rnas Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Integrated DNA Technologies rna oligos
    Differential expression of <t>RNA:m</t> 5 C, RCMTs and hnRNPK in 5-AZA-sensitive and 5-AZA-resistant leukaemia cells and the binding of hnRNPK to unmethylated and cytosine-methylated RNA. a Western blot analysis of expression of RCMTs, hnRNPK and other proteins in the 5-AZA-sensitive OCI-M2 and SC leukaemia cells and the 5-AZA-resistant M2AR and SCAR leukaemia cells. b Dot blot analysis of 5-methylcytosine (m 5 C) in RNA and DNA from OCI-M2 and M2AR cells. c Dot blot analysis of 5-methylcytosine (m 5 C) in RNA and DNA from SC and SCAR cells. d , e Visualization and measurement of the binding of purified recombinant hnRNPK to the unmethylated and cytosine-methylated fluorescein (FAM)-labelled RNA <t>oligos</t> by an antibody-coupled bead assay
    Rna Oligos, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 129 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna oligos/product/Integrated DNA Technologies
    Average 95 stars, based on 129 article reviews
    Price from $9.99 to $1999.99
    rna oligos - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    New England Biolabs sp6
    LPT (RNAi) results in differentiation defects and outgrowth formation during regeneration. a A schematic showing the amputation of RNAi worms into head (H), middle (M) and tail (T) pieces in order to observe regeneration of different structures. The time-course of all the experiments on Mll3/4 knockdown animals is depicted underneath the worm schematic. A total of 9 days of dsRNA microinjection-mediated RNAi was followed by amputation on the 10 th day and subsequent observation of regeneration. b Head, middle and tail pieces following LPT (RNAi) or control GFP (RNAi) at day 7 of regeneration. Yellow arrows point towards the defects in blastema formation. c Head, middle and tail pieces following LPT (RNAi) or control GFP (RNAi) at day 11 of regeneration. Red arrows point towards outgrowths. d Homeostatic animals following LPT (RNAi) or control GFP (RNAi) at day 14 post RNAi. Red arrows point towards outgrowths. e Gut regeneration and maintenance in middle pieces following LPT (RNAi), as illustrated by RNA probe for the gene porcupine-1 at 8 days of regeneration. f Brain regeneration in middle pieces at 8 days post-amputation following LPT (RNAi), as illustrated by anti-SYNORF-1 antibody labeling the central nervous system (CNS). g Optic chiasm recovery in tail pieces at 8 days of regeneration following LPT (RNAi), as shown by anti-VC-1 antibody. h Recovery of optic cups and organized trail of optic cup precursor cells in tail pieces at 8 days of regeneration following LPT (RNAi), as demonstrated by RNA probe for <t>SP6-9</t> . i Pharynx recovery in head pieces at 8 days of regeneration following LPT (RNAi), as illustrated by RNA probe for laminin . Number of animals with observable phenotype are recorded out of the total number of animals in the top right of each panel. Scale bars: 200 μm
    Sp6, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 70 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sp6/product/New England Biolabs
    Average 95 stars, based on 70 article reviews
    Price from $9.99 to $1999.99
    sp6 - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Millipore mrna
    Critical contribution of RyDEN in <t>IFN-mediated</t> anti-DENV response. (A and B) Induction of RyDEN expression by IFN treatments. HeLa (A) and shRNA-expressing HepG2 (B) cells were treated with increasing concentrations (10, 100, and 1,000 units/ml) of IFN-α/ω or a fixed concentration (300 units/ml) of IFN-α/ω, IFN-γ, and IFN-λ1. Cell lysates 24 h after treatment were subjected to immunoblotting (IB) analysis. Masses of molecular weight standards are indicated at left. (C) Effect of RyDEN knockdown on IFN-mediated DENV inhibition. sh1425 (RyDEN knockdown) or shCtrl-expressing HepG2 cells were pretreated with 300 units/ml of IFN-α/ω and, 24 h after infection, exposed to DENV-2 at an MOI of 1. The virus titer of the culture supernatant was measured by plaque assay 2 days after infection. Statistical significance was determined using two-way ANOVA. (D) HepG2 cells were transfected with plasmid DNA-expressing V5-RyDEN (gray bars), V5-BAP (white bars), or HA-STING (black bars). Total RNA was isolated 48 h after transfection and subjected to qRT-PCR analysis for the detection of LY6E, ISG15, ISG54, RIG-I, and IFN-β <t>mRNA.</t> Statistical significance was determined by one-way ANOVA with Dunnett’s multiple comparison test. ns, no significance. (E) RyDEN knockdown (sh1425-expressing, gray bars) and control (shCtrl-expressing, white bars) HeLa cells were cultured in the presence or absence of 1,000 units/ml IFN-α/ω. Total RNA was isolated 24 h after treatment and subjected to qRT-PCR analysis. The levels of gene expression were expressed as the fold change compared to untreated cells. ns, no significance. (F) sh1425- (left panels) and shCtrl-expressing (right panels) HeLa cells treated with IFN-α/ω were subjected to immunoblotting analysis using anti-ISG15 antibodies (top panels). The same blot was also probed with anti-actin antibodies (bottom panels). Masses of molecular weight standards are indicated at left.
    Mrna, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 2434 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mrna/product/Millipore
    Average 95 stars, based on 2434 article reviews
    Price from $9.99 to $1999.99
    mrna - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    rna  (Lonza)
    90
    Lonza rna
    Critical contribution of RyDEN in <t>IFN-mediated</t> anti-DENV response. (A and B) Induction of RyDEN expression by IFN treatments. HeLa (A) and shRNA-expressing HepG2 (B) cells were treated with increasing concentrations (10, 100, and 1,000 units/ml) of IFN-α/ω or a fixed concentration (300 units/ml) of IFN-α/ω, IFN-γ, and IFN-λ1. Cell lysates 24 h after treatment were subjected to immunoblotting (IB) analysis. Masses of molecular weight standards are indicated at left. (C) Effect of RyDEN knockdown on IFN-mediated DENV inhibition. sh1425 (RyDEN knockdown) or shCtrl-expressing HepG2 cells were pretreated with 300 units/ml of IFN-α/ω and, 24 h after infection, exposed to DENV-2 at an MOI of 1. The virus titer of the culture supernatant was measured by plaque assay 2 days after infection. Statistical significance was determined using two-way ANOVA. (D) HepG2 cells were transfected with plasmid DNA-expressing V5-RyDEN (gray bars), V5-BAP (white bars), or HA-STING (black bars). Total RNA was isolated 48 h after transfection and subjected to qRT-PCR analysis for the detection of LY6E, ISG15, ISG54, RIG-I, and IFN-β <t>mRNA.</t> Statistical significance was determined by one-way ANOVA with Dunnett’s multiple comparison test. ns, no significance. (E) RyDEN knockdown (sh1425-expressing, gray bars) and control (shCtrl-expressing, white bars) HeLa cells were cultured in the presence or absence of 1,000 units/ml IFN-α/ω. Total RNA was isolated 24 h after treatment and subjected to qRT-PCR analysis. The levels of gene expression were expressed as the fold change compared to untreated cells. ns, no significance. (F) sh1425- (left panels) and shCtrl-expressing (right panels) HeLa cells treated with IFN-α/ω were subjected to immunoblotting analysis using anti-ISG15 antibodies (top panels). The same blot was also probed with anti-actin antibodies (bottom panels). Masses of molecular weight standards are indicated at left.
    Rna, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 83 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna/product/Lonza
    Average 90 stars, based on 83 article reviews
    Price from $9.99 to $1999.99
    rna - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    95
    Qiagen control carrier rna
    Bar graphs representing total aphid offspring per day for 4 d following microinjection and electroporation trials. Graphs represent aphid offspring from the Trial 1: CRISPR treatment, the Trial 2: CRISPR treatment, and the three control treatments: Carrier <t>RNA,</t> Carrier RNA + <t>Cas9,</t> and Cas9.
    Control Carrier Rna, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control carrier rna/product/Qiagen
    Average 95 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    control carrier rna - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    90
    Thermo Fisher rna carrier
    <t>CTC</t> gene expression profiling methodology. ( A ) Schematic representation of the procedure used for CTC molecular characterization. CTC were isolated from 7.5 mL of peripheral blood by immunomagnetic separation using anti-EpCAM coated magnetic beads. Isolated cells were subjected to a <t>RNA</t> extraction followed by a whole transcriptome amplification process (WTA). Finally amplified cDNA was hybridized onto Agilent gene expression arrays. ( B ) GAPDH-CD45 levels in controls and mCRC patients measured by real time PCR. Horizontal bars represent the median value of each group (*p
    Rna Carrier, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna carrier/product/Thermo Fisher
    Average 90 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    rna carrier - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    95
    Millipore bacteriophage ms2 rna rna
    Poly(A)-tailing native <t>RNA-seq</t> protocol. (A) The protocol contains three main steps 1) Poly(A)- tailing reaction using E. coli poly(A) polymerase (EPAP) 2) native RNA-seq by nanopore MinION and 3) real-time analysis to retrieve native RNA sequence. (B) An example of sequencing result (reads) that mapped to the bacteriophage <t>MS2</t> genome. (C) For detection purpose, this protocol can provide mapped RNA sequences within the first two minutes after sequencing. (D) To obtain whole genome and mRNAs, 2–8 h sequencing could provide more complete information.
    Bacteriophage Ms2 Rna Rna, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacteriophage ms2 rna rna/product/Millipore
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bacteriophage ms2 rna rna - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    99
    Horizon Discovery rnas
    ( A ) The results of RNA selection experiment with Nova-1 KH3 Q(32)→R mutant protein. Forty clones were sequenced from the RNA pool after eight rounds of selection; shown are the clones conforming to the consensus. Lowercase letters indicate the flanking fixed sequences of the <t>RNAs.</t> The core conserved element of the consensus is indicated in boldface type. ( B ) Nitrocellulose filter binding assays of Nova-1 KH3 Q(32)→R consensus clone [containing UCAUAA motif; #4 from (A)] against Nova-1 Q(32)→R and wild-type KH3 proteins. ( C ) Nitrocellulose filter binding assays of Nova-1 KH3 Q(32)→R protein against the consensus clone with various mutations in the UCAUAA motif, as well as <t>polycytidylate</t> (C 17 ) RNA.
    Rnas, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 99/100, based on 777 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/Horizon Discovery
    Average 99 stars, based on 777 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    SABiosciences rnas
    ( A ) The results of RNA selection experiment with Nova-1 KH3 Q(32)→R mutant protein. Forty clones were sequenced from the RNA pool after eight rounds of selection; shown are the clones conforming to the consensus. Lowercase letters indicate the flanking fixed sequences of the <t>RNAs.</t> The core conserved element of the consensus is indicated in boldface type. ( B ) Nitrocellulose filter binding assays of Nova-1 KH3 Q(32)→R consensus clone [containing UCAUAA motif; #4 from (A)] against Nova-1 Q(32)→R and wild-type KH3 proteins. ( C ) Nitrocellulose filter binding assays of Nova-1 KH3 Q(32)→R protein against the consensus clone with various mutations in the UCAUAA motif, as well as <t>polycytidylate</t> (C 17 ) RNA.
    Rnas, supplied by SABiosciences, used in various techniques. Bioz Stars score: 99/100, based on 93 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/SABiosciences
    Average 99 stars, based on 93 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    97
    Shanghai GenePharma rnas
    ( A ) The results of RNA selection experiment with Nova-1 KH3 Q(32)→R mutant protein. Forty clones were sequenced from the RNA pool after eight rounds of selection; shown are the clones conforming to the consensus. Lowercase letters indicate the flanking fixed sequences of the <t>RNAs.</t> The core conserved element of the consensus is indicated in boldface type. ( B ) Nitrocellulose filter binding assays of Nova-1 KH3 Q(32)→R consensus clone [containing UCAUAA motif; #4 from (A)] against Nova-1 Q(32)→R and wild-type KH3 proteins. ( C ) Nitrocellulose filter binding assays of Nova-1 KH3 Q(32)→R protein against the consensus clone with various mutations in the UCAUAA motif, as well as <t>polycytidylate</t> (C 17 ) RNA.
    Rnas, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 97/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/Shanghai GenePharma
    Average 97 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    rnas  (Solexa)
    99
    Solexa rnas
    Composition of small <t>RNAs</t> in worker and royal jelly <t>RNA</t> samples.
    Rnas, supplied by Solexa, used in various techniques. Bioz Stars score: 99/100, based on 487 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/Solexa
    Average 99 stars, based on 487 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    rnas  (TaKaRa)
    99
    TaKaRa rnas
    Composition of small <t>RNAs</t> in worker and royal jelly <t>RNA</t> samples.
    Rnas, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 4582 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/TaKaRa
    Average 99 stars, based on 4582 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher rnas
    ERGO-1 Is Required for Methylation of 26G <t>RNAs.</t> A) ERGO-1 class 26G RNA 26G-O1 is unmethylated in the absence of ERGO-1. Total embryo wild-type (5 µg) or ergo-1(tm1860) (10 µg) β-eliminated (βe +) or control treated (βe −) RNA was probed for 26G-O1. B) Anti-ERGO-1 rabbit polyclonal antibody immunoprecipitates ERGO-1 complexes. ERGO-1 complexes were immunopurified from lysates of equalized protein concentration extracted from wild-type, henn-1(tm4477) mutant, or eri-1(mg366) mutant embryo. Aliquots of lysates and immunoprecipitates (RNA IP) were probed with anti-ERGO-1 antibody. ergo-1(tm1860) mutant lysate was run in parallel to ensure specificity of ERGO-1 detection (data not shown). C) ERGO-1 binds methylated and unmethylated 26G RNAs. <t>Taqman</t> RT-qPCR for the indicated ERGO-1 class 26G RNAs was performed on samples described in B. The eri-1(mg366) mutant lacks 26G RNAs and serves as a negative control to demonstrate specificity of 26G RNA detection by Taqman assay. Standard deviation is shown for technical duplicates. Results are representative of two independent RNA immunoprecipitation experiments.
    Rnas, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 35162 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/Thermo Fisher
    Average 99 stars, based on 35162 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    97
    biomers.net rnas
    ERGO-1 Is Required for Methylation of 26G <t>RNAs.</t> A) ERGO-1 class 26G RNA 26G-O1 is unmethylated in the absence of ERGO-1. Total embryo wild-type (5 µg) or ergo-1(tm1860) (10 µg) β-eliminated (βe +) or control treated (βe −) RNA was probed for 26G-O1. B) Anti-ERGO-1 rabbit polyclonal antibody immunoprecipitates ERGO-1 complexes. ERGO-1 complexes were immunopurified from lysates of equalized protein concentration extracted from wild-type, henn-1(tm4477) mutant, or eri-1(mg366) mutant embryo. Aliquots of lysates and immunoprecipitates (RNA IP) were probed with anti-ERGO-1 antibody. ergo-1(tm1860) mutant lysate was run in parallel to ensure specificity of ERGO-1 detection (data not shown). C) ERGO-1 binds methylated and unmethylated 26G RNAs. <t>Taqman</t> RT-qPCR for the indicated ERGO-1 class 26G RNAs was performed on samples described in B. The eri-1(mg366) mutant lacks 26G RNAs and serves as a negative control to demonstrate specificity of 26G RNA detection by Taqman assay. Standard deviation is shown for technical duplicates. Results are representative of two independent RNA immunoprecipitation experiments.
    Rnas, supplied by biomers.net, used in various techniques. Bioz Stars score: 97/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/biomers.net
    Average 97 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    99
    Bioneer Corporation rnas
    ERGO-1 Is Required for Methylation of 26G <t>RNAs.</t> A) ERGO-1 class 26G RNA 26G-O1 is unmethylated in the absence of ERGO-1. Total embryo wild-type (5 µg) or ergo-1(tm1860) (10 µg) β-eliminated (βe +) or control treated (βe −) RNA was probed for 26G-O1. B) Anti-ERGO-1 rabbit polyclonal antibody immunoprecipitates ERGO-1 complexes. ERGO-1 complexes were immunopurified from lysates of equalized protein concentration extracted from wild-type, henn-1(tm4477) mutant, or eri-1(mg366) mutant embryo. Aliquots of lysates and immunoprecipitates (RNA IP) were probed with anti-ERGO-1 antibody. ergo-1(tm1860) mutant lysate was run in parallel to ensure specificity of ERGO-1 detection (data not shown). C) ERGO-1 binds methylated and unmethylated 26G RNAs. <t>Taqman</t> RT-qPCR for the indicated ERGO-1 class 26G RNAs was performed on samples described in B. The eri-1(mg366) mutant lacks 26G RNAs and serves as a negative control to demonstrate specificity of 26G RNA detection by Taqman assay. Standard deviation is shown for technical duplicates. Results are representative of two independent RNA immunoprecipitation experiments.
    Rnas, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 99/100, based on 169 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/Bioneer Corporation
    Average 99 stars, based on 169 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    OriGene rnas
    ERGO-1 Is Required for Methylation of 26G <t>RNAs.</t> A) ERGO-1 class 26G RNA 26G-O1 is unmethylated in the absence of ERGO-1. Total embryo wild-type (5 µg) or ergo-1(tm1860) (10 µg) β-eliminated (βe +) or control treated (βe −) RNA was probed for 26G-O1. B) Anti-ERGO-1 rabbit polyclonal antibody immunoprecipitates ERGO-1 complexes. ERGO-1 complexes were immunopurified from lysates of equalized protein concentration extracted from wild-type, henn-1(tm4477) mutant, or eri-1(mg366) mutant embryo. Aliquots of lysates and immunoprecipitates (RNA IP) were probed with anti-ERGO-1 antibody. ergo-1(tm1860) mutant lysate was run in parallel to ensure specificity of ERGO-1 detection (data not shown). C) ERGO-1 binds methylated and unmethylated 26G RNAs. <t>Taqman</t> RT-qPCR for the indicated ERGO-1 class 26G RNAs was performed on samples described in B. The eri-1(mg366) mutant lacks 26G RNAs and serves as a negative control to demonstrate specificity of 26G RNA detection by Taqman assay. Standard deviation is shown for technical duplicates. Results are representative of two independent RNA immunoprecipitation experiments.
    Rnas, supplied by OriGene, used in various techniques. Bioz Stars score: 99/100, based on 55 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/OriGene
    Average 99 stars, based on 55 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Santa Cruz Biotechnology rnas
    ERGO-1 Is Required for Methylation of 26G <t>RNAs.</t> A) ERGO-1 class 26G RNA 26G-O1 is unmethylated in the absence of ERGO-1. Total embryo wild-type (5 µg) or ergo-1(tm1860) (10 µg) β-eliminated (βe +) or control treated (βe −) RNA was probed for 26G-O1. B) Anti-ERGO-1 rabbit polyclonal antibody immunoprecipitates ERGO-1 complexes. ERGO-1 complexes were immunopurified from lysates of equalized protein concentration extracted from wild-type, henn-1(tm4477) mutant, or eri-1(mg366) mutant embryo. Aliquots of lysates and immunoprecipitates (RNA IP) were probed with anti-ERGO-1 antibody. ergo-1(tm1860) mutant lysate was run in parallel to ensure specificity of ERGO-1 detection (data not shown). C) ERGO-1 binds methylated and unmethylated 26G RNAs. <t>Taqman</t> RT-qPCR for the indicated ERGO-1 class 26G RNAs was performed on samples described in B. The eri-1(mg366) mutant lacks 26G RNAs and serves as a negative control to demonstrate specificity of 26G RNA detection by Taqman assay. Standard deviation is shown for technical duplicates. Results are representative of two independent RNA immunoprecipitation experiments.
