rna concentrations Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher ribominus concentration module
    Ribominus Concentration Module, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ribominus concentration module/product/Thermo Fisher
    Average 99 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    ribominus concentration module - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore rna
    Determining negative and positive <t>RNA</t> controls for <t>EZH2</t> interactions. EZH2 reportedly binds many RNAs without well-defined protein-binding motifs. As a negative control, a nonrelated Renilla luciferase transcript was tested that did show some affinity for the EZH2 protein in the ( A ) Alphascreen assay ( n = 3) as well as in the ( B ) RNA EMSA assay. This finding is consistent with reports of EZH2 promiscuity, including the ability of this enzyme to bind nonmammalian transcripts with low affinity. 16 ( C ) The ability of biotinylated lncRNAs BDNF -AS and HOTAIR to interact with EZH2 is measured in the AlphaScreen assay. Both lncRNAs are titrated in EZH2 (4 nM). EZH2 interacts with both lncRNAs in a concentration-dependent manner ( n = 3). HOTAIR serves as a positive RNA control and biologically important screen.
    Rna, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 11003 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna/product/Millipore
    Average 99 stars, based on 11003 article reviews
    Price from $9.99 to $1999.99
    rna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore trna
    Overexpressed <t>tRNA</t> Glu from a ΔMnmC E. coli strain. ( a ) HPLC of total extracted tRNA. HPLC buffers: 100 mM Tris pH 8, 50 → 150 mM MgCl 2 . The four major modivariants are labelled 1–4. Each was isolated by HPLC for subsequent MS analysis of modified nucleosides. ( b ) Representative purified tRNA (tRNA 5, see below) after anion-exchange purifications at pH 5 and 8. HPLC buffers: 100 mM Tris pH 8, 50 mM MgCl 2 , 0 → 500 mM <t>NaCl.</t> [Note: The MgCl 2 and NaCl gradients in (a) and (b) were used interchangeably for analytical purposes] ( c ) Diagrams showing the modified nucleosides present in tRNAs 1–5 and those present in tRNAs 5 and 6, the products of reaction of tRNA 1 with MnmC (see below). Nucleosides labelled in red (or orange or yellow) were identified by MS ( Figure 2 and Supplementary Figure S1 ). The presence of nucleosides labelled in grey was not confirmed. tRNA 1 contains cmnm 5 s 2 U 34 and all other expected modifications, while tRNA 2–4 are less fully modified at anticodon–stem loop postions as shown. The nm 5 s 2 U and mnm 5 s 2 U modifications obtained by reaction with MnmC are shown in orange and yellow, respectively, to differentiate from cmnm 5 s 2 U.
    Trna, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1885 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trna/product/Millipore
    Average 99 stars, based on 1885 article reviews
    Price from $9.99 to $1999.99
    trna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore rnase
    Overexpressed <t>tRNA</t> Glu from a ΔMnmC E. coli strain. ( a ) HPLC of total extracted tRNA. HPLC buffers: 100 mM Tris pH 8, 50 → 150 mM MgCl 2 . The four major modivariants are labelled 1–4. Each was isolated by HPLC for subsequent MS analysis of modified nucleosides. ( b ) Representative purified tRNA (tRNA 5, see below) after anion-exchange purifications at pH 5 and 8. HPLC buffers: 100 mM Tris pH 8, 50 mM MgCl 2 , 0 → 500 mM <t>NaCl.</t> [Note: The MgCl 2 and NaCl gradients in (a) and (b) were used interchangeably for analytical purposes] ( c ) Diagrams showing the modified nucleosides present in tRNAs 1–5 and those present in tRNAs 5 and 6, the products of reaction of tRNA 1 with MnmC (see below). Nucleosides labelled in red (or orange or yellow) were identified by MS ( Figure 2 and Supplementary Figure S1 ). The presence of nucleosides labelled in grey was not confirmed. tRNA 1 contains cmnm 5 s 2 U 34 and all other expected modifications, while tRNA 2–4 are less fully modified at anticodon–stem loop postions as shown. The nm 5 s 2 U and mnm 5 s 2 U modifications obtained by reaction with MnmC are shown in orange and yellow, respectively, to differentiate from cmnm 5 s 2 U.
    Rnase, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 10563 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase/product/Millipore
    Average 99 stars, based on 10563 article reviews
    Price from $9.99 to $1999.99
    rnase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher rna concentrations
    Relative DEPTOR expression was measured by qPCR in MDAH-2774 cells treated with Rap (A, 20 and 100 nM), Eve (B, 20 and 100 nM), Def (C, 100 and 1,000 nM), Tem (D, 10 nM and 100 nM), Res (E, 25 and 50 µ M), BEZ (F, 10 and 100 nM) and carrier (DMSO) only control for 48 and 72 h. <t>cDNA</t> was synthesised from extracted <t>RNA</t> from 3 biological replicates for each condition * P
    Rna Concentrations, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 11985 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna concentrations/product/Thermo Fisher
    Average 99 stars, based on 11985 article reviews
    Price from $9.99 to $1999.99
    rna concentrations - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore calf liver rna
    Subtraction of <t>DNA,</t> <t>RNA</t> and protein spectra from the spect1 for positions 1 and 2. DNA, RNA and protein stack-files were subtracted sequentially from spect1 resulting in spect2D, spect2R and spect3, respectively. C, N, and O are photon energy regions of the K absorption edges for carbon, nitrogen and oxygen. Location of the positions 1 (green) and 2 (blue) were shown in the lower figure. Spect2D in the position 1 was not appeared in the figure.
    Calf Liver Rna, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/calf liver rna/product/Millipore
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    calf liver rna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    85
    Thermo Fisher bru rna concentrations
    Subtraction of <t>DNA,</t> <t>RNA</t> and protein spectra from the spect1 for positions 1 and 2. DNA, RNA and protein stack-files were subtracted sequentially from spect1 resulting in spect2D, spect2R and spect3, respectively. C, N, and O are photon energy regions of the K absorption edges for carbon, nitrogen and oxygen. Location of the positions 1 (green) and 2 (blue) were shown in the lower figure. Spect2D in the position 1 was not appeared in the figure.
    Bru Rna Concentrations, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bru rna concentrations/product/Thermo Fisher
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    bru rna concentrations - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    99
    Millipore typevi
    Subtraction of <t>DNA,</t> <t>RNA</t> and protein spectra from the spect1 for positions 1 and 2. DNA, RNA and protein stack-files were subtracted sequentially from spect1 resulting in spect2D, spect2R and spect3, respectively. C, N, and O are photon energy regions of the K absorption edges for carbon, nitrogen and oxygen. Location of the positions 1 (green) and 2 (blue) were shown in the lower figure. Spect2D in the position 1 was not appeared in the figure.
    Typevi, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/typevi/product/Millipore
    Average 99 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    typevi - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Zymo Research equivalent rna clean concetrator 25
    Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the <t>RNA</t> seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 <t>MCF7</t> cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p
    Equivalent Rna Clean Concetrator 25, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 223 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/equivalent rna clean concetrator 25/product/Zymo Research
    Average 99 stars, based on 223 article reviews
    Price from $9.99 to $1999.99
    equivalent rna clean concetrator 25 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore sigma r6750
    Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the <t>RNA</t> seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 <t>MCF7</t> cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p
    Sigma R6750, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sigma r6750/product/Millipore
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    sigma r6750 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    98
    Agilent technologies rna concentrations
    Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the <t>RNA</t> seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 <t>MCF7</t> cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p
    Rna Concentrations, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 98/100, based on 461 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna concentrations/product/Agilent technologies
    Average 98 stars, based on 461 article reviews
    Price from $9.99 to $1999.99
    rna concentrations - by Bioz Stars, 2020-04
    98/100 stars
      Buy from Supplier

