sgrna Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs sgrna
    Distribution of the most frequent alleles identified with CRISPResso around cleavage sites in B. rapa. Sequences were obtained after transfection with 60 μg <t>Cas9</t> preassembled with 60 μg of <t>sgRNA-FRI1,</t> sgRNA-FRI4, sgRNA-PDS1, or sgRNA-PDS2. The horizontal line indicates the PAM region, the vertical dashed line indicates the predicted cleavage site. Mutations are shown in bold font (substitutions), highlighted with red rectangles (insertions), or marked with horizontal dashed lines (deletions).
    Sgrna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1064 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna/product/New England Biolabs
    Average 95 stars, based on 1064 article reviews
    Price from $9.99 to $1999.99
    sgrna - by Bioz Stars, 2020-07
    95/100 stars
      Buy from Supplier

    92
    Addgene inc sgrna
    Establishment and validation of tagged exocyst subunit cell lines. a Schematic showing a region of subunit gene targeted by <t>sgRNA</t> and tags to be inserted C-terminally, in-frame with the coding region. b Strategy to isolate <t>CRISPR/Cas9-mediated</t> sfGFP-tagged clones of exocyst subunits in NMuMG cells. c Western blots with subunit specific antibodies show successful incorporation of sfGFP in both alleles (EXO70, SEC5, and SEC8), or in one allele (SEC3 and SEC6). A shRNA specific to SEC3 was used to confirm the identity of multiple bands in the blot. d Confocal images of live wild-type NMuMG cells and endogenously tagged SEC3-GFP, SEC5-GFP, SEC6-GFP, SEC8-GFP, and EXO70-GFP cell lines. Scale bar = 10 μm. e Protein–protein interaction heat map for endogenous SEC3-GFP, SEC5-GFP, and EXO70-GFP pulldown using GFP-Trap nanobodies and MS. Yellow indicates baits, blue the protein identified with high confidence, and gray denotes preys that were not identified. The experiments were repeated three times for EXO70-GFP and twice for SEC3-GFP and SEC5-GFP. All experiments were also partially confirmed by IP–WB in at least three independent experiments, with similar results. f Western blot analysis to assess the relative abundance of exocyst subunits fused to sfGFP, using anti-GFP antibodies (SEC3 and SEC6 quantifications corrected for heterozygosity). GAPDH was the loading control. Y axis shows the ratio of GFP/GAPDH. Quantification shows pooled data from three experiments
    Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 2309 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna/product/Addgene inc
    Average 92 stars, based on 2309 article reviews
    Price from $9.99 to $1999.99
    sgrna - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    90
    GenScript sgrnas
    Establishment and validation of tagged exocyst subunit cell lines. a Schematic showing a region of subunit gene targeted by <t>sgRNA</t> and tags to be inserted C-terminally, in-frame with the coding region. b Strategy to isolate <t>CRISPR/Cas9-mediated</t> sfGFP-tagged clones of exocyst subunits in NMuMG cells. c Western blots with subunit specific antibodies show successful incorporation of sfGFP in both alleles (EXO70, SEC5, and SEC8), or in one allele (SEC3 and SEC6). A shRNA specific to SEC3 was used to confirm the identity of multiple bands in the blot. d Confocal images of live wild-type NMuMG cells and endogenously tagged SEC3-GFP, SEC5-GFP, SEC6-GFP, SEC8-GFP, and EXO70-GFP cell lines. Scale bar = 10 μm. e Protein–protein interaction heat map for endogenous SEC3-GFP, SEC5-GFP, and EXO70-GFP pulldown using GFP-Trap nanobodies and MS. Yellow indicates baits, blue the protein identified with high confidence, and gray denotes preys that were not identified. The experiments were repeated three times for EXO70-GFP and twice for SEC3-GFP and SEC5-GFP. All experiments were also partially confirmed by IP–WB in at least three independent experiments, with similar results. f Western blot analysis to assess the relative abundance of exocyst subunits fused to sfGFP, using anti-GFP antibodies (SEC3 and SEC6 quantifications corrected for heterozygosity). GAPDH was the loading control. Y axis shows the ratio of GFP/GAPDH. Quantification shows pooled data from three experiments
    Sgrnas, supplied by GenScript, used in various techniques. Bioz Stars score: 90/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrnas/product/GenScript
    Average 90 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    sgrnas - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    90
    Horizon Discovery sgrna
    Establishment and validation of tagged exocyst subunit cell lines. a Schematic showing a region of subunit gene targeted by <t>sgRNA</t> and tags to be inserted C-terminally, in-frame with the coding region. b Strategy to isolate <t>CRISPR/Cas9-mediated</t> sfGFP-tagged clones of exocyst subunits in NMuMG cells. c Western blots with subunit specific antibodies show successful incorporation of sfGFP in both alleles (EXO70, SEC5, and SEC8), or in one allele (SEC3 and SEC6). A shRNA specific to SEC3 was used to confirm the identity of multiple bands in the blot. d Confocal images of live wild-type NMuMG cells and endogenously tagged SEC3-GFP, SEC5-GFP, SEC6-GFP, SEC8-GFP, and EXO70-GFP cell lines. Scale bar = 10 μm. e Protein–protein interaction heat map for endogenous SEC3-GFP, SEC5-GFP, and EXO70-GFP pulldown using GFP-Trap nanobodies and MS. Yellow indicates baits, blue the protein identified with high confidence, and gray denotes preys that were not identified. The experiments were repeated three times for EXO70-GFP and twice for SEC3-GFP and SEC5-GFP. All experiments were also partially confirmed by IP–WB in at least three independent experiments, with similar results. f Western blot analysis to assess the relative abundance of exocyst subunits fused to sfGFP, using anti-GFP antibodies (SEC3 and SEC6 quantifications corrected for heterozygosity). GAPDH was the loading control. Y axis shows the ratio of GFP/GAPDH. Quantification shows pooled data from three experiments
    Sgrna, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 90/100, based on 54 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna/product/Horizon Discovery
    Average 90 stars, based on 54 article reviews
    Price from $9.99 to $1999.99
    sgrna - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    90
    TaKaRa sgrna
    CRISPR-Cas9 system mediates EDAR gene targeting in GFbs. (a) Schematic representation of sgRNAs targeting exon 6 of the EDAR gene. The red letters represent the target sequence of each <t>sgRNA.</t> The blue letters indicate the PAM sequence. (b) Surveyor nuclease mutation-detection assay. Lanes 1 and 2: PCR products of the GFbs transfected with sgRNA1 + Cas9 or sgRNA2 + Cas9 plasmids, following treatment with Surveyor nuclease. Lanes 3 and 4: positive experimental group and negative experimental control group, respectively. M lane: 200-bp <t>DNA</t> Ladder Marker. (C) Cell line positive for a targeted EDAR gene mutation. (d) Nine different types of mutations occurred in the cell lines with EDAR gene mutations. The dotted line in the diagram represents the missing base fragment. The red box represents the inserted fragment. The red line at the top indicates the position of the sgRNA. WT, wild type
    Sgrna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 219 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna/product/TaKaRa
    Average 90 stars, based on 219 article reviews
    Price from $9.99 to $1999.99
    sgrna - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    93
    Axolabs sgrnas
    CRISPR-Cas9 system mediates EDAR gene targeting in GFbs. (a) Schematic representation of sgRNAs targeting exon 6 of the EDAR gene. The red letters represent the target sequence of each <t>sgRNA.</t> The blue letters indicate the PAM sequence. (b) Surveyor nuclease mutation-detection assay. Lanes 1 and 2: PCR products of the GFbs transfected with sgRNA1 + Cas9 or sgRNA2 + Cas9 plasmids, following treatment with Surveyor nuclease. Lanes 3 and 4: positive experimental group and negative experimental control group, respectively. M lane: 200-bp <t>DNA</t> Ladder Marker. (C) Cell line positive for a targeted EDAR gene mutation. (d) Nine different types of mutations occurred in the cell lines with EDAR gene mutations. The dotted line in the diagram represents the missing base fragment. The red box represents the inserted fragment. The red line at the top indicates the position of the sgRNA. WT, wild type
    Sgrnas, supplied by Axolabs, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrnas/product/Axolabs
    Average 93 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    sgrnas - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    93
    Synthego sgrnas
    Indel spectrum generated by <t>SpyCas9</t> editing at the HPS1 locus HPS1 B-LCL cells. Indel spectrum of SpyCas9 nuclease cells treated with different <t>sgRNAs</t> determined by UMI-based Illumina deep sequencing. a) Target site 1 b) Target site 2 c) Target site 3 d) Target site 4 e) Target site 5 f) Target site 6. Red bar indicates the 16 bp deletion that corresponds to the deletion of one of the microduplication repeats. Data depicts indel spectrum from one representative biological replicate out of a total three independent biological replicates.
    Sgrnas, supplied by Synthego, used in various techniques. Bioz Stars score: 93/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrnas/product/Synthego
    Average 93 stars, based on 94 article reviews
    Price from $9.99 to $1999.99
    sgrnas - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    91
    ABM Inc sgrna
    Indel spectrum generated by <t>SpyCas9</t> editing at the HPS1 locus HPS1 B-LCL cells. Indel spectrum of SpyCas9 nuclease cells treated with different <t>sgRNAs</t> determined by UMI-based Illumina deep sequencing. a) Target site 1 b) Target site 2 c) Target site 3 d) Target site 4 e) Target site 5 f) Target site 6. Red bar indicates the 16 bp deletion that corresponds to the deletion of one of the microduplication repeats. Data depicts indel spectrum from one representative biological replicate out of a total three independent biological replicates.
    Sgrna, supplied by ABM Inc, used in various techniques. Bioz Stars score: 91/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna/product/ABM Inc
    Average 91 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    sgrna - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    92
    Millipore sgrna
