rna substrates Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Integrated DNA Technologies dicer substrate specific small interfering rna dsirna
    Dicer Substrate Specific Small Interfering Rna Dsirna, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dicer substrate specific small interfering rna dsirna/product/Integrated DNA Technologies
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    dicer substrate specific small interfering rna dsirna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Worthington Biochemical substrate rna
    Substrate Rna, supplied by Worthington Biochemical, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/substrate rna/product/Worthington Biochemical
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    substrate rna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    Oligos Etc rna substrates
    Reconstitution of in vitro precleaved U-deletion editing with two recombinant proteins. Recombinant L. major REX1, recombinant L. tarentolae REL1, and recombinant L. tarentolae REL2 were used for this assay. ( A ) Ligation of a 5′ end-labeled ( * ) bridged nicked <t>RNA</t> substrate, shown above the panel. The RNA was mixed with 0.3 pmol of rREL1 or 0.1 pmol of rREL2 in the presence or absence of <t>rREX1.</t> Lanes: 1, mock reaction without enzymes; 2, rREL1; 3, rREL2; 4, rREL1 plus rREX1; 5, rREL2 plus rREX1. ( B ) The –2-U-deletion substrate shown above the panel was mixed with rREX1 alone, rREL1 alone, or rREL2 alone and also with mixtures of rREL1 or rREL2 and rREX1. Lanes: 1, mock reaction without enzymes; 2, rREX1; 3, rREL1, 4, rREL2; 5, rREL1 plus rREX1; 6, rREL2 plus rREX1. ( C Left ) Lanes: 1, input RNA; 2, the –2-U substrate RNA plus rREX1; 3, the –1-U substrate RNA plus rREX1; 4, the 0-U substrate RNA plus rREX1. ( Right ) gRNA-mediated U-deletion editing. Lanes: 1, mock reaction without enzymes but with the –2-U gRNA; 2, –2-U gRNA-mediated production of –1-U and –2-U ligated products (arrows); 3, –1-U gRNA-mediated production of –1-U ligated product (arrow); 4, 0-U gRNA-mediated production of no U ligated product (arrow). The 5′ fragments are indicated, as are the ligated products in each lane. The substrate RNAs used for both panels are diagrammed on the left.
    Rna Substrates, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 86/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrates/product/Oligos Etc
    Average 86 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    rna substrates - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    87
    Horizon Discovery substrate rna
    3′Biot-mH2a/5m pre-mRNA is resistant to cleavage but assembles into processing complexes. ( A ) A schematic representation of chemically synthesized mouse-specific 3′Biot-mH2a/5m pre-mRNA (64-nt). The major cleavage site (located 5 nt downstream of the stem) and 2 nt on each side of the major cleavage site are modified with a 2′O-methyl group. Biotin is placed at the 3′ end. ( B ) In vitro processing of 3′Biot-mH2a/5m (bottom) and mH2a-614 (top) pre-mRNAs. mH2a-614 (85 nt) was generated by <t>T7</t> transcription and contains the same HDE as 3′Biot-mH2a/5m but lacks biotin and modified nucleotides. Each pre-mRNA was labeled at the 5′ end with 32 P and incubated in a mouse nuclear extract for 5, 15 and 30 min, as indicated. Probe alone is shown in lane 1. Numbers to the right indicate the length of the input pre-mRNA and the upstream cleavage product. ( C ) 3′Biot-mH2a/5m was incubated with a mouse myeloma nuclear extract (Mm NE) containing recombinant N-terminal FLASH (FLASH/N, amino acids 53–138) fused to GST. Assembled processing complexes were purified on streptavidin beads and analyzed by western blotting using specific antibodies (lane 1). In lane 2, formation of the processing complexes was blocked by excess SL <t>RNA</t> and αU7 oligonucleotide complementary to the 5′ end of mouse U7 snRNA.
    Substrate Rna, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 87/100, based on 47 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/substrate rna/product/Horizon Discovery
    Average 87 stars, based on 47 article reviews
    Price from $9.99 to $1999.99
    substrate rna - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    94
    Bio-Synthesis Inc substrate rna
    3′Biot-mH2a/5m pre-mRNA is resistant to cleavage but assembles into processing complexes. ( A ) A schematic representation of chemically synthesized mouse-specific 3′Biot-mH2a/5m pre-mRNA (64-nt). The major cleavage site (located 5 nt downstream of the stem) and 2 nt on each side of the major cleavage site are modified with a 2′O-methyl group. Biotin is placed at the 3′ end. ( B ) In vitro processing of 3′Biot-mH2a/5m (bottom) and mH2a-614 (top) pre-mRNAs. mH2a-614 (85 nt) was generated by <t>T7</t> transcription and contains the same HDE as 3′Biot-mH2a/5m but lacks biotin and modified nucleotides. Each pre-mRNA was labeled at the 5′ end with 32 P and incubated in a mouse nuclear extract for 5, 15 and 30 min, as indicated. Probe alone is shown in lane 1. Numbers to the right indicate the length of the input pre-mRNA and the upstream cleavage product. ( C ) 3′Biot-mH2a/5m was incubated with a mouse myeloma nuclear extract (Mm NE) containing recombinant N-terminal FLASH (FLASH/N, amino acids 53–138) fused to GST. Assembled processing complexes were purified on streptavidin beads and analyzed by western blotting using specific antibodies (lane 1). In lane 2, formation of the processing complexes was blocked by excess SL <t>RNA</t> and αU7 oligonucleotide complementary to the 5′ end of mouse U7 snRNA.
    Substrate Rna, supplied by Bio-Synthesis Inc, used in various techniques. Bioz Stars score: 94/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/substrate rna/product/Bio-Synthesis Inc
    Average 94 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    substrate rna - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    94
    Thermo Fisher rna substrate
    Microarray analysis of global transcriptional profile of J-2792 (Δ <t>adpA</t> ) compared with J1501 (morphologically wild type) (left panel), and C-2792 ( absB , Δ adpA ) compared with C120 ( absB mutant) (right panel). <t>RNA</t> samples from these four strains were isolated at the indicated time points (shown above the figure) during parallel growth on R5 media. Cy5-dCTP (red)-labelled cDNA corresponding to transcripts isolated from J-2792 (Δ adpA ) were mixed with corresponding Cy3-dCTP (green)-labelled cDNA derived from J1501 (control strain transcripts obtained at the same time points); Cy5-dCTP labelled cDNA samples derived from the C-2792 ( absB , Δ adpA ) were hybridized with the same time point Cy3-dCTP labelled cDNA sample of C120 ( absB mutant). Differences in transcript abundance for each gene (SCO designates are shown) are displayed by means of a colour scale, in which colour saturation represents the magnitude of the difference of RNA abundance between the detected strains (J-2792 or C-2792) and control strains (J1501 or C120) at the same indicated time point. The brighter red shades represent higher transcript abundance and brighter green shades represent lower transcript abundance in the detected stain comparing with the control strain (listed second among the strains pairs). Black indicates equal RNA abundance between the two strains, and grey represents the absence of data. Ratios of genes having multiple spots on the array were averaged. A. Selected sporulation-associated genes. B. Red and Act secondary metabolite pathway genes. C. Selected protease genes. Sporulation-associated and protease genes were selected on the basis of annotation information in StrepDB – The Streptomyces Annotation Server in the Sanger Institute.
    Rna Substrate, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 93 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrate/product/Thermo Fisher
    Average 94 stars, based on 93 article reviews
    Price from $9.99 to $1999.99
    rna substrate - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    94
    Millipore rna substrate
    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to <t>SDS-PAGE.</t> Poly(C) as an <t>RNA</t> substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).
    Rna Substrate, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 40 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrate/product/Millipore
    Average 94 stars, based on 40 article reviews
    Price from $9.99 to $1999.99
    rna substrate - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    85
    IBA GmbH substrate rna
    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to <t>SDS-PAGE.</t> Poly(C) as an <t>RNA</t> substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).
    Substrate Rna, supplied by IBA GmbH, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/substrate rna/product/IBA GmbH
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    substrate rna - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    91
    Horizon Discovery rna oligonucleotide substrates
    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to <t>SDS-PAGE.</t> Poly(C) as an <t>RNA</t> substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).
    Rna Oligonucleotide Substrates, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna oligonucleotide substrates/product/Horizon Discovery
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rna oligonucleotide substrates - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    84
    Horizon Discovery rna gcuaugucugucaacuugaaaaaa substrate
    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to <t>SDS-PAGE.</t> Poly(C) as an <t>RNA</t> substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).
    Rna Gcuaugucugucaacuugaaaaaa Substrate, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 84/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna gcuaugucugucaacuugaaaaaa substrate/product/Horizon Discovery
    Average 84 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    rna gcuaugucugucaacuugaaaaaa substrate - by Bioz Stars, 2020-04
    84/100 stars
      Buy from Supplier