    94
    Eppendorf AG rna concentrations
    Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the <t>RNA</t> seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 <t>MCF7</t> cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p
    Rna Concentrations, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 94/100, based on 281 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna concentrations/product/Eppendorf AG
    Average 94 stars, based on 281 article reviews
    Price from $9.99 to $1999.99
    rna concentrations - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    93
    GE Healthcare rna concentrations
    Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the <t>RNA</t> seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 <t>MCF7</t> cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p
    Rna Concentrations, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 165 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna concentrations/product/GE Healthcare
    Average 93 stars, based on 165 article reviews
    Price from $9.99 to $1999.99
    rna concentrations - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    93
    Roche rna concentrations
    Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the <t>RNA</t> seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 <t>MCF7</t> cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p
    Rna Concentrations, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 117 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna concentrations/product/Roche
    Average 93 stars, based on 117 article reviews
    Price from $9.99 to $1999.99
    rna concentrations - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    91
    Eurofins Genomics rna concentrations
    Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the <t>RNA</t> seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 <t>MCF7</t> cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p
    Rna Concentrations, supplied by Eurofins Genomics, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna concentrations/product/Eurofins Genomics
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rna concentrations - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    93
    Molecular Devices LLC rna concentrations
    Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the <t>RNA</t> seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 <t>MCF7</t> cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p
    Rna Concentrations, supplied by Molecular Devices LLC, used in various techniques. Bioz Stars score: 93/100, based on 47 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna concentrations/product/Molecular Devices LLC
    Average 93 stars, based on 47 article reviews
    Price from $9.99 to $1999.99
    rna concentrations - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    99
    Zymo Research rna clean concentrator
    Time-dependent fragmentation of RNAs from UV-crosslinked <t>BMV</t> virions The image shown is from ethidium bromide-stained agarose gel containing 100 μg BMV virions that were resuspended in 150 μl Tris buffer (pH: 7.0) containing 10 Mm ZnCl 2 , and heated at 70 °C to fragment BMV <t>RNA</t> for the time indicated above the gel image.
    Rna Clean Concentrator, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 769 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna clean concentrator/product/Zymo Research
    Average 99 stars, based on 769 article reviews
    Price from $9.99 to $1999.99
    rna clean concentrator - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    96
    Bio-Rad rna concentration
    Time-dependent fragmentation of RNAs from UV-crosslinked <t>BMV</t> virions The image shown is from ethidium bromide-stained agarose gel containing 100 μg BMV virions that were resuspended in 150 μl Tris buffer (pH: 7.0) containing 10 Mm ZnCl 2 , and heated at 70 °C to fragment BMV <t>RNA</t> for the time indicated above the gel image.
    Rna Concentration, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 78 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna concentration/product/Bio-Rad
    Average 96 stars, based on 78 article reviews
    Price from $9.99 to $1999.99
    rna concentration - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    93
    Promega rna concentrations
    Time-dependent fragmentation of RNAs from UV-crosslinked <t>BMV</t> virions The image shown is from ethidium bromide-stained agarose gel containing 100 μg BMV virions that were resuspended in 150 μl Tris buffer (pH: 7.0) containing 10 Mm ZnCl 2 , and heated at 70 °C to fragment BMV <t>RNA</t> for the time indicated above the gel image.
    Rna Concentrations, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 126 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna concentrations/product/Promega
    Average 93 stars, based on 126 article reviews
    Price from $9.99 to $1999.99
    rna concentrations - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    91
    BioSpec rna concentration
    Time-dependent fragmentation of RNAs from UV-crosslinked <t>BMV</t> virions The image shown is from ethidium bromide-stained agarose gel containing 100 μg BMV virions that were resuspended in 150 μl Tris buffer (pH: 7.0) containing 10 Mm ZnCl 2 , and heated at 70 °C to fragment BMV <t>RNA</t> for the time indicated above the gel image.
    Rna Concentration, supplied by BioSpec, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna concentration/product/BioSpec
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rna concentration - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    87
    SPECTRO Analytical rna concentrations
    Time-dependent fragmentation of RNAs from UV-crosslinked <t>BMV</t> virions The image shown is from ethidium bromide-stained agarose gel containing 100 μg BMV virions that were resuspended in 150 μl Tris buffer (pH: 7.0) containing 10 Mm ZnCl 2 , and heated at 70 °C to fragment BMV <t>RNA</t> for the time indicated above the gel image.
    Rna Concentrations, supplied by SPECTRO Analytical, used in various techniques. Bioz Stars score: 87/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna concentrations/product/SPECTRO Analytical
    Average 87 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    rna concentrations - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    96
    Illumina Inc rna concentrations
    Time-dependent fragmentation of RNAs from UV-crosslinked <t>BMV</t> virions The image shown is from ethidium bromide-stained agarose gel containing 100 μg BMV virions that were resuspended in 150 μl Tris buffer (pH: 7.0) containing 10 Mm ZnCl 2 , and heated at 70 °C to fragment BMV <t>RNA</t> for the time indicated above the gel image.
    Rna Concentrations, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 43 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna concentrations/product/Illumina Inc
    Average 96 stars, based on 43 article reviews
    Price from $9.99 to $1999.99
    rna concentrations - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    81
    Gen-Probe rna concentrations
    Time-dependent fragmentation of RNAs from UV-crosslinked <t>BMV</t> virions The image shown is from ethidium bromide-stained agarose gel containing 100 μg BMV virions that were resuspended in 150 μl Tris buffer (pH: 7.0) containing 10 Mm ZnCl 2 , and heated at 70 °C to fragment BMV <t>RNA</t> for the time indicated above the gel image.
    Rna Concentrations, supplied by Gen-Probe, used in various techniques. Bioz Stars score: 81/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna concentrations/product/Gen-Probe
    Average 81 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    rna concentrations - by Bioz Stars, 2020-04
    81/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology ribonucleic acid sirna
    Alteration of phosphorylation on AKT came with <t>MTDH</t> expression (A and B); extra-/intracellular VEGF expression was reduced according to different concentration of AKT <t>siRNA</t> treatment (C and D); VEGF expression was attenuated in extra-/intracellular after PI3K/Akt inhibitor LY294002 stimulation (E and F); ● Control siRNA had added for vector control. ∗ P
    Ribonucleic Acid Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ribonucleic acid sirna/product/Santa Cruz Biotechnology
    Average 93 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    ribonucleic acid sirna - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    99
    Zymo Research rna clean concentrator kit
    Alteration of phosphorylation on AKT came with <t>MTDH</t> expression (A and B); extra-/intracellular VEGF expression was reduced according to different concentration of AKT <t>siRNA</t> treatment (C and D); VEGF expression was attenuated in extra-/intracellular after PI3K/Akt inhibitor LY294002 stimulation (E and F); ● Control siRNA had added for vector control. ∗ P
    Rna Clean Concentrator Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 766 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna clean concentrator kit/product/Zymo Research
    Average 99 stars, based on 766 article reviews
    Price from $9.99 to $1999.99
    rna clean concentrator kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Zymo Research concentrator
    Alteration of phosphorylation on AKT came with <t>MTDH</t> expression (A and B); extra-/intracellular VEGF expression was reduced according to different concentration of AKT <t>siRNA</t> treatment (C and D); VEGF expression was attenuated in extra-/intracellular after PI3K/Akt inhibitor LY294002 stimulation (E and F); ● Control siRNA had added for vector control. ∗ P
    Concentrator, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 625 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/concentrator/product/Zymo Research
    Average 99 stars, based on 625 article reviews
    Price from $9.99 to $1999.99
    concentrator - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Zymo Research concentrator 100
    Alteration of phosphorylation on AKT came with <t>MTDH</t> expression (A and B); extra-/intracellular VEGF expression was reduced according to different concentration of AKT <t>siRNA</t> treatment (C and D); VEGF expression was attenuated in extra-/intracellular after PI3K/Akt inhibitor LY294002 stimulation (E and F); ● Control siRNA had added for vector control. ∗ P
    Concentrator 100, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/concentrator 100/product/Zymo Research
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    concentrator 100 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Zymo Research ssdna rna clean concentrator
    Alteration of phosphorylation on AKT came with <t>MTDH</t> expression (A and B); extra-/intracellular VEGF expression was reduced according to different concentration of AKT <t>siRNA</t> treatment (C and D); VEGF expression was attenuated in extra-/intracellular after PI3K/Akt inhibitor LY294002 stimulation (E and F); ● Control siRNA had added for vector control. ∗ P
    Ssdna Rna Clean Concentrator, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ssdna rna clean concentrator/product/Zymo Research
    Average 99 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    ssdna rna clean concentrator - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    92
    Roche hiv 1 rna concentrations
    Linearity plot of mean Abbott m 2000 rt RealTi me ™ <t>HIV-1</t> <t>RNA</t> level against known samples determined by the ROCHE COBAS® AmpliPrep™/AMPLICORTM HIV-1 MONITOR® v1.5
    Hiv 1 Rna Concentrations, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hiv 1 rna concentrations/product/Roche
    Average 92 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    hiv 1 rna concentrations - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    Image Search Results


    Determining negative and positive RNA controls for EZH2 interactions. EZH2 reportedly binds many RNAs without well-defined protein-binding motifs. As a negative control, a nonrelated Renilla luciferase transcript was tested that did show some affinity for the EZH2 protein in the ( A ) Alphascreen assay ( n = 3) as well as in the ( B ) RNA EMSA assay. This finding is consistent with reports of EZH2 promiscuity, including the ability of this enzyme to bind nonmammalian transcripts with low affinity. 16 ( C ) The ability of biotinylated lncRNAs BDNF -AS and HOTAIR to interact with EZH2 is measured in the AlphaScreen assay. Both lncRNAs are titrated in EZH2 (4 nM). EZH2 interacts with both lncRNAs in a concentration-dependent manner ( n = 3). HOTAIR serves as a positive RNA control and biologically important screen.

