011.79

    Figure Lengend Snippet: UVRAG inhibits BAX-induced apoptosis. ( A ) Control shRNA or UVRAG shRNA cells were transfected with BAX plasmid, and apoptosis was assayed ( n =3, * P

    Article Snippet: Transfection with UVRAG cDNA and mutants ( , ), pEGFP–BAX , pEGFP–BAD , pEGFP–BID ( ) vector and/or UVRAG–shRNA, Beclin 1–shRNA, BAX–shRNA and control shRNA (from Sigma, USA) were performed using the FuGENE HD Transfection Reagent (Roche Applied Science, Stockholm, Sweden) according the manufacturer's instructions.

    Techniques: shRNA, Transfection, Plasmid Preparation

    UVRAG inhibits mitochondrial translocation of BAX. After transfection with indicated shRNA or cDNA for 48 h, HL60 cells were treated with doxorubicin (Doxo) and UV irradiation for 12 h, and then BAX in cytosol (Cyt) and mitochondria (Mit) was assayed by western blotting ( A – C ) and activation of BAX ( D – F ) was assayed by western blotting after IP using BAX monoclonal antibody (clone 6A7) * P

    Journal: EMBO Reports

    Article Title: UV irradiation resistance-associated gene suppresses apoptosis by interfering with BAX activation

    doi: 10.1038/embor.2011.79

    Figure Lengend Snippet: UVRAG inhibits mitochondrial translocation of BAX. After transfection with indicated shRNA or cDNA for 48 h, HL60 cells were treated with doxorubicin (Doxo) and UV irradiation for 12 h, and then BAX in cytosol (Cyt) and mitochondria (Mit) was assayed by western blotting ( A – C ) and activation of BAX ( D – F ) was assayed by western blotting after IP using BAX monoclonal antibody (clone 6A7) * P

    Article Snippet: Transfection with UVRAG cDNA and mutants ( , ), pEGFP–BAX , pEGFP–BAD , pEGFP–BID ( ) vector and/or UVRAG–shRNA, Beclin 1–shRNA, BAX–shRNA and control shRNA (from Sigma, USA) were performed using the FuGENE HD Transfection Reagent (Roche Applied Science, Stockholm, Sweden) according the manufacturer's instructions.

    Techniques: Translocation Assay, Transfection, shRNA, Irradiation, Western Blot, Activation Assay

    Regulation of the MAPK response to pore-formation is MKP1 independent. (A) A549 cells were transfected with 2.5 µg of MKP1 or scrambled siRNA per 1×10 6 cells and stimulated 24 hrs post-transfection with 200 ng/ml of purified Ply for the indicated times. Transfection with MKP1 siRNA inhibited MKP1 expression but did not have an effect on Ply-induced MAPK phosphorylation.

    Journal: PLoS ONE

    Article Title: Phosphatase-Dependent Regulation of Epithelial Mitogen-Activated Protein Kinase Responses to Toxin-Induced Membrane Pores

    doi: 10.1371/journal.pone.0008076

    Figure Lengend Snippet: Regulation of the MAPK response to pore-formation is MKP1 independent. (A) A549 cells were transfected with 2.5 µg of MKP1 or scrambled siRNA per 1×10 6 cells and stimulated 24 hrs post-transfection with 200 ng/ml of purified Ply for the indicated times. Transfection with MKP1 siRNA inhibited MKP1 expression but did not have an effect on Ply-induced MAPK phosphorylation.

    Article Snippet: siRNA and shRNA MKP1 siRNA was from Dharmacon (Lafayette, CO).

    Techniques: Transfection, Purification, Expressing

    PP1 and PP2A mediate inactivation of the epithelial MAPK response to pore-formation. (A)A549 cells were transfected with 2 µg PP1 or scrambled siRNA per 1×10 6 cells and stimulated 54 hrs post-transfection with 100 ng/ml of purified Ply. Transfection with PP1 siRNA leads to reduced PP1 expression and a corresponding increase in Ply-induced p38 and JNK phosphorylation. (B) A549 cells were transfected with 6 µg PP2Aα/β or control shRNA per 1×10 6 cells and stimulated 60 hrs post-transfection with 100 ng/ml of purified Ply. Transfection with PP2Aα/β shRNA leads to reduced PP2A expression and a moderate increase in p38 phosphorylation.

    Journal: PLoS ONE

    Article Title: Phosphatase-Dependent Regulation of Epithelial Mitogen-Activated Protein Kinase Responses to Toxin-Induced Membrane Pores

    doi: 10.1371/journal.pone.0008076

    Figure Lengend Snippet: PP1 and PP2A mediate inactivation of the epithelial MAPK response to pore-formation. (A)A549 cells were transfected with 2 µg PP1 or scrambled siRNA per 1×10 6 cells and stimulated 54 hrs post-transfection with 100 ng/ml of purified Ply. Transfection with PP1 siRNA leads to reduced PP1 expression and a corresponding increase in Ply-induced p38 and JNK phosphorylation. (B) A549 cells were transfected with 6 µg PP2Aα/β or control shRNA per 1×10 6 cells and stimulated 60 hrs post-transfection with 100 ng/ml of purified Ply. Transfection with PP2Aα/β shRNA leads to reduced PP2A expression and a moderate increase in p38 phosphorylation.

    Article Snippet: siRNA and shRNA MKP1 siRNA was from Dharmacon (Lafayette, CO).

    Techniques: Transfection, Purification, Expressing, shRNA

    Accelerated Cell-Cycle Progression in Cks2 −/− MEFs (A) Time-lapse microscopy of asynchronously growing wild-type, Cks2 −/− and Cks1 −/− MEFs. MEFs were immortalized using shRNA against p53. Wild-type MEFs were infected with a retrovirus expressing histone H2B-GFP, Cks2 −/− and Cks1 −/− MEFs expressed histone H2B-mCherry. Wild-type and knockout MEFs were mixed and imaged. The time between two successive anaphases was recorded for at least 50 cells of each genotype; the mean is shown. An example of a wild-type and Cks2 −/− cell is shown. Alternatively, MEFs were immortalized using the 3T3 protocol, and cell cycle duration was measured as the duration from one cytokinesis to the next for at least 50 cells per genotype. (B) FACS analysis of DNA content to generate cell cycle profiles of asynchronously proliferating wild-type, Cks2 −/− and Cks1 −/− MEFs. (C) Quantification of the cell cycle populations by FACS. (D) Experimental design and example of the FACS pattern of wild-type MEFs at time 0, depicting the G1, BrdU-positive and G2 gates. The ratio of BrdU-positive cells with a G1 DNA content (labeled “early S”) over unlabeled G1 cells was followed over a 24 hr chase.

    Journal: Developmental Cell

    Article Title: The CDK Subunit CKS2 Counteracts CKS1 to Control Cyclin A/CDK2 Activity in Maintaining Replicative Fidelity and Neurodevelopment

    doi: 10.1016/j.devcel.2012.06.018

    Figure Lengend Snippet: Accelerated Cell-Cycle Progression in Cks2 −/− MEFs (A) Time-lapse microscopy of asynchronously growing wild-type, Cks2 −/− and Cks1 −/− MEFs. MEFs were immortalized using shRNA against p53. Wild-type MEFs were infected with a retrovirus expressing histone H2B-GFP, Cks2 −/− and Cks1 −/− MEFs expressed histone H2B-mCherry. Wild-type and knockout MEFs were mixed and imaged. The time between two successive anaphases was recorded for at least 50 cells of each genotype; the mean is shown. An example of a wild-type and Cks2 −/− cell is shown. Alternatively, MEFs were immortalized using the 3T3 protocol, and cell cycle duration was measured as the duration from one cytokinesis to the next for at least 50 cells per genotype. (B) FACS analysis of DNA content to generate cell cycle profiles of asynchronously proliferating wild-type, Cks2 −/− and Cks1 −/− MEFs. (C) Quantification of the cell cycle populations by FACS. (D) Experimental design and example of the FACS pattern of wild-type MEFs at time 0, depicting the G1, BrdU-positive and G2 gates. The ratio of BrdU-positive cells with a G1 DNA content (labeled “early S”) over unlabeled G1 cells was followed over a 24 hr chase.

