rnase free dnase i Roche Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Millipore rnase free dnasei
    Rnase Free Dnasei, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 83 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase free dnasei/product/Millipore
    Average 94 stars, based on 83 article reviews
    Price from $9.99 to $1999.99
    rnase free dnasei - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    94
    Roche rnase free dnase i
    Analysis of transcript levels in 7 h germlings. A. parasiticus SU-1, AFS10, and Δ veA were grown on YES solid media and spores were collected at 5 days. Germlings were grown from fresh spores in GMS liquid medium for 7 h, frozen in liquid nitrogen, and stored at −80 °C. RNA was extracted from germlings using grinding and sonication as described in Methods. RT-PCR was performed on total RNA treated with <t>RNAse-free</t> <t>DNAse</t> I with primers specific for each gene ( Table 3 ). PCR products were separated on a 1% agarose gel by electrophoresis. Citrate synthase, a constitutively expressed gene, was used as a positive control. gDNA, genomic DNA.
    Rnase Free Dnase I, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 4587 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase free dnase i/product/Roche
    Average 94 stars, based on 4587 article reviews
    Price from $9.99 to $1999.99
    rnase free dnase i - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    85
    Roche ribonuclease free deoxyribonuclease dnase i
    Identification and functional analysis of an evolutionarily conserved GRE/MRE located at −5.3 kb in the mouse (−4.6 kb in the human) Klf9 gene. A, <t>DNAse</t> I protection assay with the hGR-DBD of the evolutionary conserved 179-bp fragment
    Ribonuclease Free Deoxyribonuclease Dnase I, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ribonuclease free deoxyribonuclease dnase i/product/Roche
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    ribonuclease free deoxyribonuclease dnase i - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    92
    Boehringer Mannheim rnase free dnase i
    Identification and functional analysis of an evolutionarily conserved GRE/MRE located at −5.3 kb in the mouse (−4.6 kb in the human) Klf9 gene. A, <t>DNAse</t> I protection assay with the hGR-DBD of the evolutionary conserved 179-bp fragment
    Rnase Free Dnase I, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 92/100, based on 739 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase free dnase i/product/Boehringer Mannheim
    Average 92 stars, based on 739 article reviews
    Price from $9.99 to $1999.99
    rnase free dnase i - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    Roche recombinant dnase i rnase free
    Uncapped, polyadenylated viral transcript induced IFNB gene expression. (A-C) Total RNA of mock treated or NDV-infected (12 hpi, MOI = 1) HeLa cells (A), RSV-infected (60 hpi, MOI = 1) HEp-2 cells (B), or VSV-infected (12 hpi, MOI = 1) HeLa cells (C) was separated into poly(A) - and poly(A) + RNA fractions by oligo(dT)-combined latex beads and transfected into MEFs (1×10 5 cells were transfected with 200 ng RNA). Ifnb mRNA expression levels were measured by RT-qPCR. Data are represented as means ±SD. (D and E) The Poly(A) + RNA fraction from NDV-infected (12 hpi, MOI = 1) HeLa cells was mock treated (NT) or treated with <t>RNase</t> III, DNase I, CIAP (D), or 5’-capping enzyme of Vaccinia virus (E) and then transfected to MEFs (1×10 5 cells were transfected with 200 ng RNA). Ifnb mRNA expression levels were measured by RT-qPCR. Data are represented as means ±SD (t-test: **p
    Recombinant Dnase I Rnase Free, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 96 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant dnase i rnase free/product/Roche
    Average 92 stars, based on 96 article reviews
    Price from $9.99 to $1999.99
    recombinant dnase i rnase free - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    Roche rq1 rnase free dnase i
    Uncapped, polyadenylated viral transcript induced IFNB gene expression. (A-C) Total RNA of mock treated or NDV-infected (12 hpi, MOI = 1) HeLa cells (A), RSV-infected (60 hpi, MOI = 1) HEp-2 cells (B), or VSV-infected (12 hpi, MOI = 1) HeLa cells (C) was separated into poly(A) - and poly(A) + RNA fractions by oligo(dT)-combined latex beads and transfected into MEFs (1×10 5 cells were transfected with 200 ng RNA). Ifnb mRNA expression levels were measured by RT-qPCR. Data are represented as means ±SD. (D and E) The Poly(A) + RNA fraction from NDV-infected (12 hpi, MOI = 1) HeLa cells was mock treated (NT) or treated with <t>RNase</t> III, DNase I, CIAP (D), or 5’-capping enzyme of Vaccinia virus (E) and then transfected to MEFs (1×10 5 cells were transfected with 200 ng RNA). Ifnb mRNA expression levels were measured by RT-qPCR. Data are represented as means ±SD (t-test: **p
    Rq1 Rnase Free Dnase I, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rq1 rnase free dnase i/product/Roche
    Average 92 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    rq1 rnase free dnase i - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    90
    Roche dnase i recombinant rnase free kit