    Journal: Journal of Biomolecular Screening

    Article Title: Screening for Small-Molecule Modulators of Long Noncoding RNA-Protein Interactions Using AlphaScreen

    doi: 10.1177/1087057115594187

    Figure Lengend Snippet: Determining negative and positive RNA controls for EZH2 interactions. EZH2 reportedly binds many RNAs without well-defined protein-binding motifs. As a negative control, a nonrelated Renilla luciferase transcript was tested that did show some affinity for the EZH2 protein in the ( A ) Alphascreen assay ( n = 3) as well as in the ( B ) RNA EMSA assay. This finding is consistent with reports of EZH2 promiscuity, including the ability of this enzyme to bind nonmammalian transcripts with low affinity. 16 ( C ) The ability of biotinylated lncRNAs BDNF -AS and HOTAIR to interact with EZH2 is measured in the AlphaScreen assay. Both lncRNAs are titrated in EZH2 (4 nM). EZH2 interacts with both lncRNAs in a concentration-dependent manner ( n = 3). HOTAIR serves as a positive RNA control and biologically important screen.

    Article Snippet: The RNA was allowed to interact with EZH2 for 20 min at 37 °C before the samples were run on a 0.5% agarose (Sigma-Aldrich, St. Louis, MO, cat No. A0576) gel for 2 h at 4 °C and 90 V in 0.5 X TBE.

    Techniques: Protein Binding, Negative Control, Luciferase, Amplified Luminescent Proximity Homogenous Assay, Concentration Assay

    ( A ) Mechanism of the BDNF -AS–EZH2 interaction. The BDNF -AS transcript interacts with EZH2 (RNA-protein interaction), guiding this ubiquitously expressed epigenetic enzyme to the BDNF locus (RNA-chromatin interaction) where EZH2 is able to epigenetically silence BDNF gene expression. Inhibition of the BDNF -AS–EZH2 interaction can prevent EZH2 recruitment to the BDNF promoter and results in up-regulation of the BDNF gene. ( B ) Schematic of AlphaScreen adapted to quantify lncRNA-protein interactions. Following the incubation of biotinylated long noncoding RNA BDNF -AS with Flag-tagged EZH2 protein, anti-flag tagged acceptor beads and streptavidin-coated donor beads are added to each well. Upon excitation of the donor beads at 680 nm, ambient oxygen is elevated to an excited state and excites nearby acceptor beads, resulting in a measurable emission at 570 nm that is used to quantify the assay.

    Journal: Journal of Biomolecular Screening

    Article Title: Screening for Small-Molecule Modulators of Long Noncoding RNA-Protein Interactions Using AlphaScreen

    doi: 10.1177/1087057115594187

    Figure Lengend Snippet: ( A ) Mechanism of the BDNF -AS–EZH2 interaction. The BDNF -AS transcript interacts with EZH2 (RNA-protein interaction), guiding this ubiquitously expressed epigenetic enzyme to the BDNF locus (RNA-chromatin interaction) where EZH2 is able to epigenetically silence BDNF gene expression. Inhibition of the BDNF -AS–EZH2 interaction can prevent EZH2 recruitment to the BDNF promoter and results in up-regulation of the BDNF gene. ( B ) Schematic of AlphaScreen adapted to quantify lncRNA-protein interactions. Following the incubation of biotinylated long noncoding RNA BDNF -AS with Flag-tagged EZH2 protein, anti-flag tagged acceptor beads and streptavidin-coated donor beads are added to each well. Upon excitation of the donor beads at 680 nm, ambient oxygen is elevated to an excited state and excites nearby acceptor beads, resulting in a measurable emission at 570 nm that is used to quantify the assay.

    Article Snippet: The RNA was allowed to interact with EZH2 for 20 min at 37 °C before the samples were run on a 0.5% agarose (Sigma-Aldrich, St. Louis, MO, cat No. A0576) gel for 2 h at 4 °C and 90 V in 0.5 X TBE.

    Techniques: Expressing, Inhibition, Amplified Luminescent Proximity Homogenous Assay, Incubation

    Optimization of AlphaScreen assay conditions. ( A ) Long noncoding RNA and protein concentrations were optimized by titrating BDNF -AS in fixed concentrations of EZH2 protein. The hook effect was observed at all concentrations of protein, and therefore, the maximal signal or the hook point is graphed. Data represent triplicates of a single experiment that was repeated three independent times. ( B ) AlphaScreen acceptor and donor beads were cross-titrated to determine optimal bead concentrations to produce maximal assay signal ( n = 3).

    Journal: Journal of Biomolecular Screening

    Article Title: Screening for Small-Molecule Modulators of Long Noncoding RNA-Protein Interactions Using AlphaScreen

    doi: 10.1177/1087057115594187

    Figure Lengend Snippet: Optimization of AlphaScreen assay conditions. ( A ) Long noncoding RNA and protein concentrations were optimized by titrating BDNF -AS in fixed concentrations of EZH2 protein. The hook effect was observed at all concentrations of protein, and therefore, the maximal signal or the hook point is graphed. Data represent triplicates of a single experiment that was repeated three independent times. ( B ) AlphaScreen acceptor and donor beads were cross-titrated to determine optimal bead concentrations to produce maximal assay signal ( n = 3).

    Article Snippet: The RNA was allowed to interact with EZH2 for 20 min at 37 °C before the samples were run on a 0.5% agarose (Sigma-Aldrich, St. Louis, MO, cat No. A0576) gel for 2 h at 4 °C and 90 V in 0.5 X TBE.

    Techniques: Amplified Luminescent Proximity Homogenous Assay

    Secondary assays to test the effect of ellipticine on the target of BDNF -AS–EZH2, BDNF, in vitro. ( A ) HEK293 cells were treated for 48 h with ellipticine (1 µM) before RNA was extracted to measure changes in BDNF gene expression normalized to GAPDH (~threefold up-regulation in BDNF mRNA, p

    Journal: Journal of Biomolecular Screening

    Article Title: Screening for Small-Molecule Modulators of Long Noncoding RNA-Protein Interactions Using AlphaScreen

    doi: 10.1177/1087057115594187

    Figure Lengend Snippet: Secondary assays to test the effect of ellipticine on the target of BDNF -AS–EZH2, BDNF, in vitro. ( A ) HEK293 cells were treated for 48 h with ellipticine (1 µM) before RNA was extracted to measure changes in BDNF gene expression normalized to GAPDH (~threefold up-regulation in BDNF mRNA, p

    Article Snippet: The RNA was allowed to interact with EZH2 for 20 min at 37 °C before the samples were run on a 0.5% agarose (Sigma-Aldrich, St. Louis, MO, cat No. A0576) gel for 2 h at 4 °C and 90 V in 0.5 X TBE.

    Techniques: In Vitro, Expressing

    Experimental Evaluation of RNA Target Knockdown in HeLa Cells (A) For each gapmer a sigmoidal concentration-response curve was fitted to the measured mRNA levels. Red lines indicate gapmers targeting repeated regions. Blue lines indicate gapmer targeting non-repeated, single regions. Dashed lines and gray box indicate ± 2 SD of mRNA levels of PBS controls. All data points can be found in Table S3 . (B and C) Barplots for average and SD of EC 50 (B) and maximal knockdown efficacy (C) as estimated from the fitted CRCs. For each target, the most potent and efficacious gapmers targeting repeated (red bars) and non-repeated regions (blue bar) were chosen, and the significance of the differences between them was evaluated using a Z test for EC 50 estimates and a t test for efficacy estimates. *p

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: Targeting Repeated Regions Unique to a Gene Is an Effective Strategy for Discovering Potent and Efficacious Antisense Oligonucleotides

    doi: 10.1016/j.omtn.2019.10.040

    Figure Lengend Snippet: Experimental Evaluation of RNA Target Knockdown in HeLa Cells (A) For each gapmer a sigmoidal concentration-response curve was fitted to the measured mRNA levels. Red lines indicate gapmers targeting repeated regions. Blue lines indicate gapmer targeting non-repeated, single regions. Dashed lines and gray box indicate ± 2 SD of mRNA levels of PBS controls. All data points can be found in Table S3 . (B and C) Barplots for average and SD of EC 50 (B) and maximal knockdown efficacy (C) as estimated from the fitted CRCs. For each target, the most potent and efficacious gapmers targeting repeated (red bars) and non-repeated regions (blue bar) were chosen, and the significance of the differences between them was evaluated using a Z test for EC 50 estimates and a t test for efficacy estimates. *p

    Article Snippet: RNA Analysis by qRT-PCR in HeLa Cells The HeLa cell line was purchased from the European Collection of Authenticated Cell Cultures (through Sigma-Aldrich, Denmark) and maintained as recommended by the supplier in a humidified incubator at 37°C with 5% CO2 .