    86
    Horizon Discovery rna substrates rna oligonucleotides
    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to <t>SDS-PAGE.</t> Poly(C) as an <t>RNA</t> substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).
    Rna Substrates Rna Oligonucleotides, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 86/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrates rna oligonucleotides/product/Horizon Discovery
    Average 86 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    rna substrates rna oligonucleotides - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    93
    GenScript rna substrate
    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to <t>SDS-PAGE.</t> Poly(C) as an <t>RNA</t> substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).
    Rna Substrate, supplied by GenScript, used in various techniques. Bioz Stars score: 93/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrate/product/GenScript
    Average 93 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    rna substrate - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    94
    GE Healthcare rna substrates
    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to <t>SDS-PAGE.</t> Poly(C) as an <t>RNA</t> substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).
    Rna Substrates, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 94/100, based on 52 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrates/product/GE Healthcare
    Average 94 stars, based on 52 article reviews
    Price from $9.99 to $1999.99
    rna substrates - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    93
    Promega rna substrates
    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to <t>SDS-PAGE.</t> Poly(C) as an <t>RNA</t> substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).
    Rna Substrates, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 85 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrates/product/Promega
    Average 93 stars, based on 85 article reviews
    Price from $9.99 to $1999.99
    rna substrates - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    93
    Trevigen rna substrate
    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to <t>SDS-PAGE.</t> Poly(C) as an <t>RNA</t> substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).
    Rna Substrate, supplied by Trevigen, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrate/product/Trevigen
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rna substrate - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    91
    TaKaRa rna substrates
    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to <t>SDS-PAGE.</t> Poly(C) as an <t>RNA</t> substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).
    Rna Substrates, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrates/product/TaKaRa
    Average 91 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    rna substrates - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    91
    Exosome Diagnostics rna substrate
    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to <t>SDS-PAGE.</t> Poly(C) as an <t>RNA</t> substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).
    Rna Substrate, supplied by Exosome Diagnostics, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrate/product/Exosome Diagnostics
    Average 91 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    rna substrate - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    86
    Kaneka Corp rna substrate
    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to <t>SDS-PAGE.</t> Poly(C) as an <t>RNA</t> substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).
    Rna Substrate, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 86/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrate/product/Kaneka Corp
    Average 86 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    rna substrate - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    85
    TriLink pmole rna substrate
    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to <t>SDS-PAGE.</t> Poly(C) as an <t>RNA</t> substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).
    Pmole Rna Substrate, supplied by TriLink, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmole rna substrate/product/TriLink
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pmole rna substrate - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    94
    TaKaRa fluorogenic rna substrate
    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to <t>SDS-PAGE.</t> Poly(C) as an <t>RNA</t> substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).
    Fluorogenic Rna Substrate, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorogenic rna substrate/product/TaKaRa
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    fluorogenic rna substrate - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    86
    Roche ms2 rna substrate
    In vitro RNase assay of ICE Afe 1 toxins. 1.6 µg of <t>MS2</t> <t>RNA</t> was incubated with (+) or without (−) the purified toxins in 10 mM Tris-HCl (pH 7.8) in the absence of divalent ions (A) or with 10 mM MgCl 2 (B) or MnCl 2 (C). The reactions were incubated at 37°C for 15 (A and C) or 30 minutes (B). 12 mM EDTA was added to some reactions as a control (lanes 6-10).
    Ms2 Rna Substrate, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ms2 rna substrate/product/Roche
    Average 86 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    ms2 rna substrate - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    86
    Microsynth rna oligonucleotide substrate
    In vitro RNase assay of ICE Afe 1 toxins. 1.6 µg of <t>MS2</t> <t>RNA</t> was incubated with (+) or without (−) the purified toxins in 10 mM Tris-HCl (pH 7.8) in the absence of divalent ions (A) or with 10 mM MgCl 2 (B) or MnCl 2 (C). The reactions were incubated at 37°C for 15 (A and C) or 30 minutes (B). 12 mM EDTA was added to some reactions as a control (lanes 6-10).
    Rna Oligonucleotide Substrate, supplied by Microsynth, used in various techniques. Bioz Stars score: 86/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna oligonucleotide substrate/product/Microsynth
    Average 86 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    rna oligonucleotide substrate - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    85
    Horizon Discovery single strand substrate rna 5 ucggcucuuccu
    In vitro RNase assay of ICE Afe 1 toxins. 1.6 µg of <t>MS2</t> <t>RNA</t> was incubated with (+) or without (−) the purified toxins in 10 mM Tris-HCl (pH 7.8) in the absence of divalent ions (A) or with 10 mM MgCl 2 (B) or MnCl 2 (C). The reactions were incubated at 37°C for 15 (A and C) or 30 minutes (B). 12 mM EDTA was added to some reactions as a control (lanes 6-10).
    Single Strand Substrate Rna 5 Ucggcucuuccu, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single strand substrate rna 5 ucggcucuuccu/product/Horizon Discovery
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    single strand substrate rna 5 ucggcucuuccu - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    85
    Midland Certified Reagent dna rna substrates
    Incision activities for human ENDOV on <t>RNA</t> depends on a ribonucleotide 3′ to inosine. The substrates ( a ) ds <t>DNA:RNA</t> dI:rU, ( b ) ds RNA:DNA rI:dT, ( c ) ss DNA dI rG were incubated with the wild-type enzymes (0.1–25 nM, as indicated) or the two site-specific mutants E. coli D35A and human D52A (25 nM) and reaction products analyzed by PAGE. ( d ) Structural model of the active site of human ENDOV with a ribonucleotide. The 2′ OH group is close to the conserved glutamate (E100), as well as the active site water molecule (Wat) coordinating the Mg 2+ cofactor, which bridges the 3′- and 5′-ends in the incised product. ( e ) The endonuclease V enzymes were tested for activity against the ds DNA dI:dT rG:dC substrate as in a – c ). RNA sizes (in nt) are indicated, –=no enzyme added, r=ribonucleotide and d=deoxynucleotide.
    Dna Rna Substrates, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna rna substrates/product/Midland Certified Reagent
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    dna rna substrates - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    92
    Millipore synthetic rna substrates
    Incision activities for human ENDOV on <t>RNA</t> depends on a ribonucleotide 3′ to inosine. The substrates ( a ) ds <t>DNA:RNA</t> dI:rU, ( b ) ds RNA:DNA rI:dT, ( c ) ss DNA dI rG were incubated with the wild-type enzymes (0.1–25 nM, as indicated) or the two site-specific mutants E. coli D35A and human D52A (25 nM) and reaction products analyzed by PAGE. ( d ) Structural model of the active site of human ENDOV with a ribonucleotide. The 2′ OH group is close to the conserved glutamate (E100), as well as the active site water molecule (Wat) coordinating the Mg 2+ cofactor, which bridges the 3′- and 5′-ends in the incised product. ( e ) The endonuclease V enzymes were tested for activity against the ds DNA dI:dT rG:dC substrate as in a – c ). RNA sizes (in nt) are indicated, –=no enzyme added, r=ribonucleotide and d=deoxynucleotide.
    Synthetic Rna Substrates, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/synthetic rna substrates/product/Millipore
    Average 92 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    synthetic rna substrates - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    84
    Horizon Discovery dsrna substrates duplex rna
    <t>RNA</t> editing by ADAR1-L. Editing activity was measured as the ratio of edited versus unedited adenosines at each position within the <t>dsRNA</t> molecules. Depicted are the averaged editing frequencies from three experiments for all 16 adenosines analyzed after 30 min incubation. For each edited position the background editing activity of native HEK293 cell extracts has been subtracted.
    Dsrna Substrates Duplex Rna, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dsrna substrates duplex rna/product/Horizon Discovery
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dsrna substrates duplex rna - by Bioz Stars, 2020-04
    84/100 stars
      Buy from Supplier

