Journal: PeerJ

Article Title: Regional fresh snowfall microbiology and chemistry are driven by geography in storm-tracked events, Colorado, USA

doi: 10.7717/peerj.5961

Figure Lengend Snippet: DNA concentrations from snow. Box plots of mean mass of gDNA extracted from replicate filter quadrants per milliliter of snow filtered. Error bars are standard errors, indicating technical variance. The dotted line represents the mean value across all samples and all snowstorms for the 2016–2017 snow season along the eastern Front Range in Colorado. Reported p -values are from a student’s t -test.

Article Snippet: Genomic DNA (gDNA) from Escherichia coli strain JM109 was used as a standard from a Femto Bacterial Quantification Kit (Zymo Research, Irvine, CA, USA) to calibrate amplification curves; seven standards, in addition to a no-template (negative) control (NTC), ranged from 2 × 10−5 to 20 ng of DNA per reaction well. qPCR reaction volumes were 20 μL of 1× Master Mix, 0.2 μM 334F (CCA GAC TCC TAC GGG AGG CAG C), 0.2 μM 519R (GWA TTA CCG CGG CKG CTG), and 2 μL volume of template DNA.

Techniques:

Journal: Nature

Article Title: Structure of a Naegleria Tet-like dioxygenase in complex with 5-methylcytosine DNA

doi: 10.1038/nature12905

Figure Lengend Snippet: Activity of NgTet1 on various DNA substrates a–c , The time courses (lanes 5–13) of the reactions using 32-bp DNA substrates containing 5mC (panel a ), 5hmC (panel b ) or 5caC (panel c ). Lanes 1–4: antibody sensitivity against 10 pmol of control oligonucleotides and 2 fold serial dilutions. Lanes 5–13: the rate of conversion appears to be the fastest for the reaction of 5mC to 5hmC, and decreases with each subsequent reaction: 5mC to 5hmC > 5hmC to 5fC > 5fC to 5caC. d , Activities of NgTet1 (20 µM) on genomic DNA (gDNA) of Hela cells (2.5 µg). After 1 h reaction, 87% of the products are 5caC in gDNA with the remaining being 5fC and 5hmC. The percentages were estimated from integration of the peaks in LC-MS traces. The mean and standard deviation (±s.e.m.) were estimated from three repeated experiments. e , Human thymine DNA glycosylase (TDG) excises 5fC and 5caC (but not 5mC and 5hmC) when paired with a guanine in a CpG sequence (lanes 1–4) (He et al., 2011; Maiti and Drohat, 2011; Hashimoto et al., 2012). After NgTet1 reactions with DNA substrates containing 5mC, 5hmC or 5fC, in the presence of αKG, the product DNA containing 5fC and 5caC becomes a substrate for TDG (lanes 6, 8 and 10), but not with NOG (lanes 5 and 7), again demonstrating the production of 5fC and 5caC by NgTet1. f , Activities of NgTet1 on 56-bp double-stranded (ds) DNA-2 with methylation on both strands (M/M) or single strand (hemi-methylated either on top M/C or bottom C/M strand) or single-stranded (ss) DNA (Reaction time 1 h and ±s.e.m. estimated from three repeats). We note that an in vitro activity of the mouse Tet1 catalytic domain on single-stranded DNA has also been observed (Zhang et al., 2012). g , LC-MS traces of a sample reaction mix on the hemi-methylated 5mCpG dsDNA-1 (top panel), reaction control with no enzyme (middle panel), and the standard deoxyribonucleoside mix (bottom panel). Arrows indicate peaks of 5mC, 5hmC, 5fC and 5caC. Identities of the peaks are confirmed by comparing the retention time with the standard as well as by mass spectrometry. Hashimoto, H., Hong, S., Bhagwat, A. S., Zhang, X. Cheng, X. Excision of 5-hydroxymethyluracil and 5-carboxylcytosine by the thymine DNA glycosylase domain: its structural basis and implications for active DNA demethylation. Nucleic Acids Res 40 , 10203–10214 (2012). He, Y. F. et al . Tet-mediated formation of 5-carboxylcytosine and its excision by TDG in mammalian DNA. Science 333 , 1303–1307 (2011). Maiti, A. Drohat, A. C. Thymine DNA glycosylase can rapidly excise 5-formylcytosine and 5-carboxylcytosine: potential implications for active demethylation of CpG sites. J Biol Chem 286 , 35334–35338 (2011). Zhang, L., Yu, M. He, C. Mouse Tet1 protein can oxidize 5mC to 5hmC and 5caC on single-stranded DNA. Acta Chimica Sinica 70 , 2123–2126 (2012).

