rna substrates Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Worthington Biochemical substrate rna
    Substrate Rna, supplied by Worthington Biochemical, used in various techniques. Bioz Stars score: 94/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/substrate rna/product/Worthington Biochemical
    Average 94 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    substrate rna - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    99
    Millipore rna substrate
    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to <t>SDS-PAGE.</t> Poly(C) as an <t>RNA</t> substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).
    Rna Substrate, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 68 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrate/product/Millipore
    Average 99 stars, based on 68 article reviews
    Price from $9.99 to $1999.99
    rna substrate - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    99
    Millipore duplex rna substrate
    <t>RNA</t> <t>helicase</t> activity assay. ( A ) RNA helicase activity of PfPSH2. Lanes 1–4 are reactions with 80 nM and lanes 5–8 are reactions with 160 nM of PfPSH2, respectively at various time points. The experiment was repeated at least two times; ( B ) Graphical representation of quantitative data of Fig. 6A, data points with circles and triangles depict % unwinding of RNA substrate with 80 nM and 160 nM of PfPSH2, respectively. ( C ) RNA helicase activity of PfPSH2M. Lanes 1–4 are reactions with 80 nM and lanes 5–8 are reactions with 160 nM of PfPSH2M, respectively at various time points. The experiment was repeated at least two times. In A and C, lane C represents control reaction without protein and lane B is boiled substrate.
    Duplex Rna Substrate, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/duplex rna substrate/product/Millipore
    Average 99 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    duplex rna substrate - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    89
    IBA GmbH substrate rna
    <t>RNA</t> <t>helicase</t> activity assay. ( A ) RNA helicase activity of PfPSH2. Lanes 1–4 are reactions with 80 nM and lanes 5–8 are reactions with 160 nM of PfPSH2, respectively at various time points. The experiment was repeated at least two times; ( B ) Graphical representation of quantitative data of Fig. 6A, data points with circles and triangles depict % unwinding of RNA substrate with 80 nM and 160 nM of PfPSH2, respectively. ( C ) RNA helicase activity of PfPSH2M. Lanes 1–4 are reactions with 80 nM and lanes 5–8 are reactions with 160 nM of PfPSH2M, respectively at various time points. The experiment was repeated at least two times. In A and C, lane C represents control reaction without protein and lane B is boiled substrate.
    Substrate Rna, supplied by IBA GmbH, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/substrate rna/product/IBA GmbH
    Average 89 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    substrate rna - by Bioz Stars, 2020-07
    89/100 stars
      Buy from Supplier

