rt-pcr analysis rna extraction Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Thermo Fisher ribonucleic acid rna
    Effects of PSK and docetaxel treatments on mRNA expression of markers of antitumor immune response. Groups of mice (n=8 control; n=5 docetaxel; n= 6 PSK; n=4 PSK + docetaxel) bearing established TRAMP-C2 tumors (12 days) were treated with either oral saline, subtherapeutic dose of docetaxel (5 mg/kg twice weekly), oral gavage of PSK (300 mg/kg), or a combination of docetaxel and PSK. <t>RNA</t> was extracted from isolated tumors and real-time RT-PCR performed using primers and probes for several different cytokines and antitumor immune response markers. Shown are the effects of the different treatment groups on mRNA expression of <t>IFN-γ</t> (A), IL-2 (B), and TNF-α (C). The values shown are relative cytokine mRNA per 1,000 copies of β-actin. Mice treated with PSK, either alone (p=0.04) or with docetaxel (p=0.01) significantly induced IFN-γ mRNA expression in TRAMP-C2 tumors compared to saline control.
    Ribonucleic Acid Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 419 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ribonucleic acid rna/product/Thermo Fisher
    Average 96 stars, based on 419 article reviews
    Price from $9.99 to $1999.99
    ribonucleic acid rna - by Bioz Stars, 2020-07
    96/100 stars
      Buy from Supplier