    Article Snippet: siRNA and shRNA siRNA Smart pools were purchased from Dharmacon and transfected using Hyperfect (QIAGEN) following the manufacturer's instructions.

    Techniques: Time-lapse Microscopy, shRNA, Infection, Expressing, Knock-Out, FACS, Labeling

    SDC4 enhances TGF-β1 stimulated cellular restitution, chemotaxis and proliferation. A, Scratched restitution assay. Cells were seeded in 24-well culture plates at 2×10 4 cells/well. Forty-eight hours after transfection with indicated siRNA, a scratch was made using 200-μl micropipette tip. Upper: 0 and 20 h after wounding. Black dotted lines indicate the wound edge. Lower: Percentage (%) change in migration as determined by comparing the difference in wound width ( n =3). Each bar represents means ±SEM; ※, p

    Journal: Biochemistry and Biophysics Reports

    Article Title: Up-regulation of Syndecan-4 contributes to TGF-β1-induced epithelial to mesenchymal transition in lung adenocarcinoma A549 cells

    doi: 10.1016/j.bbrep.2015.11.021

    Figure Lengend Snippet: SDC4 enhances TGF-β1 stimulated cellular restitution, chemotaxis and proliferation. A, Scratched restitution assay. Cells were seeded in 24-well culture plates at 2×10 4 cells/well. Forty-eight hours after transfection with indicated siRNA, a scratch was made using 200-μl micropipette tip. Upper: 0 and 20 h after wounding. Black dotted lines indicate the wound edge. Lower: Percentage (%) change in migration as determined by comparing the difference in wound width ( n =3). Each bar represents means ±SEM; ※, p

    Article Snippet: 2.2 RNA interference Small interfering (si) RNAs for SDC4, Snail, Slug and control scramble siRNA were obtained from Sigma-Aldrich (MISSION® siRNA, St. Louis, MO, USA). siRNAs with the following sense and antisense sequences were used: SDC4, 5′-GUAUCUCCAGCUCUGAUUATT-3′ (sense), 5′-UAAUCAGAGCUGGAGAUACTT-3′ (antisense); SNAIL, 5′-GCCUUCAACUGCAAAUACUTT-3′ (sense), 5′-AGUAUUUGCAGUUGAAGGCTT-3′ (antisense); SLUG, 5′-GCAUUUGCAGACAGGUCAATT-3′ (sense), 5′-UUGACCUGUCUGCAAAUGCTT-3′ (antisense); control scramble, 5′-CAGUGAAAUUUAUCCACAATT-3′ (sense), 5′-UUGUGGAUAAAUUUCACUGTT-3′ (antisense).

    Techniques: Chemotaxis Assay, Transfection, Migration

    SDC4 are required for retaining the inherent β1 and β3 integrin expression pattern. A, α5, β1, and β3 integrin expressions were determined by Western-blot analysis. Forty-eight hours after transfection with indicated siRNA, A549 cells were exposed with or without TGF-β1 (5 ng/ml) for 48 h. GAPDH was used as loading control. B, Schema of simplified signal transduction pathways, regulating E-cadherin expression via SDC4, Snail and Slug, and consequent actin remodeling.

    Journal: Biochemistry and Biophysics Reports

    Article Title: Up-regulation of Syndecan-4 contributes to TGF-β1-induced epithelial to mesenchymal transition in lung adenocarcinoma A549 cells

    doi: 10.1016/j.bbrep.2015.11.021

    Figure Lengend Snippet: SDC4 are required for retaining the inherent β1 and β3 integrin expression pattern. A, α5, β1, and β3 integrin expressions were determined by Western-blot analysis. Forty-eight hours after transfection with indicated siRNA, A549 cells were exposed with or without TGF-β1 (5 ng/ml) for 48 h. GAPDH was used as loading control. B, Schema of simplified signal transduction pathways, regulating E-cadherin expression via SDC4, Snail and Slug, and consequent actin remodeling.

    Article Snippet: 2.2 RNA interference Small interfering (si) RNAs for SDC4, Snail, Slug and control scramble siRNA were obtained from Sigma-Aldrich (MISSION® siRNA, St. Louis, MO, USA). siRNAs with the following sense and antisense sequences were used: SDC4, 5′-GUAUCUCCAGCUCUGAUUATT-3′ (sense), 5′-UAAUCAGAGCUGGAGAUACTT-3′ (antisense); SNAIL, 5′-GCCUUCAACUGCAAAUACUTT-3′ (sense), 5′-AGUAUUUGCAGUUGAAGGCTT-3′ (antisense); SLUG, 5′-GCAUUUGCAGACAGGUCAATT-3′ (sense), 5′-UUGACCUGUCUGCAAAUGCTT-3′ (antisense); control scramble, 5′-CAGUGAAAUUUAUCCACAATT-3′ (sense), 5′-UUGUGGAUAAAUUUCACUGTT-3′ (antisense).

    Techniques: Expressing, Western Blot, Transfection, Transduction

    2.4. Intracisternal injection of Atg7 siRNA improved Purkinje cell survival after asphyxial cardiac arrest

    Journal: Biochimica et biophysica acta

    Article Title: Ischemia-Induced Autophagy Contributes to Neurodegeneration in Cerebellar Purkinje Cells in the Developing Rat Brain and in Primary Cortical Neurons In Vitro

    doi: 10.1016/j.bbadis.2015.06.007

    Figure Lengend Snippet: 2.4. Intracisternal injection of Atg7 siRNA improved Purkinje cell survival after asphyxial cardiac arrest

    Article Snippet: A total of 800 pmol of Atg7 siRNA (5'-GCAUCAUCUUUGAAGUGAA-3'; Sigma, PDSIRNA) or non-targeting control siRNA (Fischer, D-001206-13-20) were combined with 25 μl of jetSI (Polyplus Transfection, 55–126), a commercial cationic polymer transfection reagent, formulated with dioleoylphosphatidyl ethanolamine (DOPE) (Sigma, P1223) for i.c. injection.

    Techniques: Injection

    2.4. Intracisternal injection of Atg7 siRNA improved Purkinje cell survival after asphyxial cardiac arrest

    Journal: Biochimica et biophysica acta

    Article Title: Ischemia-Induced Autophagy Contributes to Neurodegeneration in Cerebellar Purkinje Cells in the Developing Rat Brain and in Primary Cortical Neurons In Vitro

    doi: 10.1016/j.bbadis.2015.06.007

    Figure Lengend Snippet: 2.4. Intracisternal injection of Atg7 siRNA improved Purkinje cell survival after asphyxial cardiac arrest

    Article Snippet: A total of 800 pmol of Atg7 siRNA (5'-GCAUCAUCUUUGAAGUGAA-3'; Sigma, PDSIRNA) or non-targeting control siRNA (Fischer, D-001206-13-20) were combined with 25 μl of jetSI (Polyplus Transfection, 55–126), a commercial cationic polymer transfection reagent, formulated with dioleoylphosphatidyl ethanolamine (DOPE) (Sigma, P1223) for i.c. injection.

    Techniques: Injection

    Reduction in ischemia-induced motor dysfunction using Atg7 siRNA

    Journal: Biochimica et biophysica acta

    Article Title: Ischemia-Induced Autophagy Contributes to Neurodegeneration in Cerebellar Purkinje Cells in the Developing Rat Brain and in Primary Cortical Neurons In Vitro

    doi: 10.1016/j.bbadis.2015.06.007

    Figure Lengend Snippet: Reduction in ischemia-induced motor dysfunction using Atg7 siRNA

    Article Snippet: A total of 800 pmol of Atg7 siRNA (5'-GCAUCAUCUUUGAAGUGAA-3'; Sigma, PDSIRNA) or non-targeting control siRNA (Fischer, D-001206-13-20) were combined with 25 μl of jetSI (Polyplus Transfection, 55–126), a commercial cationic polymer transfection reagent, formulated with dioleoylphosphatidyl ethanolamine (DOPE) (Sigma, P1223) for i.c. injection.