    92
    Millipore noncleavable pistol substrate rna
    <t>RNA</t> editing by ADAR1-L. Editing activity was measured as the ratio of edited versus unedited adenosines at each position within the <t>dsRNA</t> molecules. Depicted are the averaged editing frequencies from three experiments for all 16 adenosines analyzed after 30 min incubation. For each edited position the background editing activity of native HEK293 cell extracts has been subtracted.
    Noncleavable Pistol Substrate Rna, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/noncleavable pistol substrate rna/product/Millipore
    Average 92 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    noncleavable pistol substrate rna - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    92
    Illumina Inc substrate rna populations
    <t>RNA</t> editing by ADAR1-L. Editing activity was measured as the ratio of edited versus unedited adenosines at each position within the <t>dsRNA</t> molecules. Depicted are the averaged editing frequencies from three experiments for all 16 adenosines analyzed after 30 min incubation. For each edited position the background editing activity of native HEK293 cell extracts has been subtracted.
    Substrate Rna Populations, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/substrate rna populations/product/Illumina Inc
    Average 92 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    substrate rna populations - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    86
    MWG-Biotech fluorescence labelled rna substrates
    <t>RNA</t> editing by ADAR1-L. Editing activity was measured as the ratio of edited versus unedited adenosines at each position within the <t>dsRNA</t> molecules. Depicted are the averaged editing frequencies from three experiments for all 16 adenosines analyzed after 30 min incubation. For each edited position the background editing activity of native HEK293 cell extracts has been subtracted.
    Fluorescence Labelled Rna Substrates, supplied by MWG-Biotech, used in various techniques. Bioz Stars score: 86/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorescence labelled rna substrates/product/MWG-Biotech
    Average 86 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    fluorescence labelled rna substrates - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    99
    Millipore ssdna oligo substrate
    ssDNA binding and annealing activities of S. aureus phage 80α Sak protein. ( A ) Electrophoretic mobility shift assay showing the binding of Sak protein to ssDNA. Radiolabelled oligo 100-nt-up (0.5 nM) was incubated with increasing amounts of Sak protein (from 30 nM to 1 μM) in buffer B containing 1 mM MgCl 2 for 15 min at 37°C. The two types of complexes formed are denoted by I and II. ( B ) Binding to dsDNA. Radiolabelled pUC18 HindIII–NdeI 216 bp dsDNA fragment (0.5 nM) was incubated with increasing amounts of Sak protein (from 60 nM to 4 μM) in buffer B containing 1 mM MgCl 2 for 15 min at 37°C. The three types of complexes formed are denoted by I, II and III. ( C ) Sak promotes single-strand annealing. Radiolabelled oligo 100-nt-up and its complementary (0.5 nM) were incubated with a fixed concentration of Sak (40 nM) in the presence of 5 mM magnesium acetate. At the given time points, aliquots were removed and deproteinized. The reaction products were analyzed by 8% PAGE and autoradiopgraphy. Lane 1: control annealed 100 bp ds <t>DNA;</t> lane 2: radiolabelled oligo 100-nt-up; lanes 3–8: control reaction without protein (2–12 min); lanes 9–14: reaction with Sak of phage 80α (40 nM, 2–12 min).
    Ssdna Oligo Substrate, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ssdna oligo substrate/product/Millipore
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    ssdna oligo substrate - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher t7 rna polymerase substrate
    ssDNA binding and annealing activities of S. aureus phage 80α Sak protein. ( A ) Electrophoretic mobility shift assay showing the binding of Sak protein to ssDNA. Radiolabelled oligo 100-nt-up (0.5 nM) was incubated with increasing amounts of Sak protein (from 30 nM to 1 μM) in buffer B containing 1 mM MgCl 2 for 15 min at 37°C. The two types of complexes formed are denoted by I and II. ( B ) Binding to dsDNA. Radiolabelled pUC18 HindIII–NdeI 216 bp dsDNA fragment (0.5 nM) was incubated with increasing amounts of Sak protein (from 60 nM to 4 μM) in buffer B containing 1 mM MgCl 2 for 15 min at 37°C. The three types of complexes formed are denoted by I, II and III. ( C ) Sak promotes single-strand annealing. Radiolabelled oligo 100-nt-up and its complementary (0.5 nM) were incubated with a fixed concentration of Sak (40 nM) in the presence of 5 mM magnesium acetate. At the given time points, aliquots were removed and deproteinized. The reaction products were analyzed by 8% PAGE and autoradiopgraphy. Lane 1: control annealed 100 bp ds <t>DNA;</t> lane 2: radiolabelled oligo 100-nt-up; lanes 3–8: control reaction without protein (2–12 min); lanes 9–14: reaction with Sak of phage 80α (40 nM, 2–12 min).
    T7 Rna Polymerase Substrate, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 rna polymerase substrate/product/Thermo Fisher
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    t7 rna polymerase substrate - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Reconstitution of in vitro precleaved U-deletion editing with two recombinant proteins. Recombinant L. major REX1, recombinant L. tarentolae REL1, and recombinant L. tarentolae REL2 were used for this assay. ( A ) Ligation of a 5′ end-labeled ( * ) bridged nicked RNA substrate, shown above the panel. The RNA was mixed with 0.3 pmol of rREL1 or 0.1 pmol of rREL2 in the presence or absence of rREX1. Lanes: 1, mock reaction without enzymes; 2, rREL1; 3, rREL2; 4, rREL1 plus rREX1; 5, rREL2 plus rREX1. ( B ) The –2-U-deletion substrate shown above the panel was mixed with rREX1 alone, rREL1 alone, or rREL2 alone and also with mixtures of rREL1 or rREL2 and rREX1. Lanes: 1, mock reaction without enzymes; 2, rREX1; 3, rREL1, 4, rREL2; 5, rREL1 plus rREX1; 6, rREL2 plus rREX1. ( C Left ) Lanes: 1, input RNA; 2, the –2-U substrate RNA plus rREX1; 3, the –1-U substrate RNA plus rREX1; 4, the 0-U substrate RNA plus rREX1. ( Right ) gRNA-mediated U-deletion editing. Lanes: 1, mock reaction without enzymes but with the –2-U gRNA; 2, –2-U gRNA-mediated production of –1-U and –2-U ligated products (arrows); 3, –1-U gRNA-mediated production of –1-U ligated product (arrow); 4, 0-U gRNA-mediated production of no U ligated product (arrow). The 5′ fragments are indicated, as are the ligated products in each lane. The substrate RNAs used for both panels are diagrammed on the left.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Reconstitution of uridine-deletion precleaved RNA editing with two recombinant enzymes