    99
    Millipore rt pcr analysis total rna extraction
    IL-33 content and IL-33-positive cells in P29 subcutaneous tumours. ( a ) IL-33 content in the lysates of normal tissues (liver, lung and spleen; n =3), A11 tumour tissues ( n =5) and P29 tumour tissues ( n =5). Bars, S.D. ( b ) IL-33 content in P29 tumour tissues established in B6-wild-type and in IL-33 −/− mice. ( c ) IL-33-positive cells in P29 tumours. Cryosections of P29 and A11 tumours were stained with the goat anti-IL-33 antibody followed by Alexa Fluor 488-conjugated chicken anti-goat IgG. The nuclei were counterstained with DAPI. The arrows show the cells with cytoplasmic and nuclear IL-33 staining. Scale bars, 50 μm. ( d ) The number of IL-33-positive cells per field (1 mm 2 ) in P29 tumour tissues established in B6-wild-type and in IL-33 −/− mice. n =20. ( e ) The effect of various cytokines on IL-33 expression in P29 and A11 cells. The cells were treated with vehicle alone, rIL-33 (10 ng/ml), rIL-1 β (10 ng/ml), rIL-4 (10 ng/ml), rIL-6 (10 ng/ml), rIFN- γ (10 ng/ml), rTNF- α (10 ng/ml) and rTRAIL (10 ng/ml) for 2 days. Total <t>RNA</t> was isolated and subjected to <t>qRT-PCR.</t> Bars: SD; * P
    Rt Pcr Analysis Total Rna Extraction, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 74 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rt pcr analysis total rna extraction/product/Millipore
    Average 99 stars, based on 74 article reviews
    Price from $9.99 to $1999.99
    rt pcr analysis total rna extraction - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    91
    TaKaRa reverse transcription polymerase chain reaction rt pcr analysis rna extraction
    IL-33 content and IL-33-positive cells in P29 subcutaneous tumours. ( a ) IL-33 content in the lysates of normal tissues (liver, lung and spleen; n =3), A11 tumour tissues ( n =5) and P29 tumour tissues ( n =5). Bars, S.D. ( b ) IL-33 content in P29 tumour tissues established in B6-wild-type and in IL-33 −/− mice. ( c ) IL-33-positive cells in P29 tumours. Cryosections of P29 and A11 tumours were stained with the goat anti-IL-33 antibody followed by Alexa Fluor 488-conjugated chicken anti-goat IgG. The nuclei were counterstained with DAPI. The arrows show the cells with cytoplasmic and nuclear IL-33 staining. Scale bars, 50 μm. ( d ) The number of IL-33-positive cells per field (1 mm 2 ) in P29 tumour tissues established in B6-wild-type and in IL-33 −/− mice. n =20. ( e ) The effect of various cytokines on IL-33 expression in P29 and A11 cells. The cells were treated with vehicle alone, rIL-33 (10 ng/ml), rIL-1 β (10 ng/ml), rIL-4 (10 ng/ml), rIL-6 (10 ng/ml), rIFN- γ (10 ng/ml), rTNF- α (10 ng/ml) and rTRAIL (10 ng/ml) for 2 days. Total <t>RNA</t> was isolated and subjected to <t>qRT-PCR.</t> Bars: SD; * P
    Reverse Transcription Polymerase Chain Reaction Rt Pcr Analysis Rna Extraction, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse transcription polymerase chain reaction rt pcr analysis rna extraction/product/TaKaRa
    Average 91 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    reverse transcription polymerase chain reaction rt pcr analysis rna extraction - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    91
    Thermo Fisher rt pcr analysis a trizol rna extraction kit
    IL-33 content and IL-33-positive cells in P29 subcutaneous tumours. ( a ) IL-33 content in the lysates of normal tissues (liver, lung and spleen; n =3), A11 tumour tissues ( n =5) and P29 tumour tissues ( n =5). Bars, S.D. ( b ) IL-33 content in P29 tumour tissues established in B6-wild-type and in IL-33 −/− mice. ( c ) IL-33-positive cells in P29 tumours. Cryosections of P29 and A11 tumours were stained with the goat anti-IL-33 antibody followed by Alexa Fluor 488-conjugated chicken anti-goat IgG. The nuclei were counterstained with DAPI. The arrows show the cells with cytoplasmic and nuclear IL-33 staining. Scale bars, 50 μm. ( d ) The number of IL-33-positive cells per field (1 mm 2 ) in P29 tumour tissues established in B6-wild-type and in IL-33 −/− mice. n =20. ( e ) The effect of various cytokines on IL-33 expression in P29 and A11 cells. The cells were treated with vehicle alone, rIL-33 (10 ng/ml), rIL-1 β (10 ng/ml), rIL-4 (10 ng/ml), rIL-6 (10 ng/ml), rIFN- γ (10 ng/ml), rTNF- α (10 ng/ml) and rTRAIL (10 ng/ml) for 2 days. Total <t>RNA</t> was isolated and subjected to <t>qRT-PCR.</t> Bars: SD; * P
    Rt Pcr Analysis A Trizol Rna Extraction Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rt pcr analysis a trizol rna extraction kit/product/Thermo Fisher
    Average 91 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    rt pcr analysis a trizol rna extraction kit - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    99
    Millipore rna sequencing total rna
    Global changes in the transcriptome profiles in <t>Camelina</t> transgenic lines and wild-type developing seeds. a The number of DEGs and the regulation in DGAT1 and GPD1 lines relative to that in WT is summarized. b Principal component analysis (PCA) indicates the variability of <t>RNA-Seq</t> datasets between WT and transgenic lines in the indicated time points after flowering, and c Venn diagram showing the overlapped relationships between DEGs in DGAT1 and GPD1 lines as compared to WT data. DEGs, differentially expressed genes, WT-15, GPD1–15, and DGAT1–15 indicate the wild-type and transgenic lines data of developing seeds harvested at 10–15 DAF, whereas WT-21, GPD1–21, and DGAT1–21 indicate the wild-type and transgenic lines data of developing seeds harvested at 16–21 DAF. Gaussian and EdgeR indicate the two pipelines analysis platforms used to determine the DEGs. DAF, days after flowering. WT, wild-type; GPD1, lines overexpressing ScGPD1 gene; and DGAT1, lines overexpressing AtDGAT1 gene
    Rna Sequencing Total Rna, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 86 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna sequencing total rna/product/Millipore
    Average 99 stars, based on 86 article reviews
    Price from $9.99 to $1999.99
    rna sequencing total rna - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher rt pcr total rna
    Ig gene rearrangement and transcription in μMT mice liver epithelial cells. ( A ) Northern blot analysis. Total <t>RNA</t> from liver cells of three μMT mice and WT spleen cells (positive control) were transferred to nylon membrane, and probed with probes to constant region of Igμ and Igκ; 28 s and 18 s RNA were shown by DNA agarose gel electrophoresis. ( B ) In situ hybridization analysis was shown for detection of Ig μ and Ig κ transcripts in μMT mice with antisense or sense probes for C region of μ chain or J-C region of κ chain. ( C ) a It was shown for the primer design of Ig μ variable region, Ig κ variable region and Igλ; b Sorted liver epithelial cells from two μMT mice were analyzed for Ig rearrangement and transcription by <t>RT-PCR.</t> WT spleen cells were used as the positive control. Variable region and constant region of heavy chain (μ, α, δ, γ, ε) and light chain (κ, λ), CD20 and GAPDH were amplified; “1, 2” represented two samples of sorted μMT liver epithelial cells.
    Rt Pcr Total Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 12883 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rt pcr total rna/product/Thermo Fisher
    Average 99 stars, based on 12883 article reviews
    Price from $9.99 to $1999.99
    rt pcr total rna - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher quantitative reverse transcription polymerase chain reaction rt pcr trizol reagent
    MiR-125b-mediated STAT3 downregulation in SOD1-G93A mouse microglia. ( a ) The two minimum free energy duplexes of miR-125b-5p and 3′-UTR of mouse STAT3 (NM_011486.4) as predicted by <t>RNA</t> hybrid. ( b ) Western blotting with anti-STAT3 antibody of total lysates from empty vector and pprime-miR-125b infected microglia at 96 hours post virus transduction. β -actin was used for protein normalization. ( c ) Semiquantitative <t>RT-PCR</t> using specific primers for STAT3 and β -actin mRNAs of total RNA from nt and SOD1-G93A microglia. β -actin was used for normalization. ( d ) Western blotting with anti-STAT3 antibody of total lysates from nt and SOD1-G93A microglia. β -actin was used for protein normalization
    Quantitative Reverse Transcription Polymerase Chain Reaction Rt Pcr Trizol Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 300 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative reverse transcription polymerase chain reaction rt pcr trizol reagent/product/Thermo Fisher
    Average 99 stars, based on 300 article reviews
    Price from $9.99 to $1999.99
    quantitative reverse transcription polymerase chain reaction rt pcr trizol reagent - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher semiquantitative reverse transcription polymerase chain reaction rt pcr analysis total cellular rna
    MiR-125b-mediated STAT3 downregulation in SOD1-G93A mouse microglia. ( a ) The two minimum free energy duplexes of miR-125b-5p and 3′-UTR of mouse STAT3 (NM_011486.4) as predicted by <t>RNA</t> hybrid. ( b ) Western blotting with anti-STAT3 antibody of total lysates from empty vector and pprime-miR-125b infected microglia at 96 hours post virus transduction. β -actin was used for protein normalization. ( c ) Semiquantitative <t>RT-PCR</t> using specific primers for STAT3 and β -actin mRNAs of total RNA from nt and SOD1-G93A microglia. β -actin was used for normalization. ( d ) Western blotting with anti-STAT3 antibody of total lysates from nt and SOD1-G93A microglia. β -actin was used for protein normalization
    Semiquantitative Reverse Transcription Polymerase Chain Reaction Rt Pcr Analysis Total Cellular Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/semiquantitative reverse transcription polymerase chain reaction rt pcr analysis total cellular rna/product/Thermo Fisher
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    semiquantitative reverse transcription polymerase chain reaction rt pcr analysis total cellular rna - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    88
    TaKaRa real time reverse transcription polymerase chain reaction rt pcr analysis
    Histone deacetylases-3 (HDAC3) expression in breast cancer. (A) Real-time reverse transcription polymerase chain reaction <t>(RT-PCR)</t> was performed to analyze of messenger <t>RNA</t> (mRNA) expression of HDAC3 in breast cancer tissue of 15 fresh specimens and their paired normal samples. (B) Representative figures of HDAC3 protein expression in adjacent normal tissue (left) and breast cancer tissue (right) using immunohistochemical staining (immunohistochemistry for HDAC3, ×200). (C) Immunofluorescence showed that HDAC3 expression was mainly localized in the cell nucleus in MCF7 cell line. (D) RT-PCR was employed to analyze of mRNA expression of HDAC3 in breast cancer cell lines and normal epithelial breast MCF10A cells. (E) Western blotting analysis of HDAC3 protein expression in breast cancer cell lines and normal epithelial breast MCF10A cells. (F) Association between HDAC3 expression and the prognosis of breast cancer patients. DAPI=4′,6-diamidino-2-phenylindole. * p
    Real Time Reverse Transcription Polymerase Chain Reaction Rt Pcr Analysis, supplied by TaKaRa, used in various techniques. Bioz Stars score: 88/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time reverse transcription polymerase chain reaction rt pcr analysis/product/TaKaRa
    Average 88 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    real time reverse transcription polymerase chain reaction rt pcr analysis - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    Image Search Results