    Rnas, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 99/100, based on 124 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/Santa Cruz Biotechnology
    Average 99 stars, based on 124 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    97
    Becton Dickinson rnas
    ERGO-1 Is Required for Methylation of 26G <t>RNAs.</t> A) ERGO-1 class 26G RNA 26G-O1 is unmethylated in the absence of ERGO-1. Total embryo wild-type (5 µg) or ergo-1(tm1860) (10 µg) β-eliminated (βe +) or control treated (βe −) RNA was probed for 26G-O1. B) Anti-ERGO-1 rabbit polyclonal antibody immunoprecipitates ERGO-1 complexes. ERGO-1 complexes were immunopurified from lysates of equalized protein concentration extracted from wild-type, henn-1(tm4477) mutant, or eri-1(mg366) mutant embryo. Aliquots of lysates and immunoprecipitates (RNA IP) were probed with anti-ERGO-1 antibody. ergo-1(tm1860) mutant lysate was run in parallel to ensure specificity of ERGO-1 detection (data not shown). C) ERGO-1 binds methylated and unmethylated 26G RNAs. <t>Taqman</t> RT-qPCR for the indicated ERGO-1 class 26G RNAs was performed on samples described in B. The eri-1(mg366) mutant lacks 26G RNAs and serves as a negative control to demonstrate specificity of 26G RNA detection by Taqman assay. Standard deviation is shown for technical duplicates. Results are representative of two independent RNA immunoprecipitation experiments.
    Rnas, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 97/100, based on 161 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/Becton Dickinson
    Average 97 stars, based on 161 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    99
    System Biosciences Inc rnas
    ERGO-1 Is Required for Methylation of 26G <t>RNAs.</t> A) ERGO-1 class 26G RNA 26G-O1 is unmethylated in the absence of ERGO-1. Total embryo wild-type (5 µg) or ergo-1(tm1860) (10 µg) β-eliminated (βe +) or control treated (βe −) RNA was probed for 26G-O1. B) Anti-ERGO-1 rabbit polyclonal antibody immunoprecipitates ERGO-1 complexes. ERGO-1 complexes were immunopurified from lysates of equalized protein concentration extracted from wild-type, henn-1(tm4477) mutant, or eri-1(mg366) mutant embryo. Aliquots of lysates and immunoprecipitates (RNA IP) were probed with anti-ERGO-1 antibody. ergo-1(tm1860) mutant lysate was run in parallel to ensure specificity of ERGO-1 detection (data not shown). C) ERGO-1 binds methylated and unmethylated 26G RNAs. <t>Taqman</t> RT-qPCR for the indicated ERGO-1 class 26G RNAs was performed on samples described in B. The eri-1(mg366) mutant lacks 26G RNAs and serves as a negative control to demonstrate specificity of 26G RNA detection by Taqman assay. Standard deviation is shown for technical duplicates. Results are representative of two independent RNA immunoprecipitation experiments.
    Rnas, supplied by System Biosciences Inc, used in various techniques. Bioz Stars score: 99/100, based on 40 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/System Biosciences Inc
    Average 99 stars, based on 40 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    97
    EuroClone rnas
    ERGO-1 Is Required for Methylation of 26G <t>RNAs.</t> A) ERGO-1 class 26G RNA 26G-O1 is unmethylated in the absence of ERGO-1. Total embryo wild-type (5 µg) or ergo-1(tm1860) (10 µg) β-eliminated (βe +) or control treated (βe −) RNA was probed for 26G-O1. B) Anti-ERGO-1 rabbit polyclonal antibody immunoprecipitates ERGO-1 complexes. ERGO-1 complexes were immunopurified from lysates of equalized protein concentration extracted from wild-type, henn-1(tm4477) mutant, or eri-1(mg366) mutant embryo. Aliquots of lysates and immunoprecipitates (RNA IP) were probed with anti-ERGO-1 antibody. ergo-1(tm1860) mutant lysate was run in parallel to ensure specificity of ERGO-1 detection (data not shown). C) ERGO-1 binds methylated and unmethylated 26G RNAs. <t>Taqman</t> RT-qPCR for the indicated ERGO-1 class 26G RNAs was performed on samples described in B. The eri-1(mg366) mutant lacks 26G RNAs and serves as a negative control to demonstrate specificity of 26G RNA detection by Taqman assay. Standard deviation is shown for technical duplicates. Results are representative of two independent RNA immunoprecipitation experiments.
    Rnas, supplied by EuroClone, used in various techniques. Bioz Stars score: 97/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/EuroClone
    Average 97 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    99
    Millipore rnas
    ERGO-1 Is Required for Methylation of 26G <t>RNAs.</t> A) ERGO-1 class 26G RNA 26G-O1 is unmethylated in the absence of ERGO-1. Total embryo wild-type (5 µg) or ergo-1(tm1860) (10 µg) β-eliminated (βe +) or control treated (βe −) RNA was probed for 26G-O1. B) Anti-ERGO-1 rabbit polyclonal antibody immunoprecipitates ERGO-1 complexes. ERGO-1 complexes were immunopurified from lysates of equalized protein concentration extracted from wild-type, henn-1(tm4477) mutant, or eri-1(mg366) mutant embryo. Aliquots of lysates and immunoprecipitates (RNA IP) were probed with anti-ERGO-1 antibody. ergo-1(tm1860) mutant lysate was run in parallel to ensure specificity of ERGO-1 detection (data not shown). C) ERGO-1 binds methylated and unmethylated 26G RNAs. <t>Taqman</t> RT-qPCR for the indicated ERGO-1 class 26G RNAs was performed on samples described in B. The eri-1(mg366) mutant lacks 26G RNAs and serves as a negative control to demonstrate specificity of 26G RNA detection by Taqman assay. Standard deviation is shown for technical duplicates. Results are representative of two independent RNA immunoprecipitation experiments.
    Rnas, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 2262 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/Millipore
    Average 99 stars, based on 2262 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Agilent technologies rnas
    ERGO-1 Is Required for Methylation of 26G <t>RNAs.</t> A) ERGO-1 class 26G RNA 26G-O1 is unmethylated in the absence of ERGO-1. Total embryo wild-type (5 µg) or ergo-1(tm1860) (10 µg) β-eliminated (βe +) or control treated (βe −) RNA was probed for 26G-O1. B) Anti-ERGO-1 rabbit polyclonal antibody immunoprecipitates ERGO-1 complexes. ERGO-1 complexes were immunopurified from lysates of equalized protein concentration extracted from wild-type, henn-1(tm4477) mutant, or eri-1(mg366) mutant embryo. Aliquots of lysates and immunoprecipitates (RNA IP) were probed with anti-ERGO-1 antibody. ergo-1(tm1860) mutant lysate was run in parallel to ensure specificity of ERGO-1 detection (data not shown). C) ERGO-1 binds methylated and unmethylated 26G RNAs. <t>Taqman</t> RT-qPCR for the indicated ERGO-1 class 26G RNAs was performed on samples described in B. The eri-1(mg366) mutant lacks 26G RNAs and serves as a negative control to demonstrate specificity of 26G RNA detection by Taqman assay. Standard deviation is shown for technical duplicates. Results are representative of two independent RNA immunoprecipitation experiments.
    Rnas, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 99/100, based on 4171 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/Agilent technologies
    Average 99 stars, based on 4171 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    97
    CureVac rnas
    ERGO-1 Is Required for Methylation of 26G <t>RNAs.</t> A) ERGO-1 class 26G RNA 26G-O1 is unmethylated in the absence of ERGO-1. Total embryo wild-type (5 µg) or ergo-1(tm1860) (10 µg) β-eliminated (βe +) or control treated (βe −) RNA was probed for 26G-O1. B) Anti-ERGO-1 rabbit polyclonal antibody immunoprecipitates ERGO-1 complexes. ERGO-1 complexes were immunopurified from lysates of equalized protein concentration extracted from wild-type, henn-1(tm4477) mutant, or eri-1(mg366) mutant embryo. Aliquots of lysates and immunoprecipitates (RNA IP) were probed with anti-ERGO-1 antibody. ergo-1(tm1860) mutant lysate was run in parallel to ensure specificity of ERGO-1 detection (data not shown). C) ERGO-1 binds methylated and unmethylated 26G RNAs. <t>Taqman</t> RT-qPCR for the indicated ERGO-1 class 26G RNAs was performed on samples described in B. The eri-1(mg366) mutant lacks 26G RNAs and serves as a negative control to demonstrate specificity of 26G RNA detection by Taqman assay. Standard deviation is shown for technical duplicates. Results are representative of two independent RNA immunoprecipitation experiments.
    Rnas, supplied by CureVac, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/CureVac
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    90
    Promega rna markers
    The SARS-CoV 7L8/12/14 complex possesses RdRp, ExoN, and N7-MTase activities. ( A ) Strep-tagged SARS-CoV nsp12 was bound to Strep-Tactin beads and incubated with 7L8, nsp14, or both simultaneously. After SDS/PAGE and Western blotting, his-tagged proteins (7L8 and nsp14) were revealed using an anti-His 5 -HRP antibody. ( B ) Time course primer extension polymerase assays were performed using either the 7L8/12 (500 nM) or the 7L8/12/14 (500 nM) complexes with LS2*/LS1 as primer*/template where LS2 was <t>5′-radiolabeled</t> (marked by *). <t>RNA</t> products were separated in a denaturing polyacrylamide/urea gel and visualized by autoradiography. ( C ) Time course exoribonuclease assays were performed using the 7L8/12/14 (500 nM) complex in the absence or presence of 100 nM nsp10, and as control with 7L8/12 (500 nM) plus nsp10 (100 nM). The RNA substrate was a 40-nt RNA (LS1) annealed with 5′-radiolabeled LS3 primer carrying one noncomplementary base at its 3′ end (LS3*) and named LS3*/LS1. Digestion products were separated by denaturing polyacrylamide/urea gel electrophoresis and visualized by autoradiography (Fuji). The “α” symbol indicates RNA cleavage products. ( D ) AdoMet-dependent N7-MTase activity of the 7L8/12/14 complex. The different purified proteins or protein complexes (nsp14, 300 nM; 7L8/12/14, 300 nM; and 7L8/12, 300 nM) were incubated with substrate GpppAC 4 RNA oligonucleotide in the presence of [ 3 ). All experiments were done in triplicate (SDs are presented).
    Rna Markers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 91 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna markers/product/Promega
    Average 90 stars, based on 91 article reviews
    Price from $9.99 to $1999.99
    rna markers - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    TaKaRa nucleospin rna kit
    The SARS-CoV 7L8/12/14 complex possesses RdRp, ExoN, and N7-MTase activities. ( A ) Strep-tagged SARS-CoV nsp12 was bound to Strep-Tactin beads and incubated with 7L8, nsp14, or both simultaneously. After SDS/PAGE and Western blotting, his-tagged proteins (7L8 and nsp14) were revealed using an anti-His 5 -HRP antibody. ( B ) Time course primer extension polymerase assays were performed using either the 7L8/12 (500 nM) or the 7L8/12/14 (500 nM) complexes with LS2*/LS1 as primer*/template where LS2 was <t>5′-radiolabeled</t> (marked by *). <t>RNA</t> products were separated in a denaturing polyacrylamide/urea gel and visualized by autoradiography. ( C ) Time course exoribonuclease assays were performed using the 7L8/12/14 (500 nM) complex in the absence or presence of 100 nM nsp10, and as control with 7L8/12 (500 nM) plus nsp10 (100 nM). The RNA substrate was a 40-nt RNA (LS1) annealed with 5′-radiolabeled LS3 primer carrying one noncomplementary base at its 3′ end (LS3*) and named LS3*/LS1. Digestion products were separated by denaturing polyacrylamide/urea gel electrophoresis and visualized by autoradiography (Fuji). The “α” symbol indicates RNA cleavage products. ( D ) AdoMet-dependent N7-MTase activity of the 7L8/12/14 complex. The different purified proteins or protein complexes (nsp14, 300 nM; 7L8/12/14, 300 nM; and 7L8/12, 300 nM) were incubated with substrate GpppAC 4 RNA oligonucleotide in the presence of [ 3 ). All experiments were done in triplicate (SDs are presented).
    Nucleospin Rna Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nucleospin rna kit/product/TaKaRa
    Average 90 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    nucleospin rna kit - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Ribobio rnas
    The SARS-CoV 7L8/12/14 complex possesses RdRp, ExoN, and N7-MTase activities. ( A ) Strep-tagged SARS-CoV nsp12 was bound to Strep-Tactin beads and incubated with 7L8, nsp14, or both simultaneously. After SDS/PAGE and Western blotting, his-tagged proteins (7L8 and nsp14) were revealed using an anti-His 5 -HRP antibody. ( B ) Time course primer extension polymerase assays were performed using either the 7L8/12 (500 nM) or the 7L8/12/14 (500 nM) complexes with LS2*/LS1 as primer*/template where LS2 was <t>5′-radiolabeled</t> (marked by *). <t>RNA</t> products were separated in a denaturing polyacrylamide/urea gel and visualized by autoradiography. ( C ) Time course exoribonuclease assays were performed using the 7L8/12/14 (500 nM) complex in the absence or presence of 100 nM nsp10, and as control with 7L8/12 (500 nM) plus nsp10 (100 nM). The RNA substrate was a 40-nt RNA (LS1) annealed with 5′-radiolabeled LS3 primer carrying one noncomplementary base at its 3′ end (LS3*) and named LS3*/LS1. Digestion products were separated by denaturing polyacrylamide/urea gel electrophoresis and visualized by autoradiography (Fuji). The “α” symbol indicates RNA cleavage products. ( D ) AdoMet-dependent N7-MTase activity of the 7L8/12/14 complex. The different purified proteins or protein complexes (nsp14, 300 nM; 7L8/12/14, 300 nM; and 7L8/12, 300 nM) were incubated with substrate GpppAC 4 RNA oligonucleotide in the presence of [ 3 ). All experiments were done in triplicate (SDs are presented).
    Rnas, supplied by Ribobio, used in various techniques. Bioz Stars score: 99/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/Ribobio
    Average 99 stars, based on 32 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    rnas  (Roche)
    99
    Roche rnas
    Dual-RNA labeling system and FISH analysis of heterodimeric RNA in virions. ( A ) Schematic representation of the constructions used in the study. HIV-1 tagged genomes were constructed by replacing a portion of the pol gene in NL4-3Δenv plasmid with 5′-lacZ (WT-lacZ) or 24xMS2 (WT-MS2) sequences to allow specific detection of unspliced RNA (positions and numbers indicated in gray refer to HIV-1 DNA nucleotides). NV-MS2 encodes a non-viral RNA containing 24xMS2 repeats from a pcDNA3 backbone. ( B ) Western-blotting of protein extracts from HeLa cells and purified virions from culture supernatants at 24 h pt with WT-lacZ, WT-MS2 or NV-MS2 plasmids. The expression of Gag (55kDa), Vpu (16 kDa) and Actin (42 kDa) is shown. The quantification of three independent blots revealed that cells transfected with the LacZ construct produced 84 ± 30% of Gag produced with the MS2 construct ( P = 0.4). ( C ) <t>RT-PCR</t> analysis of tagged <t>RNAs</t> in the cells and viruses used for FISH analyses. For dual-WT RNA detection, the RT was initiated with the same primers followed by a PCR step with two sense primers (one specific for lacZ and one for MS2) together with a common antisense primer in the same PCR reaction, generating two amplicons with specific sizes. Lanes 1 and 2 in the agarose gel correspond to the amplification of WT-lacZ and WT-MS2 plasmids, respectively ( n ≥ 3). NV-MS2 is detected by another RT-PCR system using specific primers ( n = 2). ( D ) Representative images of lacZ- (red) and MS2-tagged (green) RNAs visualized by single-molecule FISH of virus preparations. Images were obtained with a 100×-oil objective in a wide-field fluorescence microscope. Scale bar is 10 μm. The lower images show the center positions of identified spots. ( E ) Ratio between the number of green and red fluorescent spots. ( F ) Percentage of WT-lacZ RNA colocalized with WT-MS2 or NV-MS2 RNA. The fraction of bars filled in red represent the remaining proportion of WT-lacZ gRNA engaged in homodimers. Data are the mean ± SEM of three independent transfections (counting ≥1000 red spots per sample) and the significance of differences with control (NV-WT) was assessed using an unpaired Student's t -test (**** P ≤ 0.0001).
    Rnas, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 2196 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/Roche
    Average 99 stars, based on 2196 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    97
    SubTerra rnas
    <t>subTERRA</t> localize to the nucleus. (a) FISH with labeled probes detection of Y′ subtelomeric region (upper panel) and DAPI staining for nuclear DNA detection. Representative cells for WT (W303) strain with no subTERRA -specific signals (experiment was representative for biological triplicate). In xrn1 ∆ trf4 ∆ specific subTERRA signals co-localize with DAPI staining; (b) subTERRA were detected almost exclusively in nuclear fraction. Cellular fractionation experiment (biological duplicates): whole RNA extracts (TOT 1/100 of material used for fractionating), two cytoplasmic fractions (CYT1 and CYT2) and nuclear fraction (NUC) were separated on 1% formaldehyde/MOPS agarose gel (upper panel) rRNA and tRNA species are stained with ethidium bromide. <t>RNAs</t> were transferred to nylon membrane and indicated ncRNAs were detected with specific radio-labeled probes (oligonucleotides/single-stranded for ITS1 , PMA1 , scR1 or double-stranded for subTERRA ).
    Rnas, supplied by SubTerra, used in various techniques. Bioz Stars score: 97/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnas/product/SubTerra
    Average 97 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    92
    Illumina Inc rna rna comparisons
    Possible nucleotide comparisons and implemented <t>JACUSA</t> filter. a Graphical representation of <t>RNA-DNA</t> differences (RDDs) and RNA-RNA-differences (RRDs) in head-to-head comparisons of sequencing data. b Possible sequencing artifacts and their respective JACUSA filters
    Rna Rna Comparisons, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna rna comparisons/product/Illumina Inc
    Average 92 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    rna rna comparisons - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    95
    Qiagen control rna ic rna
    Possible nucleotide comparisons and implemented <t>JACUSA</t> filter. a Graphical representation of <t>RNA-DNA</t> differences (RDDs) and RNA-RNA-differences (RRDs) in head-to-head comparisons of sequencing data. b Possible sequencing artifacts and their respective JACUSA filters
    Control Rna Ic Rna, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control rna ic rna/product/Qiagen
    Average 95 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    control rna ic rna - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Zymo Research yeastar rna kit
    Possible nucleotide comparisons and implemented <t>JACUSA</t> filter. a Graphical representation of <t>RNA-DNA</t> differences (RDDs) and RNA-RNA-differences (RRDs) in head-to-head comparisons of sequencing data. b Possible sequencing artifacts and their respective JACUSA filters
    Yeastar Rna Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 74 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/yeastar rna kit/product/Zymo Research
    Average 95 stars, based on 74 article reviews
    Price from $9.99 to $1999.99
    yeastar rna kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Differential expression of RNA:m 5 C, RCMTs and hnRNPK in 5-AZA-sensitive and 5-AZA-resistant leukaemia cells and the binding of hnRNPK to unmethylated and cytosine-methylated RNA. a Western blot analysis of expression of RCMTs, hnRNPK and other proteins in the 5-AZA-sensitive OCI-M2 and SC leukaemia cells and the 5-AZA-resistant M2AR and SCAR leukaemia cells. b Dot blot analysis of 5-methylcytosine (m 5 C) in RNA and DNA from OCI-M2 and M2AR cells. c Dot blot analysis of 5-methylcytosine (m 5 C) in RNA and DNA from SC and SCAR cells. d , e Visualization and measurement of the binding of purified recombinant hnRNPK to the unmethylated and cytosine-methylated fluorescein (FAM)-labelled RNA oligos by an antibody-coupled bead assay