    Indel spectrum generated by <t>SpyCas9</t> editing at the HPS1 locus HPS1 B-LCL cells. Indel spectrum of SpyCas9 nuclease cells treated with different <t>sgRNAs</t> determined by UMI-based Illumina deep sequencing. a) Target site 1 b) Target site 2 c) Target site 3 d) Target site 4 e) Target site 5 f) Target site 6. Red bar indicates the 16 bp deletion that corresponds to the deletion of one of the microduplication repeats. Data depicts indel spectrum from one representative biological replicate out of a total three independent biological replicates.
    Sgrna, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 358 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna/product/Millipore
    Average 92 stars, based on 358 article reviews
    Price from $9.99 to $1999.99
    sgrna - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    91
    Addgene inc sgrna a
    Indel spectrum generated by <t>SpyCas9</t> editing at the HPS1 locus HPS1 B-LCL cells. Indel spectrum of SpyCas9 nuclease cells treated with different <t>sgRNAs</t> determined by UMI-based Illumina deep sequencing. a) Target site 1 b) Target site 2 c) Target site 3 d) Target site 4 e) Target site 5 f) Target site 6. Red bar indicates the 16 bp deletion that corresponds to the deletion of one of the microduplication repeats. Data depicts indel spectrum from one representative biological replicate out of a total three independent biological replicates.
    Sgrna A, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna a/product/Addgene inc
    Average 91 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    sgrna a - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    93
    Genechem sgrna
    Indel spectrum generated by <t>SpyCas9</t> editing at the HPS1 locus HPS1 B-LCL cells. Indel spectrum of SpyCas9 nuclease cells treated with different <t>sgRNAs</t> determined by UMI-based Illumina deep sequencing. a) Target site 1 b) Target site 2 c) Target site 3 d) Target site 4 e) Target site 5 f) Target site 6. Red bar indicates the 16 bp deletion that corresponds to the deletion of one of the microduplication repeats. Data depicts indel spectrum from one representative biological replicate out of a total three independent biological replicates.
    Sgrna, supplied by Genechem, used in various techniques. Bioz Stars score: 93/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna/product/Genechem
    Average 93 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    sgrna - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    88
    Addgene inc cas9 sgrna
    Effects of AFF1 and AFF4 depletion of expression on HIV transcription in the presence or absence of Tat. Jurkat-LTR-luciferase cells (J-LTR-Luc) that stably express an integrated luciferase reporter gene under the control of the HIV promoter, were depleted of AFF1, AFF4, or cyclin T1 expression, using lentivirus driving the expressing of <t>Cas9</t> and the corresponding <t>sgRNA.</t> Depletion of both AFF1 and AFF4 expression was obtained by transducing puromycin-resistant AFF4 KO cells with AFF1-Cas9/sgRNA that harbors Blastocydin. Depletion of protein expression was confirmed by western blot using specific endogenous antibodies (panel B). Lentiviruses expressing Cas9 and the empty sgRNA (pHKO23) were used to generate a control cell with no sgRNA. HIV gene transcription in the presence or absence of Tat was monitored in J-LTR-Luc wild type and KO cells. Tat was introduced to cells with lentiviruses that code for Tat-BFP (Blue Fluorescent Protein). Luciferase levels were monitored 24 hours post infection and data are presented relatively to Luc readouts in J-LTR-Luc cells infected with pHKO23 lentivirus and set to 1. Luciferase readings are a representative of three independent experiments. Error bars represent standard deviation. (C) Depletion of AFF1 and AFF4 expression does not affect gene activation from PGK or EF1α promotors. Jurkat cells, where AFF1; AFF4; or AFF1/4 expression is KO were transduced with lentivirus expressing either the PGK-luciferase or the EF1α-DsRed reporter promoters. Cells were harvested 48 hour post transduction and subjected to luciferase analysis in the case of PGK-luciferase, or FACS, when EF1α-DsRed reporter was used. Data is presented relative to control cells that express only-pHKO23-CAs9—with no sgRNA and a representative of three independent experiments where error bars represent standard deviation.
    Cas9 Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 43 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9 sgrna/product/Addgene inc
    Average 88 stars, based on 43 article reviews
    Price from $9.99 to $1999.99
    cas9 sgrna - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    92
    Addgene inc plenti sgrna
    Effects of AFF1 and AFF4 depletion of expression on HIV transcription in the presence or absence of Tat. Jurkat-LTR-luciferase cells (J-LTR-Luc) that stably express an integrated luciferase reporter gene under the control of the HIV promoter, were depleted of AFF1, AFF4, or cyclin T1 expression, using lentivirus driving the expressing of <t>Cas9</t> and the corresponding <t>sgRNA.</t> Depletion of both AFF1 and AFF4 expression was obtained by transducing puromycin-resistant AFF4 KO cells with AFF1-Cas9/sgRNA that harbors Blastocydin. Depletion of protein expression was confirmed by western blot using specific endogenous antibodies (panel B). Lentiviruses expressing Cas9 and the empty sgRNA (pHKO23) were used to generate a control cell with no sgRNA. HIV gene transcription in the presence or absence of Tat was monitored in J-LTR-Luc wild type and KO cells. Tat was introduced to cells with lentiviruses that code for Tat-BFP (Blue Fluorescent Protein). Luciferase levels were monitored 24 hours post infection and data are presented relatively to Luc readouts in J-LTR-Luc cells infected with pHKO23 lentivirus and set to 1. Luciferase readings are a representative of three independent experiments. Error bars represent standard deviation. (C) Depletion of AFF1 and AFF4 expression does not affect gene activation from PGK or EF1α promotors. Jurkat cells, where AFF1; AFF4; or AFF1/4 expression is KO were transduced with lentivirus expressing either the PGK-luciferase or the EF1α-DsRed reporter promoters. Cells were harvested 48 hour post transduction and subjected to luciferase analysis in the case of PGK-luciferase, or FACS, when EF1α-DsRed reporter was used. Data is presented relative to control cells that express only-pHKO23-CAs9—with no sgRNA and a representative of three independent experiments where error bars represent standard deviation.
    Plenti Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plenti sgrna/product/Addgene inc
    Average 92 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    plenti sgrna - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    91
    Addgene inc plx sgrna
    Effects of AFF1 and AFF4 depletion of expression on HIV transcription in the presence or absence of Tat. Jurkat-LTR-luciferase cells (J-LTR-Luc) that stably express an integrated luciferase reporter gene under the control of the HIV promoter, were depleted of AFF1, AFF4, or cyclin T1 expression, using lentivirus driving the expressing of <t>Cas9</t> and the corresponding <t>sgRNA.</t> Depletion of both AFF1 and AFF4 expression was obtained by transducing puromycin-resistant AFF4 KO cells with AFF1-Cas9/sgRNA that harbors Blastocydin. Depletion of protein expression was confirmed by western blot using specific endogenous antibodies (panel B). Lentiviruses expressing Cas9 and the empty sgRNA (pHKO23) were used to generate a control cell with no sgRNA. HIV gene transcription in the presence or absence of Tat was monitored in J-LTR-Luc wild type and KO cells. Tat was introduced to cells with lentiviruses that code for Tat-BFP (Blue Fluorescent Protein). Luciferase levels were monitored 24 hours post infection and data are presented relatively to Luc readouts in J-LTR-Luc cells infected with pHKO23 lentivirus and set to 1. Luciferase readings are a representative of three independent experiments. Error bars represent standard deviation. (C) Depletion of AFF1 and AFF4 expression does not affect gene activation from PGK or EF1α promotors. Jurkat cells, where AFF1; AFF4; or AFF1/4 expression is KO were transduced with lentivirus expressing either the PGK-luciferase or the EF1α-DsRed reporter promoters. Cells were harvested 48 hour post transduction and subjected to luciferase analysis in the case of PGK-luciferase, or FACS, when EF1α-DsRed reporter was used. Data is presented relative to control cells that express only-pHKO23-CAs9—with no sgRNA and a representative of three independent experiments where error bars represent standard deviation.
    Plx Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 118 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plx sgrna/product/Addgene inc
    Average 91 stars, based on 118 article reviews
    Price from $9.99 to $1999.99
    plx sgrna - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    96
    TaKaRa guide it sgrna
    Comparison of efficiency of crRNAs and <t>sgRNAs</t> for gene disruption. (A, B) Quantification of knockout phenotype for cells transfected with 15 nM synthetic crRNA or <t>sgRNA</t> targeting KIF11 (A) or CENPN (B), imaged at the indicated times posttransfection. Mitotic index indicates the percentage of total cells in mitosis. Cas9 expression was induced 18–20 h before transfection for KIF11 or simultaneously with RNA transfection for CENPN. Number of cells counted and statistical comparisons performed can be found in Supplemental Tables S1 and S2. (C–E) Titration of RNA guide concentrations for crRNA and sgRNA targeting KIF11 (C), CENPN (D), and RELA (E). Cells transfected with KIF11-targeting crRNA and sgRNA were treated as described above and imaged at 48 and 30 h posttransfection, respectively, to catch the peak knockout period for each synthetic guide. Cells transfected with CENPN or RELA RNA guides were treated as described in Figure 1 and analyzed at 60 or 72 h posttransfection, respectively. Quantification of the knockout phenotypes was done using immunofluorescence (KIF11/CENPN) and flow cytometry (RELA). Data are displayed as mean with error bars indicating SD.
    Guide It Sgrna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 124 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/guide it sgrna/product/TaKaRa
    Average 96 stars, based on 124 article reviews
    Price from $9.99 to $1999.99
    guide it sgrna - by Bioz Stars, 2020-07
    96/100 stars
      Buy from Supplier

    90
    Addgene inc puc57 sgrna
    Comparison of efficiency of crRNAs and <t>sgRNAs</t> for gene disruption. (A, B) Quantification of knockout phenotype for cells transfected with 15 nM synthetic crRNA or <t>sgRNA</t> targeting KIF11 (A) or CENPN (B), imaged at the indicated times posttransfection. Mitotic index indicates the percentage of total cells in mitosis. Cas9 expression was induced 18–20 h before transfection for KIF11 or simultaneously with RNA transfection for CENPN. Number of cells counted and statistical comparisons performed can be found in Supplemental Tables S1 and S2. (C–E) Titration of RNA guide concentrations for crRNA and sgRNA targeting KIF11 (C), CENPN (D), and RELA (E). Cells transfected with KIF11-targeting crRNA and sgRNA were treated as described above and imaged at 48 and 30 h posttransfection, respectively, to catch the peak knockout period for each synthetic guide. Cells transfected with CENPN or RELA RNA guides were treated as described in Figure 1 and analyzed at 60 or 72 h posttransfection, respectively. Quantification of the knockout phenotypes was done using immunofluorescence (KIF11/CENPN) and flow cytometry (RELA). Data are displayed as mean with error bars indicating SD.
    Puc57 Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 53 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/puc57 sgrna/product/Addgene inc
    Average 90 stars, based on 53 article reviews
    Price from $9.99 to $1999.99
    puc57 sgrna - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    90
    Addgene inc sgrna scaffold
    Activity of sgRNAs targeting slc45a2 ( albino ) and mpv17 ( transparent ). ( A ) Diagram showing the genomic structure of slc45a2 with the five <t>sgRNA</t> targeting sites (blue arrows) and the <t>PCR</t> amplicons used for heteroduplex mobility assay (HMA) (pink boxes). Black and gray boxes indicate exons and gray zones are untranslated regions. ( B ) HMA by PAGE in uninjected embryos (no inj.) and embryos injected with a mixture containing Cas9 mRNA and each sgRNA targeting slc45a2 . Multiple heteroduplex bands were detected in PCR amplicons from sgRNA injected embryos. ( C ) Diagram showing the genomic structure of mpv17 with the five sgRNA targeting sites (blue arrows) and the PCR amplicons used for HMA (pink boxes). ( D ) HMA by PAGE in uninjected embryos (no inj.) and embryos injected with a mixture containing Cas9 mRNA and each sgRNA targeting mpv17 .
    Sgrna Scaffold, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 111 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna scaffold/product/Addgene inc
    Average 90 stars, based on 111 article reviews
    Price from $9.99 to $1999.99
    sgrna scaffold - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    93
    4Gene sgrna sequences
    Activity of sgRNAs targeting slc45a2 ( albino ) and mpv17 ( transparent ). ( A ) Diagram showing the genomic structure of slc45a2 with the five <t>sgRNA</t> targeting sites (blue arrows) and the <t>PCR</t> amplicons used for heteroduplex mobility assay (HMA) (pink boxes). Black and gray boxes indicate exons and gray zones are untranslated regions. ( B ) HMA by PAGE in uninjected embryos (no inj.) and embryos injected with a mixture containing Cas9 mRNA and each sgRNA targeting slc45a2 . Multiple heteroduplex bands were detected in PCR amplicons from sgRNA injected embryos. ( C ) Diagram showing the genomic structure of mpv17 with the five sgRNA targeting sites (blue arrows) and the PCR amplicons used for HMA (pink boxes). ( D ) HMA by PAGE in uninjected embryos (no inj.) and embryos injected with a mixture containing Cas9 mRNA and each sgRNA targeting mpv17 .
    Sgrna Sequences, supplied by 4Gene, used in various techniques. Bioz Stars score: 93/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna sequences/product/4Gene
    Average 93 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    sgrna sequences - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    92
    Addgene inc sgrna ms2 vector
    Activity of sgRNAs targeting slc45a2 ( albino ) and mpv17 ( transparent ). ( A ) Diagram showing the genomic structure of slc45a2 with the five <t>sgRNA</t> targeting sites (blue arrows) and the <t>PCR</t> amplicons used for heteroduplex mobility assay (HMA) (pink boxes). Black and gray boxes indicate exons and gray zones are untranslated regions. ( B ) HMA by PAGE in uninjected embryos (no inj.) and embryos injected with a mixture containing Cas9 mRNA and each sgRNA targeting slc45a2 . Multiple heteroduplex bands were detected in PCR amplicons from sgRNA injected embryos. ( C ) Diagram showing the genomic structure of mpv17 with the five sgRNA targeting sites (blue arrows) and the PCR amplicons used for HMA (pink boxes). ( D ) HMA by PAGE in uninjected embryos (no inj.) and embryos injected with a mixture containing Cas9 mRNA and each sgRNA targeting mpv17 .
    Sgrna Ms2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna ms2 vector/product/Addgene inc
    Average 92 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    sgrna ms2 vector - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    Image Search Results


    Distribution of the most frequent alleles identified with CRISPResso around cleavage sites in B. rapa. Sequences were obtained after transfection with 60 μg Cas9 preassembled with 60 μg of sgRNA-FRI1, sgRNA-FRI4, sgRNA-PDS1, or sgRNA-PDS2. The horizontal line indicates the PAM region, the vertical dashed line indicates the predicted cleavage site. Mutations are shown in bold font (substitutions), highlighted with red rectangles (insertions), or marked with horizontal dashed lines (deletions).

    Journal: Frontiers in Plant Science

    Article Title: DNA-Free Genome Editing of Brassica oleracea and B. rapa Protoplasts Using CRISPR-Cas9 Ribonucleoprotein Complexes

    doi: 10.3389/fpls.2018.01594

    Figure Lengend Snippet: Distribution of the most frequent alleles identified with CRISPResso around cleavage sites in B. rapa. Sequences were obtained after transfection with 60 μg Cas9 preassembled with 60 μg of sgRNA-FRI1, sgRNA-FRI4, sgRNA-PDS1, or sgRNA-PDS2. The horizontal line indicates the PAM region, the vertical dashed line indicates the predicted cleavage site. Mutations are shown in bold font (substitutions), highlighted with red rectangles (insertions), or marked with horizontal dashed lines (deletions).

    Article Snippet: Target sites for FRI and PDS genes were amplified with the primers ‘FRI-Dig-BO,’ ‘FRI-Dig-BR,’ ‘PDS-Seq-Dig-BO,’ and ‘PDS-Seq-Dig-BR’ listed in Table and column-purified (Illustra GFP PCR DNA and gel band purification kit, GE Healthcare); 100 ng of purified PCR products was incubated with 160 ng or 1 μg Cas9 and 160 ng or 1 μg sgRNA in 1× NEBuffer 3 with BSA for 1 h at 37°C.

    Techniques: Transfection

    Establishment and validation of tagged exocyst subunit cell lines. a Schematic showing a region of subunit gene targeted by sgRNA and tags to be inserted C-terminally, in-frame with the coding region. b Strategy to isolate CRISPR/Cas9-mediated sfGFP-tagged clones of exocyst subunits in NMuMG cells. c Western blots with subunit specific antibodies show successful incorporation of sfGFP in both alleles (EXO70, SEC5, and SEC8), or in one allele (SEC3 and SEC6). A shRNA specific to SEC3 was used to confirm the identity of multiple bands in the blot. d Confocal images of live wild-type NMuMG cells and endogenously tagged SEC3-GFP, SEC5-GFP, SEC6-GFP, SEC8-GFP, and EXO70-GFP cell lines. Scale bar = 10 μm. e Protein–protein interaction heat map for endogenous SEC3-GFP, SEC5-GFP, and EXO70-GFP pulldown using GFP-Trap nanobodies and MS. Yellow indicates baits, blue the protein identified with high confidence, and gray denotes preys that were not identified. The experiments were repeated three times for EXO70-GFP and twice for SEC3-GFP and SEC5-GFP. All experiments were also partially confirmed by IP–WB in at least three independent experiments, with similar results. f Western blot analysis to assess the relative abundance of exocyst subunits fused to sfGFP, using anti-GFP antibodies (SEC3 and SEC6 quantifications corrected for heterozygosity). GAPDH was the loading control. Y axis shows the ratio of GFP/GAPDH. Quantification shows pooled data from three experiments

    Journal: Nature Communications

    Article Title: Exocyst dynamics during vesicle tethering and fusion

    doi: 10.1038/s41467-018-07467-5

    Figure Lengend Snippet: Establishment and validation of tagged exocyst subunit cell lines. a Schematic showing a region of subunit gene targeted by sgRNA and tags to be inserted C-terminally, in-frame with the coding region. b Strategy to isolate CRISPR/Cas9-mediated sfGFP-tagged clones of exocyst subunits in NMuMG cells. c Western blots with subunit specific antibodies show successful incorporation of sfGFP in both alleles (EXO70, SEC5, and SEC8), or in one allele (SEC3 and SEC6). A shRNA specific to SEC3 was used to confirm the identity of multiple bands in the blot. d Confocal images of live wild-type NMuMG cells and endogenously tagged SEC3-GFP, SEC5-GFP, SEC6-GFP, SEC8-GFP, and EXO70-GFP cell lines. Scale bar = 10 μm. e Protein–protein interaction heat map for endogenous SEC3-GFP, SEC5-GFP, and EXO70-GFP pulldown using GFP-Trap nanobodies and MS. Yellow indicates baits, blue the protein identified with high confidence, and gray denotes preys that were not identified. The experiments were repeated three times for EXO70-GFP and twice for SEC3-GFP and SEC5-GFP. All experiments were also partially confirmed by IP–WB in at least three independent experiments, with similar results. f Western blot analysis to assess the relative abundance of exocyst subunits fused to sfGFP, using anti-GFP antibodies (SEC3 and SEC6 quantifications corrected for heterozygosity). GAPDH was the loading control. Y axis shows the ratio of GFP/GAPDH. Quantification shows pooled data from three experiments

    Article Snippet: Cells were transfected with targeting vector (LITMUS29 backbone), sgRNA (Addgene plasmid #41824), and Cas9 expression vector (pCMVsp6-nls-hCas9-nls), a gift from Li-En Jao (UC Davis), at an equimolar (550 fmol) ratio using Xfect transfection reagent according to the manufacturer’s protocol.

    Techniques: CRISPR, Clone Assay, Western Blot, shRNA, Mass Spectrometry

    Deletion of B3GNT5 leads to depletion of nLc4 and P 1 . ( A ) B3GNT5 -editing strategy using two different sgRNAs (red) contain PAM sequence (green) deleting a genomic region up- and downstream of the transcription start site (+1) including a part of the open reading frame (ORF). In silico analysis revealed a deletion of 898 bp. ( B ) Representative genotyping PCR for characterization of single cell clones. PCR numbers indicate the use of different primer pairs listed in experimental procedures. ( C ) Semi-quantitative PCR with two different primer pairs ( B3GNT5 _1 and B3GNT5 _2) on wildtype (pIGROV1) and two representative knockout clones. SDHA was used as a reference gene. ( D ) DNA sequencing results for wildtype (WT), and selected biallelically deleted knockout clones (KO_1 and KO_2). ( E ) Representative counter plots for presence of Gb3, GM1, nLc4 and P 1 before (wildtype B3GNT5 ) and after gene disruption of B3GNT5 in IGROV1 cells (∆ B3GNT5 ). Percentage of GSL-positive cells (FITC) is shown in each plot. Negative control (n.c.). ( F ) Box and Whisker plots representing CRISPR Cas9 -mediated changes in expression of individual GSLs (percentage of FITC-positive cells, ordinate) for ∆ B3GNT5 and parental cells (abscissa). *** p

    Journal: Scientific Reports

    Article Title: Altered (neo-) lacto series glycolipid biosynthesis impairs α2-6 sialylation on N-glycoproteins in ovarian cancer cells

    doi: 10.1038/srep45367

    Figure Lengend Snippet: Deletion of B3GNT5 leads to depletion of nLc4 and P 1 . ( A ) B3GNT5 -editing strategy using two different sgRNAs (red) contain PAM sequence (green) deleting a genomic region up- and downstream of the transcription start site (+1) including a part of the open reading frame (ORF). In silico analysis revealed a deletion of 898 bp. ( B ) Representative genotyping PCR for characterization of single cell clones. PCR numbers indicate the use of different primer pairs listed in experimental procedures. ( C ) Semi-quantitative PCR with two different primer pairs ( B3GNT5 _1 and B3GNT5 _2) on wildtype (pIGROV1) and two representative knockout clones. SDHA was used as a reference gene. ( D ) DNA sequencing results for wildtype (WT), and selected biallelically deleted knockout clones (KO_1 and KO_2). ( E ) Representative counter plots for presence of Gb3, GM1, nLc4 and P 1 before (wildtype B3GNT5 ) and after gene disruption of B3GNT5 in IGROV1 cells (∆ B3GNT5 ). Percentage of GSL-positive cells (FITC) is shown in each plot. Negative control (n.c.). ( F ) Box and Whisker plots representing CRISPR Cas9 -mediated changes in expression of individual GSLs (percentage of FITC-positive cells, ordinate) for ∆ B3GNT5 and parental cells (abscissa). *** p

    Article Snippet: Designed and processed sgRNAs to edit either B3GNT5 or B4GALNT1 ( ) were cloned into pSpCas9(BB)-2A-GFP (addgene PX458) via BsbI restriction site using T4 DNA Ligase (Promega, Dübendorf, Switzerland).

    Techniques: Sequencing, In Silico, Polymerase Chain Reaction, Clone Assay, Real-time Polymerase Chain Reaction, Knock-Out, DNA Sequencing, Negative Control, Whisker Assay, CRISPR, Expressing

    Loss of gangliosides by B4GALNT1 -editing does not affect α2–6 sialylation in IGROV1 cells. ( A ) Depiction of CRISPR- Cas9 -mediated B4GALNT1 editing in IGROV1 cells using two different sgRNAs [red; PAM sequence (green)]. In silico analysis revealed a deletion of 917 bp including translation start site located at exon 2. ( B ) Verification of ∆ B4GALNT1 cells by DNA sequencing. ( C ) Representative flow cytometry zebra blot for parental IGROV1 and ∆ B4GALNT1 cells. ( D ) Bar chart summarizing three independent flow cytometry experiments. ( E ) SNA-staining remains unaffected in ∆ B4GALNT1 cells compared to IGROV1 ( B4GALNT1 ). Data are represented as mean ± s.d.

    Journal: Scientific Reports

    Article Title: Altered (neo-) lacto series glycolipid biosynthesis impairs α2-6 sialylation on N-glycoproteins in ovarian cancer cells

    doi: 10.1038/srep45367

    Figure Lengend Snippet: Loss of gangliosides by B4GALNT1 -editing does not affect α2–6 sialylation in IGROV1 cells. ( A ) Depiction of CRISPR- Cas9 -mediated B4GALNT1 editing in IGROV1 cells using two different sgRNAs [red; PAM sequence (green)]. In silico analysis revealed a deletion of 917 bp including translation start site located at exon 2. ( B ) Verification of ∆ B4GALNT1 cells by DNA sequencing. ( C ) Representative flow cytometry zebra blot for parental IGROV1 and ∆ B4GALNT1 cells. ( D ) Bar chart summarizing three independent flow cytometry experiments. ( E ) SNA-staining remains unaffected in ∆ B4GALNT1 cells compared to IGROV1 ( B4GALNT1 ). Data are represented as mean ± s.d.

    Article Snippet: Designed and processed sgRNAs to edit either B3GNT5 or B4GALNT1 ( ) were cloned into pSpCas9(BB)-2A-GFP (addgene PX458) via BsbI restriction site using T4 DNA Ligase (Promega, Dübendorf, Switzerland).