    Techniques: Concentration Assay

    Expression profiles in tick starvation and after injections of lysine and saccharopine. Total RNA was pooled from the same concentration of RNA samples from starved ticks. The RT-PCR results shown are representative of 3 independent experiments with the same protocol. A. m3, females starved for 3 months; m6, females starved for 6 months; m10, females starved for 10 months. B. Effect of injections of synthetic L-lysine and saccharopine on LKR/SDH gene expression. Ticks starved for 1 month were injected with synthetic L-lysine (50 mM solution of L-lysine 0.5 µl/tick), L- Saccharopine (20 mM solution L-saccharopine 0.5 µl/tick) and PBS (0.5 µl/tick), respectively. Mg; midguts; Sg, salivary glands; Ov, ovaries; Fb, fat bodies. The data are expressed as the ratio of the density of LKR/SDH to the density of actin gene products from the same template. The RT-PCR results shown are representative of 3 to 4 independent experiments with the same protocol.

    Journal: PLoS ONE

    Article Title: LKR/SDH Plays Important Roles throughout the Tick Life Cycle Including a Long Starvation Period

    doi: 10.1371/journal.pone.0007136

    Figure Lengend Snippet: Expression profiles in tick starvation and after injections of lysine and saccharopine. Total RNA was pooled from the same concentration of RNA samples from starved ticks. The RT-PCR results shown are representative of 3 independent experiments with the same protocol. A. m3, females starved for 3 months; m6, females starved for 6 months; m10, females starved for 10 months. B. Effect of injections of synthetic L-lysine and saccharopine on LKR/SDH gene expression. Ticks starved for 1 month were injected with synthetic L-lysine (50 mM solution of L-lysine 0.5 µl/tick), L- Saccharopine (20 mM solution L-saccharopine 0.5 µl/tick) and PBS (0.5 µl/tick), respectively. Mg; midguts; Sg, salivary glands; Ov, ovaries; Fb, fat bodies. The data are expressed as the ratio of the density of LKR/SDH to the density of actin gene products from the same template. The RT-PCR results shown are representative of 3 to 4 independent experiments with the same protocol.

    Article Snippet: RNA isolation and Semiquantitative RT-PCR expression analysis Total RNA was extracted from whole bodies of ticks at each developmental stage and from dissected salivary glands, midgut, ovary, fat body with trachea, and hemolymph of unfed, partially engorged and fully engorged ticks using TRI reagent (Sigma-Aldrich) to determine stage and tissue distribution profiles of LKR/SDH.

    Techniques: Expressing, Concentration Assay, Reverse Transcription Polymerase Chain Reaction, Injection

    Time courses for the formation of SAH (blue triangles), 5’-dA (red circles), ms 2 i 6 A (black triangles) and d 3 -ms 2 i 6 A (green triangles) upon ( A ) initial incubation of 150 μM Tm MiaB with a stoichiometric concentration of SAM in the absence of dithionite followed by ( B ) introduction of excess (500 μM) [ methyl - d 3 ]-SAM, 130 μM i 6 A ACSL RNA, and 1 mM dithionite in 50 mM Tris-HCl pH 7.5. The lines are fits to a first-order single-exponential equation, with the following obtained kinetic parameters: ( A ) SAH formation: A = 110 ± 4 μM, ν = 8.5 ± 1.3 min −1 ( B ) 5’-dA formation: A = 105 ± 3 μM, ν = 5.7 ± 0.7 μM min −1 ; SAH formation: A = 230 ± 3 μM, ν = 9.7 ± 0.8 μM min −1 ; ms 2 i 6 A formation: A = 40 ± 1 μM, ν = 11.6 ± 2.6 μM min −1 ; d 3 -ms 2 i 6 A formation: A = 48 ± 2 μM, ν = 1.3 ± 0.2 μM min −1 .

    Journal: Journal of the American Chemical Society

    Article Title: Identification of an Intermediate Methyl Carrier in the Radical SAM Methylthiotransferases, RimO and MiaB

    doi: 10.1021/ja4048448

    Figure Lengend Snippet: Time courses for the formation of SAH (blue triangles), 5’-dA (red circles), ms 2 i 6 A (black triangles) and d 3 -ms 2 i 6 A (green triangles) upon ( A ) initial incubation of 150 μM Tm MiaB with a stoichiometric concentration of SAM in the absence of dithionite followed by ( B ) introduction of excess (500 μM) [ methyl - d 3 ]-SAM, 130 μM i 6 A ACSL RNA, and 1 mM dithionite in 50 mM Tris-HCl pH 7.5. The lines are fits to a first-order single-exponential equation, with the following obtained kinetic parameters: ( A ) SAH formation: A = 110 ± 4 μM, ν = 8.5 ± 1.3 min −1 ( B ) 5’-dA formation: A = 105 ± 3 μM, ν = 5.7 ± 0.7 μM min −1 ; SAH formation: A = 230 ± 3 μM, ν = 9.7 ± 0.8 μM min −1 ; ms 2 i 6 A formation: A = 40 ± 1 μM, ν = 11.6 ± 2.6 μM min −1 ; d 3 -ms 2 i 6 A formation: A = 48 ± 2 μM, ν = 1.3 ± 0.2 μM min −1 .

    Article Snippet: The ACSL RNA was determined to be completely modified by MiaA, with each mol of RNA containing one mol of i6 A. Quantification was conducted by LC/MS using a standard curve generated from commercially available i6 A (Sigma).

    Techniques: Mass Spectrometry, Incubation, Concentration Assay

    Isotopic distribution of ms 2 i 6 A in assays containing 20 μM Tm MiaB, 100 μM i 6 A ACSL RNA substrate, and 1 mM dithionite in the presence of: ( A ) 500 μM SAM; ( B ) 500 μM d 3 -SAM and 500 μM NaSCH 3 ; and ( C ) 500 μM d 3 -SAM. After 2 h at 37 °C, ( A ) 19.4 μM ms 2 i 6 A was generated in the presence of SAM only ( B ) 11.7 μM ms 2 i 6 A and 9.8 μM d 3 -ms 2 i 6 A were generated in the presence both of SAM and NaSCH 3 , and ( C ) 21.2 μM d 3 -ms 2 i 6 A was generated in the presence of d 3 -SAM only.

    Journal: Journal of the American Chemical Society

    Article Title: Identification of an Intermediate Methyl Carrier in the Radical SAM Methylthiotransferases, RimO and MiaB

    doi: 10.1021/ja4048448

    Figure Lengend Snippet: Isotopic distribution of ms 2 i 6 A in assays containing 20 μM Tm MiaB, 100 μM i 6 A ACSL RNA substrate, and 1 mM dithionite in the presence of: ( A ) 500 μM SAM; ( B ) 500 μM d 3 -SAM and 500 μM NaSCH 3 ; and ( C ) 500 μM d 3 -SAM. After 2 h at 37 °C, ( A ) 19.4 μM ms 2 i 6 A was generated in the presence of SAM only ( B ) 11.7 μM ms 2 i 6 A and 9.8 μM d 3 -ms 2 i 6 A were generated in the presence both of SAM and NaSCH 3 , and ( C ) 21.2 μM d 3 -ms 2 i 6 A was generated in the presence of d 3 -SAM only.

    Article Snippet: The ACSL RNA was determined to be completely modified by MiaA, with each mol of RNA containing one mol of i6 A. Quantification was conducted by LC/MS using a standard curve generated from commercially available i6 A (Sigma).

    Techniques: Mass Spectrometry, Generated

    OND depletes intracellular ATP levels, inhibits transcription, induces relocation of the cellular polyamine pool to the nucleus and reduces the staining density of histone H3 with antibody. a The intracellular concentration of ATP in untreated, OND-exposed and recovering cells was determined using a luciferase dependent assay. b Global rates of transcription, determined by the incorporation of bromouridine into RNA, in untreated cells, cells under OND and cells recovering from OND are presented. HL-1 cells, either untreated or subjected to 1 hour of OND, were fixed, permeabilized and stained either with anti-polyamine antibody ( c , d ) or with anti-total H3 antibody ( e , f ) and counterstained with the fluorescent DNA binding dye Hoechst 33342. Cells were then examined using confocal microscopy. The content of immunostained histone H3 was evaluated by SMLM in untreated ( e ) and OND-treated ( f ) HL-1 cells. BrU bromouridine. The error bars represent the standard deviation of three independent samples

    Journal: Genome Biology

    Article Title: A transient ischemic environment induces reversible compaction of chromatin

    doi: 10.1186/s13059-015-0802-2

    Figure Lengend Snippet: OND depletes intracellular ATP levels, inhibits transcription, induces relocation of the cellular polyamine pool to the nucleus and reduces the staining density of histone H3 with antibody. a The intracellular concentration of ATP in untreated, OND-exposed and recovering cells was determined using a luciferase dependent assay. b Global rates of transcription, determined by the incorporation of bromouridine into RNA, in untreated cells, cells under OND and cells recovering from OND are presented. HL-1 cells, either untreated or subjected to 1 hour of OND, were fixed, permeabilized and stained either with anti-polyamine antibody ( c , d ) or with anti-total H3 antibody ( e , f ) and counterstained with the fluorescent DNA binding dye Hoechst 33342. Cells were then examined using confocal microscopy. The content of immunostained histone H3 was evaluated by SMLM in untreated ( e ) and OND-treated ( f ) HL-1 cells. BrU bromouridine. The error bars represent the standard deviation of three independent samples

    Article Snippet: Bromouridine labeling of nascent RNA Newly synthesized RNA was pulse labeled by incubating confluent 10-cm culture dishes with 2 mM bromouridine (BrU; Sigma Aldrich) for 1 hour, either under normal culture conditions, under OND, or after 1 hour of recovery from OND.