    Techniques:

    Prevention of ischemia-induced autophagy in cerebellum using Atg7 siRNA

    Journal: Biochimica et biophysica acta

    Article Title: Ischemia-Induced Autophagy Contributes to Neurodegeneration in Cerebellar Purkinje Cells in the Developing Rat Brain and in Primary Cortical Neurons In Vitro

    doi: 10.1016/j.bbadis.2015.06.007

    Figure Lengend Snippet: Prevention of ischemia-induced autophagy in cerebellum using Atg7 siRNA

    Article Snippet: A total of 800 pmol of Atg7 siRNA (5'-GCAUCAUCUUUGAAGUGAA-3'; Sigma, PDSIRNA) or non-targeting control siRNA (Fischer, D-001206-13-20) were combined with 25 μl of jetSI (Polyplus Transfection, 55–126), a commercial cationic polymer transfection reagent, formulated with dioleoylphosphatidyl ethanolamine (DOPE) (Sigma, P1223) for i.c. injection.

    Techniques:

    Prevention of ischemia-induced Purkinje neurodegeneration using Atg7 siRNA

    Journal: Biochimica et biophysica acta

    Article Title: Ischemia-Induced Autophagy Contributes to Neurodegeneration in Cerebellar Purkinje Cells in the Developing Rat Brain and in Primary Cortical Neurons In Vitro

    doi: 10.1016/j.bbadis.2015.06.007

    Figure Lengend Snippet: Prevention of ischemia-induced Purkinje neurodegeneration using Atg7 siRNA

    Article Snippet: A total of 800 pmol of Atg7 siRNA (5'-GCAUCAUCUUUGAAGUGAA-3'; Sigma, PDSIRNA) or non-targeting control siRNA (Fischer, D-001206-13-20) were combined with 25 μl of jetSI (Polyplus Transfection, 55–126), a commercial cationic polymer transfection reagent, formulated with dioleoylphosphatidyl ethanolamine (DOPE) (Sigma, P1223) for i.c. injection.

    Techniques:

    Therapeutic effectiveness of ATP11B siRNA plus cisplatin in ovarian cancer models.

    Journal: The Journal of Clinical Investigation

    Article Title: ATP11B mediates platinum resistance in ovarian cancer

    doi: 10.1172/JCI65425

    Figure Lengend Snippet: Therapeutic effectiveness of ATP11B siRNA plus cisplatin in ovarian cancer models.

    Article Snippet: ATP11B -targeted siRNA sequences were designed and purchased from Sigma-Aldrich.

    Techniques:

    Autophagic inhibition in azoxymethane/dextran sodium sulfate (AOM/DSS)-derived mice colon tumors using the CreERT system. a Schematic representation of Atg5 genetic inhibition by tamoxifen (TAM) in AOM/DSS-induced colon tumors. b Representative histopathological images of staining for hematoxylin and eosin (HE) or Atg5 in AOM/DSS-derived colon tumors in Atg5 flox/flox /K19 CreERT+ ( Atg5- deficient) and Atg5 flox/flox (Ctr) mice 7 days after TAM injection. Scale bars, 50 μm. Original magnification, ×200/400. c Representative immunohistochemical images of p62 staining in the non-tumor colon mucosa and AOM/DSS-derived colon tumors in Atg5- deficient mice and Ctr mice. Scale bar, 50 μm. Original magnification, ×200. d Representative immunoblot analysis image of the indicated proteins from AOM/DSS-derived colon tumors in Atg5- deficient mice and Ctr mice (two different mice each). e Body weight, colon length, tumor number, and tumor size were determined in Ctr mice ( n = 9) and Atg5- deficient mice ( n = 11). Data shown are means and SEM. *; p

    Journal: BMC Cancer

    Article Title: Inhibition of autophagy exerts anti-colon cancer effects via apoptosis induced by p53 activation and ER stress

    doi: 10.1186/s12885-015-1789-5

    Figure Lengend Snippet: Autophagic inhibition in azoxymethane/dextran sodium sulfate (AOM/DSS)-derived mice colon tumors using the CreERT system. a Schematic representation of Atg5 genetic inhibition by tamoxifen (TAM) in AOM/DSS-induced colon tumors. b Representative histopathological images of staining for hematoxylin and eosin (HE) or Atg5 in AOM/DSS-derived colon tumors in Atg5 flox/flox /K19 CreERT+ ( Atg5- deficient) and Atg5 flox/flox (Ctr) mice 7 days after TAM injection. Scale bars, 50 μm. Original magnification, ×200/400. c Representative immunohistochemical images of p62 staining in the non-tumor colon mucosa and AOM/DSS-derived colon tumors in Atg5- deficient mice and Ctr mice. Scale bar, 50 μm. Original magnification, ×200. d Representative immunoblot analysis image of the indicated proteins from AOM/DSS-derived colon tumors in Atg5- deficient mice and Ctr mice (two different mice each). e Body weight, colon length, tumor number, and tumor size were determined in Ctr mice ( n = 9) and Atg5- deficient mice ( n = 11). Data shown are means and SEM. *; p

    Article Snippet: RNA interference Small interfering RNAs (siRNAs) targeting Atg5 (MISSION siRNA, Sigma-Aldrich) and BiP (Dharmacon siGENOME SMART pool siRNA, GE Healthcare, Pittsburg, PA, USA) or the non-silencing control (5’-AATTCTCCGAACGTGTCACGT-3’) were transfected into cells using Lipofectamine RNAimax (Invitrogen, Waltham, MA, USA) for 72 h. Immunoblotting was used to verify that the siRNAs reduced cellular protein expression by more than 80 %.

    Techniques: Inhibition, Derivative Assay, Mouse Assay, Staining, Injection, Immunohistochemistry

    Antitumor effects exerted by autophagic inhibition in p53 wild-type colon cancer cells. a Immunoblot analysis of the indicated proteins in HCT116 cells transfected with non-silencing control siRNA (Ctr) or siRNA targeting Atg5 (siAtg5) for 72 h or treated with 100 μM CQ with or without amino acid starvation (HBSS medium, Stv) for 24 h. b Relative expression of the indicated mRNAs extracted from HCT116 cells transfected with non-silencing control siRNA (Ctr) or siRNA targeting Atg5 (siAtg5) for 72 h or treated with 100 μM CQ with or without HBSS medium (for amino acid starvation; positive control, Stv) for 24 h. Data shown are means ± SEM ( n = 3). *; p

    Journal: BMC Cancer

    Article Title: Inhibition of autophagy exerts anti-colon cancer effects via apoptosis induced by p53 activation and ER stress

    doi: 10.1186/s12885-015-1789-5

    Figure Lengend Snippet: Antitumor effects exerted by autophagic inhibition in p53 wild-type colon cancer cells. a Immunoblot analysis of the indicated proteins in HCT116 cells transfected with non-silencing control siRNA (Ctr) or siRNA targeting Atg5 (siAtg5) for 72 h or treated with 100 μM CQ with or without amino acid starvation (HBSS medium, Stv) for 24 h. b Relative expression of the indicated mRNAs extracted from HCT116 cells transfected with non-silencing control siRNA (Ctr) or siRNA targeting Atg5 (siAtg5) for 72 h or treated with 100 μM CQ with or without HBSS medium (for amino acid starvation; positive control, Stv) for 24 h. Data shown are means ± SEM ( n = 3). *; p

    Article Snippet: RNA interference Small interfering RNAs (siRNAs) targeting Atg5 (MISSION siRNA, Sigma-Aldrich) and BiP (Dharmacon siGENOME SMART pool siRNA, GE Healthcare, Pittsburg, PA, USA) or the non-silencing control (5’-AATTCTCCGAACGTGTCACGT-3’) were transfected into cells using Lipofectamine RNAimax (Invitrogen, Waltham, MA, USA) for 72 h. Immunoblotting was used to verify that the siRNAs reduced cellular protein expression by more than 80 %.