    91
    Horizon Discovery rna substrates
    3′Biot-mH2a/5m pre-mRNA is resistant to cleavage but assembles into processing complexes. ( A ) A schematic representation of chemically synthesized mouse-specific 3′Biot-mH2a/5m pre-mRNA (64-nt). The major cleavage site (located 5 nt downstream of the stem) and 2 nt on each side of the major cleavage site are modified with a 2′O-methyl group. Biotin is placed at the 3′ end. ( B ) In vitro processing of 3′Biot-mH2a/5m (bottom) and mH2a-614 (top) pre-mRNAs. mH2a-614 (85 nt) was generated by <t>T7</t> transcription and contains the same HDE as 3′Biot-mH2a/5m but lacks biotin and modified nucleotides. Each pre-mRNA was labeled at the 5′ end with 32 P and incubated in a mouse nuclear extract for 5, 15 and 30 min, as indicated. Probe alone is shown in lane 1. Numbers to the right indicate the length of the input pre-mRNA and the upstream cleavage product. ( C ) 3′Biot-mH2a/5m was incubated with a mouse myeloma nuclear extract (Mm NE) containing recombinant N-terminal FLASH (FLASH/N, amino acids 53–138) fused to GST. Assembled processing complexes were purified on streptavidin beads and analyzed by western blotting using specific antibodies (lane 1). In lane 2, formation of the processing complexes was blocked by excess SL <t>RNA</t> and αU7 oligonucleotide complementary to the 5′ end of mouse U7 snRNA.
    Rna Substrates, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 91/100, based on 44 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrates/product/Horizon Discovery
    Average 91 stars, based on 44 article reviews
    Price from $9.99 to $1999.99
    rna substrates - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    93
    Bio-Synthesis Inc substrate rna
    3′Biot-mH2a/5m pre-mRNA is resistant to cleavage but assembles into processing complexes. ( A ) A schematic representation of chemically synthesized mouse-specific 3′Biot-mH2a/5m pre-mRNA (64-nt). The major cleavage site (located 5 nt downstream of the stem) and 2 nt on each side of the major cleavage site are modified with a 2′O-methyl group. Biotin is placed at the 3′ end. ( B ) In vitro processing of 3′Biot-mH2a/5m (bottom) and mH2a-614 (top) pre-mRNAs. mH2a-614 (85 nt) was generated by <t>T7</t> transcription and contains the same HDE as 3′Biot-mH2a/5m but lacks biotin and modified nucleotides. Each pre-mRNA was labeled at the 5′ end with 32 P and incubated in a mouse nuclear extract for 5, 15 and 30 min, as indicated. Probe alone is shown in lane 1. Numbers to the right indicate the length of the input pre-mRNA and the upstream cleavage product. ( C ) 3′Biot-mH2a/5m was incubated with a mouse myeloma nuclear extract (Mm NE) containing recombinant N-terminal FLASH (FLASH/N, amino acids 53–138) fused to GST. Assembled processing complexes were purified on streptavidin beads and analyzed by western blotting using specific antibodies (lane 1). In lane 2, formation of the processing complexes was blocked by excess SL <t>RNA</t> and αU7 oligonucleotide complementary to the 5′ end of mouse U7 snRNA.
    Substrate Rna, supplied by Bio-Synthesis Inc, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/substrate rna/product/Bio-Synthesis Inc
    Average 93 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    substrate rna - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    91
    Oligos Etc rna substrates
    Reconstitution of in vitro precleaved U-deletion editing with two recombinant proteins. Recombinant L. major REX1, recombinant L. tarentolae REL1, and recombinant L. tarentolae REL2 were used for this assay. ( A ) Ligation of a 5′ end-labeled ( * ) bridged nicked <t>RNA</t> substrate, shown above the panel. The RNA was mixed with 0.3 pmol of rREL1 or 0.1 pmol of rREL2 in the presence or absence of <t>rREX1.</t> Lanes: 1, mock reaction without enzymes; 2, rREL1; 3, rREL2; 4, rREL1 plus rREX1; 5, rREL2 plus rREX1. ( B ) The –2-U-deletion substrate shown above the panel was mixed with rREX1 alone, rREL1 alone, or rREL2 alone and also with mixtures of rREL1 or rREL2 and rREX1. Lanes: 1, mock reaction without enzymes; 2, rREX1; 3, rREL1, 4, rREL2; 5, rREL1 plus rREX1; 6, rREL2 plus rREX1. ( C Left ) Lanes: 1, input RNA; 2, the –2-U substrate RNA plus rREX1; 3, the –1-U substrate RNA plus rREX1; 4, the 0-U substrate RNA plus rREX1. ( Right ) gRNA-mediated U-deletion editing. Lanes: 1, mock reaction without enzymes but with the –2-U gRNA; 2, –2-U gRNA-mediated production of –1-U and –2-U ligated products (arrows); 3, –1-U gRNA-mediated production of –1-U ligated product (arrow); 4, 0-U gRNA-mediated production of no U ligated product (arrow). The 5′ fragments are indicated, as are the ligated products in each lane. The substrate RNAs used for both panels are diagrammed on the left.
    Rna Substrates, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 91/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrates/product/Oligos Etc
    Average 91 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    rna substrates - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    90
    Thermo Fisher rna substrate
    Reconstitution of in vitro precleaved U-deletion editing with two recombinant proteins. Recombinant L. major REX1, recombinant L. tarentolae REL1, and recombinant L. tarentolae REL2 were used for this assay. ( A ) Ligation of a 5′ end-labeled ( * ) bridged nicked <t>RNA</t> substrate, shown above the panel. The RNA was mixed with 0.3 pmol of rREL1 or 0.1 pmol of rREL2 in the presence or absence of <t>rREX1.</t> Lanes: 1, mock reaction without enzymes; 2, rREL1; 3, rREL2; 4, rREL1 plus rREX1; 5, rREL2 plus rREX1. ( B ) The –2-U-deletion substrate shown above the panel was mixed with rREX1 alone, rREL1 alone, or rREL2 alone and also with mixtures of rREL1 or rREL2 and rREX1. Lanes: 1, mock reaction without enzymes; 2, rREX1; 3, rREL1, 4, rREL2; 5, rREL1 plus rREX1; 6, rREL2 plus rREX1. ( C Left ) Lanes: 1, input RNA; 2, the –2-U substrate RNA plus rREX1; 3, the –1-U substrate RNA plus rREX1; 4, the 0-U substrate RNA plus rREX1. ( Right ) gRNA-mediated U-deletion editing. Lanes: 1, mock reaction without enzymes but with the –2-U gRNA; 2, –2-U gRNA-mediated production of –1-U and –2-U ligated products (arrows); 3, –1-U gRNA-mediated production of –1-U ligated product (arrow); 4, 0-U gRNA-mediated production of no U ligated product (arrow). The 5′ fragments are indicated, as are the ligated products in each lane. The substrate RNAs used for both panels are diagrammed on the left.
    Rna Substrate, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 93 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrate/product/Thermo Fisher
    Average 90 stars, based on 93 article reviews
    Price from $9.99 to $1999.99
    rna substrate - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    93
    Horizon Discovery all rna substrate
    Reconstitution of in vitro precleaved U-deletion editing with two recombinant proteins. Recombinant L. major REX1, recombinant L. tarentolae REL1, and recombinant L. tarentolae REL2 were used for this assay. ( A ) Ligation of a 5′ end-labeled ( * ) bridged nicked <t>RNA</t> substrate, shown above the panel. The RNA was mixed with 0.3 pmol of rREL1 or 0.1 pmol of rREL2 in the presence or absence of <t>rREX1.</t> Lanes: 1, mock reaction without enzymes; 2, rREL1; 3, rREL2; 4, rREL1 plus rREX1; 5, rREL2 plus rREX1. ( B ) The –2-U-deletion substrate shown above the panel was mixed with rREX1 alone, rREL1 alone, or rREL2 alone and also with mixtures of rREL1 or rREL2 and rREX1. Lanes: 1, mock reaction without enzymes; 2, rREX1; 3, rREL1, 4, rREL2; 5, rREL1 plus rREX1; 6, rREL2 plus rREX1. ( C Left ) Lanes: 1, input RNA; 2, the –2-U substrate RNA plus rREX1; 3, the –1-U substrate RNA plus rREX1; 4, the 0-U substrate RNA plus rREX1. ( Right ) gRNA-mediated U-deletion editing. Lanes: 1, mock reaction without enzymes but with the –2-U gRNA; 2, –2-U gRNA-mediated production of –1-U and –2-U ligated products (arrows); 3, –1-U gRNA-mediated production of –1-U ligated product (arrow); 4, 0-U gRNA-mediated production of no U ligated product (arrow). The 5′ fragments are indicated, as are the ligated products in each lane. The substrate RNAs used for both panels are diagrammed on the left.
    All Rna Substrate, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 93/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/all rna substrate/product/Horizon Discovery
    Average 93 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    all rna substrate - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    85
    Horizon Discovery rna gcuaugucugucaacuugaaaaaa substrate
    Reconstitution of in vitro precleaved U-deletion editing with two recombinant proteins. Recombinant L. major REX1, recombinant L. tarentolae REL1, and recombinant L. tarentolae REL2 were used for this assay. ( A ) Ligation of a 5′ end-labeled ( * ) bridged nicked <t>RNA</t> substrate, shown above the panel. The RNA was mixed with 0.3 pmol of rREL1 or 0.1 pmol of rREL2 in the presence or absence of <t>rREX1.</t> Lanes: 1, mock reaction without enzymes; 2, rREL1; 3, rREL2; 4, rREL1 plus rREX1; 5, rREL2 plus rREX1. ( B ) The –2-U-deletion substrate shown above the panel was mixed with rREX1 alone, rREL1 alone, or rREL2 alone and also with mixtures of rREL1 or rREL2 and rREX1. Lanes: 1, mock reaction without enzymes; 2, rREX1; 3, rREL1, 4, rREL2; 5, rREL1 plus rREX1; 6, rREL2 plus rREX1. ( C Left ) Lanes: 1, input RNA; 2, the –2-U substrate RNA plus rREX1; 3, the –1-U substrate RNA plus rREX1; 4, the 0-U substrate RNA plus rREX1. ( Right ) gRNA-mediated U-deletion editing. Lanes: 1, mock reaction without enzymes but with the –2-U gRNA; 2, –2-U gRNA-mediated production of –1-U and –2-U ligated products (arrows); 3, –1-U gRNA-mediated production of –1-U ligated product (arrow); 4, 0-U gRNA-mediated production of no U ligated product (arrow). The 5′ fragments are indicated, as are the ligated products in each lane. The substrate RNAs used for both panels are diagrammed on the left.
    Rna Gcuaugucugucaacuugaaaaaa Substrate, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna gcuaugucugucaacuugaaaaaa substrate/product/Horizon Discovery
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    rna gcuaugucugucaacuugaaaaaa substrate - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    91
    Horizon Discovery rna oligonucleotide substrates
    Reconstitution of in vitro precleaved U-deletion editing with two recombinant proteins. Recombinant L. major REX1, recombinant L. tarentolae REL1, and recombinant L. tarentolae REL2 were used for this assay. ( A ) Ligation of a 5′ end-labeled ( * ) bridged nicked <t>RNA</t> substrate, shown above the panel. The RNA was mixed with 0.3 pmol of rREL1 or 0.1 pmol of rREL2 in the presence or absence of <t>rREX1.</t> Lanes: 1, mock reaction without enzymes; 2, rREL1; 3, rREL2; 4, rREL1 plus rREX1; 5, rREL2 plus rREX1. ( B ) The –2-U-deletion substrate shown above the panel was mixed with rREX1 alone, rREL1 alone, or rREL2 alone and also with mixtures of rREL1 or rREL2 and rREX1. Lanes: 1, mock reaction without enzymes; 2, rREX1; 3, rREL1, 4, rREL2; 5, rREL1 plus rREX1; 6, rREL2 plus rREX1. ( C Left ) Lanes: 1, input RNA; 2, the –2-U substrate RNA plus rREX1; 3, the –1-U substrate RNA plus rREX1; 4, the 0-U substrate RNA plus rREX1. ( Right ) gRNA-mediated U-deletion editing. Lanes: 1, mock reaction without enzymes but with the –2-U gRNA; 2, –2-U gRNA-mediated production of –1-U and –2-U ligated products (arrows); 3, –1-U gRNA-mediated production of –1-U ligated product (arrow); 4, 0-U gRNA-mediated production of no U ligated product (arrow). The 5′ fragments are indicated, as are the ligated products in each lane. The substrate RNAs used for both panels are diagrammed on the left.
    Rna Oligonucleotide Substrates, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna oligonucleotide substrates/product/Horizon Discovery
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rna oligonucleotide substrates - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    Image Search Results