    Techniques: Staining, Concentration Assay, Luciferase, Binding Assay, Confocal Microscopy, Standard Deviation

    Growth of Nm in human whole blood and RNA analysis. ( A ) Number of bacteria during incubation with human blood. The CFU/ml per single donor is shown during a time course experiment. ( B ) Analysis of isolated total RNA and enriched Nm RNA using a BioAnalyzer 2100 (Agilent). Upper panel: Total RNA collected from Nm incubated in human whole blood, bacterial RNA (shaded arrowheads) and eukaryotic RNA (open arrowheads) are indicated. Lower panel: Enriched bacterial RNA.

    Journal: PLoS Pathogens

    Article Title: Transcriptome Analysis of Neisseria meningitidis in Human Whole Blood and Mutagenesis Studies Identify Virulence Factors Involved in Blood Survival

    doi: 10.1371/journal.ppat.1002027

    Figure Lengend Snippet: Growth of Nm in human whole blood and RNA analysis. ( A ) Number of bacteria during incubation with human blood. The CFU/ml per single donor is shown during a time course experiment. ( B ) Analysis of isolated total RNA and enriched Nm RNA using a BioAnalyzer 2100 (Agilent). Upper panel: Total RNA collected from Nm incubated in human whole blood, bacterial RNA (shaded arrowheads) and eukaryotic RNA (open arrowheads) are indicated. Lower panel: Enriched bacterial RNA.

    Article Snippet: Total RNA (bacterial and eukaryotic RNA) was isolated by enzymatic lysis using lysozyme (Sigma) at 0.4 mg/ml final concentration, vortexed and incubated at room temperature for 5 minutes.

    Techniques: Incubation, Isolation

    miR-302 modulated the resistance of human breast cancer cells to chemotherapeutic drugs. a qRT-PCR showing the relative expression of miR-302a/b/c/d in untreated MCF-7 and MCF-7/ADR cells (Blank), cells treated with miR-302a,b,c,d mimics (a final concentration of 20nM) or the four miRNAs mimic combination (miR-302S,the miRNAs mixed with miR-302a, miR-302b, miR-302c and miR-302d mimics by same concentration (4 × 5nM = 20nM) and negative controls (NC). b Following untransfection (Blank), transfection with either of the negative control RNA (NC) or miR-302 mimic, cells were treated with various concentrations of ADR, PAC and VP-16 for 48 h, respectively. The effect of the miR-302 mimic on the viability of MCF-7 cells and MCF-7/ADR in response to the three chemotherapeutic drugs was determined using the MTS assay. n = 3 (* P

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    Article Title: MiR-302a/b/c/d cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein(P-gp) by targeting MAP/ERK kinase kinase 1 (MEKK1)

    doi: 10.1186/s13046-016-0300-8

    Figure Lengend Snippet: miR-302 modulated the resistance of human breast cancer cells to chemotherapeutic drugs. a qRT-PCR showing the relative expression of miR-302a/b/c/d in untreated MCF-7 and MCF-7/ADR cells (Blank), cells treated with miR-302a,b,c,d mimics (a final concentration of 20nM) or the four miRNAs mimic combination (miR-302S,the miRNAs mixed with miR-302a, miR-302b, miR-302c and miR-302d mimics by same concentration (4 × 5nM = 20nM) and negative controls (NC). b Following untransfection (Blank), transfection with either of the negative control RNA (NC) or miR-302 mimic, cells were treated with various concentrations of ADR, PAC and VP-16 for 48 h, respectively. The effect of the miR-302 mimic on the viability of MCF-7 cells and MCF-7/ADR in response to the three chemotherapeutic drugs was determined using the MTS assay. n = 3 (* P

    Article Snippet: RNA degradation analysis 48 h after MCF-7/ADR cells were transfected with 20 nM miR-302 mimics, actinomycin D (Sigma, CA, USA) was added to a final concentration of 5 mg/mL to block de novo RNA synthesis.

    Techniques: Quantitative RT-PCR, Expressing, Concentration Assay, Transfection, Negative Control, MTS Assay

    Stage and tissue expression profiles of Ixodes ricinus cysteine and aspartic peptidases . Messenger RNA levels of individual enzymes were determined by semi-quantitative two-step RT PCR. Panel A : Expression of peptidase mRNAs in whole body homogenates of I. ricinus eggs, unfed larvae, unfed nymphs, males, unfed females and females attached for 1 day on the guinea pigs. Panel B : Expression of peptidase mRNAs in tissues dissected from partially engorged females (the 5-th day of feeding). The abbreviations used are as in the text. IrFer shows the mRNA amplification of tick ferritin used as template loading control. (For details, see Methods).

    Journal: Parasites & Vectors

    Article Title: Profiling of proteolytic enzymes in the gut of the tick Ixodes ricinus reveals an evolutionarily conserved network of aspartic and cysteine peptidases

    doi: 10.1186/1756-3305-1-7

    Figure Lengend Snippet: Stage and tissue expression profiles of Ixodes ricinus cysteine and aspartic peptidases . Messenger RNA levels of individual enzymes were determined by semi-quantitative two-step RT PCR. Panel A : Expression of peptidase mRNAs in whole body homogenates of I. ricinus eggs, unfed larvae, unfed nymphs, males, unfed females and females attached for 1 day on the guinea pigs. Panel B : Expression of peptidase mRNAs in tissues dissected from partially engorged females (the 5-th day of feeding). The abbreviations used are as in the text. IrFer shows the mRNA amplification of tick ferritin used as template loading control. (For details, see Methods).

    Article Snippet: Two-step RT-PCR was performed using total RNA templates (prepared as described above; 50 ng/μl final concentration) and the Enhanced Avian HS RT-PCR Kit (Sigma) according to the protocol provided by the manufacturer.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Amplification

    Gcn -  substitutions D1327A/D1327K strengthen HisRS/CTD domain interaction in a manner antagonized by uncharged tRNA. (A)  Yeast two-hybrid analysis of domain interactions. Strain EGY48 carrying the  lexAop-lacZ  reporter plasmid was co-transformed with plasmids encoding lexA-HisRS (Gcn2 residues 970–1497) (with or without the indicated substitutions) and B42-CTD (Gcn2 residues 1497–1659). Strains were cultured and β-galactosidase activities were measured in WCEs.  (B) In vitro  binding of LexA-CTD (Gcn2 residues 1498–1659), expressed in yeast, to GST fusion proteins containing the Gcn2 HisRS domain (residues 970–1497), either WT or containing the indicating mutations. Aliquots of nuclease-treated whole-cell extracts (500 μg of total protein) from transformants of yeast  gcn2 Δ strain HQY132 carrying plasmids containing the LexA-CTD fusion protein were incubated with approximately equivalent amounts of GST or GST-HisRS (970–1497) fusion proteins immobilized on glutathione-Sepharose beads. After extensive washing, LexA fusion proteins bound to the GST proteins were resolved by SDS-PAGE and detected by immunoblot analysis with anti-LexA (Top) and anti-GST (bottom) antibodies. Results from quantification of LexA blots from replicate experiments are summarized in the histogram below as mean percentages of input amounts recovered in the pull-downs.  (C)  Yeast two-hybrid analysis as shown in (A). Samples for β-galactosidase assay were collected from cells under starvation (+) or nonstarvation (-) conditions as described in Materials and Methods. The results shown are averages of activities from three or more individual transformants.  (D)  Yeast two-hybrid analysis of CTD and KD interaction domains in Gcn2. Plasmids pHQ311 and pHQ428 encoding respectively the lexA-CTD(1498–1659) and B42-KD(720–999) segments were co-transformed into strain EGY48 carrying the  lexAop-lacZ  reporter plasmid. Samples for β-galactosidase assay were collected from cells under starvation (+) or nonstarvation (-) conditions. The results shown are averages of activities from three or more individual transformants.  (E and F) In vitro  binding of Gcn2 [ 35 S]-HisRS(970–1497) segment translated  in vitro  to GST fusion proteins containing the Gcn2 KD (568–998), CTD (1498–1659) or HisRS (970–1497) domains. RNA (tRNA Phe  or mRNA) was added to the reaction to the indicated final concentration. The mean fold-reductions in pull-downs of [ 35 S]-HisRS(970–1497) on tRNA Phe  addition were calculated from replicate experiments and presented in the histogram below the gel.