    Uncapped, polyadenylated viral transcript induced IFNB gene expression. (A-C) Total RNA of mock treated or NDV-infected (12 hpi, MOI = 1) HeLa cells (A), RSV-infected (60 hpi, MOI = 1) HEp-2 cells (B), or VSV-infected (12 hpi, MOI = 1) HeLa cells (C) was separated into poly(A) - and poly(A) + RNA fractions by oligo(dT)-combined latex beads and transfected into MEFs (1×10 5 cells were transfected with 200 ng RNA). Ifnb mRNA expression levels were measured by RT-qPCR. Data are represented as means ±SD. (D and E) The Poly(A) + RNA fraction from NDV-infected (12 hpi, MOI = 1) HeLa cells was mock treated (NT) or treated with <t>RNase</t> III, DNase I, CIAP (D), or 5’-capping enzyme of Vaccinia virus (E) and then transfected to MEFs (1×10 5 cells were transfected with 200 ng RNA). Ifnb mRNA expression levels were measured by RT-qPCR. Data are represented as means ±SD (t-test: **p
    Dnase I Recombinant Rnase Free Kit, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnase i recombinant rnase free kit/product/Roche
    Average 90 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    dnase i recombinant rnase free kit - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    85
    Roche rnase free bovine pancreatic dnase i
    Uncapped, polyadenylated viral transcript induced IFNB gene expression. (A-C) Total RNA of mock treated or NDV-infected (12 hpi, MOI = 1) HeLa cells (A), RSV-infected (60 hpi, MOI = 1) HEp-2 cells (B), or VSV-infected (12 hpi, MOI = 1) HeLa cells (C) was separated into poly(A) - and poly(A) + RNA fractions by oligo(dT)-combined latex beads and transfected into MEFs (1×10 5 cells were transfected with 200 ng RNA). Ifnb mRNA expression levels were measured by RT-qPCR. Data are represented as means ±SD. (D and E) The Poly(A) + RNA fraction from NDV-infected (12 hpi, MOI = 1) HeLa cells was mock treated (NT) or treated with <t>RNase</t> III, DNase I, CIAP (D), or 5’-capping enzyme of Vaccinia virus (E) and then transfected to MEFs (1×10 5 cells were transfected with 200 ng RNA). Ifnb mRNA expression levels were measured by RT-qPCR. Data are represented as means ±SD (t-test: **p
    Rnase Free Bovine Pancreatic Dnase I, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase free bovine pancreatic dnase i/product/Roche
    Average 85 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    rnase free bovine pancreatic dnase i - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    Roche rnase free certified dnase i
    Melting curve (A) amplified at various annealing temparature and gel-electrophoresis pattern (B) of 18SrRNA amplified at 60° of annealing temperature by real-time PCR using the RT product of the cell lysate treated with 0.16 U/μl <t>RNase-free</t> <t>DNase</t> I for 30 min. Lane 1: 100-bp Ladder size marker; Lane 2: amplification product of 18SrRNA (120 bp) in gel-electrophoresis pattern.
    Rnase Free Certified Dnase I, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase free certified dnase i/product/Roche
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    rnase free certified dnase i - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    88
    Roche rnase free dnase i enzyme
    Melting curve (A) amplified at various annealing temparature and gel-electrophoresis pattern (B) of 18SrRNA amplified at 60° of annealing temperature by real-time PCR using the RT product of the cell lysate treated with 0.16 U/μl <t>RNase-free</t> <t>DNase</t> I for 30 min. Lane 1: 100-bp Ladder size marker; Lane 2: amplification product of 18SrRNA (120 bp) in gel-electrophoresis pattern.
    Rnase Free Dnase I Enzyme, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase free dnase i enzyme/product/Roche
    Average 88 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    rnase free dnase i enzyme - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    94
    Roche dnase i
    DNase I-PCR Assay of the <t>DNase</t> I Sensitivity of a Transgenic Enhancer Sequence. (A) . (B) A diagram illustrating the design of a PCR primer that allows the transgenic L3 locus, but not the endogenous L3, to be specifically amplified. (C) DNase I-PCR shows differential DNase I sensitivity of chromatin in selected genomic regions. The DNase I sensitivity of the transgenic L3 locus was similar to that of the open chromatin control ACTIN7 .
    Dnase I, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 33819 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnase i/product/Roche
    Average 94 stars, based on 33819 article reviews
    Price from $9.99 to $1999.99
    dnase i - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    88
    Roche rnase free recombinant dnase i incubation mix
    DNase I-PCR Assay of the <t>DNase</t> I Sensitivity of a Transgenic Enhancer Sequence. (A) . (B) A diagram illustrating the design of a PCR primer that allows the transgenic L3 locus, but not the endogenous L3, to be specifically amplified. (C) DNase I-PCR shows differential DNase I sensitivity of chromatin in selected genomic regions. The DNase I sensitivity of the transgenic L3 locus was similar to that of the open chromatin control ACTIN7 .
    Rnase Free Recombinant Dnase I Incubation Mix, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase free recombinant dnase i incubation mix/product/Roche
    Average 88 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    rnase free recombinant dnase i incubation mix - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    Image Search Results