Article Snippet: For quantitative analyses of various 5mC oxidative species, either the 56-bp hemi-methylated dsDNA-1 ( ) or genomic DNA (gDNA) of Hela cells (NEB #N4006S) ( ) were used as substrates.

Techniques: Activity Assay, Liquid Chromatography with Mass Spectroscopy, Standard Deviation, Sequencing, Methylation, In Vitro, Mass Spectrometry

Journal: Nature

Article Title: Structure of a Naegleria Tet-like dioxygenase in complex with 5-methylcytosine DNA

doi: 10.1038/nature12905

Figure Lengend Snippet: Pairwise comparison of NgTet1 and mammalian Tet1 a , Schematic representation of hTet1 C-terminal catalytic domain. b , Sequence alignment of NgTet1, hTet1 and mTet1. Labels above the sequences indicate that i for intra-molecular polar interaction; s for exposed surface residue; h for hydrophobic core; t for structural turn; α for αKG binding; m for metal ion coordination; P for DNA phosphate interaction; g for DNA base interaction with the orphaned guanine; G for DNA base interaction with the 3’ guanine to 5mC; C for 5mC interaction; a for active site residues (A212 and V293) near the methyl group of 5mC. c , Structure of NgTet1 with arrows indicating the two large insertions of mammalian Tet1. Highlighted is the charge-charge interaction between invariant K86 and E108. d , A kinked helix α4, owing to P172 (conserved among NgTet1, human and mouse Tet1, Tet2 and Tet3) located in the middle. f , Antibody detection of 5hmC in genomic DNA of HEK293T cells (top panel) expressing Flag tagged mouse Tet1 catalytic domain or its internal deletions (bottom panel). Top panel: Lane 1 is the 32-bp oligonucleotide containing a single 5hmC (20 pmol and 2 fold serial dilutions) and lanes 2–7 are the genomic DNA (500 ng and 2 fold serial dilutions). Bottom panel: Lane 1 is the molecular weight marker and Lanes 2 and 7 are the whole cell lysates with approximately equal amount of protein.

Article Snippet: For quantitative analyses of various 5mC oxidative species, either the 56-bp hemi-methylated dsDNA-1 ( ) or genomic DNA (gDNA) of Hela cells (NEB #N4006S) ( ) were used as substrates.

Techniques: Sequencing, Binding Assay, Expressing, Molecular Weight, Marker

Journal: Nature Communications

Article Title: CUTseq is a versatile method for preparing multiplexed DNA sequencing libraries from low-input samples