    Journal: PLoS Genetics

    Article Title: Interaction between the tRNA-Binding and C-Terminal Domains of Yeast Gcn2 Regulates Kinase Activity In Vivo

    doi: 10.1371/journal.pgen.1004991

    Figure Lengend Snippet: Gcn - substitutions D1327A/D1327K strengthen HisRS/CTD domain interaction in a manner antagonized by uncharged tRNA. (A) Yeast two-hybrid analysis of domain interactions. Strain EGY48 carrying the lexAop-lacZ reporter plasmid was co-transformed with plasmids encoding lexA-HisRS (Gcn2 residues 970–1497) (with or without the indicated substitutions) and B42-CTD (Gcn2 residues 1497–1659). Strains were cultured and β-galactosidase activities were measured in WCEs. (B) In vitro binding of LexA-CTD (Gcn2 residues 1498–1659), expressed in yeast, to GST fusion proteins containing the Gcn2 HisRS domain (residues 970–1497), either WT or containing the indicating mutations. Aliquots of nuclease-treated whole-cell extracts (500 μg of total protein) from transformants of yeast gcn2 Δ strain HQY132 carrying plasmids containing the LexA-CTD fusion protein were incubated with approximately equivalent amounts of GST or GST-HisRS (970–1497) fusion proteins immobilized on glutathione-Sepharose beads. After extensive washing, LexA fusion proteins bound to the GST proteins were resolved by SDS-PAGE and detected by immunoblot analysis with anti-LexA (Top) and anti-GST (bottom) antibodies. Results from quantification of LexA blots from replicate experiments are summarized in the histogram below as mean percentages of input amounts recovered in the pull-downs. (C) Yeast two-hybrid analysis as shown in (A). Samples for β-galactosidase assay were collected from cells under starvation (+) or nonstarvation (-) conditions as described in Materials and Methods. The results shown are averages of activities from three or more individual transformants. (D) Yeast two-hybrid analysis of CTD and KD interaction domains in Gcn2. Plasmids pHQ311 and pHQ428 encoding respectively the lexA-CTD(1498–1659) and B42-KD(720–999) segments were co-transformed into strain EGY48 carrying the lexAop-lacZ reporter plasmid. Samples for β-galactosidase assay were collected from cells under starvation (+) or nonstarvation (-) conditions. The results shown are averages of activities from three or more individual transformants. (E and F) In vitro binding of Gcn2 [ 35 S]-HisRS(970–1497) segment translated in vitro to GST fusion proteins containing the Gcn2 KD (568–998), CTD (1498–1659) or HisRS (970–1497) domains. RNA (tRNA Phe or mRNA) was added to the reaction to the indicated final concentration. The mean fold-reductions in pull-downs of [ 35 S]-HisRS(970–1497) on tRNA Phe addition were calculated from replicate experiments and presented in the histogram below the gel.

    Article Snippet: Five microliters of [35 S]-HisRS domain fragments were added to beads (10-μL bed volume) containing 5 μg of bound GST fusion proteins along with the indicated amount of tRNAPhe (Sigma-Aldrich, # R4018), or synthetic mRNA (GGAAUCUCUCUCUCUCUCUCUGCUCUCUCUCUCUCUCUCUCUC) synthesized by T7 polymerase as described in [ ], and the volume was increased to 200 μL with buffer A.

    Techniques: Plasmid Preparation, Transformation Assay, Cell Culture, In Vitro, Binding Assay, Incubation, SDS Page, Concentration Assay

    The α-smooth muscle actin (α-SMA) is highly expressed in TAFs at early passages, as revealed by immunohistochemistry (A) on cells grown in 4-well chamber slides and stained with a specific anti-human SMA antibody (clone 1A4), and by qRT-PCR with cDNA samples obtained from total RNA extracted from cells (right panel, bottom graph). However, α-SMA expression decreases significantly in the older passages (B and right panel, bottom graph). α-SMA expression is also much stronger in TAFs at early passages compared to the MSCs (C) and the other fibroblasts (qRT-PCR; right panel, upper graph).

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: Tumour-associated fibroblasts and mesenchymal stem cells: more similarities than differences

    doi: 10.1111/j.1582-4934.2010.01044.x

    Figure Lengend Snippet: The α-smooth muscle actin (α-SMA) is highly expressed in TAFs at early passages, as revealed by immunohistochemistry (A) on cells grown in 4-well chamber slides and stained with a specific anti-human SMA antibody (clone 1A4), and by qRT-PCR with cDNA samples obtained from total RNA extracted from cells (right panel, bottom graph). However, α-SMA expression decreases significantly in the older passages (B and right panel, bottom graph). α-SMA expression is also much stronger in TAFs at early passages compared to the MSCs (C) and the other fibroblasts (qRT-PCR; right panel, upper graph).

    Article Snippet: RNA extraction and qRT-PCR Total RNA extraction was conducted at different passages from cultured cells using GenElute™ Mammalian Total RNA Miniprep Kit (Sigma), and RNA concentration was measured on a Nanodrop ND-1000 (Wilmington, DE, USA) spectrophotometer.

    Techniques: Immunohistochemistry, Staining, Quantitative RT-PCR, Expressing

    Overexpressed tRNA Glu from a ΔMnmC E. coli strain. ( a ) HPLC of total extracted tRNA. HPLC buffers: 100 mM Tris pH 8, 50 → 150 mM MgCl 2 . The four major modivariants are labelled 1–4. Each was isolated by HPLC for subsequent MS analysis of modified nucleosides. ( b ) Representative purified tRNA (tRNA 5, see below) after anion-exchange purifications at pH 5 and 8. HPLC buffers: 100 mM Tris pH 8, 50 mM MgCl 2 , 0 → 500 mM NaCl. [Note: The MgCl 2 and NaCl gradients in (a) and (b) were used interchangeably for analytical purposes] ( c ) Diagrams showing the modified nucleosides present in tRNAs 1–5 and those present in tRNAs 5 and 6, the products of reaction of tRNA 1 with MnmC (see below). Nucleosides labelled in red (or orange or yellow) were identified by MS ( Figure 2 and Supplementary Figure S1 ). The presence of nucleosides labelled in grey was not confirmed. tRNA 1 contains cmnm 5 s 2 U 34 and all other expected modifications, while tRNA 2–4 are less fully modified at anticodon–stem loop postions as shown. The nm 5 s 2 U and mnm 5 s 2 U modifications obtained by reaction with MnmC are shown in orange and yellow, respectively, to differentiate from cmnm 5 s 2 U.

    Journal: Nucleic Acids Research

    Article Title: Assay of both activities of the bifunctional tRNA-modifying enzyme MnmC reveals a kinetic basis for selective full modification of cmnm5s2U to mnm5s2U

    doi: 10.1093/nar/gkr071

    Figure Lengend Snippet: Overexpressed tRNA Glu from a ΔMnmC E. coli strain. ( a ) HPLC of total extracted tRNA. HPLC buffers: 100 mM Tris pH 8, 50 → 150 mM MgCl 2 . The four major modivariants are labelled 1–4. Each was isolated by HPLC for subsequent MS analysis of modified nucleosides. ( b ) Representative purified tRNA (tRNA 5, see below) after anion-exchange purifications at pH 5 and 8. HPLC buffers: 100 mM Tris pH 8, 50 mM MgCl 2 , 0 → 500 mM NaCl. [Note: The MgCl 2 and NaCl gradients in (a) and (b) were used interchangeably for analytical purposes] ( c ) Diagrams showing the modified nucleosides present in tRNAs 1–5 and those present in tRNAs 5 and 6, the products of reaction of tRNA 1 with MnmC (see below). Nucleosides labelled in red (or orange or yellow) were identified by MS ( Figure 2 and Supplementary Figure S1 ). The presence of nucleosides labelled in grey was not confirmed. tRNA 1 contains cmnm 5 s 2 U 34 and all other expected modifications, while tRNA 2–4 are less fully modified at anticodon–stem loop postions as shown. The nm 5 s 2 U and mnm 5 s 2 U modifications obtained by reaction with MnmC are shown in orange and yellow, respectively, to differentiate from cmnm 5 s 2 U.

    Article Snippet: The first purification was done in buffer F (100 mM NaOAc, pH 5.0, 50 mM MgCl2 ) with a gradient of 205–210 mM NaCl, followed by concentration of the tRNA using an Amicon Ultra 10 000 MWCO centrifugal filter (Millipore) and a further purification in buffer E using a gradient of 205–215 mM NaCl The purified tRNA was exchanged into buffer E and stored at −20°C.