    Techniques: Inhibition, Transfection, Expressing, Positive Control

    Atg5 inhibition-induced p53, caspase 3, and UPR activation in colon tumors. a Relative expression of the indicated mRNAs extracted from AOM/DSS-derived tumors in Ctr mice and Atg5- deficient mice 7 days after TAM injection. GAPDH was used as an internal control. Data shown are means ± SEM ( n = 3). *; p

    Journal: BMC Cancer

    Article Title: Inhibition of autophagy exerts anti-colon cancer effects via apoptosis induced by p53 activation and ER stress

    doi: 10.1186/s12885-015-1789-5

    Figure Lengend Snippet: Atg5 inhibition-induced p53, caspase 3, and UPR activation in colon tumors. a Relative expression of the indicated mRNAs extracted from AOM/DSS-derived tumors in Ctr mice and Atg5- deficient mice 7 days after TAM injection. GAPDH was used as an internal control. Data shown are means ± SEM ( n = 3). *; p

    Article Snippet: RNA interference Small interfering RNAs (siRNAs) targeting Atg5 (MISSION siRNA, Sigma-Aldrich) and BiP (Dharmacon siGENOME SMART pool siRNA, GE Healthcare, Pittsburg, PA, USA) or the non-silencing control (5’-AATTCTCCGAACGTGTCACGT-3’) were transfected into cells using Lipofectamine RNAimax (Invitrogen, Waltham, MA, USA) for 72 h. Immunoblotting was used to verify that the siRNAs reduced cellular protein expression by more than 80 %.

    Techniques: Inhibition, Activation Assay, Expressing, Derivative Assay, Mouse Assay, Injection

    CK19 and Atg5 expression in normal colonic mucosa and azoxymethane/dextran sodium sulphate (AOM/DSS)-derived colon tumors. a Representative immunohistochemical images of the small intestine and colon in Atg5 flox/flox /K19 CreERT mice before and 28 days after tamoxifen (TAM) injection. Scale bar, 50 μm. Original magnification, ×200. b Immunofluorescence analysis of the colon in K19 CreERT / ROSA - YFP mice 28 days after TAM injection; YFP (red) and DAPI (blue) fluorescent staining. Original magnification, ×400. c Typical macroscopic examples of colorectal tumors induced by AOM/DSS in K19 CreERT mice before TAM injection. d Typical immunohistochemical images of CK19 and Atg5 staining in AOM/DSS-derived colon tumors in K19 CreERT mice before TAM injection. Scale bar, 50 μm. Original magnification, ×400. e Immunoblot analysis of Atg5 and LC3 expression in AOM/DSS-derived tumor (T) and non-tumor colon mucosa (NT) in the same K19 CreERT mouse before TAM injection. Actin was used as an internal control. The arrow indicates LC3-II

    Journal: BMC Cancer

    Article Title: Inhibition of autophagy exerts anti-colon cancer effects via apoptosis induced by p53 activation and ER stress

    doi: 10.1186/s12885-015-1789-5

    Figure Lengend Snippet: CK19 and Atg5 expression in normal colonic mucosa and azoxymethane/dextran sodium sulphate (AOM/DSS)-derived colon tumors. a Representative immunohistochemical images of the small intestine and colon in Atg5 flox/flox /K19 CreERT mice before and 28 days after tamoxifen (TAM) injection. Scale bar, 50 μm. Original magnification, ×200. b Immunofluorescence analysis of the colon in K19 CreERT / ROSA - YFP mice 28 days after TAM injection; YFP (red) and DAPI (blue) fluorescent staining. Original magnification, ×400. c Typical macroscopic examples of colorectal tumors induced by AOM/DSS in K19 CreERT mice before TAM injection. d Typical immunohistochemical images of CK19 and Atg5 staining in AOM/DSS-derived colon tumors in K19 CreERT mice before TAM injection. Scale bar, 50 μm. Original magnification, ×400. e Immunoblot analysis of Atg5 and LC3 expression in AOM/DSS-derived tumor (T) and non-tumor colon mucosa (NT) in the same K19 CreERT mouse before TAM injection. Actin was used as an internal control. The arrow indicates LC3-II

    Article Snippet: RNA interference Small interfering RNAs (siRNAs) targeting Atg5 (MISSION siRNA, Sigma-Aldrich) and BiP (Dharmacon siGENOME SMART pool siRNA, GE Healthcare, Pittsburg, PA, USA) or the non-silencing control (5’-AATTCTCCGAACGTGTCACGT-3’) were transfected into cells using Lipofectamine RNAimax (Invitrogen, Waltham, MA, USA) for 72 h. Immunoblotting was used to verify that the siRNAs reduced cellular protein expression by more than 80 %.

    Techniques: Expressing, Derivative Assay, Immunohistochemistry, Mouse Assay, Injection, Immunofluorescence, Staining

    Autophagic and UPR inhibition in p53 mutant cells. a Immunoblot analysis of the indicated proteins in HCT116 transfected with non-silencing control siRNA (Ctr) or siRNAs targeting Atg5 (siAtg5) or BiP (siBiP) for 72 h with or without amino acid starvation (HBSS medium, Stv) for 24 h. b The growth curve of HCT116 cells transfected with non-silencing control siRNAs or siRNAs targeting Atg5 or BiP or Atg5 plus BiP (co-transfection), determined using a cell counting kit. c The number of apoptotic HCT116 cells transfected with non-silencing control siRNAs or siRNAs targeting Atg5 or BiP or Atg5 plus BiP (co-transfection), determined using a FACS analyzer. Data shown are means ± SEM ( n = 3). *; p

    Journal: BMC Cancer

    Article Title: Inhibition of autophagy exerts anti-colon cancer effects via apoptosis induced by p53 activation and ER stress

    doi: 10.1186/s12885-015-1789-5

    Figure Lengend Snippet: Autophagic and UPR inhibition in p53 mutant cells. a Immunoblot analysis of the indicated proteins in HCT116 transfected with non-silencing control siRNA (Ctr) or siRNAs targeting Atg5 (siAtg5) or BiP (siBiP) for 72 h with or without amino acid starvation (HBSS medium, Stv) for 24 h. b The growth curve of HCT116 cells transfected with non-silencing control siRNAs or siRNAs targeting Atg5 or BiP or Atg5 plus BiP (co-transfection), determined using a cell counting kit. c The number of apoptotic HCT116 cells transfected with non-silencing control siRNAs or siRNAs targeting Atg5 or BiP or Atg5 plus BiP (co-transfection), determined using a FACS analyzer. Data shown are means ± SEM ( n = 3). *; p

    Article Snippet: RNA interference Small interfering RNAs (siRNAs) targeting Atg5 (MISSION siRNA, Sigma-Aldrich) and BiP (Dharmacon siGENOME SMART pool siRNA, GE Healthcare, Pittsburg, PA, USA) or the non-silencing control (5’-AATTCTCCGAACGTGTCACGT-3’) were transfected into cells using Lipofectamine RNAimax (Invitrogen, Waltham, MA, USA) for 72 h. Immunoblotting was used to verify that the siRNAs reduced cellular protein expression by more than 80 %.

    Techniques: Inhibition, Mutagenesis, Transfection, Cotransfection, Cell Counting, FACS

    PD-L2 knockdown-induced inhibition of autophagy attenuates migration and invasion of osteosarcoma cells. a Representative TEM images depict ultrastructures present during autophagy in KHOS and U2OS cells transfected with PD-L2 shRNA or shNC. Images show autophagic vacuoles (arrows) observed in control cells (the picture in the right is a zoom of the picture in the left). No or few autophagic vacuoles were observed in PD-L2 knockdown cells. b Cells after PD-L2 knockdown exhibited a punctate pattern of LC3-II fluorescence, with reduced LC3-II compared with autophagosomes. KHOS and U2OS cells were incubated with or without CQ. c Expression of LC3, p62, and beclin-1 was evaluated by western blot. KHOS and U2OS cells were incubated in the presence or absence of CQ

    Journal: Cell Death & Disease

    Article Title: Osteosarcoma cell intrinsic PD-L2 signals promote invasion and metastasis via the RhoA-ROCK-LIMK2 and autophagy pathways

    doi: 10.1038/s41419-019-1497-1

    Figure Lengend Snippet: PD-L2 knockdown-induced inhibition of autophagy attenuates migration and invasion of osteosarcoma cells. a Representative TEM images depict ultrastructures present during autophagy in KHOS and U2OS cells transfected with PD-L2 shRNA or shNC. Images show autophagic vacuoles (arrows) observed in control cells (the picture in the right is a zoom of the picture in the left). No or few autophagic vacuoles were observed in PD-L2 knockdown cells. b Cells after PD-L2 knockdown exhibited a punctate pattern of LC3-II fluorescence, with reduced LC3-II compared with autophagosomes. KHOS and U2OS cells were incubated with or without CQ. c Expression of LC3, p62, and beclin-1 was evaluated by western blot. KHOS and U2OS cells were incubated in the presence or absence of CQ

    Article Snippet: Gene knockdown with siRNA/shRNA and overexpression with adenovirus Lentiviruses targeting PD-L2 and BMPR2 were obtained from GenePharma (Suzhou, China).