    Effects of PSK and docetaxel treatments on mRNA expression of markers of antitumor immune response. Groups of mice (n=8 control; n=5 docetaxel; n= 6 PSK; n=4 PSK + docetaxel) bearing established TRAMP-C2 tumors (12 days) were treated with either oral saline, subtherapeutic dose of docetaxel (5 mg/kg twice weekly), oral gavage of PSK (300 mg/kg), or a combination of docetaxel and PSK. RNA was extracted from isolated tumors and real-time RT-PCR performed using primers and probes for several different cytokines and antitumor immune response markers. Shown are the effects of the different treatment groups on mRNA expression of IFN-γ (A), IL-2 (B), and TNF-α (C). The values shown are relative cytokine mRNA per 1,000 copies of β-actin. Mice treated with PSK, either alone (p=0.04) or with docetaxel (p=0.01) significantly induced IFN-γ mRNA expression in TRAMP-C2 tumors compared to saline control.

    Journal: International Journal of Oncology

    Article Title: Polysaccharide-K augments docetaxel-induced tumor suppression and antitumor immune response in an immunocompetent murine model of human prostate cancer

    doi: 10.3892/ijo.2011.1292

    Figure Lengend Snippet: Effects of PSK and docetaxel treatments on mRNA expression of markers of antitumor immune response. Groups of mice (n=8 control; n=5 docetaxel; n= 6 PSK; n=4 PSK + docetaxel) bearing established TRAMP-C2 tumors (12 days) were treated with either oral saline, subtherapeutic dose of docetaxel (5 mg/kg twice weekly), oral gavage of PSK (300 mg/kg), or a combination of docetaxel and PSK. RNA was extracted from isolated tumors and real-time RT-PCR performed using primers and probes for several different cytokines and antitumor immune response markers. Shown are the effects of the different treatment groups on mRNA expression of IFN-γ (A), IL-2 (B), and TNF-α (C). The values shown are relative cytokine mRNA per 1,000 copies of β-actin. Mice treated with PSK, either alone (p=0.04) or with docetaxel (p=0.01) significantly induced IFN-γ mRNA expression in TRAMP-C2 tumors compared to saline control.

    Article Snippet: Cytokine and cytolytic gene and Foxp3 mRNA expression To assess expression of IFN-γ, IL-2, TNF-α, TGF-β, perforin, granzyme B and FoxP3 genes, ribonucleic acid (RNA) was isolated from tumors using the RNAqueous4PCR kit (Applied Biosystems/Ambion, Austin, TX).

    Techniques: Expressing, Mouse Assay, Isolation, Quantitative RT-PCR

    IL-33 content and IL-33-positive cells in P29 subcutaneous tumours. ( a ) IL-33 content in the lysates of normal tissues (liver, lung and spleen; n =3), A11 tumour tissues ( n =5) and P29 tumour tissues ( n =5). Bars, S.D. ( b ) IL-33 content in P29 tumour tissues established in B6-wild-type and in IL-33 −/− mice. ( c ) IL-33-positive cells in P29 tumours. Cryosections of P29 and A11 tumours were stained with the goat anti-IL-33 antibody followed by Alexa Fluor 488-conjugated chicken anti-goat IgG. The nuclei were counterstained with DAPI. The arrows show the cells with cytoplasmic and nuclear IL-33 staining. Scale bars, 50 μm. ( d ) The number of IL-33-positive cells per field (1 mm 2 ) in P29 tumour tissues established in B6-wild-type and in IL-33 −/− mice. n =20. ( e ) The effect of various cytokines on IL-33 expression in P29 and A11 cells. The cells were treated with vehicle alone, rIL-33 (10 ng/ml), rIL-1 β (10 ng/ml), rIL-4 (10 ng/ml), rIL-6 (10 ng/ml), rIFN- γ (10 ng/ml), rTNF- α (10 ng/ml) and rTRAIL (10 ng/ml) for 2 days. Total RNA was isolated and subjected to qRT-PCR. Bars: SD; * P

    Journal: Cell Death & Disease

    Article Title: Interleukin-33 enhances programmed oncosis of ST2L-positive low-metastatic cells in the tumour microenvironment of lung cancer

    doi: 10.1038/cddis.2015.418

    Figure Lengend Snippet: IL-33 content and IL-33-positive cells in P29 subcutaneous tumours. ( a ) IL-33 content in the lysates of normal tissues (liver, lung and spleen; n =3), A11 tumour tissues ( n =5) and P29 tumour tissues ( n =5). Bars, S.D. ( b ) IL-33 content in P29 tumour tissues established in B6-wild-type and in IL-33 −/− mice. ( c ) IL-33-positive cells in P29 tumours. Cryosections of P29 and A11 tumours were stained with the goat anti-IL-33 antibody followed by Alexa Fluor 488-conjugated chicken anti-goat IgG. The nuclei were counterstained with DAPI. The arrows show the cells with cytoplasmic and nuclear IL-33 staining. Scale bars, 50 μm. ( d ) The number of IL-33-positive cells per field (1 mm 2 ) in P29 tumour tissues established in B6-wild-type and in IL-33 −/− mice. n =20. ( e ) The effect of various cytokines on IL-33 expression in P29 and A11 cells. The cells were treated with vehicle alone, rIL-33 (10 ng/ml), rIL-1 β (10 ng/ml), rIL-4 (10 ng/ml), rIL-6 (10 ng/ml), rIFN- γ (10 ng/ml), rTNF- α (10 ng/ml) and rTRAIL (10 ng/ml) for 2 days. Total RNA was isolated and subjected to qRT-PCR. Bars: SD; * P

    Article Snippet: RNA extraction and RT-PCR analysis Total RNA extraction with TRIzol reagent (Sigma-Aldrich) and semiquantitative RT-PCR were performed as described previously.