    doi: 10.1073/pnas.0409275102

    Figure Lengend Snippet: Reconstitution of in vitro precleaved U-deletion editing with two recombinant proteins. Recombinant L. major REX1, recombinant L. tarentolae REL1, and recombinant L. tarentolae REL2 were used for this assay. ( A ) Ligation of a 5′ end-labeled ( * ) bridged nicked RNA substrate, shown above the panel. The RNA was mixed with 0.3 pmol of rREL1 or 0.1 pmol of rREL2 in the presence or absence of rREX1. Lanes: 1, mock reaction without enzymes; 2, rREL1; 3, rREL2; 4, rREL1 plus rREX1; 5, rREL2 plus rREX1. ( B ) The –2-U-deletion substrate shown above the panel was mixed with rREX1 alone, rREL1 alone, or rREL2 alone and also with mixtures of rREL1 or rREL2 and rREX1. Lanes: 1, mock reaction without enzymes; 2, rREX1; 3, rREL1, 4, rREL2; 5, rREL1 plus rREX1; 6, rREL2 plus rREX1. ( C Left ) Lanes: 1, input RNA; 2, the –2-U substrate RNA plus rREX1; 3, the –1-U substrate RNA plus rREX1; 4, the 0-U substrate RNA plus rREX1. ( Right ) gRNA-mediated U-deletion editing. Lanes: 1, mock reaction without enzymes but with the –2-U gRNA; 2, –2-U gRNA-mediated production of –1-U and –2-U ligated products (arrows); 3, –1-U gRNA-mediated production of –1-U ligated product (arrow); 4, 0-U gRNA-mediated production of no U ligated product (arrow). The 5′ fragments are indicated, as are the ligated products in each lane. The substrate RNAs used for both panels are diagrammed on the left.