    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to SDS-PAGE. Poly(C) as an RNA substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).

    Journal: mBio

    Article Title: A New Family of Membrane Electron Transporters and Its Substrates, Including a New Cell Envelope Peroxiredoxin, Reveal a Broadened Reductive Capacity of the Oxidative Bacterial Cell Envelope

    doi: 10.1128/mBio.00291-11

    Figure Lengend Snippet: In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to SDS-PAGE. Poly(C) as an RNA substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).

    Article Snippet: Poly(C) (Sigma) as an RNA substrate was added to the solution for SDS-PAGE, and toluidine blue as an intercalating dye was added after electrophoresis to the gel-staining solution.

    Techniques: In Vivo, Activity Assay, Sequencing, Expressing, Sonication, SDS Page, Mutagenesis

    Polyadenylation of GGG.RNA I and supF tRNA Tyr by PAP I in vitro . ( a ) Time course of reactions containing 1.2 pmol of GGG.RNA I or supF tRNA Tyr as substrates, using 1 μg of protein complex containing PAP I. Samples were taken at the times indicated. The secondary structure of GGG.RNA I and supF tRNA Tyr is as shown. The rate of initiation of polyadenylation was quantitated from gels by PhosphorImager analysis (Molecular Dynamics), and plotted for RNA I (●) and supF tRNA Tyr (■). The percentage of adenylated substrate at each time point was defined as follows: [1 − (the ratio of the quantity of nonadenylated substrate to the quantity of nonadenylated substrate at time 0)] × 100%. The adenylation initiation rate, which was defined as the time required for 50% of substrate to acquire one or more A residues, was 0.4 ± 0.1 min for RNA I and 8.0 ± 0.1 min for supF tRNA Tyr . ( b ) Purification of His-tagged PAP I is shown by silver nitrate staining SDS/PAGE analysis. Lane 1, eluate of His-tagged PAP I from Ni 2+ -immobilized metal affinity column; lane 2, same preparation further purified from SDS/PAGE. ( c ) In vitro polyadenylation reactions for GGG.RNA I and supF tRNA Tyr using 140 fmol of column-purified and gel-purified His-tagged PAP I.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Unpaired terminal nucleotides and 5? monophosphorylation govern 3? polyadenylation by Escherichia coli poly(A) polymerase I

    doi:

    Figure Lengend Snippet: Polyadenylation of GGG.RNA I and supF tRNA Tyr by PAP I in vitro . ( a ) Time course of reactions containing 1.2 pmol of GGG.RNA I or supF tRNA Tyr as substrates, using 1 μg of protein complex containing PAP I. Samples were taken at the times indicated. The secondary structure of GGG.RNA I and supF tRNA Tyr is as shown. The rate of initiation of polyadenylation was quantitated from gels by PhosphorImager analysis (Molecular Dynamics), and plotted for RNA I (●) and supF tRNA Tyr (■). The percentage of adenylated substrate at each time point was defined as follows: [1 − (the ratio of the quantity of nonadenylated substrate to the quantity of nonadenylated substrate at time 0)] × 100%. The adenylation initiation rate, which was defined as the time required for 50% of substrate to acquire one or more A residues, was 0.4 ± 0.1 min for RNA I and 8.0 ± 0.1 min for supF tRNA Tyr . ( b ) Purification of His-tagged PAP I is shown by silver nitrate staining SDS/PAGE analysis. Lane 1, eluate of His-tagged PAP I from Ni 2+ -immobilized metal affinity column; lane 2, same preparation further purified from SDS/PAGE. ( c ) In vitro polyadenylation reactions for GGG.RNA I and supF tRNA Tyr using 140 fmol of column-purified and gel-purified His-tagged PAP I.