doi: 10.1038/s41467-019-12570-2

Figure Lengend Snippet: CUTseq validation. a Copy number profiles (NlaIII, 100 kb resolution) determined with CUTseq and NEBNext using gDNA extracted from ten different FPPE tumors. BRCA, breast cancer. COAD, colon adenocarcinoma. GIST, gastrointestinal stromal tumor. MELA, melanoma. ρ , Pearson’s correlation between matched profiles. b Pearson’s correlation ( ρ ) between the fraction of the genome (100 kb resolution) either amplified or deleted in each of the paired CUTseq and NEBNext samples shown in a . Each dot represents one pair of replicates. Dashed line: linear regression. c Partitioning of all the SNVs called in two replicate (Rep) exome capture experiments using SKBR3 cells gDNA and either CUTseq or a commercial kit for library preparation (Agilent), in multiple different annotated genomic regions. Up- and downstream indicate 5 kb windows before the start codons and after the stop codons of protein-coding genes, respectively. d Same as in c , but for different substitution types. e Overlap between the high-confidence SNVs (at least 50× coverage) called in the two CUTseq replicates shown in c , d . f Overlap between all the high-confidence SNVs identified by CUTseq vs. Agilent, after merging matched replicates shown in c , d . In both e and f , the percentages refer to the total number of SNVs in the union of the two sets. All the source data for this figure are provided as a Source Data file

Article Snippet: We then used I-DOT One to dispense first 5 ng diluted in 350 nl of gDNA extracted from HeLa cells, followed by 100 nl of 20 U/μl of HindIII (NEB, catalog number R3104) and 50 nl of CutSmart buffer (NEB, catalog number R3104), in 96 of the 384 wells.

Techniques: Amplification

Journal: Nature Communications

Article Title: CUTseq is a versatile method for preparing multiplexed DNA sequencing libraries from low-input samples

doi: 10.1038/s41467-019-12570-2

Figure Lengend Snippet: High-throughput CUTseq. a Front picture of the I-DOT One MC, low-volume non-contact dispensing device (Dispendix) that was used in this study, and timeline for high-throughput CUTseq library preparation. IVT, in vitro transcription. The total workflow takes ~8 h for a single person to prepare 1–2 libraries, each containing up to 96 samples. The dispensing step can be done either manually or using a liquid handling device such as I-DOT One. b Number of usable reads (after alignment and PCR duplicates removal) per sample, in one multiplexed CUTseq library prepared from 96 replicate samples ( n ) of HeLa cells gDNA (5 ng), using I-DOT One. c Distribution of the sequencing error rates in the 96 replicates ( n ) shown in b . d Copy number profiles (1 Mb resolution, averaged at arm level for visualization) of 88 replicates shown in b that yielded at least 300 K usable reads. The remaining eight samples were not included, as the number of usable reads was insufficient to perform reliable copy number calling. e Distribution of all possible ( n ) pairwise Pearson’s correlations between the copy number profiles shown in d . f Fractions of the genome either amplified (AMP) or deleted (AMP) in the 88 replicates ( n ) shown in d . Each dot represents one sample. Error bars indicate the median and interquartile range. All the source data for this figure are provided as a Source Data file

Article Snippet: We then used I-DOT One to dispense first 5 ng diluted in 350 nl of gDNA extracted from HeLa cells, followed by 100 nl of 20 U/μl of HindIII (NEB, catalog number R3104) and 50 nl of CutSmart buffer (NEB, catalog number R3104), in 96 of the 384 wells.

Techniques: High Throughput Screening Assay, In Vitro, Polymerase Chain Reaction, Sequencing, Amplification

Journal: Nature Communications

Article Title: CUTseq is a versatile method for preparing multiplexed DNA sequencing libraries from low-input samples