    Article Snippet: This conclusion was confirmed by incubation of the same RNA substrates with rREX1 alone ( Left ).

    Techniques: In Vitro, Recombinant, Ligation, Labeling

    3′Biot-mH2a/5m pre-mRNA is resistant to cleavage but assembles into processing complexes. ( A ) A schematic representation of chemically synthesized mouse-specific 3′Biot-mH2a/5m pre-mRNA (64-nt). The major cleavage site (located 5 nt downstream of the stem) and 2 nt on each side of the major cleavage site are modified with a 2′O-methyl group. Biotin is placed at the 3′ end. ( B ) In vitro processing of 3′Biot-mH2a/5m (bottom) and mH2a-614 (top) pre-mRNAs. mH2a-614 (85 nt) was generated by T7 transcription and contains the same HDE as 3′Biot-mH2a/5m but lacks biotin and modified nucleotides. Each pre-mRNA was labeled at the 5′ end with 32 P and incubated in a mouse nuclear extract for 5, 15 and 30 min, as indicated. Probe alone is shown in lane 1. Numbers to the right indicate the length of the input pre-mRNA and the upstream cleavage product. ( C ) 3′Biot-mH2a/5m was incubated with a mouse myeloma nuclear extract (Mm NE) containing recombinant N-terminal FLASH (FLASH/N, amino acids 53–138) fused to GST. Assembled processing complexes were purified on streptavidin beads and analyzed by western blotting using specific antibodies (lane 1). In lane 2, formation of the processing complexes was blocked by excess SL RNA and αU7 oligonucleotide complementary to the 5′ end of mouse U7 snRNA.

    Journal: Nucleic Acids Research

    Article Title: Protein composition of catalytically active U7-dependent processing complexes assembled on histone pre-mRNA containing biotin and a photo-cleavable linker

    doi: 10.1093/nar/gky133

    Figure Lengend Snippet: 3′Biot-mH2a/5m pre-mRNA is resistant to cleavage but assembles into processing complexes. ( A ) A schematic representation of chemically synthesized mouse-specific 3′Biot-mH2a/5m pre-mRNA (64-nt). The major cleavage site (located 5 nt downstream of the stem) and 2 nt on each side of the major cleavage site are modified with a 2′O-methyl group. Biotin is placed at the 3′ end. ( B ) In vitro processing of 3′Biot-mH2a/5m (bottom) and mH2a-614 (top) pre-mRNAs. mH2a-614 (85 nt) was generated by T7 transcription and contains the same HDE as 3′Biot-mH2a/5m but lacks biotin and modified nucleotides. Each pre-mRNA was labeled at the 5′ end with 32 P and incubated in a mouse nuclear extract for 5, 15 and 30 min, as indicated. Probe alone is shown in lane 1. Numbers to the right indicate the length of the input pre-mRNA and the upstream cleavage product. ( C ) 3′Biot-mH2a/5m was incubated with a mouse myeloma nuclear extract (Mm NE) containing recombinant N-terminal FLASH (FLASH/N, amino acids 53–138) fused to GST. Assembled processing complexes were purified on streptavidin beads and analyzed by western blotting using specific antibodies (lane 1). In lane 2, formation of the processing complexes was blocked by excess SL RNA and αU7 oligonucleotide complementary to the 5′ end of mouse U7 snRNA.

    Article Snippet: RNA substrates and oligonucleotides were generated by T7 transcription or synthesized by GE Dharmacon (Lafayette, CO, USA), as listed below.

    Techniques: Synthesized, Modification, In Vitro, Generated, Labeling, Incubation, Recombinant, Purification, Western Blot

    dDis3 cleavage of 3′-end-labeled RNAs confirms endoribonuclease activity. MBP-dDis3 1–394 ( A ) and MBP-dDis3 1–982 ( B ) cleave 3′-end-labeled polyA, polyC, polyU and polyN RNA substrates. Circular RNAs were a by-product of the 3′-end-labeling procedure. Note that reaction products for both proteins are RNA fragments. Data shown is representative of at least two independent experiments.

    Journal: Nucleic Acids Research

    Article Title: Drosophila melanogaster Dis3 N-terminal domains are required for ribonuclease activities, nuclear localization and exosome interactions

    doi: 10.1093/nar/gkq295

    Figure Lengend Snippet: dDis3 cleavage of 3′-end-labeled RNAs confirms endoribonuclease activity. MBP-dDis3 1–394 ( A ) and MBP-dDis3 1–982 ( B ) cleave 3′-end-labeled polyA, polyC, polyU and polyN RNA substrates. Circular RNAs were a by-product of the 3′-end-labeling procedure. Note that reaction products for both proteins are RNA fragments. Data shown is representative of at least two independent experiments.

    Article Snippet: Preparation of RNA substrates RNA substrates utilized in the ribonuclease assays included polyA (30 nt, Dharmacon), polyC (30 nt, Dharmacon), polyU (32 nt) and an RNA containing all four nucleotides, polyN (31 nt; 5′GCGUCUUUACGGUGCUUAAAACAAAACAAAA3′).

    Techniques: Labeling, Activity Assay, End Labeling

    The dDis3 N-terminus has endoribonuclease activity. MBP-dDis3 1–394 ( A ) and MBP-dDis3 1–982 ( B ) cleave circularized polyA, polyC, polyU and polyN RNA substrates. Some linear RNA is present due to inefficiency of the ligation reaction during preparation of circular substrates. Full-length linear RNA is marked as (dashed line) and RNA circles as (open circle). These symbols are used throughout. Data shown is representative of at least two independent experiments.

    Journal: Nucleic Acids Research

    Article Title: Drosophila melanogaster Dis3 N-terminal domains are required for ribonuclease activities, nuclear localization and exosome interactions

    doi: 10.1093/nar/gkq295

    Figure Lengend Snippet: The dDis3 N-terminus has endoribonuclease activity. MBP-dDis3 1–394 ( A ) and MBP-dDis3 1–982 ( B ) cleave circularized polyA, polyC, polyU and polyN RNA substrates. Some linear RNA is present due to inefficiency of the ligation reaction during preparation of circular substrates. Full-length linear RNA is marked as (dashed line) and RNA circles as (open circle). These symbols are used throughout. Data shown is representative of at least two independent experiments.