    Analysis of transcript levels in 7 h germlings. A. parasiticus SU-1, AFS10, and Δ veA were grown on YES solid media and spores were collected at 5 days. Germlings were grown from fresh spores in GMS liquid medium for 7 h, frozen in liquid nitrogen, and stored at −80 °C. RNA was extracted from germlings using grinding and sonication as described in Methods. RT-PCR was performed on total RNA treated with RNAse-free DNAse I with primers specific for each gene ( Table 3 ). PCR products were separated on a 1% agarose gel by electrophoresis. Citrate synthase, a constitutively expressed gene, was used as a positive control. gDNA, genomic DNA.

    Journal: Toxins

    Article Title: Aflatoxin Biosynthesis Is a Novel Source of Reactive Oxygen Species—A Potential Redox Signal to Initiate Resistance to Oxidative Stress?

    doi: 10.3390/toxins7051411

    Figure Lengend Snippet: Analysis of transcript levels in 7 h germlings. A. parasiticus SU-1, AFS10, and Δ veA were grown on YES solid media and spores were collected at 5 days. Germlings were grown from fresh spores in GMS liquid medium for 7 h, frozen in liquid nitrogen, and stored at −80 °C. RNA was extracted from germlings using grinding and sonication as described in Methods. RT-PCR was performed on total RNA treated with RNAse-free DNAse I with primers specific for each gene ( Table 3 ). PCR products were separated on a 1% agarose gel by electrophoresis. Citrate synthase, a constitutively expressed gene, was used as a positive control. gDNA, genomic DNA.

    Article Snippet: RT-PCR was performed on total RNA treated with RNAse-free DNAse I (Roche Diagnostics, Indianapolis, IN, USA) with primers specific for the coding region of each gene.