    Techniques: Inhibition, Migration, Transmission Electron Microscopy, Transfection, shRNA, Fluorescence, Incubation, Expressing, Western Blot

    Autophagy promotes migration and invasion of osteosarcoma cells through targeting the RhoA-ROCK-LIMK2 pathway. ( a ) Three beclin-1 siRNA sequences were used to downregulate beclin-1 in KHOS cells (top). The migration and invasion of osteosarcoma cells after beclin-1 knockdown were analyzed by transwell and wound-healing assays (bottom). ( b and c ) Bioinformatics prediction indicated there may be co-expression between beclin-1 and RhoA, and western blot validated the relationship between them. Beclin-1 knockdown decreased p-LIMK and p-cofilin expressions ( b ) as well as RhoA activation ( c ). d The expression levels of autophagy markers (LC3, p62, Beclin1) in the primary and metastatic osteosarcoma tumors were evaluated by IHC (magnification 200X). All experiments were repeated three times. Data are presented as the mean ± S.D. ***P

    Journal: Cell Death & Disease

    Article Title: Osteosarcoma cell intrinsic PD-L2 signals promote invasion and metastasis via the RhoA-ROCK-LIMK2 and autophagy pathways

    doi: 10.1038/s41419-019-1497-1

    Figure Lengend Snippet: Autophagy promotes migration and invasion of osteosarcoma cells through targeting the RhoA-ROCK-LIMK2 pathway. ( a ) Three beclin-1 siRNA sequences were used to downregulate beclin-1 in KHOS cells (top). The migration and invasion of osteosarcoma cells after beclin-1 knockdown were analyzed by transwell and wound-healing assays (bottom). ( b and c ) Bioinformatics prediction indicated there may be co-expression between beclin-1 and RhoA, and western blot validated the relationship between them. Beclin-1 knockdown decreased p-LIMK and p-cofilin expressions ( b ) as well as RhoA activation ( c ). d The expression levels of autophagy markers (LC3, p62, Beclin1) in the primary and metastatic osteosarcoma tumors were evaluated by IHC (magnification 200X). All experiments were repeated three times. Data are presented as the mean ± S.D. ***P

    Article Snippet: Gene knockdown with siRNA/shRNA and overexpression with adenovirus Lentiviruses targeting PD-L2 and BMPR2 were obtained from GenePharma (Suzhou, China).

    Techniques: Migration, Expressing, Western Blot, Activation Assay, Immunohistochemistry

    hVps34 and PLD1 regulate cell size. (A) HEK293 cells were transduced with lentiviruses expressing shRNAs for raptor, hVps34, or PLD1, puromycin selected, and then subjected to cell size measurement of median forward scatter-height. The result of overnight treatment with 100 nM rapamycin is included as a control. Representative histograms are also shown, with cell counts in arbitrary units. (B) Cells were transfected with wt- or ΔPX-PLD1 together in pCDNA3 (vector), selected with G418 for 3 d, and then subjected to cell size measurement as described in A. A one-sample t test was performed to compare each data with the control. Three independent experiments were performed, and the results of mean ± SD are shown in the graphs. *, P

    Journal: The Journal of Cell Biology

    Article Title: Class III PI-3-kinase activates phospholipase D in an amino acid-sensing mTORC1 pathway

    doi: 10.1083/jcb.201107033

    Figure Lengend Snippet: hVps34 and PLD1 regulate cell size. (A) HEK293 cells were transduced with lentiviruses expressing shRNAs for raptor, hVps34, or PLD1, puromycin selected, and then subjected to cell size measurement of median forward scatter-height. The result of overnight treatment with 100 nM rapamycin is included as a control. Representative histograms are also shown, with cell counts in arbitrary units. (B) Cells were transfected with wt- or ΔPX-PLD1 together in pCDNA3 (vector), selected with G418 for 3 d, and then subjected to cell size measurement as described in A. A one-sample t test was performed to compare each data with the control. Three independent experiments were performed, and the results of mean ± SD are shown in the graphs. *, P

    Article Snippet: The shRNAs for human PLD1 (TRCN0000001011 and TRCN0000010572), mouse PLD1 (TRCN0000076820), and human PLD2 (TRCN0000051149 and TRCN0000051150) were previously reported ( ; ). shRNAs for the following genes were obtained from Sigma-Aldrich based on published information: Rag C (TRCN0000072874), Rag D (TRCN0000059533), and P18 (TRCN0000263628; , ).

    Techniques: Transduction, Expressing, Transfection, Plasmid Preparation

    PLD1 and Rag pathways act in parallel to mediate amino acid activation of mTORC1. (A) HEK293 cells were transduced with lentiviruses expressing shRNAs, selected with puromycin, serum starved, and amino acid (AA) deprived followed by amino acid stimulation for 30 min. Cell lysates were analyzed by Western blotting. scram, scrambled. (B) Cells were treated as in A, and in vivo PLD assays were performed. *, P

    Journal: The Journal of Cell Biology

    Article Title: Class III PI-3-kinase activates phospholipase D in an amino acid-sensing mTORC1 pathway

    doi: 10.1083/jcb.201107033

    Figure Lengend Snippet: PLD1 and Rag pathways act in parallel to mediate amino acid activation of mTORC1. (A) HEK293 cells were transduced with lentiviruses expressing shRNAs, selected with puromycin, serum starved, and amino acid (AA) deprived followed by amino acid stimulation for 30 min. Cell lysates were analyzed by Western blotting. scram, scrambled. (B) Cells were treated as in A, and in vivo PLD assays were performed. *, P

    Article Snippet: The shRNAs for human PLD1 (TRCN0000001011 and TRCN0000010572), mouse PLD1 (TRCN0000076820), and human PLD2 (TRCN0000051149 and TRCN0000051150) were previously reported ( ; ). shRNAs for the following genes were obtained from Sigma-Aldrich based on published information: Rag C (TRCN0000072874), Rag D (TRCN0000059533), and P18 (TRCN0000263628; , ).

