rhizobium tropici type a strain cfn 299 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Matsunami Glass mas gp typea glass slides
    Mas Gp Typea Glass Slides, supplied by Matsunami Glass, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mas gp typea glass slides/product/Matsunami Glass
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mas gp typea glass slides - by Bioz Stars, 2024-07
    86/100 stars
      Buy from Supplier

    86
    Nikon 50 type a
    50 Type A, supplied by Nikon, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/50 type a/product/Nikon
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    50 type a - by Bioz Stars, 2024-07
    86/100 stars
      Buy from Supplier

    86
    Nihon Gene Research Laboratories typea m264r2 acaaagcgtctacgctgcag
    Typea M264r2 Acaaagcgtctacgctgcag, supplied by Nihon Gene Research Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/typea m264r2 acaaagcgtctacgctgcag/product/Nihon Gene Research Laboratories
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    typea m264r2 acaaagcgtctacgctgcag - by Bioz Stars, 2024-07
    86/100 stars
      Buy from Supplier

    86
    ProCore Bio Med Ltd needle typea procore 20g
    Needle Typea Procore 20g, supplied by ProCore Bio Med Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/needle typea procore 20g/product/ProCore Bio Med Ltd
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    needle typea procore 20g - by Bioz Stars, 2024-07
    86/100 stars
      Buy from Supplier

    86
    Allergan onabotulinumtoxin type a
    Onabotulinumtoxin Type A, supplied by Allergan, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onabotulinumtoxin type a/product/Allergan
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    onabotulinumtoxin type a - by Bioz Stars, 2024-07
    86/100 stars
      Buy from Supplier

    Image Search Results