    Techniques: Sonication, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Electrophoresis, Positive Control

    Antiviral efficacy of 1E7-03 in HIV-1 89. 6-infected NSG mice Mice were treated with 3 mg/kg of 1E7-03 or 1.5 mg/kg F07#13 by a single dose intraperitoneal (i.p.) injection After 48 hrs, mice were sacrificed; plasma samples were collected and tested for levels of HIV-1 TAR RNA (A) and HIV-1 TAR-gag RNA (B) . For quantitative analysis of HIV-1 RNA, total RNA was isolated from blood specimens, treated with RNase-free DNase I and reverse transcribed. Real-time PCR reactions were carried out in triplicates. Each data point represents the blood from a single animal. For all figures, * p

    Journal: Oncotarget

    Article Title: Inhibition of HIV-1 infection in humanized mice and metabolic stability of protein phosphatase-1-targeting small molecule 1E7-03

    doi: 10.18632/oncotarget.19999

    Figure Lengend Snippet: Antiviral efficacy of 1E7-03 in HIV-1 89. 6-infected NSG mice Mice were treated with 3 mg/kg of 1E7-03 or 1.5 mg/kg F07#13 by a single dose intraperitoneal (i.p.) injection After 48 hrs, mice were sacrificed; plasma samples were collected and tested for levels of HIV-1 TAR RNA (A) and HIV-1 TAR-gag RNA (B) . For quantitative analysis of HIV-1 RNA, total RNA was isolated from blood specimens, treated with RNase-free DNase I and reverse transcribed. Real-time PCR reactions were carried out in triplicates. Each data point represents the blood from a single animal. For all figures, * p

    Article Snippet: A total of 1.0 μg of RNA was treated with 0.25 mg/ml DNase I RNase-free (Roche, Mannheim, Germany) for 60 min in the presence of 5 mM MgCl2 , followed by heat inactivation at 65 °C for 15 min. A 200–250 ng aliquot of total RNA was used to generate cDNA with the GoScript Reverse Transcription System (Promega, Madison, WI) using TAR-specific reverse primer TAR+59R: 5′- CAACAGACGGGCACACACTAC -3′.

    Techniques: Infection, Mouse Assay, Injection, Isolation, Real-time Polymerase Chain Reaction

    Immunostaining intensity of RNA and DNA pretreated with either DNase-1 free RNase-1 or RNase-I free DNase-I.

    Journal: Mechanisms of ageing and development

    Article Title: Epigenetic changes in the progression of Alzheimer’s disease

    doi: 10.1016/j.mad.2013.08.005

    Figure Lengend Snippet: Immunostaining intensity of RNA and DNA pretreated with either DNase-1 free RNase-1 or RNase-I free DNase-I.

    Article Snippet: To verify the presence of 5hmC in representative samples of nDNA and RNA prepared from the SMTG, samples (50 ng and 100 ng) were pretreated either with either DNase-1 free RNase-1 or RNase-I free DNase-I (0.5 μg/μl PBS, Roche, Mannheim, Germany) for 2 h at 37°C.

    Techniques: Immunostaining

    Identification and functional analysis of an evolutionarily conserved GRE/MRE located at −5.3 kb in the mouse (−4.6 kb in the human) Klf9 gene. A, DNAse I protection assay with the hGR-DBD of the evolutionary conserved 179-bp fragment

    Journal: Endocrinology

    Article Title: Molecular Basis for Glucocorticoid Induction of the Kr?ppel-Like Factor 9 Gene in Hippocampal Neurons

    doi: 10.1210/en.2012-1303

    Figure Lengend Snippet: Identification and functional analysis of an evolutionarily conserved GRE/MRE located at −5.3 kb in the mouse (−4.6 kb in the human) Klf9 gene. A, DNAse I protection assay with the hGR-DBD of the evolutionary conserved 179-bp fragment

    Article Snippet: We treated 1 μg of total RNA with 20 U of ribonuclease-free deoxyribonuclease (DNAse) I (Roche, Indianapolis, IN) ( ) before cDNA synthesis with the High Capacity Reverse Transcription kit (Invitrogen) with or without the addition of RT.