doi: 10.1038/s41467-019-12570-2

Figure Lengend Snippet: CUTseq implementation and reproducibility. a CUTseq workflow. (1) RE, restriction enzyme. T7, T7 phage promoter. IVT, in vitro transcription. RA5, RA3, SP7, and SP9: Illumina’s sequencing adapters. b BT474 cells copy number profiles (100 kb resolution). ρ , Pearson’s correlation. c Pearson’s correlation ( ρ ) between the copy number profiles (100 kb resolution) of five cancer cell lines digested with HindIII (rows) or NlaIII (columns). d Chr17 copy number profiles (NlaIII, 100 kb resolution) in two HER2-positive (SKBR3 and BT474) and one HER2-negative cell line (MCF7). ERBB2/HER2 is highlighted in red. e Copy number profiles (NlaIII, 100 kb resolution) in five replicates (Rep) from FFPE tumor samples. COAD, colon adenocarcinoma. MELA, melanoma. ρ , Pearson’s correlation. f Pearson’s correlation ( ρ ) between the replicates shown in e at different resolutions. Each dot represents one pair of replicates. Error bars indicate the median and interquartile range. g Pearson’s correlation ( ρ ) between the fraction of the genome (100 kb resolution) either amplified or deleted in the replicates (Rep) shown in e . Each dot represents one pair of replicates. Dashed line: linear regression. h , i Length of amplified (AMP) or deleted (DEL) genomic segments in Rep1 ( h ) and Rep2 ( i ) samples shown in e , at various resolutions. j Zoom-in view on chr9 q-arm in sample TRN4 shown in e . Arrows indicate focal amplifications detected only at 10 kb resolution in both replicates. Red: centromeric region. The p-arm is not shown. k Copy number profiles (NlaIII, 100 kb resolution) determined using 120 pg of gDNA extracted from one FFPE breast cancer (BRCA) sample and three different numbers of PCR cycles. l Pearson’s correlation ( ρ ) between copy number profiles (100 kb resolution) determined using different amounts of gDNA extracted from the sample shown in k . In all the profiles, gray dots represent individual genomic windows, whereas black lines indicate segmented genomic intervals after circular binary segmentation 37 . The numbers below each box indicate chromosomes from chr1 (leftmost) to chr22 (rightmost). In all the cases, TRN refers to the ID of Turin samples, as shown in Supplementary Table 2 . All the source data for this figure are provided as a Source Data file

Article Snippet: We then used I-DOT One to dispense first 5 ng diluted in 350 nl of gDNA extracted from HeLa cells, followed by 100 nl of 20 U/μl of HindIII (NEB, catalog number R3104) and 50 nl of CutSmart buffer (NEB, catalog number R3104), in 96 of the 384 wells.

Techniques: In Vitro, Sequencing, Formalin-fixed Paraffin-Embedded, Amplification, Polymerase Chain Reaction

Journal: eLife

Article Title: A complete toolset for the study of Ustilago bromivora and Brachypodium sp. as a fungal-temperate grass pathosystem

doi: 10.7554/eLife.20522

Figure Lengend Snippet: Mating type bias of U. bromivora. ( A ) Diagnostic PCR on genomic DNA derived from spores and spore progeny to test for mating type 1 (MAT-1) or mating type 2 (MAT-2). To this end, primers targeting a conserved region of pheromone receptor alleles 1 ( pra1 ) and 2 ( pra2 ), adapted from Kellner et al. (2011) , were used. Sizes of PCR products are indicated with arrow heads. Representative PCR results are shown. ( B ) Quantification of mating type alleles of 225 progeny derived from 21 spores by PCR as described in ( A ). ( C ) Schematic model illustrating the observed mating type bias phenomenon. DOI: http://dx.doi.org/10.7554/eLife.20522.007

Article Snippet: Genomic DNA extraction for Single Molecule Real-Time (PacBio) and Illumina sequencing Genomic DNA (gDNA) extraction was performed as previously described for U. maydis ( ).

Techniques: Diagnostic Assay, Polymerase Chain Reaction, Derivative Assay

Journal: BMC Genomics

Article Title: The complete genome sequence of the nitrile biocatalyst Rhodocccus rhodochrous ATCC BAA-870