    Article Snippet: Preparation of RNA substrates RNA substrates utilized in the ribonuclease assays included polyA (30 nt, Dharmacon), polyC (30 nt, Dharmacon), polyU (32 nt) and an RNA containing all four nucleotides, polyN (31 nt; 5′GCGUCUUUACGGUGCUUAAAACAAAACAAAA3′).

    Techniques: Activity Assay, Ligation

    Microarray analysis of global transcriptional profile of J-2792 (Δ adpA ) compared with J1501 (morphologically wild type) (left panel), and C-2792 ( absB , Δ adpA ) compared with C120 ( absB mutant) (right panel). RNA samples from these four strains were isolated at the indicated time points (shown above the figure) during parallel growth on R5 media. Cy5-dCTP (red)-labelled cDNA corresponding to transcripts isolated from J-2792 (Δ adpA ) were mixed with corresponding Cy3-dCTP (green)-labelled cDNA derived from J1501 (control strain transcripts obtained at the same time points); Cy5-dCTP labelled cDNA samples derived from the C-2792 ( absB , Δ adpA ) were hybridized with the same time point Cy3-dCTP labelled cDNA sample of C120 ( absB mutant). Differences in transcript abundance for each gene (SCO designates are shown) are displayed by means of a colour scale, in which colour saturation represents the magnitude of the difference of RNA abundance between the detected strains (J-2792 or C-2792) and control strains (J1501 or C120) at the same indicated time point. The brighter red shades represent higher transcript abundance and brighter green shades represent lower transcript abundance in the detected stain comparing with the control strain (listed second among the strains pairs). Black indicates equal RNA abundance between the two strains, and grey represents the absence of data. Ratios of genes having multiple spots on the array were averaged. A. Selected sporulation-associated genes. B. Red and Act secondary metabolite pathway genes. C. Selected protease genes. Sporulation-associated and protease genes were selected on the basis of annotation information in StrepDB – The Streptomyces Annotation Server in the Sanger Institute.

    Journal: Molecular Microbiology

    Article Title: Regulation of morphological differentiation in S. coelicolor by RNase III (AbsB) cleavage of mRNA encoding the AdpA transcription factor

    doi: 10.1111/j.1365-2958.2009.07023.x

    Figure Lengend Snippet: Microarray analysis of global transcriptional profile of J-2792 (Δ adpA ) compared with J1501 (morphologically wild type) (left panel), and C-2792 ( absB , Δ adpA ) compared with C120 ( absB mutant) (right panel). RNA samples from these four strains were isolated at the indicated time points (shown above the figure) during parallel growth on R5 media. Cy5-dCTP (red)-labelled cDNA corresponding to transcripts isolated from J-2792 (Δ adpA ) were mixed with corresponding Cy3-dCTP (green)-labelled cDNA derived from J1501 (control strain transcripts obtained at the same time points); Cy5-dCTP labelled cDNA samples derived from the C-2792 ( absB , Δ adpA ) were hybridized with the same time point Cy3-dCTP labelled cDNA sample of C120 ( absB mutant). Differences in transcript abundance for each gene (SCO designates are shown) are displayed by means of a colour scale, in which colour saturation represents the magnitude of the difference of RNA abundance between the detected strains (J-2792 or C-2792) and control strains (J1501 or C120) at the same indicated time point. The brighter red shades represent higher transcript abundance and brighter green shades represent lower transcript abundance in the detected stain comparing with the control strain (listed second among the strains pairs). Black indicates equal RNA abundance between the two strains, and grey represents the absence of data. Ratios of genes having multiple spots on the array were averaged. A. Selected sporulation-associated genes. B. Red and Act secondary metabolite pathway genes. C. Selected protease genes. Sporulation-associated and protease genes were selected on the basis of annotation information in StrepDB – The Streptomyces Annotation Server in the Sanger Institute.

    Article Snippet: For adpA transcripts, 2 µg of RNA substrates were incubated with 6–100 ng of purified protein in 20 µl of reactions (Applied Biosystems RNase III buffer).

    Techniques: Microarray, Mutagenesis, Isolation, Derivative Assay, Staining, Activated Clotting Time Assay

    AbsB cleavage of adpA transcripts. 2 µg of in vitro transcribed adpA transcript was incubated with 6.25, 12.5, 25, 50, 100 ng of purified His-tagged AbsB protein (lanes 2–6) and the same amounts of mutant AbsB protein (lanes 7–11) that had been similarly purified as described. The arrows indicate the positions of uncleaved RNA and the cleavage products.

    Journal: Molecular Microbiology

    Article Title: Regulation of morphological differentiation in S. coelicolor by RNase III (AbsB) cleavage of mRNA encoding the AdpA transcription factor

    doi: 10.1111/j.1365-2958.2009.07023.x

    Figure Lengend Snippet: AbsB cleavage of adpA transcripts. 2 µg of in vitro transcribed adpA transcript was incubated with 6.25, 12.5, 25, 50, 100 ng of purified His-tagged AbsB protein (lanes 2–6) and the same amounts of mutant AbsB protein (lanes 7–11) that had been similarly purified as described. The arrows indicate the positions of uncleaved RNA and the cleavage products.

    Article Snippet: For adpA transcripts, 2 µg of RNA substrates were incubated with 6–100 ng of purified protein in 20 µl of reactions (Applied Biosystems RNase III buffer).

    Techniques: In Vitro, Incubation, Purification, Mutagenesis

    In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to SDS-PAGE. Poly(C) as an RNA substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).