    Techniques: Functional Assay

    Uncapped, polyadenylated viral transcript induced IFNB gene expression. (A-C) Total RNA of mock treated or NDV-infected (12 hpi, MOI = 1) HeLa cells (A), RSV-infected (60 hpi, MOI = 1) HEp-2 cells (B), or VSV-infected (12 hpi, MOI = 1) HeLa cells (C) was separated into poly(A) - and poly(A) + RNA fractions by oligo(dT)-combined latex beads and transfected into MEFs (1×10 5 cells were transfected with 200 ng RNA). Ifnb mRNA expression levels were measured by RT-qPCR. Data are represented as means ±SD. (D and E) The Poly(A) + RNA fraction from NDV-infected (12 hpi, MOI = 1) HeLa cells was mock treated (NT) or treated with RNase III, DNase I, CIAP (D), or 5’-capping enzyme of Vaccinia virus (E) and then transfected to MEFs (1×10 5 cells were transfected with 200 ng RNA). Ifnb mRNA expression levels were measured by RT-qPCR. Data are represented as means ±SD (t-test: **p

    Journal: PLoS Pathogens

    Article Title: Leader-Containing Uncapped Viral Transcript Activates RIG-I in Antiviral Stress Granules

    doi: 10.1371/journal.ppat.1005444

    Figure Lengend Snippet: Uncapped, polyadenylated viral transcript induced IFNB gene expression. (A-C) Total RNA of mock treated or NDV-infected (12 hpi, MOI = 1) HeLa cells (A), RSV-infected (60 hpi, MOI = 1) HEp-2 cells (B), or VSV-infected (12 hpi, MOI = 1) HeLa cells (C) was separated into poly(A) - and poly(A) + RNA fractions by oligo(dT)-combined latex beads and transfected into MEFs (1×10 5 cells were transfected with 200 ng RNA). Ifnb mRNA expression levels were measured by RT-qPCR. Data are represented as means ±SD. (D and E) The Poly(A) + RNA fraction from NDV-infected (12 hpi, MOI = 1) HeLa cells was mock treated (NT) or treated with RNase III, DNase I, CIAP (D), or 5’-capping enzyme of Vaccinia virus (E) and then transfected to MEFs (1×10 5 cells were transfected with 200 ng RNA). Ifnb mRNA expression levels were measured by RT-qPCR. Data are represented as means ±SD (t-test: **p

    Article Snippet: Reverse transcription and quantitative PCR (RT-qPCR) Total RNA was isolated from cells using TRIzol Reagent (Ambion), and treated with RNase-Free Recombinant DNase I (Roche Diagnostics).

    Techniques: Expressing, Infection, Transfection, Quantitative RT-PCR, T-Test

    Melting curve (A) amplified at various annealing temparature and gel-electrophoresis pattern (B) of 18SrRNA amplified at 60° of annealing temperature by real-time PCR using the RT product of the cell lysate treated with 0.16 U/μl RNase-free DNase I for 30 min. Lane 1: 100-bp Ladder size marker; Lane 2: amplification product of 18SrRNA (120 bp) in gel-electrophoresis pattern.

    Journal: Reproductive biology and endocrinology : RB & E

    Article Title: Easy and rapid method for the determination of gene expression in cumulus cells incubated for oocyte maturation

    doi: 10.1186/1477-7827-3-59

    Figure Lengend Snippet: Melting curve (A) amplified at various annealing temparature and gel-electrophoresis pattern (B) of 18SrRNA amplified at 60° of annealing temperature by real-time PCR using the RT product of the cell lysate treated with 0.16 U/μl RNase-free DNase I for 30 min. Lane 1: 100-bp Ladder size marker; Lane 2: amplification product of 18SrRNA (120 bp) in gel-electrophoresis pattern.

    Article Snippet: DNase digestion and reverse transcript Cell lysates were supplemented with the different concentrations (final concentrations of 0.04 U/μl and 0.08 U/μl) of DNase I provided in the cells-to-cDNA II kit or with two concentrations (final concentrations of 0.08 U/μl and 0.16 U/μl) of RNase-free certified DNase I with 10 U/μl (Roche, Penzberg, Germany).