    Techniques: High Performance Liquid Chromatography, Isolation, Mass Spectrometry, Modification, Purification

    HPLCs and Michaelis–Menten plots for each MnmC catalysed reaction. ( a ) Representative HPLC showing complete separation of tRNA 1 from tRNA 5. HPLC gradient: 100 mM Tris, 50 mM MgCl 2 , 175 → 180 mM NaCl over 1 → 20 min. ( b ) Representative HPLC showing partial separation of tRNA 5 from tRNA 6, and calculated peaks for each tRNA. HPLC gradient: 100 mM Tris, 50 mM MgCl 2 , 160 → 165 mM NaCl over 1 → 30 min. ( c ) Michaelis–Menten plot for the FAD-dependent cmnm 5 s 2 U → nm 5 s 2 U demodification. ( d ) Michaelis–Menten plot for the SAM-dependent nm 5 s 2 U → mnm 5 s 2 U methylation. Rates in (c) and (d) represent the amount of substrate formed in a 40 µl reaction per minute per milligram enzyme.

    Journal: Nucleic Acids Research

    Article Title: Assay of both activities of the bifunctional tRNA-modifying enzyme MnmC reveals a kinetic basis for selective full modification of cmnm5s2U to mnm5s2U

    doi: 10.1093/nar/gkr071

    Figure Lengend Snippet: HPLCs and Michaelis–Menten plots for each MnmC catalysed reaction. ( a ) Representative HPLC showing complete separation of tRNA 1 from tRNA 5. HPLC gradient: 100 mM Tris, 50 mM MgCl 2 , 175 → 180 mM NaCl over 1 → 20 min. ( b ) Representative HPLC showing partial separation of tRNA 5 from tRNA 6, and calculated peaks for each tRNA. HPLC gradient: 100 mM Tris, 50 mM MgCl 2 , 160 → 165 mM NaCl over 1 → 30 min. ( c ) Michaelis–Menten plot for the FAD-dependent cmnm 5 s 2 U → nm 5 s 2 U demodification. ( d ) Michaelis–Menten plot for the SAM-dependent nm 5 s 2 U → mnm 5 s 2 U methylation. Rates in (c) and (d) represent the amount of substrate formed in a 40 µl reaction per minute per milligram enzyme.

    Article Snippet: The first purification was done in buffer F (100 mM NaOAc, pH 5.0, 50 mM MgCl2 ) with a gradient of 205–210 mM NaCl, followed by concentration of the tRNA using an Amicon Ultra 10 000 MWCO centrifugal filter (Millipore) and a further purification in buffer E using a gradient of 205–215 mM NaCl The purified tRNA was exchanged into buffer E and stored at −20°C.

    Techniques: High Performance Liquid Chromatography, Methylation

    Relative DEPTOR expression was measured by qPCR in MDAH-2774 cells treated with Rap (A, 20 and 100 nM), Eve (B, 20 and 100 nM), Def (C, 100 and 1,000 nM), Tem (D, 10 nM and 100 nM), Res (E, 25 and 50 µ M), BEZ (F, 10 and 100 nM) and carrier (DMSO) only control for 48 and 72 h. cDNA was synthesised from extracted RNA from 3 biological replicates for each condition * P

    Journal: International Journal of Molecular Medicine

    Article Title: Differential expression of mTOR components in endometriosis and ovarian cancer: Effects of rapalogues and dual kinase inhibitors on mTORC1 and mTORC2 stoichiometry

    doi: 10.3892/ijmm.2018.3967

    Figure Lengend Snippet: Relative DEPTOR expression was measured by qPCR in MDAH-2774 cells treated with Rap (A, 20 and 100 nM), Eve (B, 20 and 100 nM), Def (C, 100 and 1,000 nM), Tem (D, 10 nM and 100 nM), Res (E, 25 and 50 µ M), BEZ (F, 10 and 100 nM) and carrier (DMSO) only control for 48 and 72 h. cDNA was synthesised from extracted RNA from 3 biological replicates for each condition * P

    Article Snippet: RNA isolation, cDNA synthesis and quantitative RT-PCR RNA was extracted from tissue lysate using the GenElute™ mRNA MiniPrep kit (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). cDNA was synthesised from mRNA using Superscript II (Invitrogen; Thermo Fisher Scientific, Massachusetts, MN, USA). cDNA concentration was normalised using RNA concentrations determined by NanoDrop (Thermo Fisher Scientific, Pittsburgh, PA, USA).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Transmission Electron Microscopy

    Subtraction of DNA, RNA and protein spectra from the spect1 for positions 1 and 2. DNA, RNA and protein stack-files were subtracted sequentially from spect1 resulting in spect2D, spect2R and spect3, respectively. C, N, and O are photon energy regions of the K absorption edges for carbon, nitrogen and oxygen. Location of the positions 1 (green) and 2 (blue) were shown in the lower figure. Spect2D in the position 1 was not appeared in the figure.

    Journal: Journal of X-Ray Science and Technology

    Article Title: Discrimination of DNA and RNA distribution in a mammalian cell by scanning transmission soft X-ray microscopy

    doi: 10.3233/XST-180392

    Figure Lengend Snippet: Subtraction of DNA, RNA and protein spectra from the spect1 for positions 1 and 2. DNA, RNA and protein stack-files were subtracted sequentially from spect1 resulting in spect2D, spect2R and spect3, respectively. C, N, and O are photon energy regions of the K absorption edges for carbon, nitrogen and oxygen. Location of the positions 1 (green) and 2 (blue) were shown in the lower figure. Spect2D in the position 1 was not appeared in the figure.

    Article Snippet: Calf thymus DNA, calf liver RNA and bovine serum albumin (BSA) were purchased from Sigma-Aldrich Co., dissolved in water at the concentration of 2 mg/ml, dropped on a silicon nitride membrane and dried.

    Techniques:

    Soft X-ray absorption spectra of DNA, RNA and BSA at the photon energy regions of carbon, nitrogen and oxygen K absorption edge. Each spectrum was adjusted to be the same level at the left end of the photon energy.

    Journal: Journal of X-Ray Science and Technology

    Article Title: Discrimination of DNA and RNA distribution in a mammalian cell by scanning transmission soft X-ray microscopy

    doi: 10.3233/XST-180392

    Figure Lengend Snippet: Soft X-ray absorption spectra of DNA, RNA and BSA at the photon energy regions of carbon, nitrogen and oxygen K absorption edge. Each spectrum was adjusted to be the same level at the left end of the photon energy.

    Article Snippet: Calf thymus DNA, calf liver RNA and bovine serum albumin (BSA) were purchased from Sigma-Aldrich Co., dissolved in water at the concentration of 2 mg/ml, dropped on a silicon nitride membrane and dried.

    Techniques:

    RGB expression and optical density expression at the photon energy of 398 eV with gray scale of the CHO image. For RGB expression (a), DNA, RNA and protein are displayed as red, green and blue, respectively. Original (spect1) absorption image (b), DNA image (c), RNA image (d), protein image (e) and residual (spect3) image (f) at the photon energy of 398 eV are displayed with the gray scale of optical density.

    Journal: Journal of X-Ray Science and Technology

    Article Title: Discrimination of DNA and RNA distribution in a mammalian cell by scanning transmission soft X-ray microscopy

    doi: 10.3233/XST-180392

    Figure Lengend Snippet: RGB expression and optical density expression at the photon energy of 398 eV with gray scale of the CHO image. For RGB expression (a), DNA, RNA and protein are displayed as red, green and blue, respectively. Original (spect1) absorption image (b), DNA image (c), RNA image (d), protein image (e) and residual (spect3) image (f) at the photon energy of 398 eV are displayed with the gray scale of optical density.

    Article Snippet: Calf thymus DNA, calf liver RNA and bovine serum albumin (BSA) were purchased from Sigma-Aldrich Co., dissolved in water at the concentration of 2 mg/ml, dropped on a silicon nitride membrane and dried.

    Techniques: Expressing

    DNA (a) and RNA (b) images obtained by the SVD method in aXis2000 program. The scale bar is 5 μ m.

    Journal: Journal of X-Ray Science and Technology

    Article Title: Discrimination of DNA and RNA distribution in a mammalian cell by scanning transmission soft X-ray microscopy

    doi: 10.3233/XST-180392

    Figure Lengend Snippet: DNA (a) and RNA (b) images obtained by the SVD method in aXis2000 program. The scale bar is 5 μ m.

    Article Snippet: Calf thymus DNA, calf liver RNA and bovine serum albumin (BSA) were purchased from Sigma-Aldrich Co., dissolved in water at the concentration of 2 mg/ml, dropped on a silicon nitride membrane and dried.

    Techniques:

    Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the RNA seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 MCF7 cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p

    Journal: PLoS ONE

    Article Title: Macrophages attenuate the transcription of CYP1A1 in breast tumor cells and enhance their proliferation

    doi: 10.1371/journal.pone.0209694

    Figure Lengend Snippet: Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the RNA seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 MCF7 cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p

    Article Snippet: Briefly, RNA was isolated out of 100 μl MCF7 tumor cell lysates using the RNA Clean and Concentrator-25 kit (Zymo Research). rRNA was removed using the RiboZero Gold rRNA Removal kit (Human/Mouse/Rat, Illumina).