    Journal: mBio

    Article Title: A New Family of Membrane Electron Transporters and Its Substrates, Including a New Cell Envelope Peroxiredoxin, Reveal a Broadened Reductive Capacity of the Oxidative Bacterial Cell Envelope

    doi: 10.1128/mBio.00291-11

    Figure Lengend Snippet: In vivo RNase I activity depends on scsC in C. crescentus . (A) Sequence alignment of C. crescentus RNase I (CC0030) and a tobacco RNase (RNase NW) after Jpred3 analysis. The high-resolution structure of the latter has been solved, and disulfide bonds have been assigned from the structure (PDB: 1iyb). The letters in red in the alignment are predicted to be catalytic residues in the active sites of both RNases. Two cysteine residues in blue are conserved in both RNases, and those from RNase NW form a disulfide bond which is represented with an S (sulfur in thiol) in a yellow background. One additional cysteine residue between these conserved cysteines in each of the C. crescentus RNase I and RNase NW proteins is indicated in a red box. (B) Zymogram to show RNase activity in the wild-type and the scsC C. crescentus strains. Cells were induced by 0.5 mM vanillate for expression of C. crescentus RNase I from pSC164. Cells were harvested at mid-log phase, broken by sonication, and subjected to SDS-PAGE. Poly(C) as an RNA substrate and toluidine blue as an intercalating dye were added to visualize RNase activity on a gel. The strain backgrounds used were C. crescentus CB15N (wild type; lanes 1 and 2) and SEN 224 (the scsC mutant; lanes 3 and 4).

    Article Snippet: Poly(C) (Sigma) as an RNA substrate was added to the solution for SDS-PAGE, and toluidine blue as an intercalating dye was added after electrophoresis to the gel-staining solution.

    Techniques: In Vivo, Activity Assay, Sequencing, Expressing, Sonication, SDS Page, Mutagenesis

    In vitro RNase assay of ICE Afe 1 toxins. 1.6 µg of MS2 RNA was incubated with (+) or without (−) the purified toxins in 10 mM Tris-HCl (pH 7.8) in the absence of divalent ions (A) or with 10 mM MgCl 2 (B) or MnCl 2 (C). The reactions were incubated at 37°C for 15 (A and C) or 30 minutes (B). 12 mM EDTA was added to some reactions as a control (lanes 6-10).

    Journal: PLoS ONE

    Article Title: Toxin-Antitoxin Systems in the Mobile Genome of Acidithiobacillus ferrooxidans

    doi: 10.1371/journal.pone.0112226

    Figure Lengend Snippet: In vitro RNase assay of ICE Afe 1 toxins. 1.6 µg of MS2 RNA was incubated with (+) or without (−) the purified toxins in 10 mM Tris-HCl (pH 7.8) in the absence of divalent ions (A) or with 10 mM MgCl 2 (B) or MnCl 2 (C). The reactions were incubated at 37°C for 15 (A and C) or 30 minutes (B). 12 mM EDTA was added to some reactions as a control (lanes 6-10).

    Article Snippet: RNase activity The digestion reaction mixture (20 µl) consisted of 1.6 µg of MS2 RNA substrate (Roche) in 10 mM Tris-HCl (pH 7.8) with or without 10 mM MgCl2 or MnCl2 , 40 U RNase inhibitor Ribolock (ThermoScientific) and 100 pmol of each purified toxin.

    Techniques: In Vitro, Incubation, Purification

    Incision activities for human ENDOV on RNA depends on a ribonucleotide 3′ to inosine. The substrates ( a ) ds DNA:RNA dI:rU, ( b ) ds RNA:DNA rI:dT, ( c ) ss DNA dI rG were incubated with the wild-type enzymes (0.1–25 nM, as indicated) or the two site-specific mutants E. coli D35A and human D52A (25 nM) and reaction products analyzed by PAGE. ( d ) Structural model of the active site of human ENDOV with a ribonucleotide. The 2′ OH group is close to the conserved glutamate (E100), as well as the active site water molecule (Wat) coordinating the Mg 2+ cofactor, which bridges the 3′- and 5′-ends in the incised product. ( e ) The endonuclease V enzymes were tested for activity against the ds DNA dI:dT rG:dC substrate as in a – c ). RNA sizes (in nt) are indicated, –=no enzyme added, r=ribonucleotide and d=deoxynucleotide.

    Journal: Nature Communications

    Article Title: Endonuclease V cleaves at inosines in RNA

    doi: 10.1038/ncomms3271

    Figure Lengend Snippet: Incision activities for human ENDOV on RNA depends on a ribonucleotide 3′ to inosine. The substrates ( a ) ds DNA:RNA dI:rU, ( b ) ds RNA:DNA rI:dT, ( c ) ss DNA dI rG were incubated with the wild-type enzymes (0.1–25 nM, as indicated) or the two site-specific mutants E. coli D35A and human D52A (25 nM) and reaction products analyzed by PAGE. ( d ) Structural model of the active site of human ENDOV with a ribonucleotide. The 2′ OH group is close to the conserved glutamate (E100), as well as the active site water molecule (Wat) coordinating the Mg 2+ cofactor, which bridges the 3′- and 5′-ends in the incised product. ( e ) The endonuclease V enzymes were tested for activity against the ds DNA dI:dT rG:dC substrate as in a – c ). RNA sizes (in nt) are indicated, –=no enzyme added, r=ribonucleotide and d=deoxynucleotide.

    Article Snippet: DNA/RNA substrates All DNA/RNA substrates were oligonucleotides synthesized by The Midland Certified Reagent Company, and are listed in .

    Techniques: Incubation, Polyacrylamide Gel Electrophoresis, Activity Assay

    Various incision activities for E. coli and human endonuclease V at inosines in DNA and RNA. The substrates ( a ) single-stranded (ss) RNA rI, ( b ) double-stranded (ds) RNA rI:rU, ( c ) ss RNA rA, ( d ) ssDNA dI, ( e ) ds DNA dI:dT were incubated with the wild-type enzymes (1–25 nM, as indicated) or the two site-specific mutants E. coli D35A and human D52A (25 nM) and reaction products analyzed by PAGE. RNA sizes (in nt) are indicated, –=no enzyme added, r=ribonucleotide and d=deoxynucleotide. ( f ) Single-turnover kinetic analysis with enzyme and substrates as indicated.

    Journal: Nature Communications

    Article Title: Endonuclease V cleaves at inosines in RNA

    doi: 10.1038/ncomms3271

    Figure Lengend Snippet: Various incision activities for E. coli and human endonuclease V at inosines in DNA and RNA. The substrates ( a ) single-stranded (ss) RNA rI, ( b ) double-stranded (ds) RNA rI:rU, ( c ) ss RNA rA, ( d ) ssDNA dI, ( e ) ds DNA dI:dT were incubated with the wild-type enzymes (1–25 nM, as indicated) or the two site-specific mutants E. coli D35A and human D52A (25 nM) and reaction products analyzed by PAGE. RNA sizes (in nt) are indicated, –=no enzyme added, r=ribonucleotide and d=deoxynucleotide. ( f ) Single-turnover kinetic analysis with enzyme and substrates as indicated.