    Journal: Nature Communications

    Article Title: RNA cytosine methylation and methyltransferases mediate chromatin organization and 5-azacytidine response and resistance in leukaemia

    doi: 10.1038/s41467-018-03513-4

    Figure Lengend Snippet: Differential expression of RNA:m 5 C, RCMTs and hnRNPK in 5-AZA-sensitive and 5-AZA-resistant leukaemia cells and the binding of hnRNPK to unmethylated and cytosine-methylated RNA. a Western blot analysis of expression of RCMTs, hnRNPK and other proteins in the 5-AZA-sensitive OCI-M2 and SC leukaemia cells and the 5-AZA-resistant M2AR and SCAR leukaemia cells. b Dot blot analysis of 5-methylcytosine (m 5 C) in RNA and DNA from OCI-M2 and M2AR cells. c Dot blot analysis of 5-methylcytosine (m 5 C) in RNA and DNA from SC and SCAR cells. d , e Visualization and measurement of the binding of purified recombinant hnRNPK to the unmethylated and cytosine-methylated fluorescein (FAM)-labelled RNA oligos by an antibody-coupled bead assay

    Article Snippet: Visualize and quantify the binding of hnRNPK to RNA The 6-FAM (Fluorescein)-labelled methylated and unmethylated RNA oligos were purchased from Integrated DNA Technologies (Skokie, IL 60076).