    Article Snippet: Labeled RNA substrates were incubated at 37°C with PAP I in reaction buffer consisting of 250 mM NaCl/10 mM MgCl2 /2 mM K2 HPO4 /1 mM DTT/1 mM phosphoenolpyruvate/0.6 unit of pyruvate kinase (Sigma), 10 units of the RNase A inhibitor RNaseOut (Life Technologies), and 0.4 mM ATP.

    Techniques: In Vitro, Purification, Staining, SDS Page, Affinity Column

    Effect of oligonucleotides complementary to the 5′ single-strand region of RNA I on PAP I activity. ( a ) Upper , polyadenylation reactions for RNA I, RNA I + oligo 12 (5′-AAATACTGTCCC-3′), and RNA I + oligo 8 (5′-AAATACTG-3′). Lower, plot of adenylation rates for the three reactions [RNA I (○), RNA I + oligo 12 (■), and RNA I + oligo 8 (⧫)]. ( b ) RNase E cleavage assays of the substrates shown in a . →, the 8-nt RNase E cleavage product. One picomole of GGG.RNA I 5′-labeled with [γ- 32 ) at 30°C in polyadenylation reaction buffer except that ATP, phosphoenolpyruvate, and pyruvate kinase were omitted.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Unpaired terminal nucleotides and 5? monophosphorylation govern 3? polyadenylation by Escherichia coli poly(A) polymerase I

    doi:

    Figure Lengend Snippet: Effect of oligonucleotides complementary to the 5′ single-strand region of RNA I on PAP I activity. ( a ) Upper , polyadenylation reactions for RNA I, RNA I + oligo 12 (5′-AAATACTGTCCC-3′), and RNA I + oligo 8 (5′-AAATACTG-3′). Lower, plot of adenylation rates for the three reactions [RNA I (○), RNA I + oligo 12 (■), and RNA I + oligo 8 (⧫)]. ( b ) RNase E cleavage assays of the substrates shown in a . →, the 8-nt RNase E cleavage product. One picomole of GGG.RNA I 5′-labeled with [γ- 32 ) at 30°C in polyadenylation reaction buffer except that ATP, phosphoenolpyruvate, and pyruvate kinase were omitted.

    Article Snippet: Labeled RNA substrates were incubated at 37°C with PAP I in reaction buffer consisting of 250 mM NaCl/10 mM MgCl2 /2 mM K2 HPO4 /1 mM DTT/1 mM phosphoenolpyruvate/0.6 unit of pyruvate kinase (Sigma), 10 units of the RNase A inhibitor RNaseOut (Life Technologies), and 0.4 mM ATP.

    Techniques: Activity Assay, Labeling

    Biochemical analyses of nsp10 mutants. (A) TLC analysis of nuclease P1-resistant cap structures released from 32 P-labeled m7G*pppA-RNA methylated by nsp16/nsp10 G70A, nsp16/nsp10 K93A, nsp16/nsp10 Y76A/C77A/R78A, and nsp16/nsp10 H83A/P84A (lanes 5–8), respectively. Nsp16, nsp16/nsp10, and nsp10 were used as controls (lanes 3, 4, and 9). The positions of origin and migration of m7G*pppA, G*pppA, and m7G*pppAm (lanes 1, 2, and 10) are indicated on the left. The bands located between origin and G*pppA are free α- 32 P-GTP. (B) m7GpppA-RNA was used to test the methylation activities of nsp10 mutants complexed with nsp16 of SARS-CoV ( n = 2, mean values ± SD). (C) 12% SDS-PAGE analysis of SAM UV cross-linking with nsp16/nsp10 G70A, nsp16/nsp10 K93A, nsp16/nsp10 Y76A/C77A/R78A, and nsp16/nsp10 H83A/P84A (lanes 3–6), respectively. Nsp16, nsp16/nsp10, and nsp10 were used as controls (lanes 1, 2, and 7). (D) 3 H-labeled *m7GpppA-RNA substrates were used to test the binding affinities to nsp16/nsp10 G70A, nsp16/nsp10 K93A, nsp16/nsp10 Y76A/C77A/R78A, and nsp16/nsp10 H83A/P84A. Nsp16, nsp10, and nsp5 were negative controls ( n = 2, mean values ± SD).

    Journal: PLoS Pathogens

    Article Title: Biochemical and Structural Insights into the Mechanisms of SARS Coronavirus RNA Ribose 2?-O-Methylation by nsp16/nsp10 Protein Complex

    doi: 10.1371/journal.ppat.1002294

    Figure Lengend Snippet: Biochemical analyses of nsp10 mutants. (A) TLC analysis of nuclease P1-resistant cap structures released from 32 P-labeled m7G*pppA-RNA methylated by nsp16/nsp10 G70A, nsp16/nsp10 K93A, nsp16/nsp10 Y76A/C77A/R78A, and nsp16/nsp10 H83A/P84A (lanes 5–8), respectively. Nsp16, nsp16/nsp10, and nsp10 were used as controls (lanes 3, 4, and 9). The positions of origin and migration of m7G*pppA, G*pppA, and m7G*pppAm (lanes 1, 2, and 10) are indicated on the left. The bands located between origin and G*pppA are free α- 32 P-GTP. (B) m7GpppA-RNA was used to test the methylation activities of nsp10 mutants complexed with nsp16 of SARS-CoV ( n = 2, mean values ± SD). (C) 12% SDS-PAGE analysis of SAM UV cross-linking with nsp16/nsp10 G70A, nsp16/nsp10 K93A, nsp16/nsp10 Y76A/C77A/R78A, and nsp16/nsp10 H83A/P84A (lanes 3–6), respectively. Nsp16, nsp16/nsp10, and nsp10 were used as controls (lanes 1, 2, and 7). (D) 3 H-labeled *m7GpppA-RNA substrates were used to test the binding affinities to nsp16/nsp10 G70A, nsp16/nsp10 K93A, nsp16/nsp10 Y76A/C77A/R78A, and nsp16/nsp10 H83A/P84A. Nsp16, nsp10, and nsp5 were negative controls ( n = 2, mean values ± SD).