    Article Snippet: DNA/RNA substrates All DNA/RNA substrates were oligonucleotides synthesized by The Midland Certified Reagent Company, and are listed in .

    Techniques: Incubation, Polyacrylamide Gel Electrophoresis

    RNA editing by ADAR1-L. Editing activity was measured as the ratio of edited versus unedited adenosines at each position within the dsRNA molecules. Depicted are the averaged editing frequencies from three experiments for all 16 adenosines analyzed after 30 min incubation. For each edited position the background editing activity of native HEK293 cell extracts has been subtracted.

    Journal: Nucleic Acids Research

    Article Title: Modulation of ADAR1 editing activity by Z-RNA in vitro

    doi: 10.1093/nar/gki849

    Figure Lengend Snippet: RNA editing by ADAR1-L. Editing activity was measured as the ratio of edited versus unedited adenosines at each position within the dsRNA molecules. Depicted are the averaged editing frequencies from three experiments for all 16 adenosines analyzed after 30 min incubation. For each edited position the background editing activity of native HEK293 cell extracts has been subtracted.

    Article Snippet: Preparation of the dsRNA substrates Duplex RNA (Dharmacon) of 50 bp was prepared from a sense/antisense pair of RNA oligonucleotides.

    Techniques: Activity Assay, Incubation

    Model for the interaction of ADAR1-L with Z-motif containing or lacking substrate ( A ) The Zα motif binds with high-affinity to the Z-motif within the (CG) 6 -containing dsRNA substrate, thereby restricting the movements of the catalytic domain (sky blue) and causing a modification pattern that is shifted towards the 5′ end of the substrate molecule. ( B ) A double-stranded A-RNA substrate is bound by the dsRBDs (teal) with high-affinity, but without sequence specificity, allowing ADAR1 to move along the length of the substrate.

    Journal: Nucleic Acids Research

    Article Title: Modulation of ADAR1 editing activity by Z-RNA in vitro

    doi: 10.1093/nar/gki849

    Figure Lengend Snippet: Model for the interaction of ADAR1-L with Z-motif containing or lacking substrate ( A ) The Zα motif binds with high-affinity to the Z-motif within the (CG) 6 -containing dsRNA substrate, thereby restricting the movements of the catalytic domain (sky blue) and causing a modification pattern that is shifted towards the 5′ end of the substrate molecule. ( B ) A double-stranded A-RNA substrate is bound by the dsRBDs (teal) with high-affinity, but without sequence specificity, allowing ADAR1 to move along the length of the substrate.

    Article Snippet: Preparation of the dsRNA substrates Duplex RNA (Dharmacon) of 50 bp was prepared from a sense/antisense pair of RNA oligonucleotides.

    Techniques: Modification, Sequencing

    ssDNA binding and annealing activities of S. aureus phage 80α Sak protein. ( A ) Electrophoretic mobility shift assay showing the binding of Sak protein to ssDNA. Radiolabelled oligo 100-nt-up (0.5 nM) was incubated with increasing amounts of Sak protein (from 30 nM to 1 μM) in buffer B containing 1 mM MgCl 2 for 15 min at 37°C. The two types of complexes formed are denoted by I and II. ( B ) Binding to dsDNA. Radiolabelled pUC18 HindIII–NdeI 216 bp dsDNA fragment (0.5 nM) was incubated with increasing amounts of Sak protein (from 60 nM to 4 μM) in buffer B containing 1 mM MgCl 2 for 15 min at 37°C. The three types of complexes formed are denoted by I, II and III. ( C ) Sak promotes single-strand annealing. Radiolabelled oligo 100-nt-up and its complementary (0.5 nM) were incubated with a fixed concentration of Sak (40 nM) in the presence of 5 mM magnesium acetate. At the given time points, aliquots were removed and deproteinized. The reaction products were analyzed by 8% PAGE and autoradiopgraphy. Lane 1: control annealed 100 bp ds DNA; lane 2: radiolabelled oligo 100-nt-up; lanes 3–8: control reaction without protein (2–12 min); lanes 9–14: reaction with Sak of phage 80α (40 nM, 2–12 min).

    Journal: Nucleic Acids Research

    Article Title: Sak and Sak4 recombinases are required for bacteriophage replication in Staphylococcus aureus

    doi: 10.1093/nar/gkx308

    Figure Lengend Snippet: ssDNA binding and annealing activities of S. aureus phage 80α Sak protein. ( A ) Electrophoretic mobility shift assay showing the binding of Sak protein to ssDNA. Radiolabelled oligo 100-nt-up (0.5 nM) was incubated with increasing amounts of Sak protein (from 30 nM to 1 μM) in buffer B containing 1 mM MgCl 2 for 15 min at 37°C. The two types of complexes formed are denoted by I and II. ( B ) Binding to dsDNA. Radiolabelled pUC18 HindIII–NdeI 216 bp dsDNA fragment (0.5 nM) was incubated with increasing amounts of Sak protein (from 60 nM to 4 μM) in buffer B containing 1 mM MgCl 2 for 15 min at 37°C. The three types of complexes formed are denoted by I, II and III. ( C ) Sak promotes single-strand annealing. Radiolabelled oligo 100-nt-up and its complementary (0.5 nM) were incubated with a fixed concentration of Sak (40 nM) in the presence of 5 mM magnesium acetate. At the given time points, aliquots were removed and deproteinized. The reaction products were analyzed by 8% PAGE and autoradiopgraphy. Lane 1: control annealed 100 bp ds DNA; lane 2: radiolabelled oligo 100-nt-up; lanes 3–8: control reaction without protein (2–12 min); lanes 9–14: reaction with Sak of phage 80α (40 nM, 2–12 min).

    Article Snippet: DNA substrates Oligo 100-nt-up with the sequence: 5΄- GGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCGGGTTCGAAATCGATAAGCTTACAGTCTCCATTTAAAGGACAAG-3΄ and its complementary, oligo 100-nt-down, were purchased from SIGMA and purified by PAGE as described before ( ).

    Techniques: Binding Assay, Electrophoretic Mobility Shift Assay, Incubation, Concentration Assay, Polyacrylamide Gel Electrophoresis