    Techniques: Expressing, Binding Assay, Methylation, Western Blot, Dot Blot, Purification, Recombinant

    LPT (RNAi) results in differentiation defects and outgrowth formation during regeneration. a A schematic showing the amputation of RNAi worms into head (H), middle (M) and tail (T) pieces in order to observe regeneration of different structures. The time-course of all the experiments on Mll3/4 knockdown animals is depicted underneath the worm schematic. A total of 9 days of dsRNA microinjection-mediated RNAi was followed by amputation on the 10 th day and subsequent observation of regeneration. b Head, middle and tail pieces following LPT (RNAi) or control GFP (RNAi) at day 7 of regeneration. Yellow arrows point towards the defects in blastema formation. c Head, middle and tail pieces following LPT (RNAi) or control GFP (RNAi) at day 11 of regeneration. Red arrows point towards outgrowths. d Homeostatic animals following LPT (RNAi) or control GFP (RNAi) at day 14 post RNAi. Red arrows point towards outgrowths. e Gut regeneration and maintenance in middle pieces following LPT (RNAi), as illustrated by RNA probe for the gene porcupine-1 at 8 days of regeneration. f Brain regeneration in middle pieces at 8 days post-amputation following LPT (RNAi), as illustrated by anti-SYNORF-1 antibody labeling the central nervous system (CNS). g Optic chiasm recovery in tail pieces at 8 days of regeneration following LPT (RNAi), as shown by anti-VC-1 antibody. h Recovery of optic cups and organized trail of optic cup precursor cells in tail pieces at 8 days of regeneration following LPT (RNAi), as demonstrated by RNA probe for SP6-9 . i Pharynx recovery in head pieces at 8 days of regeneration following LPT (RNAi), as illustrated by RNA probe for laminin . Number of animals with observable phenotype are recorded out of the total number of animals in the top right of each panel. Scale bars: 200 μm

    Journal: Nature Communications

    Article Title: Conservation of epigenetic regulation by the MLL3/4 tumour suppressor in planarian pluripotent stem cells

    doi: 10.1038/s41467-018-06092-6

    Figure Lengend Snippet: LPT (RNAi) results in differentiation defects and outgrowth formation during regeneration. a A schematic showing the amputation of RNAi worms into head (H), middle (M) and tail (T) pieces in order to observe regeneration of different structures. The time-course of all the experiments on Mll3/4 knockdown animals is depicted underneath the worm schematic. A total of 9 days of dsRNA microinjection-mediated RNAi was followed by amputation on the 10 th day and subsequent observation of regeneration. b Head, middle and tail pieces following LPT (RNAi) or control GFP (RNAi) at day 7 of regeneration. Yellow arrows point towards the defects in blastema formation. c Head, middle and tail pieces following LPT (RNAi) or control GFP (RNAi) at day 11 of regeneration. Red arrows point towards outgrowths. d Homeostatic animals following LPT (RNAi) or control GFP (RNAi) at day 14 post RNAi. Red arrows point towards outgrowths. e Gut regeneration and maintenance in middle pieces following LPT (RNAi), as illustrated by RNA probe for the gene porcupine-1 at 8 days of regeneration. f Brain regeneration in middle pieces at 8 days post-amputation following LPT (RNAi), as illustrated by anti-SYNORF-1 antibody labeling the central nervous system (CNS). g Optic chiasm recovery in tail pieces at 8 days of regeneration following LPT (RNAi), as shown by anti-VC-1 antibody. h Recovery of optic cups and organized trail of optic cup precursor cells in tail pieces at 8 days of regeneration following LPT (RNAi), as demonstrated by RNA probe for SP6-9 . i Pharynx recovery in head pieces at 8 days of regeneration following LPT (RNAi), as illustrated by RNA probe for laminin . Number of animals with observable phenotype are recorded out of the total number of animals in the top right of each panel. Scale bars: 200 μm

    Article Snippet: T7 (Roche) and SP6 (NEB) RNA polymerases were used for transcription of each strand.

    Techniques: Antibody Labeling

    Critical contribution of RyDEN in IFN-mediated anti-DENV response. (A and B) Induction of RyDEN expression by IFN treatments. HeLa (A) and shRNA-expressing HepG2 (B) cells were treated with increasing concentrations (10, 100, and 1,000 units/ml) of IFN-α/ω or a fixed concentration (300 units/ml) of IFN-α/ω, IFN-γ, and IFN-λ1. Cell lysates 24 h after treatment were subjected to immunoblotting (IB) analysis. Masses of molecular weight standards are indicated at left. (C) Effect of RyDEN knockdown on IFN-mediated DENV inhibition. sh1425 (RyDEN knockdown) or shCtrl-expressing HepG2 cells were pretreated with 300 units/ml of IFN-α/ω and, 24 h after infection, exposed to DENV-2 at an MOI of 1. The virus titer of the culture supernatant was measured by plaque assay 2 days after infection. Statistical significance was determined using two-way ANOVA. (D) HepG2 cells were transfected with plasmid DNA-expressing V5-RyDEN (gray bars), V5-BAP (white bars), or HA-STING (black bars). Total RNA was isolated 48 h after transfection and subjected to qRT-PCR analysis for the detection of LY6E, ISG15, ISG54, RIG-I, and IFN-β mRNA. Statistical significance was determined by one-way ANOVA with Dunnett’s multiple comparison test. ns, no significance. (E) RyDEN knockdown (sh1425-expressing, gray bars) and control (shCtrl-expressing, white bars) HeLa cells were cultured in the presence or absence of 1,000 units/ml IFN-α/ω. Total RNA was isolated 24 h after treatment and subjected to qRT-PCR analysis. The levels of gene expression were expressed as the fold change compared to untreated cells. ns, no significance. (F) sh1425- (left panels) and shCtrl-expressing (right panels) HeLa cells treated with IFN-α/ω were subjected to immunoblotting analysis using anti-ISG15 antibodies (top panels). The same blot was also probed with anti-actin antibodies (bottom panels). Masses of molecular weight standards are indicated at left.

    Journal: PLoS Pathogens

    Article Title: Characterization of RyDEN (C19orf66) as an Interferon-Stimulated Cellular Inhibitor against Dengue Virus Replication

    doi: 10.1371/journal.ppat.1005357

    Figure Lengend Snippet: Critical contribution of RyDEN in IFN-mediated anti-DENV response. (A and B) Induction of RyDEN expression by IFN treatments. HeLa (A) and shRNA-expressing HepG2 (B) cells were treated with increasing concentrations (10, 100, and 1,000 units/ml) of IFN-α/ω or a fixed concentration (300 units/ml) of IFN-α/ω, IFN-γ, and IFN-λ1. Cell lysates 24 h after treatment were subjected to immunoblotting (IB) analysis. Masses of molecular weight standards are indicated at left. (C) Effect of RyDEN knockdown on IFN-mediated DENV inhibition. sh1425 (RyDEN knockdown) or shCtrl-expressing HepG2 cells were pretreated with 300 units/ml of IFN-α/ω and, 24 h after infection, exposed to DENV-2 at an MOI of 1. The virus titer of the culture supernatant was measured by plaque assay 2 days after infection. Statistical significance was determined using two-way ANOVA. (D) HepG2 cells were transfected with plasmid DNA-expressing V5-RyDEN (gray bars), V5-BAP (white bars), or HA-STING (black bars). Total RNA was isolated 48 h after transfection and subjected to qRT-PCR analysis for the detection of LY6E, ISG15, ISG54, RIG-I, and IFN-β mRNA. Statistical significance was determined by one-way ANOVA with Dunnett’s multiple comparison test. ns, no significance. (E) RyDEN knockdown (sh1425-expressing, gray bars) and control (shCtrl-expressing, white bars) HeLa cells were cultured in the presence or absence of 1,000 units/ml IFN-α/ω. Total RNA was isolated 24 h after treatment and subjected to qRT-PCR analysis. The levels of gene expression were expressed as the fold change compared to untreated cells. ns, no significance. (F) sh1425- (left panels) and shCtrl-expressing (right panels) HeLa cells treated with IFN-α/ω were subjected to immunoblotting analysis using anti-ISG15 antibodies (top panels). The same blot was also probed with anti-actin antibodies (bottom panels). Masses of molecular weight standards are indicated at left.

    Article Snippet: Generation of lentiviral vectors carrying an IFN cDNA library A Gateway-compatible cDNA library was generated from mRNA isolated from HeLa cells that had been treated with 1,000 U/ml type I IFN (a mixture of human interferon α and ω, Sigma) for 24 h. Briefly, total RNA was extracted using the RNeasy Mini Kit (Qiagen), and mRNA was then isolated using a PolyATtract mRNA Isolation System II (Promega) according to the manufacturer’s recommendations.

    Techniques: Expressing, shRNA, Concentration Assay, Molecular Weight, Inhibition, Infection, Plaque Assay, Transfection, Plasmid Preparation, Isolation, Quantitative RT-PCR, Cell Culture

    Summary of cDNAs recovered from DENV-resistant Huh7.5 cell clones. Fifty-two colonies of clonal Huh7.5 cells that survived a chellenge infection of DENV-2 were infected with DENV at an MOI of 1, and culture supernatants of infected cells were subjected to plaque assay. mRNA were isolated from cells whose supernatant formed 10 or less DENV plaques less (DENV-resistant clones, total 32 clones), and cDNA inserts expressing in the clones were analyzed by sequencing. More than 50 plaques were formed with a supernatant of control protein (BAP)-expressing Huh7.5 cells.

    Journal: PLoS Pathogens

    Article Title: Characterization of RyDEN (C19orf66) as an Interferon-Stimulated Cellular Inhibitor against Dengue Virus Replication

    doi: 10.1371/journal.ppat.1005357

    Figure Lengend Snippet: Summary of cDNAs recovered from DENV-resistant Huh7.5 cell clones. Fifty-two colonies of clonal Huh7.5 cells that survived a chellenge infection of DENV-2 were infected with DENV at an MOI of 1, and culture supernatants of infected cells were subjected to plaque assay. mRNA were isolated from cells whose supernatant formed 10 or less DENV plaques less (DENV-resistant clones, total 32 clones), and cDNA inserts expressing in the clones were analyzed by sequencing. More than 50 plaques were formed with a supernatant of control protein (BAP)-expressing Huh7.5 cells.

    Article Snippet: Generation of lentiviral vectors carrying an IFN cDNA library A Gateway-compatible cDNA library was generated from mRNA isolated from HeLa cells that had been treated with 1,000 U/ml type I IFN (a mixture of human interferon α and ω, Sigma) for 24 h. Briefly, total RNA was extracted using the RNeasy Mini Kit (Qiagen), and mRNA was then isolated using a PolyATtract mRNA Isolation System II (Promega) according to the manufacturer’s recommendations.

    Techniques: Clone Assay, Infection, Plaque Assay, Isolation, Expressing, Sequencing

    Identification of RyDEN. (A) Procedure for gain-of-function screen. The cDNA library was generated from mRNA of IFN-α/ω-treated HeLa cells and transferred into a lentiviral vector by the Gateway recombination system. Infectious lentiviral vectors carrying the IFN cDNA library were produced as a VSV-G-pseudotyped virus and used to transduce DENV-susceptible Huh7.5 cells. cDNA library-expressing Huh7.5 cells were then challenged with DENV-2 at an MOI of 1, and cell colonies that survived DENV-induced cell death were collected. (B) Histogram analysis of cDNA fragments in library vectors. The entry vector (pDONR221, left panel) and destination vector (pYK005C, right panel) recombinated with the Gateway-compatible cDNA library were applied to Escherichia coli ( E . coli) , and the cells were spread onto LB plates to develop bacterial colonies. The cDNA fragments in individual colonies were amplified by PCR using primers described in Materials and Methods and visualized with agarose gel electrophoresis. The size of the PCR fragment was estimated by comparing the migration distance of the DNA molecular weight markers. Up to sixty colonies were picked up from each vector-transformed E . coli plate and analyzed. (C) Validation of DENV-resistant cell clones. Surviving clones obtained from (A) were seeded in a chamber slide and infected with DENV-2 at an MOI of 5. Two days after infection, cells were fixed with paraformaldehyde, permeabilized, and stained with anti-dsRNA antibody, followed by detection with Alexa Fluor 488-conjugated secondary antibody (red). Cell nuclei were stained with DAPI (blue). Representative merged images using four surviving clones (#1, 13, 14, and 15) and control cells (bacterial alkaline phosphatase [BAP]-expressing Huh7.5 cells) are shown. In a parallel experiment, the culture supernatant of infected cells was harvested 2 days after infection and subjected to plaque assay to measure the virus titer (insets). (D) Amplification of cDNA from DENV-resistant cells. Genomic DNA was isolated from cell clones, whose resistant property had been confirmed in (B), and cDNA was amplified by PCR using primers specific to the lentiviral vector. PCR products were separated by agarose gel electrophoresis and visualized by ethidium bromide staining. (E) Amino acid sequence of RyDEN. (F) Predicted domain organization of RyDEN. RyDEN protein (291 amino acid) was suggested to contain eight α-helixes (blue), seven β-strands (orange), NLS (121–137), NES (261–269), zinc-ribbon domain (112–135), and coiled-coil motif (261–285). A unique glutamic acid-rich (E-rich) domain was also found in the C-terminus.