    Techniques: CRISPR, Sequencing, In Silico, DNA Sequencing, Flow Cytometry, Cytometry, Staining

    CRISPR-Cas9 system mediates EDAR gene targeting in GFbs. (a) Schematic representation of sgRNAs targeting exon 6 of the EDAR gene. The red letters represent the target sequence of each sgRNA. The blue letters indicate the PAM sequence. (b) Surveyor nuclease mutation-detection assay. Lanes 1 and 2: PCR products of the GFbs transfected with sgRNA1 + Cas9 or sgRNA2 + Cas9 plasmids, following treatment with Surveyor nuclease. Lanes 3 and 4: positive experimental group and negative experimental control group, respectively. M lane: 200-bp DNA Ladder Marker. (C) Cell line positive for a targeted EDAR gene mutation. (d) Nine different types of mutations occurred in the cell lines with EDAR gene mutations. The dotted line in the diagram represents the missing base fragment. The red box represents the inserted fragment. The red line at the top indicates the position of the sgRNA. WT, wild type

    Journal: International Journal of Biological Sciences

    Article Title: Generation of Cashmere Goats Carrying an EDAR Gene Mutant Using CRISPR-Cas9-Mediated Genome Editing

    doi: 10.7150/ijbs.23890

    Figure Lengend Snippet: CRISPR-Cas9 system mediates EDAR gene targeting in GFbs. (a) Schematic representation of sgRNAs targeting exon 6 of the EDAR gene. The red letters represent the target sequence of each sgRNA. The blue letters indicate the PAM sequence. (b) Surveyor nuclease mutation-detection assay. Lanes 1 and 2: PCR products of the GFbs transfected with sgRNA1 + Cas9 or sgRNA2 + Cas9 plasmids, following treatment with Surveyor nuclease. Lanes 3 and 4: positive experimental group and negative experimental control group, respectively. M lane: 200-bp DNA Ladder Marker. (C) Cell line positive for a targeted EDAR gene mutation. (d) Nine different types of mutations occurred in the cell lines with EDAR gene mutations. The dotted line in the diagram represents the missing base fragment. The red box represents the inserted fragment. The red line at the top indicates the position of the sgRNA. WT, wild type

    Article Snippet: These two fragments were combined with the previously annealed DNA template to obtain the complete sgRNA (455 bp) for targeting exon 6 of EDAR , which was inserted into the pMD-19T vector (TaKaRa Bio, Shiga, Japan) and sequenced.

    Techniques: CRISPR, Sequencing, Mutagenesis, Detection Assay, Polymerase Chain Reaction, Transfection, Marker

    Indel spectrum generated by SpyCas9 editing at the HPS1 locus HPS1 B-LCL cells. Indel spectrum of SpyCas9 nuclease cells treated with different sgRNAs determined by UMI-based Illumina deep sequencing. a) Target site 1 b) Target site 2 c) Target site 3 d) Target site 4 e) Target site 5 f) Target site 6. Red bar indicates the 16 bp deletion that corresponds to the deletion of one of the microduplication repeats. Data depicts indel spectrum from one representative biological replicate out of a total three independent biological replicates.

    Journal: Nature

    Article Title: Precise therapeutic gene correction by a simple nuclease-induced double-strand break

    doi: 10.1038/s41586-019-1076-8

    Figure Lengend Snippet: Indel spectrum generated by SpyCas9 editing at the HPS1 locus HPS1 B-LCL cells. Indel spectrum of SpyCas9 nuclease cells treated with different sgRNAs determined by UMI-based Illumina deep sequencing. a) Target site 1 b) Target site 2 c) Target site 3 d) Target site 4 e) Target site 5 f) Target site 6. Red bar indicates the 16 bp deletion that corresponds to the deletion of one of the microduplication repeats. Data depicts indel spectrum from one representative biological replicate out of a total three independent biological replicates.

    Article Snippet: Electroporation of cell lines with SpyCas9 RNPs 3xNLS-SpyCas9 protein was precomplexed with sgRNAs either purchased from Synthego or made in-house by T7 transcription ( ) and electroporated into cells using the Neon transfection system (Thermo Fisher).

    Techniques: Generated, Sequencing

    ( A ) Genotype of PC family knockout clones. Red arrows indicate the Cas9 cleavage site. sgRNA sequence (5’ to 3’) is shown for each targeted gene along with corresponding deletions (black dashes) and insertions (red letters) identified by deep sequencing of knockout clonal lines. Insertion/deletion sizes are indicated in parenthesis and resulting premature truncation amino acid is shown in red. ( B ) CRISPR/Cas9 generated knockout lines for Furin, PACE4, PCSK5 and PCSK7 were transfected with V5DispHA-expression vector, and formation of the ~30 kDa V5 cleavage fragment was monitored by western blot of cell lysates from Clonal line 2. Furin and PCSK7 protein levels were examined by western blot. Kinesin is loading control. PACE4 and PCSK5 were assessed by deep sequencing as in A.

    Journal: eLife

    Article Title: Cleavage activates Dispatched for Sonic Hedgehog ligand release

    doi: 10.7554/eLife.31678

    Figure Lengend Snippet: ( A ) Genotype of PC family knockout clones. Red arrows indicate the Cas9 cleavage site. sgRNA sequence (5’ to 3’) is shown for each targeted gene along with corresponding deletions (black dashes) and insertions (red letters) identified by deep sequencing of knockout clonal lines. Insertion/deletion sizes are indicated in parenthesis and resulting premature truncation amino acid is shown in red. ( B ) CRISPR/Cas9 generated knockout lines for Furin, PACE4, PCSK5 and PCSK7 were transfected with V5DispHA-expression vector, and formation of the ~30 kDa V5 cleavage fragment was monitored by western blot of cell lysates from Clonal line 2. Furin and PCSK7 protein levels were examined by western blot. Kinesin is loading control. PACE4 and PCSK5 were assessed by deep sequencing as in A.

    Article Snippet: C57BL/6 MEF cells were transiently transfected with 3.5 µl of Cas9 RNP (Cas9 (Berkeley Macrolab), 40 pmole; sgRNA (Synthego, Redwood City, CA),156 pmole) via nucleofection (Lonza, 4D-NucleofectorTM X-unit, Basal, Switzerland) using solution P3, program DS-150 in small cuvettes according to the manufacturers recommended protocol. sgRNAs used were: Furin: 5’- TCTGTAGCCGGCTGTGCCGC; Pcsk5: TGGAAAGAAACCTTGGTACT; Pace4: TACCACATGTTAGACCAAAT; Pcsk7: TTGTGGTTGCCAGTGGTAAT.

    Techniques: Knock-Out, Clone Assay, Sequencing, CRISPR, Generated, Transfection, Expressing, Plasmid Preparation, Western Blot

    Effects of AFF1 and AFF4 depletion of expression on HIV transcription in the presence or absence of Tat. Jurkat-LTR-luciferase cells (J-LTR-Luc) that stably express an integrated luciferase reporter gene under the control of the HIV promoter, were depleted of AFF1, AFF4, or cyclin T1 expression, using lentivirus driving the expressing of Cas9 and the corresponding sgRNA. Depletion of both AFF1 and AFF4 expression was obtained by transducing puromycin-resistant AFF4 KO cells with AFF1-Cas9/sgRNA that harbors Blastocydin. Depletion of protein expression was confirmed by western blot using specific endogenous antibodies (panel B). Lentiviruses expressing Cas9 and the empty sgRNA (pHKO23) were used to generate a control cell with no sgRNA. HIV gene transcription in the presence or absence of Tat was monitored in J-LTR-Luc wild type and KO cells. Tat was introduced to cells with lentiviruses that code for Tat-BFP (Blue Fluorescent Protein). Luciferase levels were monitored 24 hours post infection and data are presented relatively to Luc readouts in J-LTR-Luc cells infected with pHKO23 lentivirus and set to 1. Luciferase readings are a representative of three independent experiments. Error bars represent standard deviation. (C) Depletion of AFF1 and AFF4 expression does not affect gene activation from PGK or EF1α promotors. Jurkat cells, where AFF1; AFF4; or AFF1/4 expression is KO were transduced with lentivirus expressing either the PGK-luciferase or the EF1α-DsRed reporter promoters. Cells were harvested 48 hour post transduction and subjected to luciferase analysis in the case of PGK-luciferase, or FACS, when EF1α-DsRed reporter was used. Data is presented relative to control cells that express only-pHKO23-CAs9—with no sgRNA and a representative of three independent experiments where error bars represent standard deviation.

    Journal: Transcription

    Article Title: Super elongation complex promotes early HIV transcription and its function is modulated by P-TEFb

    doi: 10.1080/21541264.2017.1295831

    Figure Lengend Snippet: Effects of AFF1 and AFF4 depletion of expression on HIV transcription in the presence or absence of Tat. Jurkat-LTR-luciferase cells (J-LTR-Luc) that stably express an integrated luciferase reporter gene under the control of the HIV promoter, were depleted of AFF1, AFF4, or cyclin T1 expression, using lentivirus driving the expressing of Cas9 and the corresponding sgRNA. Depletion of both AFF1 and AFF4 expression was obtained by transducing puromycin-resistant AFF4 KO cells with AFF1-Cas9/sgRNA that harbors Blastocydin. Depletion of protein expression was confirmed by western blot using specific endogenous antibodies (panel B). Lentiviruses expressing Cas9 and the empty sgRNA (pHKO23) were used to generate a control cell with no sgRNA. HIV gene transcription in the presence or absence of Tat was monitored in J-LTR-Luc wild type and KO cells. Tat was introduced to cells with lentiviruses that code for Tat-BFP (Blue Fluorescent Protein). Luciferase levels were monitored 24 hours post infection and data are presented relatively to Luc readouts in J-LTR-Luc cells infected with pHKO23 lentivirus and set to 1. Luciferase readings are a representative of three independent experiments. Error bars represent standard deviation. (C) Depletion of AFF1 and AFF4 expression does not affect gene activation from PGK or EF1α promotors. Jurkat cells, where AFF1; AFF4; or AFF1/4 expression is KO were transduced with lentivirus expressing either the PGK-luciferase or the EF1α-DsRed reporter promoters. Cells were harvested 48 hour post transduction and subjected to luciferase analysis in the case of PGK-luciferase, or FACS, when EF1α-DsRed reporter was used. Data is presented relative to control cells that express only-pHKO23-CAs9—with no sgRNA and a representative of three independent experiments where error bars represent standard deviation.

    Article Snippet: For KO of protein expression, Jurkat-LTR-Luc or HEK-LTR-Luc cells were infected with lentiviral vectors expressing the Cas9/sgRNA for KO cyclin T1; AFF1; or AFF4 (Addgene #49535).

    Techniques: Expressing, Luciferase, Stable Transfection, Western Blot, Infection, Standard Deviation, Activation Assay, Transduction, FACS

    AF4/FMR2 family members 1 and 4 of SEC activate early HIV gene transcription in the absence of Tat. (A) AFF1 and AFF4 enhance HIV transcription in the absence of Tat. HEK-LTR-Luc cells stably expressing integrated HIV-luciferase were transfected either with HA-AFF4 or HA-AFF1 expressing plasmids. Cells were harvested 48 hours post transfection and their luciferase readouts were analyzed according to the manufacture protocol and normalized to protein levels. To monitor effects of Tat, cells were also transfected with HA-Tat and luciferase readings were monitored according to standard protocols. Data is a representative of three independent experiments and error bars represent standard deviation. Bottom panel presents western blot analysis for the expression levels of Tat, AFF4 and AFF1. (B) HIV transcriptional activation by AFF4 and AFF1 are independent of P-TEFb. HEK-LTR-Luc cells were depleted of cyclin T1 expression using CRISPR/Cas9-sgRNA lentiviruses. Cells expressing Cas9 and the empty sgRNA (pHKO23) were used as control. Wild type or cyclin KO cells were transfected with either HA-AFF1 or HA-AFF4, and their luciferase readings were monitored 48 hours post transfection and normalized to protein levels. Experiments were performed in the presence or absence of transiently expressed HA-Tat. Results are presented relatively to readings in cells that express LTR-Luc alone—set to 1, and are a representative of three independent experiments. Error bars represent standard deviation. Bottom panel shows western blot analysis confirming KO of cyclin T1, overexpression of HA-AFF1, and HA-AFF4 and HA-Tat.

    Journal: Transcription

    Article Title: Super elongation complex promotes early HIV transcription and its function is modulated by P-TEFb

    doi: 10.1080/21541264.2017.1295831

    Figure Lengend Snippet: AF4/FMR2 family members 1 and 4 of SEC activate early HIV gene transcription in the absence of Tat. (A) AFF1 and AFF4 enhance HIV transcription in the absence of Tat. HEK-LTR-Luc cells stably expressing integrated HIV-luciferase were transfected either with HA-AFF4 or HA-AFF1 expressing plasmids. Cells were harvested 48 hours post transfection and their luciferase readouts were analyzed according to the manufacture protocol and normalized to protein levels. To monitor effects of Tat, cells were also transfected with HA-Tat and luciferase readings were monitored according to standard protocols. Data is a representative of three independent experiments and error bars represent standard deviation. Bottom panel presents western blot analysis for the expression levels of Tat, AFF4 and AFF1. (B) HIV transcriptional activation by AFF4 and AFF1 are independent of P-TEFb. HEK-LTR-Luc cells were depleted of cyclin T1 expression using CRISPR/Cas9-sgRNA lentiviruses. Cells expressing Cas9 and the empty sgRNA (pHKO23) were used as control. Wild type or cyclin KO cells were transfected with either HA-AFF1 or HA-AFF4, and their luciferase readings were monitored 48 hours post transfection and normalized to protein levels. Experiments were performed in the presence or absence of transiently expressed HA-Tat. Results are presented relatively to readings in cells that express LTR-Luc alone—set to 1, and are a representative of three independent experiments. Error bars represent standard deviation. Bottom panel shows western blot analysis confirming KO of cyclin T1, overexpression of HA-AFF1, and HA-AFF4 and HA-Tat.

    Article Snippet: For KO of protein expression, Jurkat-LTR-Luc or HEK-LTR-Luc cells were infected with lentiviral vectors expressing the Cas9/sgRNA for KO cyclin T1; AFF1; or AFF4 (Addgene #49535).

    Techniques: Size-exclusion Chromatography, Stable Transfection, Expressing, Luciferase, Transfection, Standard Deviation, Western Blot, Activation Assay, CRISPR, Over Expression

    Comparison of efficiency of crRNAs and sgRNAs for gene disruption. (A, B) Quantification of knockout phenotype for cells transfected with 15 nM synthetic crRNA or sgRNA targeting KIF11 (A) or CENPN (B), imaged at the indicated times posttransfection. Mitotic index indicates the percentage of total cells in mitosis. Cas9 expression was induced 18–20 h before transfection for KIF11 or simultaneously with RNA transfection for CENPN. Number of cells counted and statistical comparisons performed can be found in Supplemental Tables S1 and S2. (C–E) Titration of RNA guide concentrations for crRNA and sgRNA targeting KIF11 (C), CENPN (D), and RELA (E). Cells transfected with KIF11-targeting crRNA and sgRNA were treated as described above and imaged at 48 and 30 h posttransfection, respectively, to catch the peak knockout period for each synthetic guide. Cells transfected with CENPN or RELA RNA guides were treated as described in Figure 1 and analyzed at 60 or 72 h posttransfection, respectively. Quantification of the knockout phenotypes was done using immunofluorescence (KIF11/CENPN) and flow cytometry (RELA). Data are displayed as mean with error bars indicating SD.

    Journal: Molecular Biology of the Cell

    Article Title: CRISPR/Cas9-based gene targeting using synthetic guide RNAs enables robust cell biological analyses

    doi: 10.1091/mbc.E18-04-0214

    Figure Lengend Snippet: Comparison of efficiency of crRNAs and sgRNAs for gene disruption. (A, B) Quantification of knockout phenotype for cells transfected with 15 nM synthetic crRNA or sgRNA targeting KIF11 (A) or CENPN (B), imaged at the indicated times posttransfection. Mitotic index indicates the percentage of total cells in mitosis. Cas9 expression was induced 18–20 h before transfection for KIF11 or simultaneously with RNA transfection for CENPN. Number of cells counted and statistical comparisons performed can be found in Supplemental Tables S1 and S2. (C–E) Titration of RNA guide concentrations for crRNA and sgRNA targeting KIF11 (C), CENPN (D), and RELA (E). Cells transfected with KIF11-targeting crRNA and sgRNA were treated as described above and imaged at 48 and 30 h posttransfection, respectively, to catch the peak knockout period for each synthetic guide. Cells transfected with CENPN or RELA RNA guides were treated as described in Figure 1 and analyzed at 60 or 72 h posttransfection, respectively. Quantification of the knockout phenotypes was done using immunofluorescence (KIF11/CENPN) and flow cytometry (RELA). Data are displayed as mean with error bars indicating SD.

    Article Snippet: In vitro–transcribed sgRNAs were produced according to the manufacturer instructions using the Guide-it sgRNA In Vitro Transcription Kit (Takara).

    Techniques: Knock-Out, Transfection, Expressing, Titration, Immunofluorescence, Flow Cytometry, Cytometry

    Reverse transfection allows efficient delivery of sgRNAs for phenotypic analyses. Immunofluorescence images of HeLa cells that were fixed and imaged 72 h postseeding on printed sgRNA array with control spots or spots containing sgRNA targeting KIF11 (A) or RELA (B). Cas9 expression in these cells was induced 12–18 h before seeding. For the KIF11 sgRNA array, cells were stained for DNA (cyan) and microtubules (red). Dotted boxes (white) indicate magnified region (right). For the RELA sgRNA array, cells were stained for RELA (cyan) and microtubules (red). In all images, the dotted circles (orange) indicate region of printed spot. Scale bar = 100 µm.

    Journal: Molecular Biology of the Cell

    Article Title: CRISPR/Cas9-based gene targeting using synthetic guide RNAs enables robust cell biological analyses

    doi: 10.1091/mbc.E18-04-0214

    Figure Lengend Snippet: Reverse transfection allows efficient delivery of sgRNAs for phenotypic analyses. Immunofluorescence images of HeLa cells that were fixed and imaged 72 h postseeding on printed sgRNA array with control spots or spots containing sgRNA targeting KIF11 (A) or RELA (B). Cas9 expression in these cells was induced 12–18 h before seeding. For the KIF11 sgRNA array, cells were stained for DNA (cyan) and microtubules (red). Dotted boxes (white) indicate magnified region (right). For the RELA sgRNA array, cells were stained for RELA (cyan) and microtubules (red). In all images, the dotted circles (orange) indicate region of printed spot. Scale bar = 100 µm.

    Article Snippet: In vitro–transcribed sgRNAs were produced according to the manufacturer instructions using the Guide-it sgRNA In Vitro Transcription Kit (Takara).

    Techniques: Transfection, Immunofluorescence, Expressing, Staining

    Activity of sgRNAs targeting slc45a2 ( albino ) and mpv17 ( transparent ). ( A ) Diagram showing the genomic structure of slc45a2 with the five sgRNA targeting sites (blue arrows) and the PCR amplicons used for heteroduplex mobility assay (HMA) (pink boxes). Black and gray boxes indicate exons and gray zones are untranslated regions. ( B ) HMA by PAGE in uninjected embryos (no inj.) and embryos injected with a mixture containing Cas9 mRNA and each sgRNA targeting slc45a2 . Multiple heteroduplex bands were detected in PCR amplicons from sgRNA injected embryos. ( C ) Diagram showing the genomic structure of mpv17 with the five sgRNA targeting sites (blue arrows) and the PCR amplicons used for HMA (pink boxes). ( D ) HMA by PAGE in uninjected embryos (no inj.) and embryos injected with a mixture containing Cas9 mRNA and each sgRNA targeting mpv17 .

    Journal: Scientific Reports

    Article Title: A tRNA-based multiplex sgRNA expression system in zebrafish and its application to generation of transgenic albino fish

    doi: 10.1038/s41598-018-31476-5

    Figure Lengend Snippet: Activity of sgRNAs targeting slc45a2 ( albino ) and mpv17 ( transparent ). ( A ) Diagram showing the genomic structure of slc45a2 with the five sgRNA targeting sites (blue arrows) and the PCR amplicons used for heteroduplex mobility assay (HMA) (pink boxes). Black and gray boxes indicate exons and gray zones are untranslated regions. ( B ) HMA by PAGE in uninjected embryos (no inj.) and embryos injected with a mixture containing Cas9 mRNA and each sgRNA targeting slc45a2 . Multiple heteroduplex bands were detected in PCR amplicons from sgRNA injected embryos. ( C ) Diagram showing the genomic structure of mpv17 with the five sgRNA targeting sites (blue arrows) and the PCR amplicons used for HMA (pink boxes). ( D ) HMA by PAGE in uninjected embryos (no inj.) and embryos injected with a mixture containing Cas9 mRNA and each sgRNA targeting mpv17 .

    Article Snippet: For cloning of other tRNA genes, a DNA fragment containing Bsa I site at the downstream end of the sgRNA scaffold was amplified by PCR, and cloned between the first Nde I site and the Apa I site of pUAS:Cas9T2AGFP;U6:sgRNA1;U6:sgRNA2 (Addgene plasmid 74009) to generate ptRNA-empty.

    Techniques: Activity Assay, Polymerase Chain Reaction, Polyacrylamide Gel Electrophoresis, Injection

    Precise excision of functional sgRNAs by the endogenous tRNA processing machinery in zebrafish embryos. ( A ) Introduction of mutations by the slc45a2-sg1 fused to tRNA at its 5′ end (5′-tRNA Gly (GCC)-sg1). (left) Heteroduplex mobility assay (HMA) by PAGE in uninjected embryos (no inj.), embryos injected with a mixture containing Cas9 mRNA and unfused slc45a2-sg1 (sgRNA), and embryos injected with a mixture containing Cas9 mRNA and 5′-tRNA Gly (GCC)-sg1. (right) Bar chart shows quantification of the ratio of heteroduplex bands. Data are shown as mean ± SEM (N = 4). Each dot represents data obtained from individual sample. Multiple heteroduplex bands were detected in PCR amplicons from wild-type tRNA-sgRNA (5′-tRNA Gly (GCC)-sg1) injected embryos (Dr-Gly WT and Os-Gly WT), whereas only a single band was detected in scrambled tRNA-sgRNA (5′-tRNA Gly (GCC)scr-sg1) injected embryos (Dr-Gly scr. and Os-Gly scr.). ( B ) (left) HMA by PAGE in uninjected embryos (no inj.), embryos injected with a mixture containing Cas9 mRNA and unfused slc45a2-sg1 (sgRNA), and embryos injected with a mixture containing Cas9 mRNA and slc45a2-sg1 fused to tRNA at its 3′-end (sg1-tRNA Gly (GCC)-3′). (right) A Bar chart showing the quantification of the ratio of heteroduplex bands. Data are shown as mean ± SEM (N = 3 for HDV and N = 4 for the others). Each dot represents data obtained from individual sample. Multiple heteroduplex bands were detected in PCR amplicons from both wild-type (WT) and scrambled (scr.) tRNA-sgRNAs. ( C ) (left) HMA by PAGE in uninjected embryos (no inj.), embryos injected with a mixture containing Cas9 mRNA and unfused slc45a2-sg1 (sgRNA), and embryos injected with a mixture containing Cas9 mRNA and slc45a2-sg1 fused to each of the eight species of tRNAs at its 5′-end. (right) A bar chart showing the quantification of the ratio of heteroduplex bands. Data are shown as mean ± SEM (N = 4 for sgRNA and N = 3 for tRNA-sgRNAs). Each dot represents data obtained from individual sample. Multiple heteroduplex bands were comparably detected from the embryos injected with slc45a2-sg1 fused to each of the eight tRNAs. ( D ) Detection of the mature sgRNA processed from 5′-Dr-tRNA Gly (GCC)-sg1 in vivo with cRT-PCR. The white arrowhead indicates the mature sgRNA, and the black arrowhead indicates the precursor RNA. The bands corresponding to the mature sgRNA are detected in 5′-Dr-tRNA Gly (GCC)-sg1 injected embryos (Dr-Gly inj.) but neither in 5′-Dr-tRNA Gly (GCC)scr-sg1 injected (Dr-Glyscr. inj.) nor in uninjected embryos mixed with 5′-Dr-tRNA Gly (GCC) -sg1 after total RNA extraction (no inj.-mixed total RNA w/Dr-Gly-sgRNA). ( E .

    Journal: Scientific Reports

    Article Title: A tRNA-based multiplex sgRNA expression system in zebrafish and its application to generation of transgenic albino fish

    doi: 10.1038/s41598-018-31476-5

    Figure Lengend Snippet: Precise excision of functional sgRNAs by the endogenous tRNA processing machinery in zebrafish embryos. ( A ) Introduction of mutations by the slc45a2-sg1 fused to tRNA at its 5′ end (5′-tRNA Gly (GCC)-sg1). (left) Heteroduplex mobility assay (HMA) by PAGE in uninjected embryos (no inj.), embryos injected with a mixture containing Cas9 mRNA and unfused slc45a2-sg1 (sgRNA), and embryos injected with a mixture containing Cas9 mRNA and 5′-tRNA Gly (GCC)-sg1. (right) Bar chart shows quantification of the ratio of heteroduplex bands. Data are shown as mean ± SEM (N = 4). Each dot represents data obtained from individual sample. Multiple heteroduplex bands were detected in PCR amplicons from wild-type tRNA-sgRNA (5′-tRNA Gly (GCC)-sg1) injected embryos (Dr-Gly WT and Os-Gly WT), whereas only a single band was detected in scrambled tRNA-sgRNA (5′-tRNA Gly (GCC)scr-sg1) injected embryos (Dr-Gly scr. and Os-Gly scr.). ( B ) (left) HMA by PAGE in uninjected embryos (no inj.), embryos injected with a mixture containing Cas9 mRNA and unfused slc45a2-sg1 (sgRNA), and embryos injected with a mixture containing Cas9 mRNA and slc45a2-sg1 fused to tRNA at its 3′-end (sg1-tRNA Gly (GCC)-3′). (right) A Bar chart showing the quantification of the ratio of heteroduplex bands. Data are shown as mean ± SEM (N = 3 for HDV and N = 4 for the others). Each dot represents data obtained from individual sample. Multiple heteroduplex bands were detected in PCR amplicons from both wild-type (WT) and scrambled (scr.) tRNA-sgRNAs. ( C ) (left) HMA by PAGE in uninjected embryos (no inj.), embryos injected with a mixture containing Cas9 mRNA and unfused slc45a2-sg1 (sgRNA), and embryos injected with a mixture containing Cas9 mRNA and slc45a2-sg1 fused to each of the eight species of tRNAs at its 5′-end. (right) A bar chart showing the quantification of the ratio of heteroduplex bands. Data are shown as mean ± SEM (N = 4 for sgRNA and N = 3 for tRNA-sgRNAs). Each dot represents data obtained from individual sample. Multiple heteroduplex bands were comparably detected from the embryos injected with slc45a2-sg1 fused to each of the eight tRNAs. ( D ) Detection of the mature sgRNA processed from 5′-Dr-tRNA Gly (GCC)-sg1 in vivo with cRT-PCR. The white arrowhead indicates the mature sgRNA, and the black arrowhead indicates the precursor RNA. The bands corresponding to the mature sgRNA are detected in 5′-Dr-tRNA Gly (GCC)-sg1 injected embryos (Dr-Gly inj.) but neither in 5′-Dr-tRNA Gly (GCC)scr-sg1 injected (Dr-Glyscr. inj.) nor in uninjected embryos mixed with 5′-Dr-tRNA Gly (GCC) -sg1 after total RNA extraction (no inj.-mixed total RNA w/Dr-Gly-sgRNA). ( E .

    Article Snippet: For cloning of other tRNA genes, a DNA fragment containing Bsa I site at the downstream end of the sgRNA scaffold was amplified by PCR, and cloned between the first Nde I site and the Apa I site of pUAS:Cas9T2AGFP;U6:sgRNA1;U6:sgRNA2 (Addgene plasmid 74009) to generate ptRNA-empty.

    Techniques: Functional Assay, Polyacrylamide Gel Electrophoresis, Injection, Polymerase Chain Reaction, In Vivo, RNA Extraction

    Comparison of the activities of 3xalb tRNA-sgRNAs carrying tRNAs and sgRNAs in different orders. ( A ) Schematic depiction of 3xalb tRNA-sgRNAs. 3 × -slc45a2-sgRNA-A (3xalb-A), the original; 3 × -slc45a2-sgRNA-B (3xalb-B); sg3 and sg4 were switched (bold italic); 3 × -slc45a2-sgRNA-C (3xalb-C), Asn and Lys tRNAs were switched (bold italic). ( B – D ) (left) Heteroduplex mobility assay (HMA) of PCR amplicons amplified from the target sequences of sg1 ( B ), sg3 ( C ), and sg4 ( D ) in embryos injected with a mixture containing Cas9 mRNA and each 3xalb tRNA-sgRNA. Embryos injected with single sgRNAs synthesized in vitro (slc45a2-sg1 in B, slc45a2-sg3 in C, and slc45a2-sg4 in D) and embryos simultaneously injected with three sgRNAs (sg1 + sg3 + sg4) were also analyzed. (right) Bar charts show quantification of the ratio of the heteroduplex bands. Data are shown as mean ± SEM (N = 3). Dots represent data obtained from individual samples. Means with the same letter are not significantly different ( P .

    Journal: Scientific Reports

    Article Title: A tRNA-based multiplex sgRNA expression system in zebrafish and its application to generation of transgenic albino fish

    doi: 10.1038/s41598-018-31476-5

    Figure Lengend Snippet: Comparison of the activities of 3xalb tRNA-sgRNAs carrying tRNAs and sgRNAs in different orders. ( A ) Schematic depiction of 3xalb tRNA-sgRNAs. 3 × -slc45a2-sgRNA-A (3xalb-A), the original; 3 × -slc45a2-sgRNA-B (3xalb-B); sg3 and sg4 were switched (bold italic); 3 × -slc45a2-sgRNA-C (3xalb-C), Asn and Lys tRNAs were switched (bold italic). ( B – D ) (left) Heteroduplex mobility assay (HMA) of PCR amplicons amplified from the target sequences of sg1 ( B ), sg3 ( C ), and sg4 ( D ) in embryos injected with a mixture containing Cas9 mRNA and each 3xalb tRNA-sgRNA. Embryos injected with single sgRNAs synthesized in vitro (slc45a2-sg1 in B, slc45a2-sg3 in C, and slc45a2-sg4 in D) and embryos simultaneously injected with three sgRNAs (sg1 + sg3 + sg4) were also analyzed. (right) Bar charts show quantification of the ratio of the heteroduplex bands. Data are shown as mean ± SEM (N = 3). Dots represent data obtained from individual samples. Means with the same letter are not significantly different ( P .

    Article Snippet: For cloning of other tRNA genes, a DNA fragment containing Bsa I site at the downstream end of the sgRNA scaffold was amplified by PCR, and cloned between the first Nde I site and the Apa I site of pUAS:Cas9T2AGFP;U6:sgRNA1;U6:sgRNA2 (Addgene plasmid 74009) to generate ptRNA-empty.

    Techniques: Polymerase Chain Reaction, Amplification, Injection, Synthesized, In Vitro

    Generation of transgenic albino zebrafish by using tRNA-based multiplexed sgRNA expression. ( A ) Structure of DNA construct used for the generation of transgenic albino zebrafish. Three distinct sgRNAs targeting the albino ( slc45a2 ) locus were cloned at the Bse RI site of an all-in-one Tol2 vector, pT2TS-ubb:Cas9;u6c:Dr-tRNA Gly (GCC)-sgRNA-scaffold, and are transcribed as a single polycistronic RNA under the zebrafish u6c promoter. Cas9 is driven by the ubb promoter, and its direction is opposite to that of the u6c:sgRNAs. ( B ) Representative images of the dorsal view of 3-dpf larvae derived from a founder fish (#11). Some larvae show severe albino phenotype (lower), whereas most larvae show normal pigmentation (upper). ( C ) The rate of F1 larvae showing albino phenotype at 3 dpf for each founder fish. Numbers in parentheses indicate the number of F1 larvae examined. ( D ) Transgenic ratio of F1 fish with albino phenotypes derived from two founders, F0#11 and F0#14. ( E ) Detection of mutations at multiple genomic sites of the slc45a2 locus in transgenic-albino larvae. (top) Genotyping of transgenic fish was performed by PCR using primers on SpCas9 genes. (middle three panels) Detection of mutations at multiple genomic sites of the slc45a2 locus by Heteroduplex mobility assay (HMA). Mutations were introduced in all the three targeting sites in a transgenic larva (lane#3) that showed severe albino phenotype. White asterisks on the HMA gel image of sg3 denote faint heteroduplex bands. (bottom) Bar charts show quantification of the ratio of the heteroduplex bands in sg1 and sg4. Data are shown as mean ± SEM (N = 3 for sever and mild, and N = 6 for normal). Dots represent data obtained from individual samples. Asterisks indicate significant differences ( P

    Journal: Scientific Reports

    Article Title: A tRNA-based multiplex sgRNA expression system in zebrafish and its application to generation of transgenic albino fish

    doi: 10.1038/s41598-018-31476-5

    Figure Lengend Snippet: Generation of transgenic albino zebrafish by using tRNA-based multiplexed sgRNA expression. ( A ) Structure of DNA construct used for the generation of transgenic albino zebrafish. Three distinct sgRNAs targeting the albino ( slc45a2 ) locus were cloned at the Bse RI site of an all-in-one Tol2 vector, pT2TS-ubb:Cas9;u6c:Dr-tRNA Gly (GCC)-sgRNA-scaffold, and are transcribed as a single polycistronic RNA under the zebrafish u6c promoter. Cas9 is driven by the ubb promoter, and its direction is opposite to that of the u6c:sgRNAs. ( B ) Representative images of the dorsal view of 3-dpf larvae derived from a founder fish (#11). Some larvae show severe albino phenotype (lower), whereas most larvae show normal pigmentation (upper). ( C ) The rate of F1 larvae showing albino phenotype at 3 dpf for each founder fish. Numbers in parentheses indicate the number of F1 larvae examined. ( D ) Transgenic ratio of F1 fish with albino phenotypes derived from two founders, F0#11 and F0#14. ( E ) Detection of mutations at multiple genomic sites of the slc45a2 locus in transgenic-albino larvae. (top) Genotyping of transgenic fish was performed by PCR using primers on SpCas9 genes. (middle three panels) Detection of mutations at multiple genomic sites of the slc45a2 locus by Heteroduplex mobility assay (HMA). Mutations were introduced in all the three targeting sites in a transgenic larva (lane#3) that showed severe albino phenotype. White asterisks on the HMA gel image of sg3 denote faint heteroduplex bands. (bottom) Bar charts show quantification of the ratio of the heteroduplex bands in sg1 and sg4. Data are shown as mean ± SEM (N = 3 for sever and mild, and N = 6 for normal). Dots represent data obtained from individual samples. Asterisks indicate significant differences ( P

    Article Snippet: For cloning of other tRNA genes, a DNA fragment containing Bsa I site at the downstream end of the sgRNA scaffold was amplified by PCR, and cloned between the first Nde I site and the Apa I site of pUAS:Cas9T2AGFP;U6:sgRNA1;U6:sgRNA2 (Addgene plasmid 74009) to generate ptRNA-empty.

    Techniques: Transgenic Assay, Expressing, Construct, Clone Assay, Plasmid Preparation, Derivative Assay, Fluorescence In Situ Hybridization, Polymerase Chain Reaction