doi: 10.1186/s12864-019-6405-7

Figure Lengend Snippet: Protein function breakdown of Rhodococcus rhodochrous ATCC BAA-870 based on BASys annotation COG classifications. Unknown proteins form the majority of proteins in the BASys annotated genome, and make up 55 and 59% respectively of genes in the a chromosome and b plasmid. For simplicity, functional categories less than 0.02% are not included in the graphic. Letters refer to COG functional categories, with one-letter abbreviations: C - Energy production and conversion; D - Cell division and chromosome partitioning; E - Amino acid transport and metabolism; F - Nucleotide transport and metabolism; G - Carbohydrate transport and metabolism; H - Coenzyme metabolism; I - Lipid metabolism; J - Translation, ribosomal structure and biogenesis; K - Transcription; L - DNA replication, recombination and repair; M - Cell envelope biogenesis, outer membrane; N - Secretion, motility and chemotaxis; O - Posttranslational modification, protein turnover, chaperones; P - Inorganic ion transport and metabolism; Q - Secondary metabolites biosynthesis, transport and catabolism; R - General function prediction only; S - COG of unknown function; T - Signal transduction mechanisms

Article Snippet: Illumina sequencing Genomic DNA of R. rhodochrous BAA-870 was used to obtain two libraries with different insert sizes.

Techniques: Plasmid Preparation, Functional Assay, Chemotaxis Assay, Modification, Transduction

Journal: Nature genetics

Article Title: A role for the bacterial GATC methylome in antibiotic stress survival

doi: 10.1038/ng.3530

Figure Lengend Snippet: Kinetics of the Dam methylome during normal growth or under antibiotic stress Genomic DNA extracted from wild-type E. coli MG1655 growing with or without ampicillin (2.5 μg/mL) was analyzed by SMRT sequencing for genome-wide GATC methylation over 4h. Methylation is shown as the average fraction of sequenced molecules methylated for each GATC site, or ‘frac;’ dottted red lines indicate the limit of detection (0.25) a. Representative frac data for untreated bacteria; X-axis, position on selected genomic segment; arrows non-methylated (black) or hemimethylated (orange) GATC sites. b. Genome-wide frac distributions during growth in LB (solid line, gray fill) or ampicillin (dashed line, no fill) over time; mean frac ± SD are shown. c. Genome-wide kinetics of adenine methylation at GATC sites during log-to-stationary phase growth in LB; black lines indicate frac values as shown in (a); colored hashes show the position of genes either strands; the innermost ring is a reference map of genomic positions in megabases; oriC, origin of replication; colored indicators on the outer most ring highlight sites detected as non-methylated (frac

Article Snippet: Genomic DNA extraction and PacBio sequencing Genomic DNA (gDNA) was extracted from E. coli K12 MG1655 LB cultures grown in the presence or absence of ampicillin using the GenElute Bacterial Genomic DNA Extraction Kit (Sigma).

Techniques: Sequencing, Genome Wide, Methylation

Journal: BMC Medical Genetics

Article Title: An intronic alteration of the fibroblast growth factor 10 gene causing ALSG-(aplasia of lacrimal and salivary glands) syndrome

doi: 10.1186/1471-2350-9-114

Figure Lengend Snippet: a: A heterozygous sequence variation in the terminal nucleotide of intron 2 of the FGF10 gene (g.85478 corresponding to c.430-1, G > A) was detected which alters the consensus motif for splice acceptor site recognition . The upper panel shows a representative electropherogram of a healthy individual. The middle and the lower panel demonstrate the sequence variation in genomic DNA derived from the patient and his brother. The changed nucleotide is marked by an arrow. 2b: Chart showing the exon/intron structure of the FGF10 gene. The characteristic polypyrimidine stretch and the consensus acceptor site are shown. The changed nucleotide is marked by an arrow.

Article Snippet: Sequence analysis of the FGF10 gene For sequence analysis of the FGF10 gene, blood samples from both patient and his brother, and the control group were obtained, and genomic DNA (gDNA) was extracted from PBMCs using the QIAamp Blood Kit according to the manufacturer's protocols (Qiagen, Hilden, Germany).