    Techniques: Mouse Assay, Staining, Expressing, Isolation, Quantitative RT-PCR

    Seasonal expression of Vegfa and VegfR2 in the ovine MBH and pituitary. All values on the y-axis are normalized relative levels of expression (qPCR) or optical density (ISH). A / 1 st Experiment: qRT-PCR for Vegfa and VegfR2 on MBH cDNA samples from OVX+E2 ewes maintained under natural conditions and culled in May, August and November. Post-hoc Tukey test: **p

    Journal: PLoS ONE

    Article Title: Anti-angiogenic VEGFAxxxb transcripts are not expressed in the medio-basal hypothalamus of the seasonal sheep

    doi: 10.1371/journal.pone.0197123

    Figure Lengend Snippet: Seasonal expression of Vegfa and VegfR2 in the ovine MBH and pituitary. All values on the y-axis are normalized relative levels of expression (qPCR) or optical density (ISH). A / 1 st Experiment: qRT-PCR for Vegfa and VegfR2 on MBH cDNA samples from OVX+E2 ewes maintained under natural conditions and culled in May, August and November. Post-hoc Tukey test: **p

    Article Snippet: RNA extraction, standard RT-PCR and qRT-PCR analysis RNA extraction was performed on each MBH block or PD (see ) using TriReagent (Sigma).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, In Situ Hybridization, Quantitative RT-PCR

    SDOS binds and regulates translation of mRNAs encoding for ciliary components. ( A ) RT-qPCR of Cc2D2a, Kif7 and Tmem107 mRNAs from HeLa cells upon 24 h of SDOS-eGFP or eGFP induction (βActin used as the internal control). Data are expressed as mean ± S.E.M. from four independent experiments with technical triplicate each. Numbers above bars indicate the statistical significance ( P -value), based on one-sample t -test. Red line indicates expression level of the relative eGFP control. ( B ) Representative results of RT-qPCR from RIP independent experiments to validate iCLIP data. RNA enrichment was normalized to a spike-in control (red line). Actin was used as negative control showing no enrichment. ( C and D ) WB analysis of HeLa cell extracts following SDOS-eGFP or eGFP (24 h) and sh-GFP or sh-SDOS (48 h) induction (C), with relative densitometric analysis (D), calculated by assuming protein levels of the control equal 1. The P -value in the graph indicate the statistical significance based on one-sample t -test ( n = 3).

    Journal: Nucleic Acids Research

    Article Title: Protein Syndesmos is a novel RNA-binding protein that regulates primary cilia formation

    doi: 10.1093/nar/gky873

    Figure Lengend Snippet: SDOS binds and regulates translation of mRNAs encoding for ciliary components. ( A ) RT-qPCR of Cc2D2a, Kif7 and Tmem107 mRNAs from HeLa cells upon 24 h of SDOS-eGFP or eGFP induction (βActin used as the internal control). Data are expressed as mean ± S.E.M. from four independent experiments with technical triplicate each. Numbers above bars indicate the statistical significance ( P -value), based on one-sample t -test. Red line indicates expression level of the relative eGFP control. ( B ) Representative results of RT-qPCR from RIP independent experiments to validate iCLIP data. RNA enrichment was normalized to a spike-in control (red line). Actin was used as negative control showing no enrichment. ( C and D ) WB analysis of HeLa cell extracts following SDOS-eGFP or eGFP (24 h) and sh-GFP or sh-SDOS (48 h) induction (C), with relative densitometric analysis (D), calculated by assuming protein levels of the control equal 1. The P -value in the graph indicate the statistical significance based on one-sample t -test ( n = 3).

    Article Snippet: RNA extraction and RT-qPCR analysis Total RNA extraction was performed by using the TRI Reagent (Sigma-Aldrich, product code T9424) following the manufacturer’s instruction.

    Techniques: Quantitative RT-PCR, Expressing, Negative Control, Western Blot

    Global transcriptional changes in lvr mutants. (A) Venn diagram depicting the number of differentially expressed genes in lvr mutants, lvrA/B (M1529) and lvrB (M1419) with ± log 2-fold change cut-off and P ≤ 0.05. (B) Validation of RNA-Seq Analysis was performed by RT-qPCR and correlation coefficient has been indicated. (C) Heatmap depicting clusters of differentially expressed genes in lvr mutants when compared to L. interrogans Manilae L495 WT. Computationally we identified five arbitrary clusters that are marked in the heat map. (D) Lvr regulatory functions inferred from transcriptome analysis of lvr mutants, lvrA/B (M1529) and lvrB (M1419). Solid and dashed lines depict positive regulation and negative regulation, respectively. Inferences are based on relative abundance of COG categories ( > 5%) across each cluster. (E) Functional categorization of upregulated and downregulated genes in lvr mutants, lvrA/B (M1529) and lvrB (M1419) during late-log phase of growth at 30°C. Percent distribution is calculated for the total number of differentially expressed genes (according to the RNA-Seq analysis; log 2-fold change, P

    Journal: Frontiers in Cellular and Infection Microbiology

    Article Title: Lvr, a Signaling System That Controls Global Gene Regulation and Virulence in Pathogenic Leptospira

    doi: 10.3389/fcimb.2018.00045

    Figure Lengend Snippet: Global transcriptional changes in lvr mutants. (A) Venn diagram depicting the number of differentially expressed genes in lvr mutants, lvrA/B (M1529) and lvrB (M1419) with ± log 2-fold change cut-off and P ≤ 0.05. (B) Validation of RNA-Seq Analysis was performed by RT-qPCR and correlation coefficient has been indicated. (C) Heatmap depicting clusters of differentially expressed genes in lvr mutants when compared to L. interrogans Manilae L495 WT. Computationally we identified five arbitrary clusters that are marked in the heat map. (D) Lvr regulatory functions inferred from transcriptome analysis of lvr mutants, lvrA/B (M1529) and lvrB (M1419). Solid and dashed lines depict positive regulation and negative regulation, respectively. Inferences are based on relative abundance of COG categories ( > 5%) across each cluster. (E) Functional categorization of upregulated and downregulated genes in lvr mutants, lvrA/B (M1529) and lvrB (M1419) during late-log phase of growth at 30°C. Percent distribution is calculated for the total number of differentially expressed genes (according to the RNA-Seq analysis; log 2-fold change, P

    Article Snippet: RNA extraction, library preparation, and RNA-sequencing Leptospira cells of WT and mutant strains (lvrA/B and lvrB ) were cultured in EMJH (Johnson and Harris, ) supplemented with 1% rabbit serum (Sigma-Aldrich, St. Louis, MO, USA) at 30°C with shaking (100 rpm) and subsequently harvested at late-log phase by centrifugation at 3,200 g .

    Techniques: RNA Sequencing Assay, Quantitative RT-PCR, Functional Assay

    Apis mellifera elav alternative splicing in brains of worker bees is unaffected by thiamethoxan, carbendazim and glyphosate. ( A ) Gene structure of Apis mellifera elav depicting color-coded functional protein domains with constant exons (1–5, bottom, solid lines) and alternative splicing exons (3a and 4a–d, top, dashed lines). RNA Recognition Motiv 1 (RRM1): light blue, RRM2: dark blue, RRM3: purple, hinge region: red and alternatively spliced parts in red. Kpn I and Fok I restriction sites used to separate isoforms are indicated below the gene model. An asterisk indicates isoforms that encode truncated proteins by introducing a frameshift. ( B , C ) Denaturing polyacrylamide gels (6%) showing the alternative splicing pattern of elav by digestion of a 5′ ( B ) or 3′ ( C ) 32 P labeled RT-PCR product with Kpn I ( B ) and Fok I ( C ) in control bees dissected immediately after collection (Control 1), control bees fed with water and sucrose for 24 h (Control 2) and control bees injected with water (Control 3) compared to bees injected with thiamethoxam (1 µM) and bees injected with a mixture of thiamethoxam (1 µM, T), carbendazim (2 mM, C) and glyphosate (32 mM, G) 24 h prior dissection. Samples were run on 6% polyacrylamide gel. Ma: DNA marker. The undigested PCR product is shown at the bottom.

    Journal: Scientific Reports

    Article Title: Acute thiamethoxam toxicity in honeybees is not enhanced by common fungicide and herbicide and lacks stress-induced changes in mRNA splicing

    doi: 10.1038/s41598-019-55534-8

    Figure Lengend Snippet: Apis mellifera elav alternative splicing in brains of worker bees is unaffected by thiamethoxan, carbendazim and glyphosate. ( A ) Gene structure of Apis mellifera elav depicting color-coded functional protein domains with constant exons (1–5, bottom, solid lines) and alternative splicing exons (3a and 4a–d, top, dashed lines). RNA Recognition Motiv 1 (RRM1): light blue, RRM2: dark blue, RRM3: purple, hinge region: red and alternatively spliced parts in red. Kpn I and Fok I restriction sites used to separate isoforms are indicated below the gene model. An asterisk indicates isoforms that encode truncated proteins by introducing a frameshift. ( B , C ) Denaturing polyacrylamide gels (6%) showing the alternative splicing pattern of elav by digestion of a 5′ ( B ) or 3′ ( C ) 32 P labeled RT-PCR product with Kpn I ( B ) and Fok I ( C ) in control bees dissected immediately after collection (Control 1), control bees fed with water and sucrose for 24 h (Control 2) and control bees injected with water (Control 3) compared to bees injected with thiamethoxam (1 µM) and bees injected with a mixture of thiamethoxam (1 µM, T), carbendazim (2 mM, C) and glyphosate (32 mM, G) 24 h prior dissection. Samples were run on 6% polyacrylamide gel. Ma: DNA marker. The undigested PCR product is shown at the bottom.

    Article Snippet: RNA extraction, reverse transcription (RT) and polymerase chain reaction (PCR) and analysis of alternative splicing RNA extraction was done using Tri-reagent (SIGMA) and reverse transcription was done with Superscript II (Invitrogen) as previously described using primer AM Dscam 13R2 (GCCGAGAGTCCTGCGCCGATTCCATTCACAG, 1 pmol/ 20 µl reaction) in combination with an oligo dT primer.

    Techniques: Functional Assay, Labeling, Reverse Transcription Polymerase Chain Reaction, Injection, Dissection, Marker, Polymerase Chain Reaction

    eif4e1 KO eifiso4e KO eIF 4E1 R plant resistance spectrum extends to resistance‐breaking Tu MV isolates. Controls and eif4e1 KO eifiso4e KO eIF 4E1 R lines were challenged with either GFP ‐tagged Tu MV , GFP ‐Tu MV ‐E116Q ( RB ) or GFP ‐Tu MV ‐N163Y ( RB ). Viral accumulation was assessed using GFP cam ( PSI ) camera‐imaging (a). Fluorescence intensity is shown in false colour from blue (low) to red (high intensity) with the plant pot reflecting light, allowing visualization of the outline of the plant position. (b) Detection of Tu MV mRNA by RT ‐ PCR amplification of the VP g coding sequence for both Tu MV ‐ GFP and Tu MV ‐N163Y‐ GFP 21 dpi in the noninoculated leaves. ADENINE PHOSPHORIBOSYL TRANSFERASE 1 ( APT 1) gene was used as a control for RNA extraction.