    Techniques: Activated Clotting Time Assay, Activation Assay, Transduction, Expressing, Western Blot, In Vivo

    hVps34 is necessary for amino acid activation of PLD1 upstream of mTORC1. HEK293 cells were treated as described below, and in vivo PLD assays and Western analysis of cell lysates were performed in parallel. (A) Serum-starved cells were subjected to amino acid withdrawal for 2 h and were then stimulated with amino acids for 30 min. 10 mM 3-MA and 100 nM rapamycin were added 60 and 30 min before stimulation, respectively, where indicated. (B and C) Cells were transduced with lentiviruses expressing two independent shRNAs against hVps34 and a scrambled (scram) sequence as a negative control, selected with puromycin, serum starved overnight, and amino acid deprived for 2 h followed by 30 min of amino acid (AA) stimulation (B) or insulin (100 nM) stimulation (C). (D) Cells transduced with lentiviruses expressing PLD1-shRNA or scramble control and selected with puromycin were transiently transfected with an Myc-hVps34/V5-hVps15 bicistronic construct or empty vector. The cells were then serum starved overnight and amino acid deprived for 2 h followed by amino acid stimulation for 30 min. Cell lysates were subjected to Western analysis. (E) Cells were transduced with lentiviruses expressing hVps34-shRNA or scramble control, selected with puromycin, serum starved overnight, and then stimulated with 300 µM PA for 30 min. Cell lysates were subjected to Western analysis. (F) Cells were treated as in E but amino acid deprived for 2 h followed by amino acid stimulation, PA (300 µM) stimulation, or both for 30 min. Predicted molecular masses of the proteins are indicated for Western blots. S6K1 migrated on SDS-PAGE as a 70-kD protein. (A–C) All data are mean ± SD or representative blots from three to five independent experiments. A one-sample or paired t test was performed to compare the indicated pairs of data. *, P

    Journal: The Journal of Cell Biology

    Article Title: Class III PI-3-kinase activates phospholipase D in an amino acid-sensing mTORC1 pathway

    doi: 10.1083/jcb.201107033

    Figure Lengend Snippet: hVps34 is necessary for amino acid activation of PLD1 upstream of mTORC1. HEK293 cells were treated as described below, and in vivo PLD assays and Western analysis of cell lysates were performed in parallel. (A) Serum-starved cells were subjected to amino acid withdrawal for 2 h and were then stimulated with amino acids for 30 min. 10 mM 3-MA and 100 nM rapamycin were added 60 and 30 min before stimulation, respectively, where indicated. (B and C) Cells were transduced with lentiviruses expressing two independent shRNAs against hVps34 and a scrambled (scram) sequence as a negative control, selected with puromycin, serum starved overnight, and amino acid deprived for 2 h followed by 30 min of amino acid (AA) stimulation (B) or insulin (100 nM) stimulation (C). (D) Cells transduced with lentiviruses expressing PLD1-shRNA or scramble control and selected with puromycin were transiently transfected with an Myc-hVps34/V5-hVps15 bicistronic construct or empty vector. The cells were then serum starved overnight and amino acid deprived for 2 h followed by amino acid stimulation for 30 min. Cell lysates were subjected to Western analysis. (E) Cells were transduced with lentiviruses expressing hVps34-shRNA or scramble control, selected with puromycin, serum starved overnight, and then stimulated with 300 µM PA for 30 min. Cell lysates were subjected to Western analysis. (F) Cells were treated as in E but amino acid deprived for 2 h followed by amino acid stimulation, PA (300 µM) stimulation, or both for 30 min. Predicted molecular masses of the proteins are indicated for Western blots. S6K1 migrated on SDS-PAGE as a 70-kD protein. (A–C) All data are mean ± SD or representative blots from three to five independent experiments. A one-sample or paired t test was performed to compare the indicated pairs of data. *, P

    Article Snippet: The shRNAs for human PLD1 (TRCN0000001011 and TRCN0000010572), mouse PLD1 (TRCN0000076820), and human PLD2 (TRCN0000051149 and TRCN0000051150) were previously reported ( ; ). shRNAs for the following genes were obtained from Sigma-Aldrich based on published information: Rag C (TRCN0000072874), Rag D (TRCN0000059533), and P18 (TRCN0000263628; , ).

    Techniques: Activation Assay, In Vivo, Western Blot, Transduction, Expressing, Sequencing, Negative Control, shRNA, Transfection, Construct, Plasmid Preparation, SDS Page

    Stat3 is overexpressed and regulates Jab1 levels in NPC cells (A) Whole-cell lysates were prepared from the cells as indicated. β-actin was used as a control for protein loading and integrity. The relative p-Stat3, T-Stat3, and Jab1 intensities for six samples are shown. (B) Ectopic Stat3 increased Jab1 expression in NPC cells. NPC cells were transfected by incubation with the Flag-Stat3 plasmid for 48 hours. The cells were then lysed and subjected to Western blotting for detection of Flag and Jab1 protein levels. (C) Knockdown of Stat3 downregulated endogenous Stat3 levels in NPC cell lines. Lysates were prepared from Stat3 siRNA-infected cells. (D) NPC cells were transfected with increasing [10 pM (+) and 40 pM (++)] doses of Stat3 siRNA for 48 hours, and Stat3 and Jab1 RNA levels were examined via quantitative PCR. (E) NPC cells with stable knockdown of Stat3 were established, and two clones for each cell line were selected for Stat3 and Jab1 detection. (F) NPC cells were exposed to CYT387 at the indicated concentration for 48 ho, and then were detected for p-Stat3 and Jab1 protein expression by western blotting. (G) Progressive deletions of the 5′ region of the Jab1 promoter in luciferase (Luc) constructs were transfected into NP460 and CNE1 cells and subjected to luciferase reporter assays. Promoter activity was higher in CNE1 cells than in NP460 cells. Deletion of the region −472 to −344 containing Stat3 binding site (−446/−423) 30 resulted in a loss of promoter activity in CNE1 cells. (H) ChIP assay was carried out using Stat3 and immunoglobulin G (IgG) antibodies, and the extracted DNA was amplified by real-time PCR. The data are the means with standard deviations for three independent experiments. ** P

    Journal: Oncogene

    Article Title: Stat3 Contributes to Cancer Progression by Regulating Jab1/Csn5 Expression

    doi: 10.1038/onc.2016.271

    Figure Lengend Snippet: Stat3 is overexpressed and regulates Jab1 levels in NPC cells (A) Whole-cell lysates were prepared from the cells as indicated. β-actin was used as a control for protein loading and integrity. The relative p-Stat3, T-Stat3, and Jab1 intensities for six samples are shown. (B) Ectopic Stat3 increased Jab1 expression in NPC cells. NPC cells were transfected by incubation with the Flag-Stat3 plasmid for 48 hours. The cells were then lysed and subjected to Western blotting for detection of Flag and Jab1 protein levels. (C) Knockdown of Stat3 downregulated endogenous Stat3 levels in NPC cell lines. Lysates were prepared from Stat3 siRNA-infected cells. (D) NPC cells were transfected with increasing [10 pM (+) and 40 pM (++)] doses of Stat3 siRNA for 48 hours, and Stat3 and Jab1 RNA levels were examined via quantitative PCR. (E) NPC cells with stable knockdown of Stat3 were established, and two clones for each cell line were selected for Stat3 and Jab1 detection. (F) NPC cells were exposed to CYT387 at the indicated concentration for 48 ho, and then were detected for p-Stat3 and Jab1 protein expression by western blotting. (G) Progressive deletions of the 5′ region of the Jab1 promoter in luciferase (Luc) constructs were transfected into NP460 and CNE1 cells and subjected to luciferase reporter assays. Promoter activity was higher in CNE1 cells than in NP460 cells. Deletion of the region −472 to −344 containing Stat3 binding site (−446/−423) 30 resulted in a loss of promoter activity in CNE1 cells. (H) ChIP assay was carried out using Stat3 and immunoglobulin G (IgG) antibodies, and the extracted DNA was amplified by real-time PCR. The data are the means with standard deviations for three independent experiments. ** P

    Article Snippet: The negative siRNA control gene products and the siRNA targeting human Stat3 were obtained from Dharmacon (Lafayette, CO). shRNA targeting Stat3 was from Open Biosystems.