    Article Snippet: Biochemical assays for MTase activity Purified recombinant or mutant proteins (0.5 µg) and 2×103 cpm of 32 P-labeled m7G*pppA-RNA or G*pppA-RNA substrates were added to 8.5 µL reaction mixture [40 mM Tris-HCl (pH 7.5 or 8.0), 2 mM MgCl2 , 2 mM DTT, 10 units RNase inhibitor, 0.2 mM SAM] and incubated at 37°C for 1.5 h. RNA cap structures were liberated with 5 µg of nuclease P1 (Sigma), then spotted onto polyethyleneimine cellulose-F plates (Merck) for TLC, and developed in 0.4 M ammonium sulfate.

    Techniques: Thin Layer Chromatography, Labeling, Methylation, Migration, SDS Page, Binding Assay

    Biochemical analyses of the MTase activities of SARS-CoV nsp14, nsp16 and nsp10. (A) TLC analysis of nuclease P1-resistant cap structures released from 32 P-labeled G*pppA-RNA methylated by nsp10, nsp14, nsp16, nsp14/nsp10, nsp16/nsp10, nsp14/nsp16, and nsp10/nsp14/nsp16, respectively (lanes 1–7), and m7G*pppA-RNA methylated by nsp16/nsp10 (at pH 7.5), nsp10, nsp14, nsp16, nsp14/nsp10, nsp10/nsp14/nsp16, nsp16/nsp10, and nsp14/nsp16, respectively (at pH 8.0) (lanes 10–17). The markers G*pppA (lane 8), m7G*pppA (lane 9), and m7G*pppAm (lane 18) were prepared with commercial vaccinia virus capping enzymes. The positions of origin and migration of G*pppA, m7G*pppA, and m7G*pppAm (lanes 8, 9, and 18) are indicated on the left. The bands located between origin and G*pppA are free α- 32 P-GTP, which may be left over after one-step purification of labeled RNA. (B) Different RNA substrates were used to test the methylation activities of nsp16/nsp10 complex of SARS-CoV ( n = 3, mean values ± SD). (C) 32 P-labeled G*pppG-RNA was used as substrate to test the methylation activities of nsp16/nsp10, nsp16, and nsp10 respectively. Vaccinia VP39 2′-O-MTase was used as a positive control ( n = 3, mean values ± SD).

    Journal: PLoS Pathogens

    Article Title: Biochemical and Structural Insights into the Mechanisms of SARS Coronavirus RNA Ribose 2?-O-Methylation by nsp16/nsp10 Protein Complex

    doi: 10.1371/journal.ppat.1002294

    Figure Lengend Snippet: Biochemical analyses of the MTase activities of SARS-CoV nsp14, nsp16 and nsp10. (A) TLC analysis of nuclease P1-resistant cap structures released from 32 P-labeled G*pppA-RNA methylated by nsp10, nsp14, nsp16, nsp14/nsp10, nsp16/nsp10, nsp14/nsp16, and nsp10/nsp14/nsp16, respectively (lanes 1–7), and m7G*pppA-RNA methylated by nsp16/nsp10 (at pH 7.5), nsp10, nsp14, nsp16, nsp14/nsp10, nsp10/nsp14/nsp16, nsp16/nsp10, and nsp14/nsp16, respectively (at pH 8.0) (lanes 10–17). The markers G*pppA (lane 8), m7G*pppA (lane 9), and m7G*pppAm (lane 18) were prepared with commercial vaccinia virus capping enzymes. The positions of origin and migration of G*pppA, m7G*pppA, and m7G*pppAm (lanes 8, 9, and 18) are indicated on the left. The bands located between origin and G*pppA are free α- 32 P-GTP, which may be left over after one-step purification of labeled RNA. (B) Different RNA substrates were used to test the methylation activities of nsp16/nsp10 complex of SARS-CoV ( n = 3, mean values ± SD). (C) 32 P-labeled G*pppG-RNA was used as substrate to test the methylation activities of nsp16/nsp10, nsp16, and nsp10 respectively. Vaccinia VP39 2′-O-MTase was used as a positive control ( n = 3, mean values ± SD).

    Article Snippet: Biochemical assays for MTase activity Purified recombinant or mutant proteins (0.5 µg) and 2×103 cpm of 32 P-labeled m7G*pppA-RNA or G*pppA-RNA substrates were added to 8.5 µL reaction mixture [40 mM Tris-HCl (pH 7.5 or 8.0), 2 mM MgCl2 , 2 mM DTT, 10 units RNase inhibitor, 0.2 mM SAM] and incubated at 37°C for 1.5 h. RNA cap structures were liberated with 5 µg of nuclease P1 (Sigma), then spotted onto polyethyleneimine cellulose-F plates (Merck) for TLC, and developed in 0.4 M ammonium sulfate.

    Techniques: Thin Layer Chromatography, Labeling, Methylation, Migration, Purification, Positive Control

    RNA substrate binding analyses of nsp10 and nsp16 of SARS-CoV. (A) Gel shift assays were performed by 8% N-PAGE to analyze the binding of 32 P-labeled m7G*pppA-RNA incubated with nsp10, nsp16, and nsp16/nsp10, respectively (lanes 1–3). There was no protein in the mock as negative control (lane 4). Nsp10 (with 2 mM ZnCl 2 ) and nsp14 were used as positive controls (lanes 5–6). (B) 32 P-labeled m7G*pppG-RNA was incubated with nsp10, nsp16, nsp16/nsp10, and mock respectively (lanes 1–4). Mixtures were analyzed by 8% N-PAGE. (C) 32 P-labeled m7G*pppA cap analogue was incubated with different proteins as in (A). Mixtures were analyzed by 14% N-PAGE. (D) 32 P-labeled m7G*pppG cap analogue was incubated with different proteins as in (B). Mixtures were analyzed by 14% N-PAGE. Positions of the free RNA substrates and shifting RNA substrates are indicated on the left. Black arrows indicate shifting RNA bands in each lane. (E) Different 3 H-labeled RNA substrates were used to test the binding affinities to nsp10, nsp16, and nsp16/nsp10. His 6 -nsp5 was a negative control ( n = 2, mean values ± SD). (F) 30 µL of the final suspensions from (E) were analyzed by Western Blotting analysis. (G to I) ITC profiles for the binding of nsp16 (G), nsp10 (H), and nsp16/nsp10 complex (I), respectively to m7GpppA-capped RNA. The top panels represent the raw data for sequential injections of nsp16, nsp10 and nsp16/nsp10 complex into m7GpppA-capped RNA (7 µM). The bottom panels show the plots of the heat evolved (kilocalories) per mole of purified proteins.