    Journal: PLoS Pathogens

    Article Title: Characterization of RyDEN (C19orf66) as an Interferon-Stimulated Cellular Inhibitor against Dengue Virus Replication

    doi: 10.1371/journal.ppat.1005357

    Figure Lengend Snippet: Identification of RyDEN. (A) Procedure for gain-of-function screen. The cDNA library was generated from mRNA of IFN-α/ω-treated HeLa cells and transferred into a lentiviral vector by the Gateway recombination system. Infectious lentiviral vectors carrying the IFN cDNA library were produced as a VSV-G-pseudotyped virus and used to transduce DENV-susceptible Huh7.5 cells. cDNA library-expressing Huh7.5 cells were then challenged with DENV-2 at an MOI of 1, and cell colonies that survived DENV-induced cell death were collected. (B) Histogram analysis of cDNA fragments in library vectors. The entry vector (pDONR221, left panel) and destination vector (pYK005C, right panel) recombinated with the Gateway-compatible cDNA library were applied to Escherichia coli ( E . coli) , and the cells were spread onto LB plates to develop bacterial colonies. The cDNA fragments in individual colonies were amplified by PCR using primers described in Materials and Methods and visualized with agarose gel electrophoresis. The size of the PCR fragment was estimated by comparing the migration distance of the DNA molecular weight markers. Up to sixty colonies were picked up from each vector-transformed E . coli plate and analyzed. (C) Validation of DENV-resistant cell clones. Surviving clones obtained from (A) were seeded in a chamber slide and infected with DENV-2 at an MOI of 5. Two days after infection, cells were fixed with paraformaldehyde, permeabilized, and stained with anti-dsRNA antibody, followed by detection with Alexa Fluor 488-conjugated secondary antibody (red). Cell nuclei were stained with DAPI (blue). Representative merged images using four surviving clones (#1, 13, 14, and 15) and control cells (bacterial alkaline phosphatase [BAP]-expressing Huh7.5 cells) are shown. In a parallel experiment, the culture supernatant of infected cells was harvested 2 days after infection and subjected to plaque assay to measure the virus titer (insets). (D) Amplification of cDNA from DENV-resistant cells. Genomic DNA was isolated from cell clones, whose resistant property had been confirmed in (B), and cDNA was amplified by PCR using primers specific to the lentiviral vector. PCR products were separated by agarose gel electrophoresis and visualized by ethidium bromide staining. (E) Amino acid sequence of RyDEN. (F) Predicted domain organization of RyDEN. RyDEN protein (291 amino acid) was suggested to contain eight α-helixes (blue), seven β-strands (orange), NLS (121–137), NES (261–269), zinc-ribbon domain (112–135), and coiled-coil motif (261–285). A unique glutamic acid-rich (E-rich) domain was also found in the C-terminus.

    Article Snippet: Generation of lentiviral vectors carrying an IFN cDNA library A Gateway-compatible cDNA library was generated from mRNA isolated from HeLa cells that had been treated with 1,000 U/ml type I IFN (a mixture of human interferon α and ω, Sigma) for 24 h. Briefly, total RNA was extracted using the RNeasy Mini Kit (Qiagen), and mRNA was then isolated using a PolyATtract mRNA Isolation System II (Promega) according to the manufacturer’s recommendations.

    Techniques: cDNA Library Assay, Generated, Plasmid Preparation, Produced, Transduction, Expressing, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Migration, Molecular Weight, Transformation Assay, Clone Assay, Infection, Staining, Plaque Assay, Isolation, Sequencing

    Possible models for RyDEN’s mechanism of action in the suppression of DENV infection. During DENV replication, PABPC1 and LARP1 are recruited to viral RNA, form a closed-loop structure of viral RNA with a cap-binding complex that includes eIF4G and eIF4E, and serve as positive regulators for the translation of viral proteins. RyDEN, whose expression is upregulated by IFN, specifically recognizes the DENV translation complex via interaction with viral RNA and PABPC1/LARP1. This interaction may interfere with the protein translation machinery of DENV RNA. Additionally, functions of PABPC1 and LARP1 in the regulation of mRNA turnover may be enhanced by interaction with RyDEN, resulting in the degradation of viral RNA in cytoplasmic foci such as P-bodies.

    Journal: PLoS Pathogens

    Article Title: Characterization of RyDEN (C19orf66) as an Interferon-Stimulated Cellular Inhibitor against Dengue Virus Replication

    doi: 10.1371/journal.ppat.1005357

    Figure Lengend Snippet: Possible models for RyDEN’s mechanism of action in the suppression of DENV infection. During DENV replication, PABPC1 and LARP1 are recruited to viral RNA, form a closed-loop structure of viral RNA with a cap-binding complex that includes eIF4G and eIF4E, and serve as positive regulators for the translation of viral proteins. RyDEN, whose expression is upregulated by IFN, specifically recognizes the DENV translation complex via interaction with viral RNA and PABPC1/LARP1. This interaction may interfere with the protein translation machinery of DENV RNA. Additionally, functions of PABPC1 and LARP1 in the regulation of mRNA turnover may be enhanced by interaction with RyDEN, resulting in the degradation of viral RNA in cytoplasmic foci such as P-bodies.

    Article Snippet: Generation of lentiviral vectors carrying an IFN cDNA library A Gateway-compatible cDNA library was generated from mRNA isolated from HeLa cells that had been treated with 1,000 U/ml type I IFN (a mixture of human interferon α and ω, Sigma) for 24 h. Briefly, total RNA was extracted using the RNeasy Mini Kit (Qiagen), and mRNA was then isolated using a PolyATtract mRNA Isolation System II (Promega) according to the manufacturer’s recommendations.

    Techniques: Infection, Binding Assay, Expressing

    Inhibition of DENV replication by RyDEN expression. (A) Establishment of human cell lines stably expressing V5-tagged RyDEN. Huh7.5 and HepG2 cells expressing V5-RyDEN or V5-DHFR were created by lentiviral vector transduction and blasticidin selection. Expression of V5-tagged proteins was analyzed by immunoblotting (IB). Masses of molecular weight standards are indicated at left. (B) Replication of DENV-2 in stable cell lines. Huh7.5 (left panels) and HepG2 (right panels) cells expressing V5-RyDEN (gray) or V5-DHFR (white) were infected with DENV-2 (Singapore isolate) at MOIs of 0.1 (top), 1 (middle), and 10 (bottom), and virus replication was monitored until 72 h after infection. Infectious titers in culture supernatants were quantified by plaque assay. Note that, at an MOI of 10, the virus titer for V5-DHFR-expressing Huh7.5 cells peaked at the first day, and by the second day, a large proportion of the cells exhibited massive CPE, whereas V5-RyDEN-expressing Huh7.5 cells that displayed resistance to DENV-induced CPE produced steady level of viruses even after 2 days. (C) Inhibitory effect of RyDEN against all DENV serotypes. HepG2 cells expressing V5-RyDEN (gray bars) and V5-DHFR (white bars) were infected with DENV-1, -3, -4 (Singapore isolates), or -2 (New Guinea strain [NGC]) at an MOI of 0.1, and the virus titer was determined 2 days after infection. (D) shRNA-based knockdown of RyDEN mRNA. HeLa cells were transduced with lentiviral vectors expressing three different shRNA sequences against RyDEN mRNA (sh1425, sh3151, or sh5890) and subjected to puromycin selection to create stable cell lines. The expression level of RyDEN mRNA in RyDEN shRNA and non-targeting control shRNA (shCtrl)-expressing cells were analyzed by qRT-PCR analysis and normalized with GAPDH mRNA levels. (E) Replication efficiency of DENV in the knockdown cells. shRNA-expressing HeLa cells were infected with DENV-2 at an MOI of 1, and the viral titer in culture supernatant 2 days after infection was quantified by plaque assay. (F) Add-back of shRNA-resistant RyDEN in knockdown cells. Control shRNA (shCtrl, left lanes) and RyDEN shRNA (sh1425, right lanes)-expressing cells were established again using HepG2 cells. Cells were further transduced with lentiviral vectors expressing sh1425-susceptible wild-type (WT) or sh1425-resistant (1425 R ) V5-RyDEN and selected with blasticidin. The expression of V5-tagged RyDEN was analyzed by immunoblotting (IB) analysis. Masses of molecular weight standards are indicated at left. Parental stands for the untransduced shRNA cell line. (G) Effect of the shRNA-resistant RyDEN expression on DENV replication in knockdown cells. Cell lines created in (F) were infected with DENV-2 at an MOI of 0.1, and the virus titer 2 days after infection was determined. The level of virus titer in the culture supernatants of WT and 1425 R cells relative to the parent cells (derived from each shRNA-expressing cells) is shown. Statistical significance was determined by two-way ANOVA (B), Student’s t test (C), or one-way ANOVA with Dunnett’s multiple comparison test (D, E, and G). ns, no significance (i.e., P > 0.05).

    Journal: PLoS Pathogens

    Article Title: Characterization of RyDEN (C19orf66) as an Interferon-Stimulated Cellular Inhibitor against Dengue Virus Replication

    doi: 10.1371/journal.ppat.1005357

    Figure Lengend Snippet: Inhibition of DENV replication by RyDEN expression. (A) Establishment of human cell lines stably expressing V5-tagged RyDEN. Huh7.5 and HepG2 cells expressing V5-RyDEN or V5-DHFR were created by lentiviral vector transduction and blasticidin selection. Expression of V5-tagged proteins was analyzed by immunoblotting (IB). Masses of molecular weight standards are indicated at left. (B) Replication of DENV-2 in stable cell lines. Huh7.5 (left panels) and HepG2 (right panels) cells expressing V5-RyDEN (gray) or V5-DHFR (white) were infected with DENV-2 (Singapore isolate) at MOIs of 0.1 (top), 1 (middle), and 10 (bottom), and virus replication was monitored until 72 h after infection. Infectious titers in culture supernatants were quantified by plaque assay. Note that, at an MOI of 10, the virus titer for V5-DHFR-expressing Huh7.5 cells peaked at the first day, and by the second day, a large proportion of the cells exhibited massive CPE, whereas V5-RyDEN-expressing Huh7.5 cells that displayed resistance to DENV-induced CPE produced steady level of viruses even after 2 days. (C) Inhibitory effect of RyDEN against all DENV serotypes. HepG2 cells expressing V5-RyDEN (gray bars) and V5-DHFR (white bars) were infected with DENV-1, -3, -4 (Singapore isolates), or -2 (New Guinea strain [NGC]) at an MOI of 0.1, and the virus titer was determined 2 days after infection. (D) shRNA-based knockdown of RyDEN mRNA. HeLa cells were transduced with lentiviral vectors expressing three different shRNA sequences against RyDEN mRNA (sh1425, sh3151, or sh5890) and subjected to puromycin selection to create stable cell lines. The expression level of RyDEN mRNA in RyDEN shRNA and non-targeting control shRNA (shCtrl)-expressing cells were analyzed by qRT-PCR analysis and normalized with GAPDH mRNA levels. (E) Replication efficiency of DENV in the knockdown cells. shRNA-expressing HeLa cells were infected with DENV-2 at an MOI of 1, and the viral titer in culture supernatant 2 days after infection was quantified by plaque assay. (F) Add-back of shRNA-resistant RyDEN in knockdown cells. Control shRNA (shCtrl, left lanes) and RyDEN shRNA (sh1425, right lanes)-expressing cells were established again using HepG2 cells. Cells were further transduced with lentiviral vectors expressing sh1425-susceptible wild-type (WT) or sh1425-resistant (1425 R ) V5-RyDEN and selected with blasticidin. The expression of V5-tagged RyDEN was analyzed by immunoblotting (IB) analysis. Masses of molecular weight standards are indicated at left. Parental stands for the untransduced shRNA cell line. (G) Effect of the shRNA-resistant RyDEN expression on DENV replication in knockdown cells. Cell lines created in (F) were infected with DENV-2 at an MOI of 0.1, and the virus titer 2 days after infection was determined. The level of virus titer in the culture supernatants of WT and 1425 R cells relative to the parent cells (derived from each shRNA-expressing cells) is shown. Statistical significance was determined by two-way ANOVA (B), Student’s t test (C), or one-way ANOVA with Dunnett’s multiple comparison test (D, E, and G). ns, no significance (i.e., P > 0.05).

    Article Snippet: Generation of lentiviral vectors carrying an IFN cDNA library A Gateway-compatible cDNA library was generated from mRNA isolated from HeLa cells that had been treated with 1,000 U/ml type I IFN (a mixture of human interferon α and ω, Sigma) for 24 h. Briefly, total RNA was extracted using the RNeasy Mini Kit (Qiagen), and mRNA was then isolated using a PolyATtract mRNA Isolation System II (Promega) according to the manufacturer’s recommendations.

    Techniques: Inhibition, Expressing, Stable Transfection, Plasmid Preparation, Transduction, Selection, Molecular Weight, Infection, Plaque Assay, Produced, shRNA, Quantitative RT-PCR, Derivative Assay

    Bar graphs representing total aphid offspring per day for 4 d following microinjection and electroporation trials. Graphs represent aphid offspring from the Trial 1: CRISPR treatment, the Trial 2: CRISPR treatment, and the three control treatments: Carrier RNA, Carrier RNA + Cas9, and Cas9.

    Journal: Journal of Insect Science

    Article Title: Efficacy of In Vivo Electroporation on the Delivery of Molecular Agents into Aphid (Hemiptera: Aphididae) Ovarioles

    doi: 10.1093/jisesa/iey041

    Figure Lengend Snippet: Bar graphs representing total aphid offspring per day for 4 d following microinjection and electroporation trials. Graphs represent aphid offspring from the Trial 1: CRISPR treatment, the Trial 2: CRISPR treatment, and the three control treatments: Carrier RNA, Carrier RNA + Cas9, and Cas9.

    Article Snippet: For microinjections, concentrations of both sgRNA and Cas9 were 160 ng/ul based on optimization trials in , and the control carrier RNA (Qiagen, Hilden, Germany) concentration was also at 160 ng/ul for microinjection trials.

    Techniques: Electroporation, CRISPR

    CTC gene expression profiling methodology. ( A ) Schematic representation of the procedure used for CTC molecular characterization. CTC were isolated from 7.5 mL of peripheral blood by immunomagnetic separation using anti-EpCAM coated magnetic beads. Isolated cells were subjected to a RNA extraction followed by a whole transcriptome amplification process (WTA). Finally amplified cDNA was hybridized onto Agilent gene expression arrays. ( B ) GAPDH-CD45 levels in controls and mCRC patients measured by real time PCR. Horizontal bars represent the median value of each group (*p

    Journal: PLoS ONE

    Article Title: Molecular Characterization of Circulating Tumor Cells in Human Metastatic Colorectal Cancer

    doi: 10.1371/journal.pone.0040476

    Figure Lengend Snippet: CTC gene expression profiling methodology. ( A ) Schematic representation of the procedure used for CTC molecular characterization. CTC were isolated from 7.5 mL of peripheral blood by immunomagnetic separation using anti-EpCAM coated magnetic beads. Isolated cells were subjected to a RNA extraction followed by a whole transcriptome amplification process (WTA). Finally amplified cDNA was hybridized onto Agilent gene expression arrays. ( B ) GAPDH-CD45 levels in controls and mCRC patients measured by real time PCR. Horizontal bars represent the median value of each group (*p

    Article Snippet: CTC were isolated as described, and RNA was purified with a RNA carrier to improve yield and stability. cDNA was synthesized by using SuperScriptIII chemistry (Invitrogen) following manufacturer’s instructions.

    Techniques: Expressing, Isolation, Immunomagnetic Separation, Magnetic Beads, RNA Extraction, Amplification, Real-time Polymerase Chain Reaction

    Poly(A)-tailing native RNA-seq protocol. (A) The protocol contains three main steps 1) Poly(A)- tailing reaction using E. coli poly(A) polymerase (EPAP) 2) native RNA-seq by nanopore MinION and 3) real-time analysis to retrieve native RNA sequence. (B) An example of sequencing result (reads) that mapped to the bacteriophage MS2 genome. (C) For detection purpose, this protocol can provide mapped RNA sequences within the first two minutes after sequencing. (D) To obtain whole genome and mRNAs, 2–8 h sequencing could provide more complete information.

    Journal: Frontiers in Microbiology

    Article Title: Rapid Sequencing of Multiple RNA Viruses in Their Native Form

    doi: 10.3389/fmicb.2019.00260

    Figure Lengend Snippet: Poly(A)-tailing native RNA-seq protocol. (A) The protocol contains three main steps 1) Poly(A)- tailing reaction using E. coli poly(A) polymerase (EPAP) 2) native RNA-seq by nanopore MinION and 3) real-time analysis to retrieve native RNA sequence. (B) An example of sequencing result (reads) that mapped to the bacteriophage MS2 genome. (C) For detection purpose, this protocol can provide mapped RNA sequences within the first two minutes after sequencing. (D) To obtain whole genome and mRNAs, 2–8 h sequencing could provide more complete information.

    Article Snippet: Bacteriophage MS2 RNA RNA from bacteriophage MS2 (Sigma) is composed of 3569 nucleotides (Genbank no: NC_001417.2).

    Techniques: RNA Sequencing Assay, Sequencing

    ( A ) The results of RNA selection experiment with Nova-1 KH3 Q(32)→R mutant protein. Forty clones were sequenced from the RNA pool after eight rounds of selection; shown are the clones conforming to the consensus. Lowercase letters indicate the flanking fixed sequences of the RNAs. The core conserved element of the consensus is indicated in boldface type. ( B ) Nitrocellulose filter binding assays of Nova-1 KH3 Q(32)→R consensus clone [containing UCAUAA motif; #4 from (A)] against Nova-1 Q(32)→R and wild-type KH3 proteins. ( C ) Nitrocellulose filter binding assays of Nova-1 KH3 Q(32)→R protein against the consensus clone with various mutations in the UCAUAA motif, as well as polycytidylate (C 17 ) RNA.

    Journal: Nucleic Acids Research

    Article Title: Determination and augmentation of RNA sequence specificity of the Nova K-homology domains

    doi: 10.1093/nar/gkh799

    Figure Lengend Snippet: ( A ) The results of RNA selection experiment with Nova-1 KH3 Q(32)→R mutant protein. Forty clones were sequenced from the RNA pool after eight rounds of selection; shown are the clones conforming to the consensus. Lowercase letters indicate the flanking fixed sequences of the RNAs. The core conserved element of the consensus is indicated in boldface type. ( B ) Nitrocellulose filter binding assays of Nova-1 KH3 Q(32)→R consensus clone [containing UCAUAA motif; #4 from (A)] against Nova-1 Q(32)→R and wild-type KH3 proteins. ( C ) Nitrocellulose filter binding assays of Nova-1 KH3 Q(32)→R protein against the consensus clone with various mutations in the UCAUAA motif, as well as polycytidylate (C 17 ) RNA.

    Article Snippet: Wild-type and mutant 10048 RNAs (based on 23mer GCGCGGAUCAGUCACCCAAGCGC template) and 17mer polycytidylate RNA (C17 ) were prepared by end-labeling commercially synthesized RNAs (Dharmacon Research) with [γ-32 P]ATP (Amersham Pharmacia), followed by size-purification with 20% denaturing PAGE.

    Techniques: Selection, Mutagenesis, Clone Assay, Binding Assay

    Nitrocellulose filter binding assays of wild-type and mutant 10048 RNAs against Nova-1 KH1/2 protein. Each mutant 10048 RNA harbors a single nucleotide change in the UCAGUCAC sequence. The eight panels include all possible mutants in each of the eight positions of the UCAGUCAC sequence.

    Journal: Nucleic Acids Research

    Article Title: Determination and augmentation of RNA sequence specificity of the Nova K-homology domains

    doi: 10.1093/nar/gkh799

    Figure Lengend Snippet: Nitrocellulose filter binding assays of wild-type and mutant 10048 RNAs against Nova-1 KH1/2 protein. Each mutant 10048 RNA harbors a single nucleotide change in the UCAGUCAC sequence. The eight panels include all possible mutants in each of the eight positions of the UCAGUCAC sequence.

    Article Snippet: Wild-type and mutant 10048 RNAs (based on 23mer GCGCGGAUCAGUCACCCAAGCGC template) and 17mer polycytidylate RNA (C17 ) were prepared by end-labeling commercially synthesized RNAs (Dharmacon Research) with [γ-32 P]ATP (Amersham Pharmacia), followed by size-purification with 20% denaturing PAGE.

    Techniques: Binding Assay, Mutagenesis, Sequencing

    Composition of small RNAs in worker and royal jelly RNA samples.

    Journal: PLoS ONE

    Article Title: Recipe for a Busy Bee: MicroRNAs in Honey Bee Caste Determination

    doi: 10.1371/journal.pone.0081661

    Figure Lengend Snippet: Composition of small RNAs in worker and royal jelly RNA samples.

    Article Snippet: After total RNA was extracted and quantified, equal amounts of total RNAs from each of the three sampling days were pooled into worker and royal jelly samples, and the fraction of small RNAs less than 30nt long was retained and sequenced on the Illumina/Solexa high-throughput platform (HTP).

    Techniques:

    ERGO-1 Is Required for Methylation of 26G RNAs. A) ERGO-1 class 26G RNA 26G-O1 is unmethylated in the absence of ERGO-1. Total embryo wild-type (5 µg) or ergo-1(tm1860) (10 µg) β-eliminated (βe +) or control treated (βe −) RNA was probed for 26G-O1. B) Anti-ERGO-1 rabbit polyclonal antibody immunoprecipitates ERGO-1 complexes. ERGO-1 complexes were immunopurified from lysates of equalized protein concentration extracted from wild-type, henn-1(tm4477) mutant, or eri-1(mg366) mutant embryo. Aliquots of lysates and immunoprecipitates (RNA IP) were probed with anti-ERGO-1 antibody. ergo-1(tm1860) mutant lysate was run in parallel to ensure specificity of ERGO-1 detection (data not shown). C) ERGO-1 binds methylated and unmethylated 26G RNAs. Taqman RT-qPCR for the indicated ERGO-1 class 26G RNAs was performed on samples described in B. The eri-1(mg366) mutant lacks 26G RNAs and serves as a negative control to demonstrate specificity of 26G RNA detection by Taqman assay. Standard deviation is shown for technical duplicates. Results are representative of two independent RNA immunoprecipitation experiments.

    Journal: PLoS Genetics

    Article Title: The Caenorhabditis elegans HEN1 Ortholog, HENN-1, Methylates and Stabilizes Select Subclasses of Germline Small RNAsPIWI Associated siRNAs and piRNAs Specifically Require the Caenorhabditis elegans HEN1 Ortholog henn-1

    doi: 10.1371/journal.pgen.1002617

    Figure Lengend Snippet: ERGO-1 Is Required for Methylation of 26G RNAs. A) ERGO-1 class 26G RNA 26G-O1 is unmethylated in the absence of ERGO-1. Total embryo wild-type (5 µg) or ergo-1(tm1860) (10 µg) β-eliminated (βe +) or control treated (βe −) RNA was probed for 26G-O1. B) Anti-ERGO-1 rabbit polyclonal antibody immunoprecipitates ERGO-1 complexes. ERGO-1 complexes were immunopurified from lysates of equalized protein concentration extracted from wild-type, henn-1(tm4477) mutant, or eri-1(mg366) mutant embryo. Aliquots of lysates and immunoprecipitates (RNA IP) were probed with anti-ERGO-1 antibody. ergo-1(tm1860) mutant lysate was run in parallel to ensure specificity of ERGO-1 detection (data not shown). C) ERGO-1 binds methylated and unmethylated 26G RNAs. Taqman RT-qPCR for the indicated ERGO-1 class 26G RNAs was performed on samples described in B. The eri-1(mg366) mutant lacks 26G RNAs and serves as a negative control to demonstrate specificity of 26G RNA detection by Taqman assay. Standard deviation is shown for technical duplicates. Results are representative of two independent RNA immunoprecipitation experiments.

    Article Snippet: Sequences of the indicated small RNAs were submitted to Applied Biosystems for Taqman small RNA probe design and synthesis. (DOC) Click here for additional data file.

    Techniques: Methylation, Protein Concentration, Mutagenesis, Quantitative RT-PCR, Negative Control, RNA Detection, TaqMan Assay, Standard Deviation, Immunoprecipitation

    HEN1 Stabilizes ERGO-1 Class, but Not ALG-3/ALG-4 Class, 26G RNAs. A) Loss of henn-1 impairs ERGO-1 class 26G RNA accumulation at all stages. Levels of ERGO-1 class 26G RNA 26G-O3 were assayed by Taqman qPCR across development of wild-type and henn-1(tm4477) mutant animals at 25°C. Standard deviation is shown for biological triplicates. Taqman qPCR data for seven additional ERGO-1 class 26G RNAs are shown in Figure S8 . B) ALG-3/ALG-4 class 26G RNAs are henn-1 -independent. Levels of ALG-3/ALG-4 class 26G RNA 26G-S5 were assayed across the period of development in which ALG-3/ALG-4 class 26G RNAs are readily detectable. Standard deviation is shown for biological triplicates. Taqman qPCR data for two additional ALG-3/ALG-4 class 26G RNAs are shown in Figure S9 . C) Loss of henn-1 may result in modest, sporadic defects in ERGO-1 class 26G RNA target silencing. Levels of eight target and two non-target mRNAs were assayed across development of wild-type and henn-1(tm4477) mutant animals at 25°C and normalized to eft-2 . Expression in the henn-1(tm4477) mutant relative to wild-type is represented according to the red-green color scheme indicated in the right panel. Raw data is shown in Figure S10 . E, embryo.

    Journal: PLoS Genetics

    Article Title: The Caenorhabditis elegans HEN1 Ortholog, HENN-1, Methylates and Stabilizes Select Subclasses of Germline Small RNAsPIWI Associated siRNAs and piRNAs Specifically Require the Caenorhabditis elegans HEN1 Ortholog henn-1

    doi: 10.1371/journal.pgen.1002617

    Figure Lengend Snippet: HEN1 Stabilizes ERGO-1 Class, but Not ALG-3/ALG-4 Class, 26G RNAs. A) Loss of henn-1 impairs ERGO-1 class 26G RNA accumulation at all stages. Levels of ERGO-1 class 26G RNA 26G-O3 were assayed by Taqman qPCR across development of wild-type and henn-1(tm4477) mutant animals at 25°C. Standard deviation is shown for biological triplicates. Taqman qPCR data for seven additional ERGO-1 class 26G RNAs are shown in Figure S8 . B) ALG-3/ALG-4 class 26G RNAs are henn-1 -independent. Levels of ALG-3/ALG-4 class 26G RNA 26G-S5 were assayed across the period of development in which ALG-3/ALG-4 class 26G RNAs are readily detectable. Standard deviation is shown for biological triplicates. Taqman qPCR data for two additional ALG-3/ALG-4 class 26G RNAs are shown in Figure S9 . C) Loss of henn-1 may result in modest, sporadic defects in ERGO-1 class 26G RNA target silencing. Levels of eight target and two non-target mRNAs were assayed across development of wild-type and henn-1(tm4477) mutant animals at 25°C and normalized to eft-2 . Expression in the henn-1(tm4477) mutant relative to wild-type is represented according to the red-green color scheme indicated in the right panel. Raw data is shown in Figure S10 . E, embryo.

    Article Snippet: Sequences of the indicated small RNAs were submitted to Applied Biosystems for Taqman small RNA probe design and synthesis. (DOC) Click here for additional data file.

    Techniques: Real-time Polymerase Chain Reaction, Mutagenesis, Standard Deviation, Expressing

    HENN-1 Stabilizes 21U RNAs. A) Loss of henn-1 impairs 21U RNA accumulation in adult, embryo, and early larva. Levels of 21UR-1848 were assayed by Taqman qPCR in embryo and every four hours across development of wild-type and henn-1(tm4477) mutant animals at 25°C. Standard deviation is shown for biological triplicates. Taqman qPCR data for eight additional 21U RNAs are shown in Figure S4 . B) Effects of loss of henn-1 are restricted to its small RNA substrates. Levels of miR-1 across development were assayed by Taqman qPCR. Standard deviation is shown for biological triplicates. Additional Taqman qPCR data for miRNAs are shown in Figure S5 . C) Loss of henn-1 impairs Tc3 transposase silencing primarily in early L1 larva. Tc3 transposase mRNA levels were assayed by qPCR across development and normalized to mRNA levels of eft-2 , an abundantly expressed housekeeping gene. prg-1(tm872) lacks 21U RNAs and is included as a positive control for Tc3 upregulation. Significant zero and four hour time points are expanded at right (*: P = 0.0251; **: P = 0.0250, two-tailed t -test). Standard deviation is shown for biological triplicates. E, embryo; hr, hour.

    Journal: PLoS Genetics

    Article Title: The Caenorhabditis elegans HEN1 Ortholog, HENN-1, Methylates and Stabilizes Select Subclasses of Germline Small RNAsPIWI Associated siRNAs and piRNAs Specifically Require the Caenorhabditis elegans HEN1 Ortholog henn-1

    doi: 10.1371/journal.pgen.1002617

    Figure Lengend Snippet: HENN-1 Stabilizes 21U RNAs. A) Loss of henn-1 impairs 21U RNA accumulation in adult, embryo, and early larva. Levels of 21UR-1848 were assayed by Taqman qPCR in embryo and every four hours across development of wild-type and henn-1(tm4477) mutant animals at 25°C. Standard deviation is shown for biological triplicates. Taqman qPCR data for eight additional 21U RNAs are shown in Figure S4 . B) Effects of loss of henn-1 are restricted to its small RNA substrates. Levels of miR-1 across development were assayed by Taqman qPCR. Standard deviation is shown for biological triplicates. Additional Taqman qPCR data for miRNAs are shown in Figure S5 . C) Loss of henn-1 impairs Tc3 transposase silencing primarily in early L1 larva. Tc3 transposase mRNA levels were assayed by qPCR across development and normalized to mRNA levels of eft-2 , an abundantly expressed housekeeping gene. prg-1(tm872) lacks 21U RNAs and is included as a positive control for Tc3 upregulation. Significant zero and four hour time points are expanded at right (*: P = 0.0251; **: P = 0.0250, two-tailed t -test). Standard deviation is shown for biological triplicates. E, embryo; hr, hour.

    Article Snippet: Sequences of the indicated small RNAs were submitted to Applied Biosystems for Taqman small RNA probe design and synthesis. (DOC) Click here for additional data file.

    Techniques: Real-time Polymerase Chain Reaction, Mutagenesis, Standard Deviation, Positive Control, Two Tailed Test

    The SARS-CoV 7L8/12/14 complex possesses RdRp, ExoN, and N7-MTase activities. ( A ) Strep-tagged SARS-CoV nsp12 was bound to Strep-Tactin beads and incubated with 7L8, nsp14, or both simultaneously. After SDS/PAGE and Western blotting, his-tagged proteins (7L8 and nsp14) were revealed using an anti-His 5 -HRP antibody. ( B ) Time course primer extension polymerase assays were performed using either the 7L8/12 (500 nM) or the 7L8/12/14 (500 nM) complexes with LS2*/LS1 as primer*/template where LS2 was 5′-radiolabeled (marked by *). RNA products were separated in a denaturing polyacrylamide/urea gel and visualized by autoradiography. ( C ) Time course exoribonuclease assays were performed using the 7L8/12/14 (500 nM) complex in the absence or presence of 100 nM nsp10, and as control with 7L8/12 (500 nM) plus nsp10 (100 nM). The RNA substrate was a 40-nt RNA (LS1) annealed with 5′-radiolabeled LS3 primer carrying one noncomplementary base at its 3′ end (LS3*) and named LS3*/LS1. Digestion products were separated by denaturing polyacrylamide/urea gel electrophoresis and visualized by autoradiography (Fuji). The “α” symbol indicates RNA cleavage products. ( D ) AdoMet-dependent N7-MTase activity of the 7L8/12/14 complex. The different purified proteins or protein complexes (nsp14, 300 nM; 7L8/12/14, 300 nM; and 7L8/12, 300 nM) were incubated with substrate GpppAC 4 RNA oligonucleotide in the presence of [ 3 ). All experiments were done in triplicate (SDs are presented).

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: One severe acute respiratory syndrome coronavirus protein complex integrates processive RNA polymerase and exonuclease activities

    doi: 10.1073/pnas.1323705111

    Figure Lengend Snippet: The SARS-CoV 7L8/12/14 complex possesses RdRp, ExoN, and N7-MTase activities. ( A ) Strep-tagged SARS-CoV nsp12 was bound to Strep-Tactin beads and incubated with 7L8, nsp14, or both simultaneously. After SDS/PAGE and Western blotting, his-tagged proteins (7L8 and nsp14) were revealed using an anti-His 5 -HRP antibody. ( B ) Time course primer extension polymerase assays were performed using either the 7L8/12 (500 nM) or the 7L8/12/14 (500 nM) complexes with LS2*/LS1 as primer*/template where LS2 was 5′-radiolabeled (marked by *). RNA products were separated in a denaturing polyacrylamide/urea gel and visualized by autoradiography. ( C ) Time course exoribonuclease assays were performed using the 7L8/12/14 (500 nM) complex in the absence or presence of 100 nM nsp10, and as control with 7L8/12 (500 nM) plus nsp10 (100 nM). The RNA substrate was a 40-nt RNA (LS1) annealed with 5′-radiolabeled LS3 primer carrying one noncomplementary base at its 3′ end (LS3*) and named LS3*/LS1. Digestion products were separated by denaturing polyacrylamide/urea gel electrophoresis and visualized by autoradiography (Fuji). The “α” symbol indicates RNA cleavage products. ( D ) AdoMet-dependent N7-MTase activity of the 7L8/12/14 complex. The different purified proteins or protein complexes (nsp14, 300 nM; 7L8/12/14, 300 nM; and 7L8/12, 300 nM) were incubated with substrate GpppAC 4 RNA oligonucleotide in the presence of [ 3 ). All experiments were done in triplicate (SDs are presented).

    Article Snippet: RNA marker (Promega; catalog no. G3191) was radiolabeled with the T4 polynucleotide kinase (PNK) (NEB) and [γ-32 P]ATP.

    Techniques: Incubation, SDS Page, Western Blot, Autoradiography, Nucleic Acid Electrophoresis, Activity Assay, Purification

    The 7L8/12 polymerase complex catalyzes de novo RNA synthesis. De novo RNA polymerase assays were performed using 500 nM 7L8/12 with 500 nM RNA template (3R), representing the 3′-terminal 339 nt of the SARS-CoV genome. Reaction products, collected at the indicated time points, were analyzed by denaturing agarose gel electrophoresis and autoradiography. Reaction products are identified on the Right of the gel, and radiolabeled RNA size marker (M) is shown to the Left of the panel.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: One severe acute respiratory syndrome coronavirus protein complex integrates processive RNA polymerase and exonuclease activities

    doi: 10.1073/pnas.1323705111

    Figure Lengend Snippet: The 7L8/12 polymerase complex catalyzes de novo RNA synthesis. De novo RNA polymerase assays were performed using 500 nM 7L8/12 with 500 nM RNA template (3R), representing the 3′-terminal 339 nt of the SARS-CoV genome. Reaction products, collected at the indicated time points, were analyzed by denaturing agarose gel electrophoresis and autoradiography. Reaction products are identified on the Right of the gel, and radiolabeled RNA size marker (M) is shown to the Left of the panel.

    Article Snippet: RNA marker (Promega; catalog no. G3191) was radiolabeled with the T4 polynucleotide kinase (PNK) (NEB) and [γ-32 P]ATP.

    Techniques: Agarose Gel Electrophoresis, Autoradiography, Marker

    SARS-CoV nsp12 polymerase activity is activated by nsp7 and nsp8. ( A ) Sequence of the RNA primer/template used in this study; the 20-nt primer LS2 was 5′-radiolabeled (marked by *) and annealed to the 40-nt template LS1. ( B ) Primer extension polymerase assays were performed using LS2*/LS1 as substrate and different combinations of separately purified nsp12, nsp8, and nsp7. RNA products were separated by denaturing gel electrophoresis (20% polyacrylamide/7 M urea) and analyzed by autoradiography. The positions of the primer (20-mer) and the full-length extension product (40-mer) are indicated. ( C ) WT or mutant (D760A) nsp12 were coexpressed in E. coli with the nsp7-L-nsp8 fusion protein (7L8). After purification of the 7L8/nsp12 complex on a Strep-Tactin column, analysis by 12% SDS/PAGE and Coomassie blue staining of the proteins constituting the complex (nsp12 WT or D760A mutant) was done. # indicates the position of E. coli protein contaminants (defined by MALDI-TOF analysis). ( D ) Comparison of primer extension polymerase activities of WT and mutant (D760A) nsp12 in the presence of nsp7 and nsp8. Nsp7, nsp8, and nsp12 were either purified and added separately (lanes labeled 7+8+12) or copurified from E. coli as described above (lanes labeled 7L8/12). The reactions were performed on RNA template LS2*/LS1 (see B ). Primer conversion rates (at 60 min): 40% for 7+8+12; 67% for 7L8/12; and 0% for 7+8+12(D760A) and 7L8/12(D760A).

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: One severe acute respiratory syndrome coronavirus protein complex integrates processive RNA polymerase and exonuclease activities

    doi: 10.1073/pnas.1323705111

    Figure Lengend Snippet: SARS-CoV nsp12 polymerase activity is activated by nsp7 and nsp8. ( A ) Sequence of the RNA primer/template used in this study; the 20-nt primer LS2 was 5′-radiolabeled (marked by *) and annealed to the 40-nt template LS1. ( B ) Primer extension polymerase assays were performed using LS2*/LS1 as substrate and different combinations of separately purified nsp12, nsp8, and nsp7. RNA products were separated by denaturing gel electrophoresis (20% polyacrylamide/7 M urea) and analyzed by autoradiography. The positions of the primer (20-mer) and the full-length extension product (40-mer) are indicated. ( C ) WT or mutant (D760A) nsp12 were coexpressed in E. coli with the nsp7-L-nsp8 fusion protein (7L8). After purification of the 7L8/nsp12 complex on a Strep-Tactin column, analysis by 12% SDS/PAGE and Coomassie blue staining of the proteins constituting the complex (nsp12 WT or D760A mutant) was done. # indicates the position of E. coli protein contaminants (defined by MALDI-TOF analysis). ( D ) Comparison of primer extension polymerase activities of WT and mutant (D760A) nsp12 in the presence of nsp7 and nsp8. Nsp7, nsp8, and nsp12 were either purified and added separately (lanes labeled 7+8+12) or copurified from E. coli as described above (lanes labeled 7L8/12). The reactions were performed on RNA template LS2*/LS1 (see B ). Primer conversion rates (at 60 min): 40% for 7+8+12; 67% for 7L8/12; and 0% for 7+8+12(D760A) and 7L8/12(D760A).

    Article Snippet: RNA marker (Promega; catalog no. G3191) was radiolabeled with the T4 polynucleotide kinase (PNK) (NEB) and [γ-32 P]ATP.

    Techniques: Activity Assay, Sequencing, Purification, Nucleic Acid Electrophoresis, Autoradiography, Mutagenesis, SDS Page, Staining, Labeling

    Dual-RNA labeling system and FISH analysis of heterodimeric RNA in virions. ( A ) Schematic representation of the constructions used in the study. HIV-1 tagged genomes were constructed by replacing a portion of the pol gene in NL4-3Δenv plasmid with 5′-lacZ (WT-lacZ) or 24xMS2 (WT-MS2) sequences to allow specific detection of unspliced RNA (positions and numbers indicated in gray refer to HIV-1 DNA nucleotides). NV-MS2 encodes a non-viral RNA containing 24xMS2 repeats from a pcDNA3 backbone. ( B ) Western-blotting of protein extracts from HeLa cells and purified virions from culture supernatants at 24 h pt with WT-lacZ, WT-MS2 or NV-MS2 plasmids. The expression of Gag (55kDa), Vpu (16 kDa) and Actin (42 kDa) is shown. The quantification of three independent blots revealed that cells transfected with the LacZ construct produced 84 ± 30% of Gag produced with the MS2 construct ( P = 0.4). ( C ) RT-PCR analysis of tagged RNAs in the cells and viruses used for FISH analyses. For dual-WT RNA detection, the RT was initiated with the same primers followed by a PCR step with two sense primers (one specific for lacZ and one for MS2) together with a common antisense primer in the same PCR reaction, generating two amplicons with specific sizes. Lanes 1 and 2 in the agarose gel correspond to the amplification of WT-lacZ and WT-MS2 plasmids, respectively ( n ≥ 3). NV-MS2 is detected by another RT-PCR system using specific primers ( n = 2). ( D ) Representative images of lacZ- (red) and MS2-tagged (green) RNAs visualized by single-molecule FISH of virus preparations. Images were obtained with a 100×-oil objective in a wide-field fluorescence microscope. Scale bar is 10 μm. The lower images show the center positions of identified spots. ( E ) Ratio between the number of green and red fluorescent spots. ( F ) Percentage of WT-lacZ RNA colocalized with WT-MS2 or NV-MS2 RNA. The fraction of bars filled in red represent the remaining proportion of WT-lacZ gRNA engaged in homodimers. Data are the mean ± SEM of three independent transfections (counting ≥1000 red spots per sample) and the significance of differences with control (NV-WT) was assessed using an unpaired Student's t -test (**** P ≤ 0.0001).

    Journal: Nucleic Acids Research

    Article Title: Imaging HIV-1 RNA dimerization in cells by multicolor super-resolution and fluctuation microscopies

    doi: 10.1093/nar/gkw511

    Figure Lengend Snippet: Dual-RNA labeling system and FISH analysis of heterodimeric RNA in virions. ( A ) Schematic representation of the constructions used in the study. HIV-1 tagged genomes were constructed by replacing a portion of the pol gene in NL4-3Δenv plasmid with 5′-lacZ (WT-lacZ) or 24xMS2 (WT-MS2) sequences to allow specific detection of unspliced RNA (positions and numbers indicated in gray refer to HIV-1 DNA nucleotides). NV-MS2 encodes a non-viral RNA containing 24xMS2 repeats from a pcDNA3 backbone. ( B ) Western-blotting of protein extracts from HeLa cells and purified virions from culture supernatants at 24 h pt with WT-lacZ, WT-MS2 or NV-MS2 plasmids. The expression of Gag (55kDa), Vpu (16 kDa) and Actin (42 kDa) is shown. The quantification of three independent blots revealed that cells transfected with the LacZ construct produced 84 ± 30% of Gag produced with the MS2 construct ( P = 0.4). ( C ) RT-PCR analysis of tagged RNAs in the cells and viruses used for FISH analyses. For dual-WT RNA detection, the RT was initiated with the same primers followed by a PCR step with two sense primers (one specific for lacZ and one for MS2) together with a common antisense primer in the same PCR reaction, generating two amplicons with specific sizes. Lanes 1 and 2 in the agarose gel correspond to the amplification of WT-lacZ and WT-MS2 plasmids, respectively ( n ≥ 3). NV-MS2 is detected by another RT-PCR system using specific primers ( n = 2). ( D ) Representative images of lacZ- (red) and MS2-tagged (green) RNAs visualized by single-molecule FISH of virus preparations. Images were obtained with a 100×-oil objective in a wide-field fluorescence microscope. Scale bar is 10 μm. The lower images show the center positions of identified spots. ( E ) Ratio between the number of green and red fluorescent spots. ( F ) Percentage of WT-lacZ RNA colocalized with WT-MS2 or NV-MS2 RNA. The fraction of bars filled in red represent the remaining proportion of WT-lacZ gRNA engaged in homodimers. Data are the mean ± SEM of three independent transfections (counting ≥1000 red spots per sample) and the significance of differences with control (NV-WT) was assessed using an unpaired Student's t -test (**** P ≤ 0.0001).

    Article Snippet: For RT-PCR, RNAs were reverse transcribed with Expand reverse transcriptase (Roche) using oligo (dT) primer for NV RNAs or specific primers targeting viral sequences for the viral RNAs.

    Techniques: Labeling, Fluorescence In Situ Hybridization, Construct, Plasmid Preparation, Western Blot, Purification, Expressing, Transfection, Produced, Reverse Transcription Polymerase Chain Reaction, RNA Detection, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Amplification, Fluorescence, Microscopy

    subTERRA localize to the nucleus. (a) FISH with labeled probes detection of Y′ subtelomeric region (upper panel) and DAPI staining for nuclear DNA detection. Representative cells for WT (W303) strain with no subTERRA -specific signals (experiment was representative for biological triplicate). In xrn1 ∆ trf4 ∆ specific subTERRA signals co-localize with DAPI staining; (b) subTERRA were detected almost exclusively in nuclear fraction. Cellular fractionation experiment (biological duplicates): whole RNA extracts (TOT 1/100 of material used for fractionating), two cytoplasmic fractions (CYT1 and CYT2) and nuclear fraction (NUC) were separated on 1% formaldehyde/MOPS agarose gel (upper panel) rRNA and tRNA species are stained with ethidium bromide. RNAs were transferred to nylon membrane and indicated ncRNAs were detected with specific radio-labeled probes (oligonucleotides/single-stranded for ITS1 , PMA1 , scR1 or double-stranded for subTERRA ).

    Journal: Non-Coding RNA

    Article Title: Expression of Subtelomeric lncRNAs Links Telomeres Dynamics to RNA Decay in S. cerevisiae

    doi: 10.3390/ncrna1020094

    Figure Lengend Snippet: subTERRA localize to the nucleus. (a) FISH with labeled probes detection of Y′ subtelomeric region (upper panel) and DAPI staining for nuclear DNA detection. Representative cells for WT (W303) strain with no subTERRA -specific signals (experiment was representative for biological triplicate). In xrn1 ∆ trf4 ∆ specific subTERRA signals co-localize with DAPI staining; (b) subTERRA were detected almost exclusively in nuclear fraction. Cellular fractionation experiment (biological duplicates): whole RNA extracts (TOT 1/100 of material used for fractionating), two cytoplasmic fractions (CYT1 and CYT2) and nuclear fraction (NUC) were separated on 1% formaldehyde/MOPS agarose gel (upper panel) rRNA and tRNA species are stained with ethidium bromide. RNAs were transferred to nylon membrane and indicated ncRNAs were detected with specific radio-labeled probes (oligonucleotides/single-stranded for ITS1 , PMA1 , scR1 or double-stranded for subTERRA ).

    Article Snippet: We defined these lncRNAs as subTERRA since, contrary to TERRA they do not cover the terminal telomeric repeats. subTERRA are transcribed in both transcriptional senses which gives rise to two sets of RNAs: subTERRA -CUTs, sensitive to nuclear degradation are transcribed towards centromere, and subTERRA -XUTs are preferentially degraded in the cytoplasm by Xrn1p.

    Techniques: Fluorescence In Situ Hybridization, Labeling, Staining, Cell Fractionation, Agarose Gel Electrophoresis

    Subtelomeric regions are transcribed yielding unstable Y′ ncRNAs. ( a ) Schematic representation of VL chromosome end with coordinates. Telomeric repeats (around 300 bp) are brown diamonds; subtelomeric long Y′ element (6278 bp) containing putative Y′-helicase gene ( YEL077C ) is light brown; subtelomeric X element core (195 bp) is shown in darker brown. Position of specific subtelomeric double strand probe [ 51 ] used for Y’ ncRNA detection is shown in red. PCR1 and PCR2 are oligonucleotide pairs used for subTERRA quantification with qPCR; ( b ) Characterization of unstable Y′ RNAs transcribed from subtelomeric regions. Total RNA from WT and mutant strains (W303 genetic background, exponentially grown in rich media (YPD – Yeast Extract, Peptone, Dextrose; at 30 °C) were extracted and analyzed by Northern blot. Signals of Y′ RNAs detected with radiolabelled subtelomeric probe (as shown in 1a) were normalized with the scR1 RNA level. scR1 is small cytoplasmic RNA, RNA component of the Signal Recognition Particle (SRP) synthesized by RNAPIII. Representative experiments from at least 10 biological replicates. Signal quantification is shown below respective lines ( subTERRA/ scR1 ); ( c ) Detection of Y’ RNAs in strains mutated for genes implicated in RNA degradation. Genetic backgrounds are marked under the panels; detection and normalization as in 1b, at minimum, biological duplicates were made. Cells were grown in YPD at 30 °C ON, for the rat1-1 mutant, cells were grown at 25 °C and shifted to 37 °C for 3h. Signal quantification is shown below respective lines ( subTERRA/ scR1 ).

    Journal: Non-Coding RNA

    Article Title: Expression of Subtelomeric lncRNAs Links Telomeres Dynamics to RNA Decay in S. cerevisiae

    doi: 10.3390/ncrna1020094

    Figure Lengend Snippet: Subtelomeric regions are transcribed yielding unstable Y′ ncRNAs. ( a ) Schematic representation of VL chromosome end with coordinates. Telomeric repeats (around 300 bp) are brown diamonds; subtelomeric long Y′ element (6278 bp) containing putative Y′-helicase gene ( YEL077C ) is light brown; subtelomeric X element core (195 bp) is shown in darker brown. Position of specific subtelomeric double strand probe [ 51 ] used for Y’ ncRNA detection is shown in red. PCR1 and PCR2 are oligonucleotide pairs used for subTERRA quantification with qPCR; ( b ) Characterization of unstable Y′ RNAs transcribed from subtelomeric regions. Total RNA from WT and mutant strains (W303 genetic background, exponentially grown in rich media (YPD – Yeast Extract, Peptone, Dextrose; at 30 °C) were extracted and analyzed by Northern blot. Signals of Y′ RNAs detected with radiolabelled subtelomeric probe (as shown in 1a) were normalized with the scR1 RNA level. scR1 is small cytoplasmic RNA, RNA component of the Signal Recognition Particle (SRP) synthesized by RNAPIII. Representative experiments from at least 10 biological replicates. Signal quantification is shown below respective lines ( subTERRA/ scR1 ); ( c ) Detection of Y’ RNAs in strains mutated for genes implicated in RNA degradation. Genetic backgrounds are marked under the panels; detection and normalization as in 1b, at minimum, biological duplicates were made. Cells were grown in YPD at 30 °C ON, for the rat1-1 mutant, cells were grown at 25 °C and shifted to 37 °C for 3h. Signal quantification is shown below respective lines ( subTERRA/ scR1 ).

    Article Snippet: We defined these lncRNAs as subTERRA since, contrary to TERRA they do not cover the terminal telomeric repeats. subTERRA are transcribed in both transcriptional senses which gives rise to two sets of RNAs: subTERRA -CUTs, sensitive to nuclear degradation are transcribed towards centromere, and subTERRA -XUTs are preferentially degraded in the cytoplasm by Xrn1p.

    Techniques: Real-time Polymerase Chain Reaction, Mutagenesis, Northern Blot, Synthesized

    Possible nucleotide comparisons and implemented JACUSA filter. a Graphical representation of RNA-DNA differences (RDDs) and RNA-RNA-differences (RRDs) in head-to-head comparisons of sequencing data. b Possible sequencing artifacts and their respective JACUSA filters

    Journal: BMC Bioinformatics

    Article Title: JACUSA: site-specific identification of RNA editing events from replicate sequencing data

    doi: 10.1186/s12859-016-1432-8

    Figure Lengend Snippet: Possible nucleotide comparisons and implemented JACUSA filter. a Graphical representation of RNA-DNA differences (RDDs) and RNA-RNA-differences (RRDs) in head-to-head comparisons of sequencing data. b Possible sequencing artifacts and their respective JACUSA filters

    Article Snippet: Detection of differential RNA editing from RNA-RNA comparisons Another JACUSA application is to detect sites of differential RNA editing from RNA-seq data only.

    Techniques: Sequencing