    Techniques: Expressing, Transfection, Incubation, Plasmid Preparation, Western Blot, Infection, Real-time Polymerase Chain Reaction, Clone Assay, Concentration Assay, Luciferase, Construct, Activity Assay, Binding Assay, Chromatin Immunoprecipitation, Amplification

    Depletion of Stat3 inhibits cell proliferation and invasion in NPC (A) NPC cells were transfected with Stat3 siRNA for 48 hours and C666.1 cells stably infected with Stat3 shRNA (sh-Stat3)- or control shRNA (sh-Cont) carrying lentivirus, and cell growth was determined via an MTT assay. (B) Representative results of colony formation assays with NPC cells treated with control siRNA or 10 pM (+) or 40 pM (++) Stat3 siRNA. The relative numbers of colonies are shown at the right panel. (C) NPC cells transfected with Stat3 siRNA or Jab1 siRNA were exposed to invasion chamber assay. Stat3 and Jab1 mRNA levels were determined by RT-QPCR (Right, top). Matrigel membranes containing invading cells were observed via optical microscopy (Left), and the cells were counted (Right, bottom). The number of invading cells from each cell population was quantified. Cont-si, Control siRNA; Jab1-si, Jab1 siRNA. The data are means with standard deviations for three independent experiments. ** P

    Journal: Oncogene

    Article Title: Stat3 Contributes to Cancer Progression by Regulating Jab1/Csn5 Expression

    doi: 10.1038/onc.2016.271

    Figure Lengend Snippet: Depletion of Stat3 inhibits cell proliferation and invasion in NPC (A) NPC cells were transfected with Stat3 siRNA for 48 hours and C666.1 cells stably infected with Stat3 shRNA (sh-Stat3)- or control shRNA (sh-Cont) carrying lentivirus, and cell growth was determined via an MTT assay. (B) Representative results of colony formation assays with NPC cells treated with control siRNA or 10 pM (+) or 40 pM (++) Stat3 siRNA. The relative numbers of colonies are shown at the right panel. (C) NPC cells transfected with Stat3 siRNA or Jab1 siRNA were exposed to invasion chamber assay. Stat3 and Jab1 mRNA levels were determined by RT-QPCR (Right, top). Matrigel membranes containing invading cells were observed via optical microscopy (Left), and the cells were counted (Right, bottom). The number of invading cells from each cell population was quantified. Cont-si, Control siRNA; Jab1-si, Jab1 siRNA. The data are means with standard deviations for three independent experiments. ** P

    Article Snippet: The negative siRNA control gene products and the siRNA targeting human Stat3 were obtained from Dharmacon (Lafayette, CO). shRNA targeting Stat3 was from Open Biosystems.

    Techniques: Transfection, Stable Transfection, Infection, shRNA, MTT Assay, Invasion Chamber Assay, Quantitative RT-PCR, Microscopy

    Effect of Stat3 depletion on NPC cells’ sensitivity to cisplatin (A–D) Stat3 expression levels and cisplatin (CP) responses of CNE2 and HONE1 cells transiently transfected with Stat3 siRNA (Stat3-si) or scrambled control siRNA (Cont-si) and of C666.1 cells stably infected with Stat3 shRNA (sh-Stat3)- or control shRNA (sh-Cont)-carrying lentivirus as determined by MTT assay (A), colony formation assay (B), annexin-V/PI staining (C), and PARP cleavage in CNE2 cells (D). (E, F) CNE2 cells stably expressing sh-Stat3 were transfected with pcDNA or Myc-Jab1 plasmid DNA. (E) Western blot analyses demonstrated the effective knockdown and ectopic expression. (F) Colonies were stained with crystal violet 10 days after CP exposure. The data are means with standard deviations for three independent experiments. ** P

    Journal: Oncogene

    Article Title: Stat3 Contributes to Cancer Progression by Regulating Jab1/Csn5 Expression

    doi: 10.1038/onc.2016.271

    Figure Lengend Snippet: Effect of Stat3 depletion on NPC cells’ sensitivity to cisplatin (A–D) Stat3 expression levels and cisplatin (CP) responses of CNE2 and HONE1 cells transiently transfected with Stat3 siRNA (Stat3-si) or scrambled control siRNA (Cont-si) and of C666.1 cells stably infected with Stat3 shRNA (sh-Stat3)- or control shRNA (sh-Cont)-carrying lentivirus as determined by MTT assay (A), colony formation assay (B), annexin-V/PI staining (C), and PARP cleavage in CNE2 cells (D). (E, F) CNE2 cells stably expressing sh-Stat3 were transfected with pcDNA or Myc-Jab1 plasmid DNA. (E) Western blot analyses demonstrated the effective knockdown and ectopic expression. (F) Colonies were stained with crystal violet 10 days after CP exposure. The data are means with standard deviations for three independent experiments. ** P

    Article Snippet: The negative siRNA control gene products and the siRNA targeting human Stat3 were obtained from Dharmacon (Lafayette, CO). shRNA targeting Stat3 was from Open Biosystems.

    Techniques: Expressing, Transfection, Stable Transfection, Infection, shRNA, MTT Assay, Colony Assay, Staining, Plasmid Preparation, Western Blot

    BSTA is essential for adipocyte differentiation. ( A ) 3T3 L1 preadipocytes treated as indicated were immunoblotted for BSTA and extracellular signal–regulated kinase (ERK). Total RNA from a second set of cells was used for qPCR analysis of bsta expression (graph), and averages and SDs obtained from three independent experiments are shown. ( B ) 3T3 L1 preadipocytes electroporated with scrambled (scr) or BSTA siRNA were differentiated with insulin/IBMX/dexamethasone (Dex) and stained with oil Red O. Scale bar, 100 μm. n = 5 experiments. ( C ) Primary human preadipocytes were electroporated with siRNA, induced to differentiate, and either immunoblotted to determine the phosphorylation status of Akt at Ser 473 (right) or differentiated further and stained. Scale bar, 100 μm. n = 2 experiments. ( D and E ) 3T3 L1 cells expressing a control vector (pMX) or human bsta (pMX-BSTA) were electroporated with siRNA and either immunoblotted with the indicated antibodies (D) or differentiated further (E). Endogenous murine BSTA is less mobile than exogenous (human) protein. Densitometric data ( n = 3 experiments) showing pAkt/Akt ratios (means ± SD; * P

    Journal: Science signaling

    Article Title: BSTA Promotes mTORC2-Mediated Phosphorylation of Akt1 to Suppress Expression of FoxC2 and Stimulate Adipocyte Differentiation

    doi: 10.1126/scisignal.2003295

    Figure Lengend Snippet: BSTA is essential for adipocyte differentiation. ( A ) 3T3 L1 preadipocytes treated as indicated were immunoblotted for BSTA and extracellular signal–regulated kinase (ERK). Total RNA from a second set of cells was used for qPCR analysis of bsta expression (graph), and averages and SDs obtained from three independent experiments are shown. ( B ) 3T3 L1 preadipocytes electroporated with scrambled (scr) or BSTA siRNA were differentiated with insulin/IBMX/dexamethasone (Dex) and stained with oil Red O. Scale bar, 100 μm. n = 5 experiments. ( C ) Primary human preadipocytes were electroporated with siRNA, induced to differentiate, and either immunoblotted to determine the phosphorylation status of Akt at Ser 473 (right) or differentiated further and stained. Scale bar, 100 μm. n = 2 experiments. ( D and E ) 3T3 L1 cells expressing a control vector (pMX) or human bsta (pMX-BSTA) were electroporated with siRNA and either immunoblotted with the indicated antibodies (D) or differentiated further (E). Endogenous murine BSTA is less mobile than exogenous (human) protein. Densitometric data ( n = 3 experiments) showing pAkt/Akt ratios (means ± SD; * P

    Article Snippet: Other control nontargeting siRNAs (Ambion) and scrambled and FoxC2 short hairpin RNA (shRNA) (Open Biosystems) were purchased.

    Techniques: Real-time Polymerase Chain Reaction, Expressing, Staining, Plasmid Preparation

    Preferred production of piRNAs from 3' UTRs. (A) Normalized piRNA read density amongst the transcript features of 5’ UTRs, CDS and 3’ UTRs in genes with > 50 piRNAs from OSS cells. Values greater than 1 indicate enrichment of piRNAs, values less than 1 indicate a depletion (see Methods). The box plot on the left shows the distribution of read density values amongst the group of genes with > 50 piRNAs, and a breakdown of genes enriched in certain features. The 3’ UTR feature contains the majority of genes and the greatest overall enrichment values. The bar graph on the right shows the enrichment of piRNAs in the 3’ UTR of tj and brat . 5’ UTRs, CDS and 3’ UTRs features are represented by blue, dark grey, and red colors, respectively. (B,C) Example of 3' UTR-directed piRNA production from the traffic jam and brat transcripts. (D) Comparison of proportions of 3’ UTR piRNAs in small RNA libraries from heterozygous and homozygous Drosophila mutants. 3’ UTR levels in homozygotes were normalized to the levels in the corresponding heterozygotes. (E) Normalized 3' UTR piRNA reads per million in wild type and Piwi-class mutants. piwi heterozygous ovaries exhibit substantially lower 3' UTR piRNAs than to aub or AGO3 heterozygotes.