    Journal: PLoS Pathogens

    Article Title: Biochemical and Structural Insights into the Mechanisms of SARS Coronavirus RNA Ribose 2?-O-Methylation by nsp16/nsp10 Protein Complex

    doi: 10.1371/journal.ppat.1002294

    Figure Lengend Snippet: RNA substrate binding analyses of nsp10 and nsp16 of SARS-CoV. (A) Gel shift assays were performed by 8% N-PAGE to analyze the binding of 32 P-labeled m7G*pppA-RNA incubated with nsp10, nsp16, and nsp16/nsp10, respectively (lanes 1–3). There was no protein in the mock as negative control (lane 4). Nsp10 (with 2 mM ZnCl 2 ) and nsp14 were used as positive controls (lanes 5–6). (B) 32 P-labeled m7G*pppG-RNA was incubated with nsp10, nsp16, nsp16/nsp10, and mock respectively (lanes 1–4). Mixtures were analyzed by 8% N-PAGE. (C) 32 P-labeled m7G*pppA cap analogue was incubated with different proteins as in (A). Mixtures were analyzed by 14% N-PAGE. (D) 32 P-labeled m7G*pppG cap analogue was incubated with different proteins as in (B). Mixtures were analyzed by 14% N-PAGE. Positions of the free RNA substrates and shifting RNA substrates are indicated on the left. Black arrows indicate shifting RNA bands in each lane. (E) Different 3 H-labeled RNA substrates were used to test the binding affinities to nsp10, nsp16, and nsp16/nsp10. His 6 -nsp5 was a negative control ( n = 2, mean values ± SD). (F) 30 µL of the final suspensions from (E) were analyzed by Western Blotting analysis. (G to I) ITC profiles for the binding of nsp16 (G), nsp10 (H), and nsp16/nsp10 complex (I), respectively to m7GpppA-capped RNA. The top panels represent the raw data for sequential injections of nsp16, nsp10 and nsp16/nsp10 complex into m7GpppA-capped RNA (7 µM). The bottom panels show the plots of the heat evolved (kilocalories) per mole of purified proteins.

    Article Snippet: Biochemical assays for MTase activity Purified recombinant or mutant proteins (0.5 µg) and 2×103 cpm of 32 P-labeled m7G*pppA-RNA or G*pppA-RNA substrates were added to 8.5 µL reaction mixture [40 mM Tris-HCl (pH 7.5 or 8.0), 2 mM MgCl2 , 2 mM DTT, 10 units RNase inhibitor, 0.2 mM SAM] and incubated at 37°C for 1.5 h. RNA cap structures were liberated with 5 µg of nuclease P1 (Sigma), then spotted onto polyethyleneimine cellulose-F plates (Merck) for TLC, and developed in 0.4 M ammonium sulfate.

    Techniques: Binding Assay, Electrophoretic Mobility Shift Assay, Polyacrylamide Gel Electrophoresis, Labeling, Incubation, Negative Control, Western Blot, Purification

    In vitro reconstitution of intragenic complementation in RNase E. ( A ) Visualization by Coomassie blue staining of purified preparations of RNase E variants following electrophoresis on SDS–10% polyacrylamide gel. Lane 1, molecular-weight standards; values (in kDa) for some of the bands on this lane are indicated. ( B ) Determination of catalytic activity for RNase E variants singly and in combination. The proteins tested are indicated on top, and each wedge represents increasing reaction times (5, 10 and 15 min) from left to right. For lanes 14 to 16, the polypeptides were pre-mixed immediately before their addition to the reaction mixture. Positions of migration of 13-mer RNA substrate and 5-mer product, both fluorescein-tagged, are marked by red and green arrowheads, respectively.

    Journal: Nucleic Acids Research

    Article Title: Cross-subunit catalysis and a new phenomenon of recessive resurrection in Escherichia coli RNase E

    doi: 10.1093/nar/gkz1152

    Figure Lengend Snippet: In vitro reconstitution of intragenic complementation in RNase E. ( A ) Visualization by Coomassie blue staining of purified preparations of RNase E variants following electrophoresis on SDS–10% polyacrylamide gel. Lane 1, molecular-weight standards; values (in kDa) for some of the bands on this lane are indicated. ( B ) Determination of catalytic activity for RNase E variants singly and in combination. The proteins tested are indicated on top, and each wedge represents increasing reaction times (5, 10 and 15 min) from left to right. For lanes 14 to 16, the polypeptides were pre-mixed immediately before their addition to the reaction mixture. Positions of migration of 13-mer RNA substrate and 5-mer product, both fluorescein-tagged, are marked by red and green arrowheads, respectively.

    Article Snippet: RNase E assays were performed essentially as described , with a 13-mer RNA substrate BR13 (5′-GGGACAGUAUUUG-3′) which was monophosphorylated and fluorescein-conjugated at its 5′- and 3′-ends, respectively (obtained from Sigma Chemicals, USA); cleavage by RNase E leads to the release of a pentanucleotide product with the fluorescein tag.

    Techniques: In Vitro, Staining, Purification, Electrophoresis, Molecular Weight, Activity Assay, Migration

    RNA helicase activity assay. ( A ) RNA helicase activity of PfPSH2. Lanes 1–4 are reactions with 80 nM and lanes 5–8 are reactions with 160 nM of PfPSH2, respectively at various time points. The experiment was repeated at least two times; ( B ) Graphical representation of quantitative data of Fig. 6A, data points with circles and triangles depict % unwinding of RNA substrate with 80 nM and 160 nM of PfPSH2, respectively. ( C ) RNA helicase activity of PfPSH2M. Lanes 1–4 are reactions with 80 nM and lanes 5–8 are reactions with 160 nM of PfPSH2M, respectively at various time points. The experiment was repeated at least two times. In A and C, lane C represents control reaction without protein and lane B is boiled substrate.

    Journal: Scientific Reports

    Article Title: Plasmodium falciparum specific helicase 2 is a dual, bipolar helicase and is crucial for parasite growth

    doi: 10.1038/s41598-018-38032-1

    Figure Lengend Snippet: RNA helicase activity assay. ( A ) RNA helicase activity of PfPSH2. Lanes 1–4 are reactions with 80 nM and lanes 5–8 are reactions with 160 nM of PfPSH2, respectively at various time points. The experiment was repeated at least two times; ( B ) Graphical representation of quantitative data of Fig. 6A, data points with circles and triangles depict % unwinding of RNA substrate with 80 nM and 160 nM of PfPSH2, respectively. ( C ) RNA helicase activity of PfPSH2M. Lanes 1–4 are reactions with 80 nM and lanes 5–8 are reactions with 160 nM of PfPSH2M, respectively at various time points. The experiment was repeated at least two times. In A and C, lane C represents control reaction without protein and lane B is boiled substrate.

    Article Snippet: To prepare the partially duplex RNA substrate for RNA helicase assay, 13 mer (5′-AUAGCCUCAACCG-3′) and 39 mer oligoribonucleotide (5′- GGGAGAAAUCACUCGGUUGAGGCUAUCCGUAAAGCACGC-3′) were synthesized from Sigma Aldrich.

    Techniques: Helicase Activity Assay, Activity Assay

    Kinetic analysis of the eight most promising ribozyme clones. ( A ) Schematic of the assay using the 8–17 DNAzyme. After reaction with TMP, internally [ 32 P]-radiolabeled ribozymes were cleaved by the DNAzyme. This freed the eight 5′-terminal nucleotides, facilitating gel separation of triphosphorylated and unreacted RNAs. ( B ) Autoradiogram of products after the DNAzyme reaction and separation by denaturing 22% PAGE. An RNA that was not exposed to TMP (5′-OH) and an RNA that was transcribed with a 5′-terminal triphosphate (5′-PPP) were used as negative and positive controls, respectively. The incubation times with TMP are indicated on the top. The long fragment of the cleaved ribozymes (174 nt) and possible remaining uncleaved ribozymes (182 nt) migrated much slower than the 8-nt fragments. The 8-nt fragments were separated based on their phosphorylation status. The particular autoradiogram was from analysis of clone R8_35C18A. ( C ) Determination of triphosphorylation kinetics from signals as shown in (B). The percent of triphosphorylation of the 8-mer was plotted as function of the incubation time with TMP. Single-exponential fits are shown as black or gray lines. Error bars are standard deviations from three experiments. Symbols are explained in (D). Single-exponential curve fits are shown in black lines for filled symbols and gray lines for empty symbols. ( D ) Symbols and clone names used in (C), together with the parameters obtained by curve fits, the maximal percentage of reacted ribozyme (Max.) and the observed pseudo-first order rate constant (k obs ).

    Journal: Nucleic Acids Research

    Article Title: A ribozyme that triphosphorylates RNA 5?-hydroxyl groups

    doi: 10.1093/nar/gkt1405

    Figure Lengend Snippet: Kinetic analysis of the eight most promising ribozyme clones. ( A ) Schematic of the assay using the 8–17 DNAzyme. After reaction with TMP, internally [ 32 P]-radiolabeled ribozymes were cleaved by the DNAzyme. This freed the eight 5′-terminal nucleotides, facilitating gel separation of triphosphorylated and unreacted RNAs. ( B ) Autoradiogram of products after the DNAzyme reaction and separation by denaturing 22% PAGE. An RNA that was not exposed to TMP (5′-OH) and an RNA that was transcribed with a 5′-terminal triphosphate (5′-PPP) were used as negative and positive controls, respectively. The incubation times with TMP are indicated on the top. The long fragment of the cleaved ribozymes (174 nt) and possible remaining uncleaved ribozymes (182 nt) migrated much slower than the 8-nt fragments. The 8-nt fragments were separated based on their phosphorylation status. The particular autoradiogram was from analysis of clone R8_35C18A. ( C ) Determination of triphosphorylation kinetics from signals as shown in (B). The percent of triphosphorylation of the 8-mer was plotted as function of the incubation time with TMP. Single-exponential fits are shown as black or gray lines. Error bars are standard deviations from three experiments. Symbols are explained in (D). Single-exponential curve fits are shown in black lines for filled symbols and gray lines for empty symbols. ( D ) Symbols and clone names used in (C), together with the parameters obtained by curve fits, the maximal percentage of reacted ribozyme (Max.) and the observed pseudo-first order rate constant (k obs ).

    Article Snippet: A fraction of the substrate was incubated with an excess of the TPR1 ribozyme for 3 h. The product of the triphosphorylation reaction and unreacted substrate RNA were purified by denaturing PAGE, and desalted on C18 Zip-tips (Millipore).

    Techniques: Clone Assay, Polyacrylamide Gel Electrophoresis, Incubation

    3′Biot-mH2a/5m pre-mRNA is resistant to cleavage but assembles into processing complexes. ( A ) A schematic representation of chemically synthesized mouse-specific 3′Biot-mH2a/5m pre-mRNA (64-nt). The major cleavage site (located 5 nt downstream of the stem) and 2 nt on each side of the major cleavage site are modified with a 2′O-methyl group. Biotin is placed at the 3′ end. ( B ) In vitro processing of 3′Biot-mH2a/5m (bottom) and mH2a-614 (top) pre-mRNAs. mH2a-614 (85 nt) was generated by T7 transcription and contains the same HDE as 3′Biot-mH2a/5m but lacks biotin and modified nucleotides. Each pre-mRNA was labeled at the 5′ end with 32 P and incubated in a mouse nuclear extract for 5, 15 and 30 min, as indicated. Probe alone is shown in lane 1. Numbers to the right indicate the length of the input pre-mRNA and the upstream cleavage product. ( C ) 3′Biot-mH2a/5m was incubated with a mouse myeloma nuclear extract (Mm NE) containing recombinant N-terminal FLASH (FLASH/N, amino acids 53–138) fused to GST. Assembled processing complexes were purified on streptavidin beads and analyzed by western blotting using specific antibodies (lane 1). In lane 2, formation of the processing complexes was blocked by excess SL RNA and αU7 oligonucleotide complementary to the 5′ end of mouse U7 snRNA.

    Journal: Nucleic Acids Research

    Article Title: Protein composition of catalytically active U7-dependent processing complexes assembled on histone pre-mRNA containing biotin and a photo-cleavable linker

    doi: 10.1093/nar/gky133

    Figure Lengend Snippet: 3′Biot-mH2a/5m pre-mRNA is resistant to cleavage but assembles into processing complexes. ( A ) A schematic representation of chemically synthesized mouse-specific 3′Biot-mH2a/5m pre-mRNA (64-nt). The major cleavage site (located 5 nt downstream of the stem) and 2 nt on each side of the major cleavage site are modified with a 2′O-methyl group. Biotin is placed at the 3′ end. ( B ) In vitro processing of 3′Biot-mH2a/5m (bottom) and mH2a-614 (top) pre-mRNAs. mH2a-614 (85 nt) was generated by T7 transcription and contains the same HDE as 3′Biot-mH2a/5m but lacks biotin and modified nucleotides. Each pre-mRNA was labeled at the 5′ end with 32 P and incubated in a mouse nuclear extract for 5, 15 and 30 min, as indicated. Probe alone is shown in lane 1. Numbers to the right indicate the length of the input pre-mRNA and the upstream cleavage product. ( C ) 3′Biot-mH2a/5m was incubated with a mouse myeloma nuclear extract (Mm NE) containing recombinant N-terminal FLASH (FLASH/N, amino acids 53–138) fused to GST. Assembled processing complexes were purified on streptavidin beads and analyzed by western blotting using specific antibodies (lane 1). In lane 2, formation of the processing complexes was blocked by excess SL RNA and αU7 oligonucleotide complementary to the 5′ end of mouse U7 snRNA.

    Article Snippet: RNA substrates and oligonucleotides were generated by T7 transcription or synthesized by GE Dharmacon (Lafayette, CO, USA), as listed below.

    Techniques: Synthesized, Modification, In Vitro, Generated, Labeling, Incubation, Recombinant, Purification, Western Blot

    Reconstitution of in vitro precleaved U-deletion editing with two recombinant proteins. Recombinant L. major REX1, recombinant L. tarentolae REL1, and recombinant L. tarentolae REL2 were used for this assay. ( A ) Ligation of a 5′ end-labeled ( * ) bridged nicked RNA substrate, shown above the panel. The RNA was mixed with 0.3 pmol of rREL1 or 0.1 pmol of rREL2 in the presence or absence of rREX1. Lanes: 1, mock reaction without enzymes; 2, rREL1; 3, rREL2; 4, rREL1 plus rREX1; 5, rREL2 plus rREX1. ( B ) The –2-U-deletion substrate shown above the panel was mixed with rREX1 alone, rREL1 alone, or rREL2 alone and also with mixtures of rREL1 or rREL2 and rREX1. Lanes: 1, mock reaction without enzymes; 2, rREX1; 3, rREL1, 4, rREL2; 5, rREL1 plus rREX1; 6, rREL2 plus rREX1. ( C Left ) Lanes: 1, input RNA; 2, the –2-U substrate RNA plus rREX1; 3, the –1-U substrate RNA plus rREX1; 4, the 0-U substrate RNA plus rREX1. ( Right ) gRNA-mediated U-deletion editing. Lanes: 1, mock reaction without enzymes but with the –2-U gRNA; 2, –2-U gRNA-mediated production of –1-U and –2-U ligated products (arrows); 3, –1-U gRNA-mediated production of –1-U ligated product (arrow); 4, 0-U gRNA-mediated production of no U ligated product (arrow). The 5′ fragments are indicated, as are the ligated products in each lane. The substrate RNAs used for both panels are diagrammed on the left.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Reconstitution of uridine-deletion precleaved RNA editing with two recombinant enzymes

    doi: 10.1073/pnas.0409275102

    Figure Lengend Snippet: Reconstitution of in vitro precleaved U-deletion editing with two recombinant proteins. Recombinant L. major REX1, recombinant L. tarentolae REL1, and recombinant L. tarentolae REL2 were used for this assay. ( A ) Ligation of a 5′ end-labeled ( * ) bridged nicked RNA substrate, shown above the panel. The RNA was mixed with 0.3 pmol of rREL1 or 0.1 pmol of rREL2 in the presence or absence of rREX1. Lanes: 1, mock reaction without enzymes; 2, rREL1; 3, rREL2; 4, rREL1 plus rREX1; 5, rREL2 plus rREX1. ( B ) The –2-U-deletion substrate shown above the panel was mixed with rREX1 alone, rREL1 alone, or rREL2 alone and also with mixtures of rREL1 or rREL2 and rREX1. Lanes: 1, mock reaction without enzymes; 2, rREX1; 3, rREL1, 4, rREL2; 5, rREL1 plus rREX1; 6, rREL2 plus rREX1. ( C Left ) Lanes: 1, input RNA; 2, the –2-U substrate RNA plus rREX1; 3, the –1-U substrate RNA plus rREX1; 4, the 0-U substrate RNA plus rREX1. ( Right ) gRNA-mediated U-deletion editing. Lanes: 1, mock reaction without enzymes but with the –2-U gRNA; 2, –2-U gRNA-mediated production of –1-U and –2-U ligated products (arrows); 3, –1-U gRNA-mediated production of –1-U ligated product (arrow); 4, 0-U gRNA-mediated production of no U ligated product (arrow). The 5′ fragments are indicated, as are the ligated products in each lane. The substrate RNAs used for both panels are diagrammed on the left.

    Article Snippet: This conclusion was confirmed by incubation of the same RNA substrates with rREX1 alone ( Left ).

    Techniques: In Vitro, Recombinant, Ligation, Labeling