    Journal: Plant Biotechnology Journal

    Article Title: Trans‐species synthetic gene design allows resistance pyramiding and broad‐spectrum engineering of virus resistance in plants

    doi: 10.1111/pbi.12896

    Figure Lengend Snippet: eif4e1 KO eifiso4e KO eIF 4E1 R plant resistance spectrum extends to resistance‐breaking Tu MV isolates. Controls and eif4e1 KO eifiso4e KO eIF 4E1 R lines were challenged with either GFP ‐tagged Tu MV , GFP ‐Tu MV ‐E116Q ( RB ) or GFP ‐Tu MV ‐N163Y ( RB ). Viral accumulation was assessed using GFP cam ( PSI ) camera‐imaging (a). Fluorescence intensity is shown in false colour from blue (low) to red (high intensity) with the plant pot reflecting light, allowing visualization of the outline of the plant position. (b) Detection of Tu MV mRNA by RT ‐ PCR amplification of the VP g coding sequence for both Tu MV ‐ GFP and Tu MV ‐N163Y‐ GFP 21 dpi in the noninoculated leaves. ADENINE PHOSPHORIBOSYL TRANSFERASE 1 ( APT 1) gene was used as a control for RNA extraction.

    Article Snippet: Expression analysis by Reverse transcription Total RNA was extracted from young noninoculated leaves of 1‐month‐old plants using TRI‐Reagent (Sigma‐Aldrich, St Louis, MO).

    Techniques: Chick Chorioallantoic Membrane Assay, Imaging, Fluorescence, Reverse Transcription Polymerase Chain Reaction, Amplification, Sequencing, RNA Extraction

    Global changes in the transcriptome profiles in Camelina transgenic lines and wild-type developing seeds. a The number of DEGs and the regulation in DGAT1 and GPD1 lines relative to that in WT is summarized. b Principal component analysis (PCA) indicates the variability of RNA-Seq datasets between WT and transgenic lines in the indicated time points after flowering, and c Venn diagram showing the overlapped relationships between DEGs in DGAT1 and GPD1 lines as compared to WT data. DEGs, differentially expressed genes, WT-15, GPD1–15, and DGAT1–15 indicate the wild-type and transgenic lines data of developing seeds harvested at 10–15 DAF, whereas WT-21, GPD1–21, and DGAT1–21 indicate the wild-type and transgenic lines data of developing seeds harvested at 16–21 DAF. Gaussian and EdgeR indicate the two pipelines analysis platforms used to determine the DEGs. DAF, days after flowering. WT, wild-type; GPD1, lines overexpressing ScGPD1 gene; and DGAT1, lines overexpressing AtDGAT1 gene

    Journal: Biotechnology for Biofuels

    Article Title: Comparative transcriptome and metabolome analysis suggests bottlenecks that limit seed and oil yields in transgenic Camelina sativa expressing diacylglycerol acyltransferase 1 and glycerol-3-phosphate dehydrogenase

    doi: 10.1186/s13068-018-1326-2

    Figure Lengend Snippet: Global changes in the transcriptome profiles in Camelina transgenic lines and wild-type developing seeds. a The number of DEGs and the regulation in DGAT1 and GPD1 lines relative to that in WT is summarized. b Principal component analysis (PCA) indicates the variability of RNA-Seq datasets between WT and transgenic lines in the indicated time points after flowering, and c Venn diagram showing the overlapped relationships between DEGs in DGAT1 and GPD1 lines as compared to WT data. DEGs, differentially expressed genes, WT-15, GPD1–15, and DGAT1–15 indicate the wild-type and transgenic lines data of developing seeds harvested at 10–15 DAF, whereas WT-21, GPD1–21, and DGAT1–21 indicate the wild-type and transgenic lines data of developing seeds harvested at 16–21 DAF. Gaussian and EdgeR indicate the two pipelines analysis platforms used to determine the DEGs. DAF, days after flowering. WT, wild-type; GPD1, lines overexpressing ScGPD1 gene; and DGAT1, lines overexpressing AtDGAT1 gene

    Article Snippet: RNA extraction, cDNA library construction, and RNA sequencing Total RNA was extracted from Camelina seeds using the plant RNeasy mini kit (Sigma-Aldrich), according to the manufacturer’s recommendations.

    Techniques: Transgenic Assay, RNA Sequencing Assay

    The gene expression analysis for the selected genes showing differential regulation in Camelina transgenic lines. Data are the fold changes (FC) in expression measured by using both RNA-Seq and qRT-PCR techniques ( a , b ) in both DGAT1 and GPD1, respectively, relative to WT. The fold change values used in the analysis are presented in Additional file 1 : Table S15. Data shown in c , d indicate the relative gene expression for the selected genes measured by qRT-PCR in both DGAT1 and GPD1 lines, respectively, relative to WT. The genes shown here are non-specific lipid transfer 4-like ( NSLT - L ), glycerol-3-phosphate sn -2-acyltransferase 1 ( GPAT1 ), oleosin 5 ( OLE5 ), 3-ketoacyl-synthase 18-like ( KCS18 ), TAG-lipase 2-like ( TAGL2 - L ), acyl CoA thioesterase 13-like ( ACOT13 - L ), cruciferin 3 ( CRU3 ), acyl-CoA:diacylglycerol acyltransferase 1 ( DGAT1 ), oleosin 1 ( OLE1 ), glycerol-3-phosphate acyltransferase 9 ( GPAT9 ), lysophosphatidyl acyltransferase 2 ( LPAT2 ), glycerol-3-phosphate transporter 1 ( GLPT1 ), lysophosphatidyl acyltransferase 5 ( LPAT5 ), glucose-6-phosphate l-epimerase ( G6Pe ), diacylglycerol kinase 3-like isoform X1 ( DAGK ), 3-keto acyl-synthase 6 ( KCS6 ), acyl-activating enzyme 7 ( Acylae7 ), glycerol-3-phosphate acyltransferase 5 ( GPAT5 )

    Journal: Biotechnology for Biofuels

    Article Title: Comparative transcriptome and metabolome analysis suggests bottlenecks that limit seed and oil yields in transgenic Camelina sativa expressing diacylglycerol acyltransferase 1 and glycerol-3-phosphate dehydrogenase

    doi: 10.1186/s13068-018-1326-2

    Figure Lengend Snippet: The gene expression analysis for the selected genes showing differential regulation in Camelina transgenic lines. Data are the fold changes (FC) in expression measured by using both RNA-Seq and qRT-PCR techniques ( a , b ) in both DGAT1 and GPD1, respectively, relative to WT. The fold change values used in the analysis are presented in Additional file 1 : Table S15. Data shown in c , d indicate the relative gene expression for the selected genes measured by qRT-PCR in both DGAT1 and GPD1 lines, respectively, relative to WT. The genes shown here are non-specific lipid transfer 4-like ( NSLT - L ), glycerol-3-phosphate sn -2-acyltransferase 1 ( GPAT1 ), oleosin 5 ( OLE5 ), 3-ketoacyl-synthase 18-like ( KCS18 ), TAG-lipase 2-like ( TAGL2 - L ), acyl CoA thioesterase 13-like ( ACOT13 - L ), cruciferin 3 ( CRU3 ), acyl-CoA:diacylglycerol acyltransferase 1 ( DGAT1 ), oleosin 1 ( OLE1 ), glycerol-3-phosphate acyltransferase 9 ( GPAT9 ), lysophosphatidyl acyltransferase 2 ( LPAT2 ), glycerol-3-phosphate transporter 1 ( GLPT1 ), lysophosphatidyl acyltransferase 5 ( LPAT5 ), glucose-6-phosphate l-epimerase ( G6Pe ), diacylglycerol kinase 3-like isoform X1 ( DAGK ), 3-keto acyl-synthase 6 ( KCS6 ), acyl-activating enzyme 7 ( Acylae7 ), glycerol-3-phosphate acyltransferase 5 ( GPAT5 )

    Article Snippet: RNA extraction, cDNA library construction, and RNA sequencing Total RNA was extracted from Camelina seeds using the plant RNeasy mini kit (Sigma-Aldrich), according to the manufacturer’s recommendations.

    Techniques: Expressing, Transgenic Assay, RNA Sequencing Assay, Quantitative RT-PCR

    Ig gene rearrangement and transcription in μMT mice liver epithelial cells. ( A ) Northern blot analysis. Total RNA from liver cells of three μMT mice and WT spleen cells (positive control) were transferred to nylon membrane, and probed with probes to constant region of Igμ and Igκ; 28 s and 18 s RNA were shown by DNA agarose gel electrophoresis. ( B ) In situ hybridization analysis was shown for detection of Ig μ and Ig κ transcripts in μMT mice with antisense or sense probes for C region of μ chain or J-C region of κ chain. ( C ) a It was shown for the primer design of Ig μ variable region, Ig κ variable region and Igλ; b Sorted liver epithelial cells from two μMT mice were analyzed for Ig rearrangement and transcription by RT-PCR. WT spleen cells were used as the positive control. Variable region and constant region of heavy chain (μ, α, δ, γ, ε) and light chain (κ, λ), CD20 and GAPDH were amplified; “1, 2” represented two samples of sorted μMT liver epithelial cells.

    Journal: Scientific Reports

    Article Title: Identification of Liver Epithelial Cell-derived Ig Expression in μ chain-deficient mice

    doi: 10.1038/srep23669

    Figure Lengend Snippet: Ig gene rearrangement and transcription in μMT mice liver epithelial cells. ( A ) Northern blot analysis. Total RNA from liver cells of three μMT mice and WT spleen cells (positive control) were transferred to nylon membrane, and probed with probes to constant region of Igμ and Igκ; 28 s and 18 s RNA were shown by DNA agarose gel electrophoresis. ( B ) In situ hybridization analysis was shown for detection of Ig μ and Ig κ transcripts in μMT mice with antisense or sense probes for C region of μ chain or J-C region of κ chain. ( C ) a It was shown for the primer design of Ig μ variable region, Ig κ variable region and Igλ; b Sorted liver epithelial cells from two μMT mice were analyzed for Ig rearrangement and transcription by RT-PCR. WT spleen cells were used as the positive control. Variable region and constant region of heavy chain (μ, α, δ, γ, ε) and light chain (κ, λ), CD20 and GAPDH were amplified; “1, 2” represented two samples of sorted μMT liver epithelial cells.

    Article Snippet: RNA extraction and RT-PCR Total RNA in spleen was extracted using TRIzol reagent (Invitrogen, Carlsbad, USA).

    Techniques: Mouse Assay, Northern Blot, Positive Control, Agarose Gel Electrophoresis, In Situ Hybridization, Reverse Transcription Polymerase Chain Reaction, Amplification

    MiR-125b-mediated STAT3 downregulation in SOD1-G93A mouse microglia. ( a ) The two minimum free energy duplexes of miR-125b-5p and 3′-UTR of mouse STAT3 (NM_011486.4) as predicted by RNA hybrid. ( b ) Western blotting with anti-STAT3 antibody of total lysates from empty vector and pprime-miR-125b infected microglia at 96 hours post virus transduction. β -actin was used for protein normalization. ( c ) Semiquantitative RT-PCR using specific primers for STAT3 and β -actin mRNAs of total RNA from nt and SOD1-G93A microglia. β -actin was used for normalization. ( d ) Western blotting with anti-STAT3 antibody of total lysates from nt and SOD1-G93A microglia. β -actin was used for protein normalization

    Journal: Cell Death & Disease

    Article Title: Dysregulated microRNAs in amyotrophic lateral sclerosis microglia modulate genes linked to neuroinflammation

    doi: 10.1038/cddis.2013.491

    Figure Lengend Snippet: MiR-125b-mediated STAT3 downregulation in SOD1-G93A mouse microglia. ( a ) The two minimum free energy duplexes of miR-125b-5p and 3′-UTR of mouse STAT3 (NM_011486.4) as predicted by RNA hybrid. ( b ) Western blotting with anti-STAT3 antibody of total lysates from empty vector and pprime-miR-125b infected microglia at 96 hours post virus transduction. β -actin was used for protein normalization. ( c ) Semiquantitative RT-PCR using specific primers for STAT3 and β -actin mRNAs of total RNA from nt and SOD1-G93A microglia. β -actin was used for normalization. ( d ) Western blotting with anti-STAT3 antibody of total lysates from nt and SOD1-G93A microglia. β -actin was used for protein normalization

    Article Snippet: Quantitative RT-PCR Total RNA including small RNA was extracted with TRIZOL (Invitrogen) according to the manufacturer's instruction and was checked with the Nanodrop 100 System and the Agilent 2100 bioanalyzer.

    Techniques: Western Blot, Plasmid Preparation, Infection, Transduction, Reverse Transcription Polymerase Chain Reaction

    TNF α -mediated miR-125b upregulation and STAT3 repression in microglia. ( a ) Semiquantitative RT-PCR performed using specific primers for mouse TNF α and β -actin mRNAs on nt and SOD1-G93A microglia total RNA. β -actin was used for normalization. ( b ) QPCR quantification of TNF α mRNA was performed at 48 h after transfection with the specified miRNA inhibitors. ( c ) QPCR quantification of miR-125b and ( d ) semiquantitative RT-PCR of STAT3 mRNA in nt and SOD1-G93A microglia upon 24 h of TNF α (10 ng/ml) or anti-TNF α (0.5 ng/ml) treatment

    Journal: Cell Death & Disease

    Article Title: Dysregulated microRNAs in amyotrophic lateral sclerosis microglia modulate genes linked to neuroinflammation

    doi: 10.1038/cddis.2013.491

    Figure Lengend Snippet: TNF α -mediated miR-125b upregulation and STAT3 repression in microglia. ( a ) Semiquantitative RT-PCR performed using specific primers for mouse TNF α and β -actin mRNAs on nt and SOD1-G93A microglia total RNA. β -actin was used for normalization. ( b ) QPCR quantification of TNF α mRNA was performed at 48 h after transfection with the specified miRNA inhibitors. ( c ) QPCR quantification of miR-125b and ( d ) semiquantitative RT-PCR of STAT3 mRNA in nt and SOD1-G93A microglia upon 24 h of TNF α (10 ng/ml) or anti-TNF α (0.5 ng/ml) treatment

    Article Snippet: Quantitative RT-PCR Total RNA including small RNA was extracted with TRIZOL (Invitrogen) according to the manufacturer's instruction and was checked with the Nanodrop 100 System and the Agilent 2100 bioanalyzer.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Transfection

    IL-6 downregulation in SOD1-G93A mouse microglia. ( a ) Semiquantitative RT-PCR using specific primers for IL-6 and β -actin mRNAs, on total RNA from nt and SOD1-G93A microglia. β -actin was used for normalization. ( b ) Western blotting with anti-IL-6 antibody on total lysates from nt and SOD1-G93A microglia. β -actin was used for protein normalization. ( c ) IL-6 levels in the culture media of microglia from nt and G93A mice, after 6 h incubation in fresh media, as assessed by ELISA

    Journal: Cell Death & Disease

    Article Title: Dysregulated microRNAs in amyotrophic lateral sclerosis microglia modulate genes linked to neuroinflammation

    doi: 10.1038/cddis.2013.491

    Figure Lengend Snippet: IL-6 downregulation in SOD1-G93A mouse microglia. ( a ) Semiquantitative RT-PCR using specific primers for IL-6 and β -actin mRNAs, on total RNA from nt and SOD1-G93A microglia. β -actin was used for normalization. ( b ) Western blotting with anti-IL-6 antibody on total lysates from nt and SOD1-G93A microglia. β -actin was used for protein normalization. ( c ) IL-6 levels in the culture media of microglia from nt and G93A mice, after 6 h incubation in fresh media, as assessed by ELISA

    Article Snippet: Quantitative RT-PCR Total RNA including small RNA was extracted with TRIZOL (Invitrogen) according to the manufacturer's instruction and was checked with the Nanodrop 100 System and the Agilent 2100 bioanalyzer.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Western Blot, Mouse Assay, Incubation, Enzyme-linked Immunosorbent Assay

    Histone deacetylases-3 (HDAC3) expression in breast cancer. (A) Real-time reverse transcription polymerase chain reaction (RT-PCR) was performed to analyze of messenger RNA (mRNA) expression of HDAC3 in breast cancer tissue of 15 fresh specimens and their paired normal samples. (B) Representative figures of HDAC3 protein expression in adjacent normal tissue (left) and breast cancer tissue (right) using immunohistochemical staining (immunohistochemistry for HDAC3, ×200). (C) Immunofluorescence showed that HDAC3 expression was mainly localized in the cell nucleus in MCF7 cell line. (D) RT-PCR was employed to analyze of mRNA expression of HDAC3 in breast cancer cell lines and normal epithelial breast MCF10A cells. (E) Western blotting analysis of HDAC3 protein expression in breast cancer cell lines and normal epithelial breast MCF10A cells. (F) Association between HDAC3 expression and the prognosis of breast cancer patients. DAPI=4′,6-diamidino-2-phenylindole. * p

    Journal: Journal of Breast Cancer

    Article Title: Histone Deacetylase-3 Modification of MicroRNA-31 Promotes Cell Proliferation and Aerobic Glycolysis in Breast Cancer and Is Predictive of Poor Prognosis

    doi: 10.4048/jbc.2018.21.2.112

    Figure Lengend Snippet: Histone deacetylases-3 (HDAC3) expression in breast cancer. (A) Real-time reverse transcription polymerase chain reaction (RT-PCR) was performed to analyze of messenger RNA (mRNA) expression of HDAC3 in breast cancer tissue of 15 fresh specimens and their paired normal samples. (B) Representative figures of HDAC3 protein expression in adjacent normal tissue (left) and breast cancer tissue (right) using immunohistochemical staining (immunohistochemistry for HDAC3, ×200). (C) Immunofluorescence showed that HDAC3 expression was mainly localized in the cell nucleus in MCF7 cell line. (D) RT-PCR was employed to analyze of mRNA expression of HDAC3 in breast cancer cell lines and normal epithelial breast MCF10A cells. (E) Western blotting analysis of HDAC3 protein expression in breast cancer cell lines and normal epithelial breast MCF10A cells. (F) Association between HDAC3 expression and the prognosis of breast cancer patients. DAPI=4′,6-diamidino-2-phenylindole. * p

    Article Snippet: Real-time reverse transcription polymerase chain reaction Total RNA extraction and the real-time reverse transcription polymerase chain reaction (RT-PCR) analysis were performed using the manufacturer's instructions (Takara Bio Inc., Shiga, Japan).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Immunohistochemistry, Staining, Immunofluorescence, Western Blot