    Journal: Current biology : CB

    Article Title: A broadly conserved pathway generates 3' UTR-directed primary piRNAs

    doi: 10.1016/j.cub.2009.11.064

    Figure Lengend Snippet: Preferred production of piRNAs from 3' UTRs. (A) Normalized piRNA read density amongst the transcript features of 5’ UTRs, CDS and 3’ UTRs in genes with > 50 piRNAs from OSS cells. Values greater than 1 indicate enrichment of piRNAs, values less than 1 indicate a depletion (see Methods). The box plot on the left shows the distribution of read density values amongst the group of genes with > 50 piRNAs, and a breakdown of genes enriched in certain features. The 3’ UTR feature contains the majority of genes and the greatest overall enrichment values. The bar graph on the right shows the enrichment of piRNAs in the 3’ UTR of tj and brat . 5’ UTRs, CDS and 3’ UTRs features are represented by blue, dark grey, and red colors, respectively. (B,C) Example of 3' UTR-directed piRNA production from the traffic jam and brat transcripts. (D) Comparison of proportions of 3’ UTR piRNAs in small RNA libraries from heterozygous and homozygous Drosophila mutants. 3’ UTR levels in homozygotes were normalized to the levels in the corresponding heterozygotes. (E) Normalized 3' UTR piRNA reads per million in wild type and Piwi-class mutants. piwi heterozygous ovaries exhibit substantially lower 3' UTR piRNAs than to aub or AGO3 heterozygotes.

    Article Snippet: We next assayed the relationship of piRNA-producing transcripts with Affymetrix gene expression data from OSS cells (this study) and murine testis [ ].

    Techniques:

    Mammalian 3' UTR-directed piRNAs and representative directed transcripts. (A) Size distribution of reads sequenced from total small RNAs (top graph), a MIWI IP (middle graph), and a MILI IP (bottom graph) from adult mouse testes extract. Dotted boxes highlight congruent peaks between the graphs. (B) Normalized piRNA read density amongst the transcript features of 5' UTR, CDS, and 3' UTR in coding genes with > 50 piRNAs from mouse 10dpp and adult testes. Values greater than 1 indicate enrichment of piRNAs; values less than 1 indicate a depletion (see Methods); and 5’ UTR, CDS and 3’ UTR features are represented by blue, dark grey, and red colors, respectively. The box plot on the left shows the distribution of read density values amongst the group of coding genes with > 50 piRNAs, and a breakdown of genes enriched in certain features. In line with OSS cell genic piRNAs, the 3’ UTR feature contains the majority of genes and the greatest overall enrichment values. The bar graph on the right shows the enrichment of piRNAs in the 3’ UTR of ELK4 and ABL2 . Hundreds of murine transcripts, such as ELK4 ). Repeats track indicates that 3' UTRs are strongly depleted in transposon/repetitive sequences.

    Journal: Current biology : CB

    Article Title: A broadly conserved pathway generates 3' UTR-directed primary piRNAs

    doi: 10.1016/j.cub.2009.11.064

    Figure Lengend Snippet: Mammalian 3' UTR-directed piRNAs and representative directed transcripts. (A) Size distribution of reads sequenced from total small RNAs (top graph), a MIWI IP (middle graph), and a MILI IP (bottom graph) from adult mouse testes extract. Dotted boxes highlight congruent peaks between the graphs. (B) Normalized piRNA read density amongst the transcript features of 5' UTR, CDS, and 3' UTR in coding genes with > 50 piRNAs from mouse 10dpp and adult testes. Values greater than 1 indicate enrichment of piRNAs; values less than 1 indicate a depletion (see Methods); and 5’ UTR, CDS and 3’ UTR features are represented by blue, dark grey, and red colors, respectively. The box plot on the left shows the distribution of read density values amongst the group of coding genes with > 50 piRNAs, and a breakdown of genes enriched in certain features. In line with OSS cell genic piRNAs, the 3’ UTR feature contains the majority of genes and the greatest overall enrichment values. The bar graph on the right shows the enrichment of piRNAs in the 3’ UTR of ELK4 and ABL2 . Hundreds of murine transcripts, such as ELK4 ). Repeats track indicates that 3' UTRs are strongly depleted in transposon/repetitive sequences.

    Article Snippet: We next assayed the relationship of piRNA-producing transcripts with Affymetrix gene expression data from OSS cells (this study) and murine testis [ ].

    Techniques:

    Tumorigenicity of high salt passaged breast cancer cells following shRNA knock down of Orai1 expression ( A ) Temporal changes in the tumor volume following injection of 5 × 10 5 MCF-7 and MCF-7s cells into Nu/J ( n = 6) mice. ( B – E ) The mRNA expression of Orai (B), STIM1 (C), P-glycoprotein (D) and SIK3 (E). Data were represented as mean ± SEM, n = 6 per cohort, p

    Journal: Oncotarget

    Article Title: High salt induces P-glycoprotein mediated treatment resistance in breast cancer cells through store operated calcium influx

    doi: 10.18632/oncotarget.25391

    Figure Lengend Snippet: Tumorigenicity of high salt passaged breast cancer cells following shRNA knock down of Orai1 expression ( A ) Temporal changes in the tumor volume following injection of 5 × 10 5 MCF-7 and MCF-7s cells into Nu/J ( n = 6) mice. ( B – E ) The mRNA expression of Orai (B), STIM1 (C), P-glycoprotein (D) and SIK3 (E). Data were represented as mean ± SEM, n = 6 per cohort, p

    Article Snippet: For murine injections cells were transfected by the following shRNA: Orai shRNA (sc-76001-SH, Santa Cruz Biotech), and SIK3 shRNA (sc-97056-SH, Santa Cruz Biotech).

    Techniques: shRNA, Expressing, Injection, Mouse Assay

    ( A ) Fluo-3 Ca 2+ measurement following siRNA knock down of SIK3 in MCF-7 cells. Westernblot analysis to demonstrate SIK3-siRNA knock down efficiency (H/s refers to high salt). ( B ) Impact of high salt treatment plus SIK3 knock down on intracellular Rhodamine-123 accumulation. ( C ) Tumorigenicity of high salt passaged breast cancer cells following shRNA knock down of SIK3 expression. Temporal changes in the tumor volume following injection of 5 × 10 5 MCF-7 and MCF-7s cells into Nu/J ( n = 6) mice. ( D–G ) The mRNA expression of Orai (D), STIM1 (E), P-glycoprotein (F) and SIK3 (G). Data were represented as mean ± SEM, n = 6 per cohort, p

    Journal: Oncotarget

    Article Title: High salt induces P-glycoprotein mediated treatment resistance in breast cancer cells through store operated calcium influx

    doi: 10.18632/oncotarget.25391

    Figure Lengend Snippet: ( A ) Fluo-3 Ca 2+ measurement following siRNA knock down of SIK3 in MCF-7 cells. Westernblot analysis to demonstrate SIK3-siRNA knock down efficiency (H/s refers to high salt). ( B ) Impact of high salt treatment plus SIK3 knock down on intracellular Rhodamine-123 accumulation. ( C ) Tumorigenicity of high salt passaged breast cancer cells following shRNA knock down of SIK3 expression. Temporal changes in the tumor volume following injection of 5 × 10 5 MCF-7 and MCF-7s cells into Nu/J ( n = 6) mice. ( D–G ) The mRNA expression of Orai (D), STIM1 (E), P-glycoprotein (F) and SIK3 (G). Data were represented as mean ± SEM, n = 6 per cohort, p

    Article Snippet: For murine injections cells were transfected by the following shRNA: Orai shRNA (sc-76001-SH, Santa Cruz Biotech), and SIK3 shRNA (sc-97056-SH, Santa Cruz Biotech).

    Techniques: shRNA, Expressing, Injection, Mouse Assay