Techniques: Sequencing, Derivative Assay

Journal: Molecular Biology of the Cell

Article Title: Regulation of Membrane Trafficking by a Novel Cdc42-related Protein in Caenorhabditis elegans Epithelial Cells

doi: 10.1091/mbc.E04-08-0760

Figure Lengend Snippet: Genetic characterization of crp-1(ok685) mutant. (A) Localization of crp-1 transcribed sequence and crp-1(ok685) deletion on chromosome V. crp-1 exons (squares, numbered from 1 to 4) and introns (lines) are indicated as well as translated sequences (black squares) in both N2 and crp-1(ok685) containing RB855 strain. Genomic DNA fragment fused to GFP and used to generate CRP-1::GFP expressing animals is indicated by an arrowed line. (B) crp-1 sequence from ATG to stop codon were amplified from N2 and RB855 genomic DNA (gDNA) and cDNA (cDNA) and separated by electrophoresis in agarose gel. Size of DNA fragments is indicated in base pairs (bp).

Article Snippet: To position deletion breakpoints in crp-1(ok685) mutant, genomic DNA (gDNA) was purified from crp-1(ok685) animal using DNAzol reagent (Invitrogen) according to the manufacturer's instructions and cDNA was synthesized using thermoscript RT-PCR system (Invitrogen) after purification of total crp-1(ok685) RNA using RNAzol (Invitrogen). crp-1 coding sequence was then PCR amplified from both crp-1(ok685) gDNA and cDNA using specific primers (5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTGGAGAACAAATTGAAATTGGTAG/5′-GGGGACCACTTTGTACAAGAAAGCTGGGTATCAAAGTATTGTACAACAAGGATTTGG), inserted into pDONR201 by BP recombination and sequenced.

Techniques: Mutagenesis, Sequencing, Expressing, Amplification, Electrophoresis, Agarose Gel Electrophoresis

Journal: The Journal of Experimental Medicine

Article Title: CD83 increases MHC II and CD86 on dendritic cells by opposing IL-10-driven MARCH1-mediated ubiquitination and degradation

doi: 10.1084/jem.20092203

Figure Lengend Snippet: ENU mouse mutation, anubis , eliminating the CD83 TM segment. (A) Percentage of CD4 + and CD8 + lymphocytes in spleen of individual anu/anu or anu/+ mice (dots), with means (columns) and statistical comparison by Student’s t test. Data are representative of three independent experiments. (B) Thymocytes from anu/+ (shaded) or anu/anu mice were stained with antibodies to CD4, CD8, and TCRβ. Histograms show CD4 and TCRβ on CD4 + CD8 + (DP) thymocytes. Scatter plots show CD4 and TCRβ geometric mean fluorescence intensity (MFI) of DP thymocytes from individual anu/anu or anu /+ mice, with means (columns) and statistical comparison by Student’s t test. Data are representative of two independent experiments. (C) Genomic DNA sequence traces across the Cd83 exon 4-intron 4 boundary (dashed line). Arrow shows mutated nucleotide. Data are representative from three independent samples. (D) cDNA sequences showing the skipped exon 4 in the Cd83 anu/anu mutant transcript. Data are representative of three independent samples. (E) Amino acid sequence encoded by Cd83 anu/anu mRNAs, showing the frameshift and premature stop codons in the mutant protein. (F) Cell surface or total CD83 expression on 6-d GM-CSF cultures of BM-derived CD11c + DCs from Cd83 +/+ and Cd83 anu/anu mice, either unstimulated or stimulated with 1 µg/ml LPS during the last 16–20 h of culture. Data are representative of two independent experiments, each done using two individual animals.

Article Snippet: The following primers were used for sequencing (Geneworks): For gDNA sequencing, CD83e4F, 5′-GGTAGTCAACAACGCTGCAA-3′, and CD83e4R, 5′-TGCCTAACCTCACAGGCTCT-3′; For cDNA sequencing, CD83RNAfor, 5′-GCCTCCAGCTCCTGTTTCTA-3′, CD83RNArev, 5′-GAAAGGTTGCCATCTGAGGA-3′.

Techniques: Mutagenesis, Mouse Assay, Staining, Fluorescence, Sequencing, Expressing, Derivative Assay