    Techniques: Amplification, Nucleic Acid Electrophoresis, Real-time Polymerase Chain Reaction, Marker

    Amplification curves (A) and melting curves (B) of 18SrRNA amplified by real-time PCR using the RT-minus product of the cell lysate treated for 15, 30 and 60 min with 0.08 U/μl RNase-free DNase I.

    Journal: Reproductive biology and endocrinology : RB & E

    Article Title: Easy and rapid method for the determination of gene expression in cumulus cells incubated for oocyte maturation

    doi: 10.1186/1477-7827-3-59

    Figure Lengend Snippet: Amplification curves (A) and melting curves (B) of 18SrRNA amplified by real-time PCR using the RT-minus product of the cell lysate treated for 15, 30 and 60 min with 0.08 U/μl RNase-free DNase I.

    Article Snippet: DNase digestion and reverse transcript Cell lysates were supplemented with the different concentrations (final concentrations of 0.04 U/μl and 0.08 U/μl) of DNase I provided in the cells-to-cDNA II kit or with two concentrations (final concentrations of 0.08 U/μl and 0.16 U/μl) of RNase-free certified DNase I with 10 U/μl (Roche, Penzberg, Germany).

    Techniques: Amplification, Real-time Polymerase Chain Reaction

    Amplification curves (A) and melting curves (B) of 18SrRNA amplified by real-time PCR using the RT – minus product of the cell lysate treated for 15, 30 and 60 min with 0.16 U/μl RNase-free DNase I.

    Journal: Reproductive biology and endocrinology : RB & E

    Article Title: Easy and rapid method for the determination of gene expression in cumulus cells incubated for oocyte maturation

    doi: 10.1186/1477-7827-3-59

    Figure Lengend Snippet: Amplification curves (A) and melting curves (B) of 18SrRNA amplified by real-time PCR using the RT – minus product of the cell lysate treated for 15, 30 and 60 min with 0.16 U/μl RNase-free DNase I.

    Article Snippet: DNase digestion and reverse transcript Cell lysates were supplemented with the different concentrations (final concentrations of 0.04 U/μl and 0.08 U/μl) of DNase I provided in the cells-to-cDNA II kit or with two concentrations (final concentrations of 0.08 U/μl and 0.16 U/μl) of RNase-free certified DNase I with 10 U/μl (Roche, Penzberg, Germany).

    Techniques: Amplification, Real-time Polymerase Chain Reaction

    DNase I-PCR Assay of the DNase I Sensitivity of a Transgenic Enhancer Sequence. (A) . (B) A diagram illustrating the design of a PCR primer that allows the transgenic L3 locus, but not the endogenous L3, to be specifically amplified. (C) DNase I-PCR shows differential DNase I sensitivity of chromatin in selected genomic regions. The DNase I sensitivity of the transgenic L3 locus was similar to that of the open chromatin control ACTIN7 .

    Journal: The Plant Cell

    Article Title: Genome-Wide Prediction and Validation of Intergenic Enhancers in Arabidopsis Using Open Chromatin Signatures [OPEN]

    doi: 10.1105/tpc.15.00537

    Figure Lengend Snippet: DNase I-PCR Assay of the DNase I Sensitivity of a Transgenic Enhancer Sequence. (A) . (B) A diagram illustrating the design of a PCR primer that allows the transgenic L3 locus, but not the endogenous L3, to be specifically amplified. (C) DNase I-PCR shows differential DNase I sensitivity of chromatin in selected genomic regions. The DNase I sensitivity of the transgenic L3 locus was similar to that of the open chromatin control ACTIN7 .

    Article Snippet: A DNase I (RNase-free; 10 U/μL; Roche Applied Science; catalog number 04716728001) dilution series was prepared by step-wise dilution using digestion buffer.

    Techniques: Polymerase Chain Reaction, Transgenic Assay, Sequencing, Amplification