    Techniques: Functional Assay, RNA Sequencing Assay, Incubation

    Tumor cell-specific gene expression changes after macrophage infiltration. (A) Schematic overview of the experimental setup of tumor cell isolation for RNA seq. (B) Purity of tumor cells after removal of CD14 + cells from dissociated tumor spheroids was determined by FACS analysis of tumor cells (EpCAM + ) and immune cells (CD45 + ). Graph is representative of 3 independent experiments. The proportion of immune cells (CD45 + ) was quantified relative to all cells and is given as mean ± SEM (n = 3). (C) Top differentially expressed genes identified by RNA seq analysis of tumor cells from infiltrated relative to non-infiltrated MCF7 tumor spheroids.

    Journal: PLoS ONE

    Article Title: Macrophages attenuate the transcription of CYP1A1 in breast tumor cells and enhance their proliferation

    doi: 10.1371/journal.pone.0209694

    Figure Lengend Snippet: Tumor cell-specific gene expression changes after macrophage infiltration. (A) Schematic overview of the experimental setup of tumor cell isolation for RNA seq. (B) Purity of tumor cells after removal of CD14 + cells from dissociated tumor spheroids was determined by FACS analysis of tumor cells (EpCAM + ) and immune cells (CD45 + ). Graph is representative of 3 independent experiments. The proportion of immune cells (CD45 + ) was quantified relative to all cells and is given as mean ± SEM (n = 3). (C) Top differentially expressed genes identified by RNA seq analysis of tumor cells from infiltrated relative to non-infiltrated MCF7 tumor spheroids.

    Article Snippet: Briefly, RNA was isolated out of 100 μl MCF7 tumor cell lysates using the RNA Clean and Concentrator-25 kit (Zymo Research). rRNA was removed using the RiboZero Gold rRNA Removal kit (Human/Mouse/Rat, Illumina).

    Techniques: Expressing, Cell Isolation, RNA Sequencing Assay, FACS

    Time-dependent fragmentation of RNAs from UV-crosslinked BMV virions The image shown is from ethidium bromide-stained agarose gel containing 100 μg BMV virions that were resuspended in 150 μl Tris buffer (pH: 7.0) containing 10 Mm ZnCl 2 , and heated at 70 °C to fragment BMV RNA for the time indicated above the gel image.

    Journal: Bio-protocol

    Article Title: Mapping RNA Sequences that Contact Viral Capsid Proteins in Virions

    doi: 10.21769/BioProtoc.2398

    Figure Lengend Snippet: Time-dependent fragmentation of RNAs from UV-crosslinked BMV virions The image shown is from ethidium bromide-stained agarose gel containing 100 μg BMV virions that were resuspended in 150 μl Tris buffer (pH: 7.0) containing 10 Mm ZnCl 2 , and heated at 70 °C to fragment BMV RNA for the time indicated above the gel image.

    Article Snippet: Pipette tips (Corning, catalog number: 4154) 6-well clear polystyrene flat-bottomed tissue culture plate (Corning, Falcon® , catalog number: 351146) Polyallomer centrifuge tubes (Beckman Coulter, catalog number: 344060) Polypropylene microcentrifuge tubes and tips that are certified to be Ribonuclease free iBlot™ PVDF membrane (0.2 μm) (Thermo Fisher Scientific, Invitrogen™ , catalog number: IB401001) Razor blade (GEM, catalog number: RB-GEM-080014) 0.22 μm filter (EMD Millipore, catalog number: SCGPU05RE) Zymo RNA Clean & Concentrator (ZYMO RESEARCH, catalog number: R1015) BMV virions purified using cesium chloride density gradients and suspended in SAMA buffer Note: High purity BMV virions can be obtained as described in .

    Techniques: Staining, Agarose Gel Electrophoresis

    Location of the RNA excised from crosslinked BMV coat protein The image is of the membrane following Western blot transfer. The boxes with dashed lines denote the area of the membrane excise with a razor blade.

    Journal: Bio-protocol

    Article Title: Mapping RNA Sequences that Contact Viral Capsid Proteins in Virions

    doi: 10.21769/BioProtoc.2398

    Figure Lengend Snippet: Location of the RNA excised from crosslinked BMV coat protein The image is of the membrane following Western blot transfer. The boxes with dashed lines denote the area of the membrane excise with a razor blade.

    Article Snippet: Pipette tips (Corning, catalog number: 4154) 6-well clear polystyrene flat-bottomed tissue culture plate (Corning, Falcon® , catalog number: 351146) Polyallomer centrifuge tubes (Beckman Coulter, catalog number: 344060) Polypropylene microcentrifuge tubes and tips that are certified to be Ribonuclease free iBlot™ PVDF membrane (0.2 μm) (Thermo Fisher Scientific, Invitrogen™ , catalog number: IB401001) Razor blade (GEM, catalog number: RB-GEM-080014) 0.22 μm filter (EMD Millipore, catalog number: SCGPU05RE) Zymo RNA Clean & Concentrator (ZYMO RESEARCH, catalog number: R1015) BMV virions purified using cesium chloride density gradients and suspended in SAMA buffer Note: High purity BMV virions can be obtained as described in .

    Techniques: Western Blot

    Alteration of phosphorylation on AKT came with MTDH expression (A and B); extra-/intracellular VEGF expression was reduced according to different concentration of AKT siRNA treatment (C and D); VEGF expression was attenuated in extra-/intracellular after PI3K/Akt inhibitor LY294002 stimulation (E and F); ● Control siRNA had added for vector control. ∗ P

    Journal: Medicine

    Article Title: Metadherin Regulation of Vascular Endothelial Growth Factor Expression Is Dependent Upon the PI3K/Akt Pathway in Squamous Cell Carcinoma of the Head and Neck

    doi: 10.1097/MD.0000000000000502

    Figure Lengend Snippet: Alteration of phosphorylation on AKT came with MTDH expression (A and B); extra-/intracellular VEGF expression was reduced according to different concentration of AKT siRNA treatment (C and D); VEGF expression was attenuated in extra-/intracellular after PI3K/Akt inhibitor LY294002 stimulation (E and F); ● Control siRNA had added for vector control. ∗ P

    Article Snippet: Tu686 and 5-8F cells stably expressing MTDH were transiently transfected with AKT or control small interfering ribonucleic acid (siRNA) (SC-43609; SC-37007, purchased from Santa Cruz, CA).

    Techniques: Expressing, Concentration Assay, Plasmid Preparation

    Increasing expression of VEGF in overexpressed MTDH (MTDH cDNA) cells was detected comparing with parental cell (Blank) and vector control (pcDNA) by western blot (A) and ELISA (C and E); reduced VEGF expression was found in MTDH knockdown (shRNA MTDH ) cells compared with parental (Blank) and control cells (shRNA control ) by western blot (B) and ELISA (D and F). ∗ P

    Journal: Medicine

    Article Title: Metadherin Regulation of Vascular Endothelial Growth Factor Expression Is Dependent Upon the PI3K/Akt Pathway in Squamous Cell Carcinoma of the Head and Neck

    doi: 10.1097/MD.0000000000000502

    Figure Lengend Snippet: Increasing expression of VEGF in overexpressed MTDH (MTDH cDNA) cells was detected comparing with parental cell (Blank) and vector control (pcDNA) by western blot (A) and ELISA (C and E); reduced VEGF expression was found in MTDH knockdown (shRNA MTDH ) cells compared with parental (Blank) and control cells (shRNA control ) by western blot (B) and ELISA (D and F). ∗ P

    Article Snippet: Tu686 and 5-8F cells stably expressing MTDH were transiently transfected with AKT or control small interfering ribonucleic acid (siRNA) (SC-43609; SC-37007, purchased from Santa Cruz, CA).

    Techniques: Expressing, Plasmid Preparation, Western Blot, Enzyme-linked Immunosorbent Assay, shRNA

    Linearity plot of mean Abbott m 2000 rt RealTi me ™ HIV-1 RNA level against known samples determined by the ROCHE COBAS® AmpliPrep™/AMPLICORTM HIV-1 MONITOR® v1.5

    Journal: Journal of virological methods

    Article Title: Evaluation of the Abbott m2000rt RealTime(TM) HIV-1 assay with manual sample preparation compared with the ROCHE COBAS(R) AmpliPrep(TM)/AMPLICOR(TM) HIV-1 MONITOR(R) v1.5 using specimens from East Africa

    doi: 10.1016/j.jviromet.2009.08.013

    Figure Lengend Snippet: Linearity plot of mean Abbott m 2000 rt RealTi me ™ HIV-1 RNA level against known samples determined by the ROCHE COBAS® AmpliPrep™/AMPLICORTM HIV-1 MONITOR® v1.5

    Article Snippet: Of 100 patient samples, 39 (39%) were determined to have HIV-1 RNA concentrations < 400 copies/mL on the Roche assay.

    Techniques: