real-time quantitative pcr Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher mirvana qrt pcr mirna detection kit
    Impact of micro RNA (miR)‐542‐3p overexpression on the decidual phenotype. A, A quantitative real‐time polymerase chain reaction amplification ( <t>qRT</t> ‐ <t>PCR</t> ) analysis of the miR‐542‐3p expression levels in the human eutopic endometrial stromal cells ( HE u ESC s) and the human ectopic endometrial stromal cells ( HE c ESC s) that had been treated with or without 8‐bromo‐cyclic adenosine monophosphate (8‐br‐ cAMP ) and medroxyprogesterone acetate ( MPA ) for 6 days. The expression of miR542‐3p was calculated as the fold change, relative to the HE u ESC s or HE c ESC s. B, A qRT ‐ PCR analysis of the insulin‐like growth factor‐binding protein 1 ( IGFBP 1 ) transcript levels in the HE c ESC s that were transfected with a miR‐542‐3p mimic or NC mimic and decidualized for 6 days. The expression levels were normalized to glyceraldehyde 3‐phosphate dehydrogenase. The data are presented as the mean±standard error of the mean of three independent experiments. ** P
    Mirvana Qrt Pcr Mirna Detection Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 981 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mirvana qrt pcr mirna detection kit/product/Thermo Fisher
    Average 99 stars, based on 981 article reviews
    Price from $9.99 to $1999.99
    mirvana qrt pcr mirna detection kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    96
    Bio-Rad quantitative real time pcr
    Transgenic overexpression of <t>Dlk1</t> modulates EAE severity and adaptive immune responses. A) Dlk1 mRNA expression in immune tissues in Dlk1 transgenic and wild type littermate control mice measured using TaqMan <t>PCR.</t> Relative Dlk1 expression was calculated in relation to the mean of housekeeping gene, beta-2 microglobulin, using 2-ΔΔCt method (N = 3–5 mice/group). B) Daily EAE scores in Dlk1 transgenic (N = 24) and wild type littermate control (N = 20) mice after immunization with MOG demonstrate that the higher levels of Dlk1 in transgenic mice are protective against EAE. Mean EAE clinical score (and the standard error of the mean) is given for each day post immunization (p.i.). The figure represents pooled data from three separate experiments. Mann-Whitney U-test was used to compare the daily EAE scores (p-value
    Quantitative Real Time Pcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 17044 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Bio-Rad
    Average 96 stars, based on 17044 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-09
    96/100 stars
      Buy from Supplier

    94
    Bio-Rad quantitative real time pcr qpcr
    cmvIL-10 does not impact CXCR4 gene expression or protein levels. HEK293 cells were treated with CXCL12 (100 ng/ml) and/or cmvIL-10 (100 ng/ml) for 2 h or 24 h. (A) Total RNA was harvested for <t>qPCR</t> analysis. Fold change was calculated relative to the mock-treated control (Con) cells. Error bars, standard error for 3 replicates. (B) The cDNA from the experiment whose data are shown in panel A was used to amplify CXCR4 or β-actin by <t>PCR.</t> The resulting products were visualized via agarose gel electrophoresis. (C) Cells were treated as described above and then lysed, and total protein was harvested and immunoblotted for CXCR4 or total MAPK (protein loading control).
    Quantitative Real Time Pcr Qpcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 2448 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr qpcr/product/Bio-Rad
    Average 94 stars, based on 2448 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr qpcr - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    96
    Thermo Fisher quantitative real time pcr
    KLF15 is the major Kruppel-Like Factor in HPMEC and important regulator of critical endothelial enzymes- Arginase 2 and eNOS Total RNA from Human Pulmonary Microvascular endothelial cells was converted to <t>cDNA</t> and the relative mRNA expression of KLF15 was determined in quiescent HPMEC using real-time <t>PCR</t> (N=3), B) Cell lysates from HPMEC, human coronary artery endothelial cells (HCAEC), Human Aortic Endothelial Cells (HAEC), Human Aortic Smooth Muscle Cells (HASMC) were subjected to western blotting with KLF15, eNOS and β-tubulin antibodies (N=4). Cell lysates from HPMEC overexpressing HA-KLF15 was used as a positive control, C) Total RNA from Human Pulmonary Microvascular endothelial cells was converted to cDNA and the relative mRNA expression of KLF2, 4 and 15 was determined in quiescent HPMEC using real-time PCR (N=3) *p
    Quantitative Real Time Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 45481 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Thermo Fisher
    Average 96 stars, based on 45481 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-09
    96/100 stars
      Buy from Supplier

    94
    Bio-Rad quantitative real time pcr qrt pcr
    IPA Network Analysis Genes in Cluster 4. (a) IPA Network analysis was generated by seeding the genes within cluster 4 (blue highlighted genes) and “growing” those genes into a network by displaying direct (solid lines) and indirect (dashed lines) connections. All orphan genes were removed. Genes added to the network are illustrated with purple lines. (b) <t>qRT-PCR</t> was performed for node genes IRS1, OPA3, and POU6F1 to identify the associated gene expression profiles. The average ΔCt was calculated for each experimental group, where ΔCt = Ct (gene of interest)–Ct (Housekeeper gene–GAPDH). Data are shown ± S.D.
    Quantitative Real Time Pcr Qrt Pcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 3564 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr qrt pcr/product/Bio-Rad
    Average 94 stars, based on 3564 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr qrt pcr - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    84
    Thermo Fisher 7900ht fast real time pcr system relative quantitation guide
    IPA Network Analysis Genes in Cluster 4. (a) IPA Network analysis was generated by seeding the genes within cluster 4 (blue highlighted genes) and “growing” those genes into a network by displaying direct (solid lines) and indirect (dashed lines) connections. All orphan genes were removed. Genes added to the network are illustrated with purple lines. (b) <t>qRT-PCR</t> was performed for node genes IRS1, OPA3, and POU6F1 to identify the associated gene expression profiles. The average ΔCt was calculated for each experimental group, where ΔCt = Ct (gene of interest)–Ct (Housekeeper gene–GAPDH). Data are shown ± S.D.
    7900ht Fast Real Time Pcr System Relative Quantitation Guide, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/7900ht fast real time pcr system relative quantitation guide/product/Thermo Fisher
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    7900ht fast real time pcr system relative quantitation guide - by Bioz Stars, 2020-09
    84/100 stars
      Buy from Supplier

    92
    Toyobo quantitative real time pcr
    The activated signaling pathways and upregulation of gene and protein associated with invasion induced by astrocytes A. Western blot analysis of protein lysates prepared from U251 or A172 exposed to astrocytes condition medium (ACM) for the times indicated. B, C. Graphic representations of <t>qRT-PCR</t> results for invasion related gene expression changes induced in U251 or A172 in co-culture with astrocytes. Total <t>RNA</t> was extracted from U251 or A172 glioma cells were incubated with ACM for 48 h where DMEM containing 3% FBS was used as the control. * p
    Quantitative Real Time Pcr, supplied by Toyobo, used in various techniques. Bioz Stars score: 92/100, based on 1299 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Toyobo
    Average 92 stars, based on 1299 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    94
    Stratagene quantitative real time pcr
    Mutations in ref(2)P result in the accumulation of <t>mtDNA.</t> ( a ) Regular mitochondrial distribution is disrupted in ref(2)P mutants and the number of mtDNA nucleoids (mt) is increased. PicoGreen also labels the dsDNA of muscle nuclei (nuc). ( b ) ref(2)P mutants flies showed an increase in mtDNA. The ratio of mtDNA to nDNA was measured using real-time quantitative <t>PCR</t> in flies with the indicated ages (mean±S.D., n =9 per genotype). Statistically significant values relative to the control ( w 1118 ) are indicated by asterisks (one-way ANOVA with Dunnett's multiple comparison test). ( c and d ) Mutations in ref(2)P do not cause alterations in mitochondrial protein density. Protein density was determined in 26-day-old flies with the indicated genotypes by determining the concentration of Cyt c using an ELISA assay ( d ) and by measuring the activity of the mitochondrial matrix enzyme citrate synthase ( c ). Data are shown as the mean ±S.E.M ( n =3 in each group). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test). ( e ) Analysis of the mtTFA levels in ref(2)P mutants. Lysates prepared from adult flies were subjected to western blot analysis with the indicated antibodies. ( f ) Normal respiration in ref(2)P mutant flies. Activity of the indicated complexes in coupled mitochondria was measured in 3-day-old flies using high-resolution respirometry. Data are shown as the mean±S.E.M. ( n ≥4 in each genotype). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test)
    Quantitative Real Time Pcr, supplied by Stratagene, used in various techniques. Bioz Stars score: 94/100, based on 1471 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Stratagene
    Average 94 stars, based on 1471 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher quantitative real time pcr qpcr
    CNM affected expression of osteoclastogenic markers in M-CSF+RANKL induced osteoclastogenesis. (A-G) mouse bone marrow macrophages (BMM) were incubated in the presence of M-CSF (30ng/mL) and RANKL, (10ng/mL) and with or without CNM (2.5, 5 and 10μg/mL). At day three, RNA was extracted and the mRNA expression of NFATc1(A), Trap/Acp5 (B), Itgb3 (C), V-ATPase (D), Ctsk(E) and Mmp9 (F) was analyzed by quantitative <t>PCR</t> <t>(RT-qPCR).</t> The graphs represents mean ± SEM. For protein levels, BMMs were cultured as describes above and the total cell lysates were subjected to Western blots with the indicate specific antibodies (G). β-Actin was used as a loading control. The graph represents the densitometric measurement normalized by β-Actin and bars represents mean ± SEM (H). All gels were run under the same experimental conditions. All results are representative of at least three independent experiments. One-way ANOVA with Bonferroni’s multiple comparison tests was used to determine statistical significance. *p
    Quantitative Real Time Pcr Qpcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 4920 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr qpcr/product/Thermo Fisher
    Average 99 stars, based on 4920 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr qpcr - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    94
    Bio-Rad quantitative real time polymerase chain reaction qrt pcr
    The preventive effects of AMPK on the senescence associated with NAD + synthesis. (A) Cellular concentrations of NAD + on day 3 or day 5 after H 2 O 2 treatment. (B) Representative images of SA ‐β‐Gal staining of cells (left) and percentage of SA ‐β‐Gal‐positive cells (right). (C) Cellular concentrations of NAD + in the cells incubated with nicotinamide mononucleotide ( NMN ) for 3 days after H 2 O 2 treatment. (D) H 2 O 2 ‐treated cells were incubated with Met (10 mM ), BBR (10 μM), or CC (10 μM) for 3 days. The concentrations of NAD + are shown. (E) A schematic diagram of two pathways of NAD + synthesis. Red ones indicate rate‐limiting enzymes, and blue ones illustrate the enzyme inhibitors we used. (F) Relative fold‐changes in the mRNA levels of NAMPT , as monitored by <t>qRT</t> ‐ <t>PCR</t> (left), and representative images from immunoblot assays against NAMPT are shown (right). The ratio of NAMPT to actin was quantified by densitometry, based on the immunoblot images from three independent experiments. (G) Cells were incubated with Met, BBR , and CC for 3 days. Representative images from immunoblots against NAMPT are shown. The ratio of NAMPT to β‐actin was quantified by densitometry based on the immunoblot images from three independent experiments. (H) H 2 O 2 ‐treated NIH 3T3 cells were incubated with NAMPT inhibitor ( FK 866, 5 nM ), QPRT inhibitor ( PHTH , 1 mM ), Met (10 mM ), and BBR (10 μM) alone or in combination as indicated for 3 days. The percentages of SA ‐β‐Gal‐positive cells are shown. (I) The mRNA levels of NMNAT 1 , NMNAT 2 , and NMNAT 3 genes in the cells infected with corresponding lentivirus‐sh RNA or nontargeting sh RNA (sh CON ) as determined by qRT ‐ PCR . (J) Cellular concentrations of NAD + in sh RNA ‐infected cells. (K) Cells infected with sh RNA s were treated with H 2 O 2 and incubated with BBR for 3 days. Representative images of SA ‐β‐Gal staining of cells (left) and percentages of SA ‐β‐Gal‐positive cells (right). * P
    Quantitative Real Time Polymerase Chain Reaction Qrt Pcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 678 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time polymerase chain reaction qrt pcr/product/Bio-Rad
    Average 94 stars, based on 678 article reviews
    Price from $9.99 to $1999.99
    quantitative real time polymerase chain reaction qrt pcr - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    94
    Agilent technologies real time quantitative pcr
    Stable knockdown of BCORL1 in A375 cells (A-C) and A375-p47BRAF V600E [clone E9] (D-F). (A, D) Efficiency of shRNA-mediated BCORL1 silencing as shown by quantitative <t>PCR</t> using GAPDH as a reference gene. (B, E) Dose-response curves obtained in the presence of increasing concentrations of vemurafenib, with cells expressing a nontargeting ( shNT , blue curves) or a BCORL1-specific ( shBCORL1 , red curves) shRNA. (C, F) CRISPR/Cas9 system was used to disrupt BCORL1 gene; vemurafenib dose-response curves are shown comparing knockout ( KO ) with parental ( WT ) cells. (G) CRISPR/Cas9-mediated gene editing was used to introduce the Q1076H substitution in the endogenous BCORL1 locus; vemurafenib dose-response curves are shown comparing two mutated clones ( C8 and D7 ) with a wild-type clone ( WT ) and with parental A375 cells ( Par ). All curves are representative of at least three experiments. For all panels, extra-sum-of-squares F test was run to compare the two curves; P values are indicated at the lower-left corner, where P
    Real Time Quantitative Pcr, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 94/100, based on 720 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time quantitative pcr/product/Agilent technologies
    Average 94 stars, based on 720 article reviews
    Price from $9.99 to $1999.99
    real time quantitative pcr - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    93
    Eppendorf AG real time quantitative pcr
    Stable silencing of IGF1R confers epithelial-like phenotypes in mesenchymal TNBC cells (A) Endogenous expression of IGF1R-β and total FAK analyzed via Western blot analysis in a panel of mesenchymal human TNBC cells. (B) Western blot confirmation of stable lentiviral knockdown of IGF1R-α/β (IGF1R-KD) in MDA-MB-231 and BT549 TNBC cells. β-actin was used as a loading control. (C) Morphological changes in MDA-MB-231 and BT549 IGF1R-KD cells compared to EV control cells four to six passages post-lentiviral infections; brightfield magnification x20. (D) Western blot analyses of mesenchymal markers (vimentin, Snail-1, ZEB-1), motility marker pFAK, and epithelial markers (E-cadherin, claudin-1, and ZO-1) in cell lines stably expressing EV control plasmid or IGF1R-KD lentiviral plasmids using specific antibodies. β-actin was used as a loading control. (E) Relative <t>mRNA</t> expression levels of Vimentin, ZEB-1, and E-cadherin in MDA-MB-231 EV and IGF1R-KD cell lines was detected by TaqMan quantitative <t>RT-PCR</t> and normalized to RPLPO. The relative amounts of transcript were described using the 2–ΔΔCt method. Data are displayed in means ± standard deviation of at least three independent experiments of each group.
    Real Time Quantitative Pcr, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 93/100, based on 519 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time quantitative pcr/product/Eppendorf AG
    Average 93 stars, based on 519 article reviews
    Price from $9.99 to $1999.99
    real time quantitative pcr - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher 7500 real time pcr system
    Stable silencing of IGF1R confers epithelial-like phenotypes in mesenchymal TNBC cells (A) Endogenous expression of IGF1R-β and total FAK analyzed via Western blot analysis in a panel of mesenchymal human TNBC cells. (B) Western blot confirmation of stable lentiviral knockdown of IGF1R-α/β (IGF1R-KD) in MDA-MB-231 and BT549 TNBC cells. β-actin was used as a loading control. (C) Morphological changes in MDA-MB-231 and BT549 IGF1R-KD cells compared to EV control cells four to six passages post-lentiviral infections; brightfield magnification x20. (D) Western blot analyses of mesenchymal markers (vimentin, Snail-1, ZEB-1), motility marker pFAK, and epithelial markers (E-cadherin, claudin-1, and ZO-1) in cell lines stably expressing EV control plasmid or IGF1R-KD lentiviral plasmids using specific antibodies. β-actin was used as a loading control. (E) Relative <t>mRNA</t> expression levels of Vimentin, ZEB-1, and E-cadherin in MDA-MB-231 EV and IGF1R-KD cell lines was detected by TaqMan quantitative <t>RT-PCR</t> and normalized to RPLPO. The relative amounts of transcript were described using the 2–ΔΔCt method. Data are displayed in means ± standard deviation of at least three independent experiments of each group.
    7500 Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 54115 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/7500 real time pcr system/product/Thermo Fisher
    Average 99 stars, based on 54115 article reviews
    Price from $9.99 to $1999.99
    7500 real time pcr system - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher quantitative real time pcr trizol reagent
    Stable silencing of IGF1R confers epithelial-like phenotypes in mesenchymal TNBC cells (A) Endogenous expression of IGF1R-β and total FAK analyzed via Western blot analysis in a panel of mesenchymal human TNBC cells. (B) Western blot confirmation of stable lentiviral knockdown of IGF1R-α/β (IGF1R-KD) in MDA-MB-231 and BT549 TNBC cells. β-actin was used as a loading control. (C) Morphological changes in MDA-MB-231 and BT549 IGF1R-KD cells compared to EV control cells four to six passages post-lentiviral infections; brightfield magnification x20. (D) Western blot analyses of mesenchymal markers (vimentin, Snail-1, ZEB-1), motility marker pFAK, and epithelial markers (E-cadherin, claudin-1, and ZO-1) in cell lines stably expressing EV control plasmid or IGF1R-KD lentiviral plasmids using specific antibodies. β-actin was used as a loading control. (E) Relative <t>mRNA</t> expression levels of Vimentin, ZEB-1, and E-cadherin in MDA-MB-231 EV and IGF1R-KD cell lines was detected by TaqMan quantitative <t>RT-PCR</t> and normalized to RPLPO. The relative amounts of transcript were described using the 2–ΔΔCt method. Data are displayed in means ± standard deviation of at least three independent experiments of each group.
    Quantitative Real Time Pcr Trizol Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 210 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr trizol reagent/product/Thermo Fisher
    Average 99 stars, based on 210 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr trizol reagent - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Impact of micro RNA (miR)‐542‐3p overexpression on the decidual phenotype. A, A quantitative real‐time polymerase chain reaction amplification ( qRT ‐ PCR ) analysis of the miR‐542‐3p expression levels in the human eutopic endometrial stromal cells ( HE u ESC s) and the human ectopic endometrial stromal cells ( HE c ESC s) that had been treated with or without 8‐bromo‐cyclic adenosine monophosphate (8‐br‐ cAMP ) and medroxyprogesterone acetate ( MPA ) for 6 days. The expression of miR542‐3p was calculated as the fold change, relative to the HE u ESC s or HE c ESC s. B, A qRT ‐ PCR analysis of the insulin‐like growth factor‐binding protein 1 ( IGFBP 1 ) transcript levels in the HE c ESC s that were transfected with a miR‐542‐3p mimic or NC mimic and decidualized for 6 days. The expression levels were normalized to glyceraldehyde 3‐phosphate dehydrogenase. The data are presented as the mean±standard error of the mean of three independent experiments. ** P

    Journal: Reproductive Medicine and Biology

    Article Title: Overexpression of microRNA‐542‐3p attenuates the differentiating capacity of endometriotic stromal cells, et al. Overexpression of microRNA‐542‐3p attenuates the differentiating capacity of endometriotic stromal cells

    doi: 10.1002/rmb2.12028

    Figure Lengend Snippet: Impact of micro RNA (miR)‐542‐3p overexpression on the decidual phenotype. A, A quantitative real‐time polymerase chain reaction amplification ( qRT ‐ PCR ) analysis of the miR‐542‐3p expression levels in the human eutopic endometrial stromal cells ( HE u ESC s) and the human ectopic endometrial stromal cells ( HE c ESC s) that had been treated with or without 8‐bromo‐cyclic adenosine monophosphate (8‐br‐ cAMP ) and medroxyprogesterone acetate ( MPA ) for 6 days. The expression of miR542‐3p was calculated as the fold change, relative to the HE u ESC s or HE c ESC s. B, A qRT ‐ PCR analysis of the insulin‐like growth factor‐binding protein 1 ( IGFBP 1 ) transcript levels in the HE c ESC s that were transfected with a miR‐542‐3p mimic or NC mimic and decidualized for 6 days. The expression levels were normalized to glyceraldehyde 3‐phosphate dehydrogenase. The data are presented as the mean±standard error of the mean of three independent experiments. ** P

    Article Snippet: A morphological evaluation, RNA extraction, and quantitative real‐time polymerase chain reaction (qRT‐PCR) analysis were performed on day 6 of decidualization.

    Techniques: Over Expression, Real-time Polymerase Chain Reaction, Amplification, Quantitative RT-PCR, Expressing, Binding Assay, Transfection

    Transgenic overexpression of Dlk1 modulates EAE severity and adaptive immune responses. A) Dlk1 mRNA expression in immune tissues in Dlk1 transgenic and wild type littermate control mice measured using TaqMan PCR. Relative Dlk1 expression was calculated in relation to the mean of housekeeping gene, beta-2 microglobulin, using 2-ΔΔCt method (N = 3–5 mice/group). B) Daily EAE scores in Dlk1 transgenic (N = 24) and wild type littermate control (N = 20) mice after immunization with MOG demonstrate that the higher levels of Dlk1 in transgenic mice are protective against EAE. Mean EAE clinical score (and the standard error of the mean) is given for each day post immunization (p.i.). The figure represents pooled data from three separate experiments. Mann-Whitney U-test was used to compare the daily EAE scores (p-value

    Journal: PLoS Genetics

    Article Title: Parent-of-Origin Effects Implicate Epigenetic Regulation of Experimental Autoimmune Encephalomyelitis and Identify Imprinted Dlk1 as a Novel Risk Gene

    doi: 10.1371/journal.pgen.1004265

    Figure Lengend Snippet: Transgenic overexpression of Dlk1 modulates EAE severity and adaptive immune responses. A) Dlk1 mRNA expression in immune tissues in Dlk1 transgenic and wild type littermate control mice measured using TaqMan PCR. Relative Dlk1 expression was calculated in relation to the mean of housekeeping gene, beta-2 microglobulin, using 2-ΔΔCt method (N = 3–5 mice/group). B) Daily EAE scores in Dlk1 transgenic (N = 24) and wild type littermate control (N = 20) mice after immunization with MOG demonstrate that the higher levels of Dlk1 in transgenic mice are protective against EAE. Mean EAE clinical score (and the standard error of the mean) is given for each day post immunization (p.i.). The figure represents pooled data from three separate experiments. Mann-Whitney U-test was used to compare the daily EAE scores (p-value

    Article Snippet: Quantitative real-time PCR of rat Dlk1 , Rtl1 and Dio3 in the BC material was performed using a BioRad CFX384 Touch real-time PCR system with a two-step PCR protocol (95°C for 3 min. followed by 40 cycles of 95°C for 10 sec., 60°C for 30 sec. followed by melt curve analysis), using SYBR Green as the fluorophore (Bio-Rad).

    Techniques: Transgenic Assay, Over Expression, Expressing, Mouse Assay, Polymerase Chain Reaction, MANN-WHITNEY, Significance Assay

    Albumin activated the transcriptional responses of ECM genes via TGFβ receptor signaling. ( a ) The expression levels of ECM-related genes is upregulated across models (marked in bold in A, C) in a separate microarray data set in comparisons between albumin vs. albumin + TGFβ receptor (R) blockers. **p = 0.0078, Wilcoxon signed-rank test, two-tailed. ( b – g ) Quantitative real-time PCR for the mRNA expression of selected genes in primary cortical astrocytic or neuronal cultures at 24 hours following treatment of albumin or albumin plus a specific Alk5 blocker, SJN2511. Results were of three independent primary culture derivations (n = 11 per condition in neurons; n = 10–12 per condition in astrocytes). One way ANOVA with posthoc Turkey’s test (in astrocytes) and student t-test (in neurons) were performed. Cont, control; Alb, albumin; SJN, SJN2511; n.d., non detectable (Cq value ≥ 35). *p

    Journal: Scientific Reports

    Article Title: TGFβ signaling is associated with changes in inflammatory gene expression and perineuronal net degradation around inhibitory neurons following various neurological insults

    doi: 10.1038/s41598-017-07394-3

    Figure Lengend Snippet: Albumin activated the transcriptional responses of ECM genes via TGFβ receptor signaling. ( a ) The expression levels of ECM-related genes is upregulated across models (marked in bold in A, C) in a separate microarray data set in comparisons between albumin vs. albumin + TGFβ receptor (R) blockers. **p = 0.0078, Wilcoxon signed-rank test, two-tailed. ( b – g ) Quantitative real-time PCR for the mRNA expression of selected genes in primary cortical astrocytic or neuronal cultures at 24 hours following treatment of albumin or albumin plus a specific Alk5 blocker, SJN2511. Results were of three independent primary culture derivations (n = 11 per condition in neurons; n = 10–12 per condition in astrocytes). One way ANOVA with posthoc Turkey’s test (in astrocytes) and student t-test (in neurons) were performed. Cont, control; Alb, albumin; SJN, SJN2511; n.d., non detectable (Cq value ≥ 35). *p

    Article Snippet: Real time quantitative PCR The expression level of mRNA was detected by real time quantitative reverse transcriptase-PCR using CFX96 Real Time System (BioRad) with SsoAdvanced SYBR Green Supermix (BioRad).

    Techniques: Expressing, Microarray, Two Tailed Test, Real-time Polymerase Chain Reaction

    Transcriptional activation of TGFβ-regulated extracellular matrix genes across models. The expression levels of genes encoding for extracellular matrix (ECM) components ( a ) and for molecules involved in ECM remodeling ( c ) are shown across models. Heat maps are based on a log 2 scale. ( b ) Quantitative real-time PCR was used to measure mRNA level of Tnc in the undercut (UC) cortex and peri-infarct hippocampi (Stroke). One way ANOVA with posthoc Turkey’s test (in Stroke, B) and student t-test (in UC). The number of animals used per condition is indicated within the bar.

    Journal: Scientific Reports

    Article Title: TGFβ signaling is associated with changes in inflammatory gene expression and perineuronal net degradation around inhibitory neurons following various neurological insults

    doi: 10.1038/s41598-017-07394-3

    Figure Lengend Snippet: Transcriptional activation of TGFβ-regulated extracellular matrix genes across models. The expression levels of genes encoding for extracellular matrix (ECM) components ( a ) and for molecules involved in ECM remodeling ( c ) are shown across models. Heat maps are based on a log 2 scale. ( b ) Quantitative real-time PCR was used to measure mRNA level of Tnc in the undercut (UC) cortex and peri-infarct hippocampi (Stroke). One way ANOVA with posthoc Turkey’s test (in Stroke, B) and student t-test (in UC). The number of animals used per condition is indicated within the bar.

    Article Snippet: Real time quantitative PCR The expression level of mRNA was detected by real time quantitative reverse transcriptase-PCR using CFX96 Real Time System (BioRad) with SsoAdvanced SYBR Green Supermix (BioRad).

    Techniques: Activation Assay, Expressing, Real-time Polymerase Chain Reaction

    Incubation of monocytes with LPS for 24 h results in reduced ability to release TNFα in response to a second LPS stimulus and increased mtDNA copy number. Blood monocytes were incubated with LPS (10 ng/ml) before measuring cytokine release and mtDNA copy number. (A) The release of TNFα in response to a second 4 h exposure to LPS (10 ng/ml) was measured by ELISA ( n = 5). (B) mtDNA copy number was determined by measuring MT-ND1 relative to B2M using qPCR ( n = 5). Data are represented as (A) mean ± standard deviation or (B) individual values with a line representing the mean. * p

    Journal: Frontiers in Immunology

    Article Title: Exposure of Monocytic Cells to Lipopolysaccharide Induces Coordinated Endotoxin Tolerance, Mitochondrial Biogenesis, Mitophagy, and Antioxidant Defenses

    doi: 10.3389/fimmu.2018.02217

    Figure Lengend Snippet: Incubation of monocytes with LPS for 24 h results in reduced ability to release TNFα in response to a second LPS stimulus and increased mtDNA copy number. Blood monocytes were incubated with LPS (10 ng/ml) before measuring cytokine release and mtDNA copy number. (A) The release of TNFα in response to a second 4 h exposure to LPS (10 ng/ml) was measured by ELISA ( n = 5). (B) mtDNA copy number was determined by measuring MT-ND1 relative to B2M using qPCR ( n = 5). Data are represented as (A) mean ± standard deviation or (B) individual values with a line representing the mean. * p

    Article Snippet: The relative mtDNA copy number was determined by comparing the level of the mtDNA-encoded MT-ND1 gene (primers: F - ACGCCATAAAACTCTTCACCAAAG, R - GGGTTCATAGTAGAAGAGCGATGG) to that of the nuclear reference gene B2M (primers: F - CACTGAAAAAGATGAGTATGCC, R - AACATTCCCTGACAATCCC) by real-time quantitative polymerase chain reaction (qPCR) using the SYBR® Green technique and the MyiQTM PCR machine (both BioRad, Hercules, CA, USA) ( ).

    Techniques: Incubation, Enzyme-linked Immunosorbent Assay, Real-time Polymerase Chain Reaction, Standard Deviation

    Induction of mitochondrial biogenesis following exposure of THP-1 cells to LPS. THP-1 cells were incubated with LPS (100 ng/ml) for 0–72 h before assessing mitochondrial biogenesis and respiration. (A) Mitochondrial mass was assessed by measuring the uptake of NAO using flow cytometry, (positive control - glucose-free medium supplemented with 5 mM galactose) ( n = 4). (B) A colorimetric assay was used to assess the activity of the mitochondrial matrix enzyme citrate synthase ( n = 3). (C) mtDNA copy number was determined by measuring MT-ND1 relative to B2M using qPCR ( n = 5). (D) The level of TFAM protein relative to β-actin was determined by Western blot ( n = 4). (E) Scatter plot, linear regression and Pearson's correlation of the relationship between mtDNA copy number and TFAM protein levels. * p

    Journal: Frontiers in Immunology

    Article Title: Exposure of Monocytic Cells to Lipopolysaccharide Induces Coordinated Endotoxin Tolerance, Mitochondrial Biogenesis, Mitophagy, and Antioxidant Defenses

    doi: 10.3389/fimmu.2018.02217

    Figure Lengend Snippet: Induction of mitochondrial biogenesis following exposure of THP-1 cells to LPS. THP-1 cells were incubated with LPS (100 ng/ml) for 0–72 h before assessing mitochondrial biogenesis and respiration. (A) Mitochondrial mass was assessed by measuring the uptake of NAO using flow cytometry, (positive control - glucose-free medium supplemented with 5 mM galactose) ( n = 4). (B) A colorimetric assay was used to assess the activity of the mitochondrial matrix enzyme citrate synthase ( n = 3). (C) mtDNA copy number was determined by measuring MT-ND1 relative to B2M using qPCR ( n = 5). (D) The level of TFAM protein relative to β-actin was determined by Western blot ( n = 4). (E) Scatter plot, linear regression and Pearson's correlation of the relationship between mtDNA copy number and TFAM protein levels. * p

    Article Snippet: The relative mtDNA copy number was determined by comparing the level of the mtDNA-encoded MT-ND1 gene (primers: F - ACGCCATAAAACTCTTCACCAAAG, R - GGGTTCATAGTAGAAGAGCGATGG) to that of the nuclear reference gene B2M (primers: F - CACTGAAAAAGATGAGTATGCC, R - AACATTCCCTGACAATCCC) by real-time quantitative polymerase chain reaction (qPCR) using the SYBR® Green technique and the MyiQTM PCR machine (both BioRad, Hercules, CA, USA) ( ).

    Techniques: Incubation, Flow Cytometry, Cytometry, Positive Control, Colorimetric Assay, Activity Assay, Real-time Polymerase Chain Reaction, Western Blot

    CD36 is required for LTA-induced cytokine production. Peritoneal macrophages from wild-type and Cd36 −/− mice were incubated with 100 ng/ml LTA or LPS for 6 h, and cytokine mRNA (a) and protein (b) expression was determined by quantitative RT-PCR and ELISA, respectively. *, P ≤ 0.05; **, P ≤ 0.005, significantly different from wild-type macrophages.

    Journal: The Journal of Cell Biology

    Article Title: Response to Staphylococcus aureus requires CD36-mediated phagocytosis triggered by the COOH-terminal cytoplasmic domain

    doi: 10.1083/jcb.200501113

    Figure Lengend Snippet: CD36 is required for LTA-induced cytokine production. Peritoneal macrophages from wild-type and Cd36 −/− mice were incubated with 100 ng/ml LTA or LPS for 6 h, and cytokine mRNA (a) and protein (b) expression was determined by quantitative RT-PCR and ELISA, respectively. *, P ≤ 0.05; **, P ≤ 0.005, significantly different from wild-type macrophages.

    Article Snippet: Measurement of cytokine expression TNFα, IL-12, and IL-6 mRNA levels were measured by real-time quantitative RT-PCR using an i Cycler (Bio-Rad Laboratories) as described previously ( ).

    Techniques: Mouse Assay, Incubation, Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

    The expression of miR-146a were up-regulated after mycobacterial infection both in vivo and in vitro . Murine BMDMs ( a , b ) or RAW264.7 cells ( c , d ) were infected with M. bovis BCG at an MOI of 5 for the indicated time ( a , c ) or at the indicated MOIs for 24 h ( b , d ). Peritoneal lavage fluid and different organs were collected from BCG-infected or PBS-treated mice (n = 5).The expression levels of miR-146a were measured by real-time PCR ( e ). RAW264.7 cells were transfected with siRNA targeting MyD88 ( f ) or pretreated with IKKα/β inhibitor (BMS345541) ( g ), followed by BCG infection. The mRNA levels of MyD88 and miR-146a were measured by real-time PCR ( f , g ). Data are shown as mean ± s.e.m. of three independent experiments. *p

    Journal: Scientific Reports

    Article Title: microRNA-146a promotes mycobacterial survival in macrophages through suppressing nitric oxide production

    doi: 10.1038/srep23351

    Figure Lengend Snippet: The expression of miR-146a were up-regulated after mycobacterial infection both in vivo and in vitro . Murine BMDMs ( a , b ) or RAW264.7 cells ( c , d ) were infected with M. bovis BCG at an MOI of 5 for the indicated time ( a , c ) or at the indicated MOIs for 24 h ( b , d ). Peritoneal lavage fluid and different organs were collected from BCG-infected or PBS-treated mice (n = 5).The expression levels of miR-146a were measured by real-time PCR ( e ). RAW264.7 cells were transfected with siRNA targeting MyD88 ( f ) or pretreated with IKKα/β inhibitor (BMS345541) ( g ), followed by BCG infection. The mRNA levels of MyD88 and miR-146a were measured by real-time PCR ( f , g ). Data are shown as mean ± s.e.m. of three independent experiments. *p

    Article Snippet: Quantitative real-time PCR analysis of TRAF6 and iNOS mRNA was performed on Bio-Rad CFX96 real-time detection system using SYBR Green Master Mix (Applied Biosystems, Foster City, CA).

    Techniques: Expressing, Infection, In Vivo, In Vitro, Mouse Assay, Real-time Polymerase Chain Reaction, Transfection

    Mycobacteria-induced miR-146a impairs iNOS expression and NO production by inhibiting NF-κB and MAPKs pathways. RAW264.7 cells were transfected with miR-146a mimic or inhibitor for 24 h, followed by BCG infection ( a – d ). The mRNA levels of iNOS ( a , c ) and NO production ( b , d ) were measured by real-time PCR and Griess assay, respectively. The protein level of NF-κB p65 subunit in nucleus was detected by Western blot ( e ) and confocal microscopy ( f ). Arrows indicate NF-κB p65 accumulation in nucleus ( f ). Scale bar, 5 μm. The phosphorylation of ERK, JNK and p38 were determined by Western blot ( g ). RAW264.7 cells were pretreated with inhibitors for IKK, JNK or p38 for 1 h, followed by BCG infection. The mRNA levels of iNOS ( h ) and NO production ( i ) were measured by real-time PCR and Griess assay, respectively. Data are shown as mean ± s.e.m. of three independent experiments. *p

    Journal: Scientific Reports

    Article Title: microRNA-146a promotes mycobacterial survival in macrophages through suppressing nitric oxide production

    doi: 10.1038/srep23351

    Figure Lengend Snippet: Mycobacteria-induced miR-146a impairs iNOS expression and NO production by inhibiting NF-κB and MAPKs pathways. RAW264.7 cells were transfected with miR-146a mimic or inhibitor for 24 h, followed by BCG infection ( a – d ). The mRNA levels of iNOS ( a , c ) and NO production ( b , d ) were measured by real-time PCR and Griess assay, respectively. The protein level of NF-κB p65 subunit in nucleus was detected by Western blot ( e ) and confocal microscopy ( f ). Arrows indicate NF-κB p65 accumulation in nucleus ( f ). Scale bar, 5 μm. The phosphorylation of ERK, JNK and p38 were determined by Western blot ( g ). RAW264.7 cells were pretreated with inhibitors for IKK, JNK or p38 for 1 h, followed by BCG infection. The mRNA levels of iNOS ( h ) and NO production ( i ) were measured by real-time PCR and Griess assay, respectively. Data are shown as mean ± s.e.m. of three independent experiments. *p

    Article Snippet: Quantitative real-time PCR analysis of TRAF6 and iNOS mRNA was performed on Bio-Rad CFX96 real-time detection system using SYBR Green Master Mix (Applied Biosystems, Foster City, CA).

    Techniques: Expressing, Transfection, Infection, Real-time Polymerase Chain Reaction, Griess Assay, Western Blot, Confocal Microscopy

    miR-146a represses TRAF6 expression post-transcriptionally to inhibit iNOS expression. Sequence of miR-146a and its predicted binding with the TRAF6 3′UTRs of different species are shown ( a ). The mRNA ( b ) and protein ( c ) levels of TRAF6 in control or miR-146a mimic-transfected RAW264.7 cells were measured by real-time PCR and Western blot, respectively. RAW264.7 cells were transfected with negative control siRNA (siNC), TRAF6 siRNA-1or siRNA-2, followed by BCG infection for 24 h. The mRNA and protein levels of TRAF6 were examined ( d , e ). The mRNA expression level of iNOS ( f ) and the nitrite level ( g ) were measured by real-time PCR and Griess assay, respectively. Data are shown as the mean ± s.e.m. of three independent experiments. * p

    Journal: Scientific Reports

    Article Title: microRNA-146a promotes mycobacterial survival in macrophages through suppressing nitric oxide production

    doi: 10.1038/srep23351

    Figure Lengend Snippet: miR-146a represses TRAF6 expression post-transcriptionally to inhibit iNOS expression. Sequence of miR-146a and its predicted binding with the TRAF6 3′UTRs of different species are shown ( a ). The mRNA ( b ) and protein ( c ) levels of TRAF6 in control or miR-146a mimic-transfected RAW264.7 cells were measured by real-time PCR and Western blot, respectively. RAW264.7 cells were transfected with negative control siRNA (siNC), TRAF6 siRNA-1or siRNA-2, followed by BCG infection for 24 h. The mRNA and protein levels of TRAF6 were examined ( d , e ). The mRNA expression level of iNOS ( f ) and the nitrite level ( g ) were measured by real-time PCR and Griess assay, respectively. Data are shown as the mean ± s.e.m. of three independent experiments. * p

    Article Snippet: Quantitative real-time PCR analysis of TRAF6 and iNOS mRNA was performed on Bio-Rad CFX96 real-time detection system using SYBR Green Master Mix (Applied Biosystems, Foster City, CA).

    Techniques: Expressing, Sequencing, Binding Assay, Transfection, Real-time Polymerase Chain Reaction, Western Blot, Negative Control, Infection, Griess Assay

    Overexpression of TRAF6 reverses miR-146a-mediated inhibition of NO production and BCG clearance. RAW264.7 cells were co-transfected with control or miR-146a mimic together with empty vector or TRAF6 plasmid for 24 h. The expression levels of TRAF6 were determined by Western blot ( a ). RAW264.7 cells were co-transfected with mimics and plasmids as described above, followed by BCG infection for 24 h. The mRNA expression level of iNOS ( b ) and the nitrite level in the culture supernatant ( c ) were measured by real-time PCR and Griess assay, respectively. Mycobacterial viability was determined by CFU assay, and survival was expressed as a percentage of the control ( d ). Data are shown as the mean ± s.e.m. of three independent experiments. * p

    Journal: Scientific Reports

    Article Title: microRNA-146a promotes mycobacterial survival in macrophages through suppressing nitric oxide production

    doi: 10.1038/srep23351

    Figure Lengend Snippet: Overexpression of TRAF6 reverses miR-146a-mediated inhibition of NO production and BCG clearance. RAW264.7 cells were co-transfected with control or miR-146a mimic together with empty vector or TRAF6 plasmid for 24 h. The expression levels of TRAF6 were determined by Western blot ( a ). RAW264.7 cells were co-transfected with mimics and plasmids as described above, followed by BCG infection for 24 h. The mRNA expression level of iNOS ( b ) and the nitrite level in the culture supernatant ( c ) were measured by real-time PCR and Griess assay, respectively. Mycobacterial viability was determined by CFU assay, and survival was expressed as a percentage of the control ( d ). Data are shown as the mean ± s.e.m. of three independent experiments. * p

    Article Snippet: Quantitative real-time PCR analysis of TRAF6 and iNOS mRNA was performed on Bio-Rad CFX96 real-time detection system using SYBR Green Master Mix (Applied Biosystems, Foster City, CA).

    Techniques: Over Expression, Inhibition, Transfection, Plasmid Preparation, Expressing, Western Blot, Infection, Real-time Polymerase Chain Reaction, Griess Assay, Colony-forming Unit Assay

    ChIP-qPCR of the DNA binding for PXR and RNA-Pol-II to the Cyp3a gene loci, as well as PPAR α and RNA-Pol-II to the Cyp4a gene loci. For PXR, sites 1–5 were selected based on the reanalysis of a published PXR-ChIP sequencing experiment

    Journal: Drug Metabolism and Disposition

    Article Title:

    doi: 10.1124/dmd.115.067504

    Figure Lengend Snippet: ChIP-qPCR of the DNA binding for PXR and RNA-Pol-II to the Cyp3a gene loci, as well as PPAR α and RNA-Pol-II to the Cyp4a gene loci. For PXR, sites 1–5 were selected based on the reanalysis of a published PXR-ChIP sequencing experiment

    Article Snippet: Real-time qPCR reactions of the ChIP DNA were performed using SsoAdvanced Universal SYBR Green Supermix in a Bio-Rad CFX384 Real-Time PCR Detection System.

    Techniques: Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Binding Assay, Sequencing

    Gnas expression by BPA exposure and age. Based on BPA-related DHMR annotated to the Gnas gene, real-time quantitative polymerase chain reaction (RT-qPCR) was used to investigate longitudinal blood Gnas mRNA expression levels. RNA was isolated from the same longitudinal Control ( n = 6 per age group) and BPA-exposed ( n = 6 per age group) mouse blood samples used for DNA hydroxymethylation analyses. RT-qPCR was performed on the Gnas gene in triplicate. Three housekeeping genes— β -actin , 18S, and Gapdh—were included as internal controls in all RT-qPCR runs. In addition to housekeeping genes, an inter-plate calibrator control of brain cDNA was included for calculation of relative gene expression across multiple plates; all expression values are shown relative to this inter-plate calibrator. Expression levels were calculated following the 2 − Δ Δ Ct method. a Mean Gnas expression in BPA-exposed mouse blood showed a significant increase between 2 and 10 months of age ( p = 0.05 ); this pattern was not found in Control samples. b Mean Gnas expression was significantly lower in Control blood than BPA-exposed blood at 10 months of age ( p = 0.01 ).

    Journal: Environmental Health Perspectives

    Article Title: Longitudinal Effects of Developmental Bisphenol A Exposure on Epigenome-Wide DNA Hydroxymethylation at Imprinted Loci in Mouse Blood

    doi: 10.1289/EHP3441

    Figure Lengend Snippet: Gnas expression by BPA exposure and age. Based on BPA-related DHMR annotated to the Gnas gene, real-time quantitative polymerase chain reaction (RT-qPCR) was used to investigate longitudinal blood Gnas mRNA expression levels. RNA was isolated from the same longitudinal Control ( n = 6 per age group) and BPA-exposed ( n = 6 per age group) mouse blood samples used for DNA hydroxymethylation analyses. RT-qPCR was performed on the Gnas gene in triplicate. Three housekeeping genes— β -actin , 18S, and Gapdh—were included as internal controls in all RT-qPCR runs. In addition to housekeeping genes, an inter-plate calibrator control of brain cDNA was included for calculation of relative gene expression across multiple plates; all expression values are shown relative to this inter-plate calibrator. Expression levels were calculated following the 2 − Δ Δ Ct method. a Mean Gnas expression in BPA-exposed mouse blood showed a significant increase between 2 and 10 months of age ( p = 0.05 ); this pattern was not found in Control samples. b Mean Gnas expression was significantly lower in Control blood than BPA-exposed blood at 10 months of age ( p = 0.01 ).

    Article Snippet: In preparation for real-time quantitative polymerase chain reaction (RT-qPCR), cDNA samples were diluted 1:2.5 in RNase-free water, then mixed with 10 μ M forward/reverse primers, nuclease-free water, and Bio-Rad iQ SYBR Green Supermix (Catalog #1,708,880).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Isolation

    JMJD2A SUMOylation plays an essential role in KSHV viral gene transactivation and viral reactivation. (A) RNA-seq was performed using total RNA from non-induced (0 hrs, upper panel) and 0.2 μg/ml Dox treated (24 hrs, lower panel) TREx-MH-K-Rta-shJMJD2A (green bars), -shJMJD2A-Flag-JMJD2A-WT (blue bars) and -K471R (red bars) BCBL-1 cells. One representative RNA-seq expression dataset of KSHV genes is presented as reads per million (RPM) mapped. (B) RT-qPCR verification of KSHV K6 , PAN , K-bZIP and Orf52 expression in TREx-MH-K-Rta-shJMJD2A-Flag-JMJD2A-WT and -K471R BCBL-1 cells. (C and D) Heat map depicts hierarchical clustering of RNA-seq data of cellular (C) and KSHV (D) gene expression. (+, plus Dox 24h). (E) Supernatants from TREx-MH-K-Rta-shJMJD2A, -shJMJD2A-Flag-JMJD2A-WT and -K471R BCBL-1 cells treated as described in (A) for 48 hrs were collected, filtered, and the viral titers were determined by analyzing the virion-associated DNA levels using TaqMan qPCR. (Data represent mean±SEM. n = 3. **p

    Journal: PLoS Pathogens

    Article Title: SUMO modification of a heterochromatin histone demethylase JMJD2A enables viral gene transactivation and viral replication

    doi: 10.1371/journal.ppat.1006216

    Figure Lengend Snippet: JMJD2A SUMOylation plays an essential role in KSHV viral gene transactivation and viral reactivation. (A) RNA-seq was performed using total RNA from non-induced (0 hrs, upper panel) and 0.2 μg/ml Dox treated (24 hrs, lower panel) TREx-MH-K-Rta-shJMJD2A (green bars), -shJMJD2A-Flag-JMJD2A-WT (blue bars) and -K471R (red bars) BCBL-1 cells. One representative RNA-seq expression dataset of KSHV genes is presented as reads per million (RPM) mapped. (B) RT-qPCR verification of KSHV K6 , PAN , K-bZIP and Orf52 expression in TREx-MH-K-Rta-shJMJD2A-Flag-JMJD2A-WT and -K471R BCBL-1 cells. (C and D) Heat map depicts hierarchical clustering of RNA-seq data of cellular (C) and KSHV (D) gene expression. (+, plus Dox 24h). (E) Supernatants from TREx-MH-K-Rta-shJMJD2A, -shJMJD2A-Flag-JMJD2A-WT and -K471R BCBL-1 cells treated as described in (A) for 48 hrs were collected, filtered, and the viral titers were determined by analyzing the virion-associated DNA levels using TaqMan qPCR. (Data represent mean±SEM. n = 3. **p

    Article Snippet: ChIP DNA was confirmed for successful IP using SYBR Green-Based real-time qPCR analysis by CFX connect real-time PCR detection system (Bio-Rad, Richmond, CA).

    Techniques: RNA Sequencing Assay, Expressing, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

    JMJD2A is required for efficient SUMO-2/3 enrichment on the viral genome during KSHV reactivation. (A) ChIP-on-chip analysis of JMJD2A binding across the KSHV lytic genome. A JMJD2A ChIP assay was performed on TREx-MH-K-Rta BCBL-1 cells treated with 0.2 μg/ml doxycycline (Dox) for 12 hours (hrs). The genomic locations of KSHV ORFs are depicted below the histogram. The blue rectangular areas are locations that comprise high SUMO-2/3 levels after KSHV reactivation (Yang et al. 2015). (B) Total cell lysates (TCLs) from TREx-MH-K-Rta-shCtrl and -shJMJD2A BCBL-1 cells before and after Dox treatment (12 hrs) were immunoblotted with antibodies as indicated. Ratio is the relative signal of K-Rta or K-bZIP to GAPDH observed for Dox treatment at 12 hrs using TREx-MH-K-Rta-shCtrl BCBL-1 cells set as 1.0. (C) ChIP was performed with chromatin prepared from cells treated as described in (B) using rabbit IgG, anti-SUMO-2/3 (upper panel) and anti-JMJD2A (lower panel) antibodies. ChIP DNA was quantified by real-time quantitative PCR (qPCR) using primer pairs specific for promoter regions of KSHV K6 , PAN , K-bZIP , Orf52 , Orf23 and Orf25 . (Data represent mean±SEM. n = 3. ** p

    Journal: PLoS Pathogens

    Article Title: SUMO modification of a heterochromatin histone demethylase JMJD2A enables viral gene transactivation and viral replication

    doi: 10.1371/journal.ppat.1006216

    Figure Lengend Snippet: JMJD2A is required for efficient SUMO-2/3 enrichment on the viral genome during KSHV reactivation. (A) ChIP-on-chip analysis of JMJD2A binding across the KSHV lytic genome. A JMJD2A ChIP assay was performed on TREx-MH-K-Rta BCBL-1 cells treated with 0.2 μg/ml doxycycline (Dox) for 12 hours (hrs). The genomic locations of KSHV ORFs are depicted below the histogram. The blue rectangular areas are locations that comprise high SUMO-2/3 levels after KSHV reactivation (Yang et al. 2015). (B) Total cell lysates (TCLs) from TREx-MH-K-Rta-shCtrl and -shJMJD2A BCBL-1 cells before and after Dox treatment (12 hrs) were immunoblotted with antibodies as indicated. Ratio is the relative signal of K-Rta or K-bZIP to GAPDH observed for Dox treatment at 12 hrs using TREx-MH-K-Rta-shCtrl BCBL-1 cells set as 1.0. (C) ChIP was performed with chromatin prepared from cells treated as described in (B) using rabbit IgG, anti-SUMO-2/3 (upper panel) and anti-JMJD2A (lower panel) antibodies. ChIP DNA was quantified by real-time quantitative PCR (qPCR) using primer pairs specific for promoter regions of KSHV K6 , PAN , K-bZIP , Orf52 , Orf23 and Orf25 . (Data represent mean±SEM. n = 3. ** p

    Article Snippet: ChIP DNA was confirmed for successful IP using SYBR Green-Based real-time qPCR analysis by CFX connect real-time PCR detection system (Bio-Rad, Richmond, CA).

    Techniques: Chromatin Immunoprecipitation, Binding Assay, Real-time Polymerase Chain Reaction

    JMJD2A SUMOylation affects the expression of cellular genes involved in cancer. (A and B) WT JMJD2A but not its K471R mutant rescue proliferation of JMJD2A knockdown SLK (A) and BCBL-1 (B) cells. (A) SLK cells were sequentially infected with lentivirus expressing JMJD2A shRNA and Flag-tagged WT or K471R of JMJD2A. Cell proliferation was assessed by MTT assay. (B) Proliferation of TREx-MH-K-Rta-shJMJD2A, shJMJD2A-Flag-JMJD2A-WT and -K471R BCBL-1 cell lines was assessed by MTT assay. (C) Gene function analysis of cellular genes less upregulated in SUMOylation-deficient JMJD2A mutant (K471R) compared to JMJD2A-WT 24 hrs after KSHV reactivation. Gene list was shown in S7 Table . (D) Genes present in more than five identified functional pathways in (C). The plus (+) indicates genes with JMJD2A binding on the promoter region (transcription start site (TSS) ± 500bp). Gene list was shown in S8 Table . (E) RT-qPCR verification of TBX3 expression in TREx-MH-K-Rta-shJMJD2A, -shJMJD2A-Flag-JMJD2A-WT and -K471R BCBL-1 cells. (F) qPCR was performed with ChIP DNA from Fig 6A using primer pairs specific for promoter region of TBX3 (G) Schematic diagram illustrates the SUMO modification of JMJD2A in regulation gene transcription during KSHV reactivation.

    Journal: PLoS Pathogens

    Article Title: SUMO modification of a heterochromatin histone demethylase JMJD2A enables viral gene transactivation and viral replication

    doi: 10.1371/journal.ppat.1006216

    Figure Lengend Snippet: JMJD2A SUMOylation affects the expression of cellular genes involved in cancer. (A and B) WT JMJD2A but not its K471R mutant rescue proliferation of JMJD2A knockdown SLK (A) and BCBL-1 (B) cells. (A) SLK cells were sequentially infected with lentivirus expressing JMJD2A shRNA and Flag-tagged WT or K471R of JMJD2A. Cell proliferation was assessed by MTT assay. (B) Proliferation of TREx-MH-K-Rta-shJMJD2A, shJMJD2A-Flag-JMJD2A-WT and -K471R BCBL-1 cell lines was assessed by MTT assay. (C) Gene function analysis of cellular genes less upregulated in SUMOylation-deficient JMJD2A mutant (K471R) compared to JMJD2A-WT 24 hrs after KSHV reactivation. Gene list was shown in S7 Table . (D) Genes present in more than five identified functional pathways in (C). The plus (+) indicates genes with JMJD2A binding on the promoter region (transcription start site (TSS) ± 500bp). Gene list was shown in S8 Table . (E) RT-qPCR verification of TBX3 expression in TREx-MH-K-Rta-shJMJD2A, -shJMJD2A-Flag-JMJD2A-WT and -K471R BCBL-1 cells. (F) qPCR was performed with ChIP DNA from Fig 6A using primer pairs specific for promoter region of TBX3 (G) Schematic diagram illustrates the SUMO modification of JMJD2A in regulation gene transcription during KSHV reactivation.

    Article Snippet: ChIP DNA was confirmed for successful IP using SYBR Green-Based real-time qPCR analysis by CFX connect real-time PCR detection system (Bio-Rad, Richmond, CA).

    Techniques: Expressing, Mutagenesis, Infection, shRNA, MTT Assay, Functional Assay, Binding Assay, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation, Modification

    cmvIL-10 does not impact CXCR4 gene expression or protein levels. HEK293 cells were treated with CXCL12 (100 ng/ml) and/or cmvIL-10 (100 ng/ml) for 2 h or 24 h. (A) Total RNA was harvested for qPCR analysis. Fold change was calculated relative to the mock-treated control (Con) cells. Error bars, standard error for 3 replicates. (B) The cDNA from the experiment whose data are shown in panel A was used to amplify CXCR4 or β-actin by PCR. The resulting products were visualized via agarose gel electrophoresis. (C) Cells were treated as described above and then lysed, and total protein was harvested and immunoblotted for CXCR4 or total MAPK (protein loading control).

    Journal: Journal of Virology

    Article Title: Human Cytomegalovirus UL111A and US27 Gene Products Enhance the CXCL12/CXCR4 Signaling Axis via Distinct Mechanisms

    doi: 10.1128/JVI.01981-17

    Figure Lengend Snippet: cmvIL-10 does not impact CXCR4 gene expression or protein levels. HEK293 cells were treated with CXCL12 (100 ng/ml) and/or cmvIL-10 (100 ng/ml) for 2 h or 24 h. (A) Total RNA was harvested for qPCR analysis. Fold change was calculated relative to the mock-treated control (Con) cells. Error bars, standard error for 3 replicates. (B) The cDNA from the experiment whose data are shown in panel A was used to amplify CXCR4 or β-actin by PCR. The resulting products were visualized via agarose gel electrophoresis. (C) Cells were treated as described above and then lysed, and total protein was harvested and immunoblotted for CXCR4 or total MAPK (protein loading control).

    Article Snippet: Quantitative real-time PCR (qPCR) was performed using the CXCR4 and β-actin primers described above using the CFX96 real-time machine (Bio-Rad, Hercules, CA) and SYBR green with the following parameters: 95°C for 10 min and 40 cycles of 95°C for 15 s and 60°C for 1 min. Data were analyzed using the ΔΔ CT method (where CT is threshold cycle) as described previously ( ).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    KLF15 is the major Kruppel-Like Factor in HPMEC and important regulator of critical endothelial enzymes- Arginase 2 and eNOS Total RNA from Human Pulmonary Microvascular endothelial cells was converted to cDNA and the relative mRNA expression of KLF15 was determined in quiescent HPMEC using real-time PCR (N=3), B) Cell lysates from HPMEC, human coronary artery endothelial cells (HCAEC), Human Aortic Endothelial Cells (HAEC), Human Aortic Smooth Muscle Cells (HASMC) were subjected to western blotting with KLF15, eNOS and β-tubulin antibodies (N=4). Cell lysates from HPMEC overexpressing HA-KLF15 was used as a positive control, C) Total RNA from Human Pulmonary Microvascular endothelial cells was converted to cDNA and the relative mRNA expression of KLF2, 4 and 15 was determined in quiescent HPMEC using real-time PCR (N=3) *p

    Journal: Arteriosclerosis, thrombosis, and vascular biology

    Article Title: Hypoxia Triggers SENP1 Modulation of Kruppel-Like Factor 15 and Transcriptional Regulation of Arginase 2 in Pulmonary Endothelium

    doi: 10.1161/ATVBAHA.117.310660

    Figure Lengend Snippet: KLF15 is the major Kruppel-Like Factor in HPMEC and important regulator of critical endothelial enzymes- Arginase 2 and eNOS Total RNA from Human Pulmonary Microvascular endothelial cells was converted to cDNA and the relative mRNA expression of KLF15 was determined in quiescent HPMEC using real-time PCR (N=3), B) Cell lysates from HPMEC, human coronary artery endothelial cells (HCAEC), Human Aortic Endothelial Cells (HAEC), Human Aortic Smooth Muscle Cells (HASMC) were subjected to western blotting with KLF15, eNOS and β-tubulin antibodies (N=4). Cell lysates from HPMEC overexpressing HA-KLF15 was used as a positive control, C) Total RNA from Human Pulmonary Microvascular endothelial cells was converted to cDNA and the relative mRNA expression of KLF2, 4 and 15 was determined in quiescent HPMEC using real-time PCR (N=3) *p

    Article Snippet: RNA was then reverse transcribed with oligo dT primers to obtain cDNA and quantitative real time PCR (Applied Biosystems) was performed using SYBR Green Supermix mix (Applied Biosystems) whereas semi-quantitative RTPCR was performed using a conventional Biorad PCR machine and the following primer sets: Human Arg2 : Forward: 5′-GGG CCC TGA AGG CTG TAG-3′, Reverse: 5′-AAT GGA GCC ACT GCC ATC-3′.

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Western Blot, Positive Control

    Real-time PCR of OC mRNA expression. The expression in the immediate group was significantly higher than in the control and 1-wk group. Although a similar tendency of increased OC expression was seen in the 1-wk group as compared with the control group, there was no significant difference. * p

    Journal: International Journal of Stem Cells

    Article Title: Cell Sheet Injection as a Technique of Osteogenic Supply

    doi:

    Figure Lengend Snippet: Real-time PCR of OC mRNA expression. The expression in the immediate group was significantly higher than in the control and 1-wk group. Although a similar tendency of increased OC expression was seen in the 1-wk group as compared with the control group, there was no significant difference. * p

    Article Snippet: To measure the mRNA expression levels, we conducted real-time quantitative PCR (ABI PRISM 7700 Sequence Detection System; Applied Biosystems, Norwalk, CT, USA), using the respective primers and specific fluorogenic probes of OC and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, internal standard) for rat cDNAs as described previously ( , ).

    Techniques: Real-time Polymerase Chain Reaction, Expressing

    IPA Network Analysis Genes in Cluster 4. (a) IPA Network analysis was generated by seeding the genes within cluster 4 (blue highlighted genes) and “growing” those genes into a network by displaying direct (solid lines) and indirect (dashed lines) connections. All orphan genes were removed. Genes added to the network are illustrated with purple lines. (b) qRT-PCR was performed for node genes IRS1, OPA3, and POU6F1 to identify the associated gene expression profiles. The average ΔCt was calculated for each experimental group, where ΔCt = Ct (gene of interest)–Ct (Housekeeper gene–GAPDH). Data are shown ± S.D.

    Journal: PLoS ONE

    Article Title: Transcriptomic analysis of neuregulin-1 regulated genes following ischemic stroke by computational identification of promoter binding sites: A role for the ETS-1 transcription factor

    doi: 10.1371/journal.pone.0197092

    Figure Lengend Snippet: IPA Network Analysis Genes in Cluster 4. (a) IPA Network analysis was generated by seeding the genes within cluster 4 (blue highlighted genes) and “growing” those genes into a network by displaying direct (solid lines) and indirect (dashed lines) connections. All orphan genes were removed. Genes added to the network are illustrated with purple lines. (b) qRT-PCR was performed for node genes IRS1, OPA3, and POU6F1 to identify the associated gene expression profiles. The average ΔCt was calculated for each experimental group, where ΔCt = Ct (gene of interest)–Ct (Housekeeper gene–GAPDH). Data are shown ± S.D.

    Article Snippet: Quantitative real-time PCR (qRT-PCR) was performed using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad Laboratories, Inc., Hercules, California) along with custom oligo primers for IRS1 (forward: CTGCATCGGACTCTACCAGG ; reverse: CGAGGACTAAGTCTCCCCCA ), OPA3 (forward: AGAGTGCAATTGATGCCCCA ; reverse: TGAGGGGATCTGTACAGGCA ) POU6F1 (forward: TGACTATGCTCTTCCTCCCCT ; reverse: CACAGGAGGGGAAATACAGTTGA ); SK1/Kcnn1 (forward: TCATCTCCATTACCTTCCTG ; reverse: AGCCTGGTGTGTTTGTAGAT ), SK2/Kcnn2 (forward: ACCTGCACGAGATGGACTCA ; reverse: TTGTGCTCCGGCTTAGACAC ); ERG1 (forward: CAACATCGCCACAGGAGA ; reverse: ACACGGTACTCAGGGTCCAT ) ERG2/Kcnh6/Kv11.2 (forward: AGATTGGAGTCCCGTGTGTC ; reverse: TCCCACCAGAAGCGTAGACT ) (Life Technologies, Rockville, MD), according to manufacturing guidelines.

    Techniques: Indirect Immunoperoxidase Assay, Generated, Quantitative RT-PCR, Expressing

    The activated signaling pathways and upregulation of gene and protein associated with invasion induced by astrocytes A. Western blot analysis of protein lysates prepared from U251 or A172 exposed to astrocytes condition medium (ACM) for the times indicated. B, C. Graphic representations of qRT-PCR results for invasion related gene expression changes induced in U251 or A172 in co-culture with astrocytes. Total RNA was extracted from U251 or A172 glioma cells were incubated with ACM for 48 h where DMEM containing 3% FBS was used as the control. * p

    Journal: Oncotarget

    Article Title: Human astrocytes secrete IL-6 to promote glioma migration and invasion through upregulation of cytomembrane MMP14

    doi: 10.18632/oncotarget.11515

    Figure Lengend Snippet: The activated signaling pathways and upregulation of gene and protein associated with invasion induced by astrocytes A. Western blot analysis of protein lysates prepared from U251 or A172 exposed to astrocytes condition medium (ACM) for the times indicated. B, C. Graphic representations of qRT-PCR results for invasion related gene expression changes induced in U251 or A172 in co-culture with astrocytes. Total RNA was extracted from U251 or A172 glioma cells were incubated with ACM for 48 h where DMEM containing 3% FBS was used as the control. * p

    Article Snippet: RNA isolation and quantitative real-time PCR After incubation with ACM or transfection with siRNA for 48 h, total RNA was isolated from glioma cells using TRIzol. cDNA was synthesized with the ReverTra Ace qPCR RT Kit (Toyobo) according to the manufacturer's instructions. mRNA expression levels of different genes was determined with qRT-PCR.

    Techniques: Western Blot, Quantitative RT-PCR, Expressing, Co-Culture Assay, Incubation

    Mutations in ref(2)P result in the accumulation of mtDNA. ( a ) Regular mitochondrial distribution is disrupted in ref(2)P mutants and the number of mtDNA nucleoids (mt) is increased. PicoGreen also labels the dsDNA of muscle nuclei (nuc). ( b ) ref(2)P mutants flies showed an increase in mtDNA. The ratio of mtDNA to nDNA was measured using real-time quantitative PCR in flies with the indicated ages (mean±S.D., n =9 per genotype). Statistically significant values relative to the control ( w 1118 ) are indicated by asterisks (one-way ANOVA with Dunnett's multiple comparison test). ( c and d ) Mutations in ref(2)P do not cause alterations in mitochondrial protein density. Protein density was determined in 26-day-old flies with the indicated genotypes by determining the concentration of Cyt c using an ELISA assay ( d ) and by measuring the activity of the mitochondrial matrix enzyme citrate synthase ( c ). Data are shown as the mean ±S.E.M ( n =3 in each group). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test). ( e ) Analysis of the mtTFA levels in ref(2)P mutants. Lysates prepared from adult flies were subjected to western blot analysis with the indicated antibodies. ( f ) Normal respiration in ref(2)P mutant flies. Activity of the indicated complexes in coupled mitochondria was measured in 3-day-old flies using high-resolution respirometry. Data are shown as the mean±S.E.M. ( n ≥4 in each genotype). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test)

    Journal: Cell Death & Disease

    Article Title: Drosophila ref(2)P is required for the parkin-mediated suppression of mitochondrial dysfunction in pink1 mutants

    doi: 10.1038/cddis.2013.394

    Figure Lengend Snippet: Mutations in ref(2)P result in the accumulation of mtDNA. ( a ) Regular mitochondrial distribution is disrupted in ref(2)P mutants and the number of mtDNA nucleoids (mt) is increased. PicoGreen also labels the dsDNA of muscle nuclei (nuc). ( b ) ref(2)P mutants flies showed an increase in mtDNA. The ratio of mtDNA to nDNA was measured using real-time quantitative PCR in flies with the indicated ages (mean±S.D., n =9 per genotype). Statistically significant values relative to the control ( w 1118 ) are indicated by asterisks (one-way ANOVA with Dunnett's multiple comparison test). ( c and d ) Mutations in ref(2)P do not cause alterations in mitochondrial protein density. Protein density was determined in 26-day-old flies with the indicated genotypes by determining the concentration of Cyt c using an ELISA assay ( d ) and by measuring the activity of the mitochondrial matrix enzyme citrate synthase ( c ). Data are shown as the mean ±S.E.M ( n =3 in each group). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test). ( e ) Analysis of the mtTFA levels in ref(2)P mutants. Lysates prepared from adult flies were subjected to western blot analysis with the indicated antibodies. ( f ) Normal respiration in ref(2)P mutant flies. Activity of the indicated complexes in coupled mitochondria was measured in 3-day-old flies using high-resolution respirometry. Data are shown as the mean±S.E.M. ( n ≥4 in each genotype). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test)

    Article Snippet: PCR amplification of mtDNA Analysis of the mtDNA content was performed using quantitative real-time PCR on an Mx4000 (Stratagene, Santa Clara, CA, USA) real-time cycler using QuantiTect SYBR Green PCR system (QIAGEN, Manchester, UK).

    Techniques: Real-time Polymerase Chain Reaction, Concentration Assay, Enzyme-linked Immunosorbent Assay, Activity Assay, Western Blot, Mutagenesis

    miR-33a knockdown induces EMT and metastasis and miR-33a overexpression blocks EMT and metastasis. ( A ) SPC-A-1 cells was transfected with miR-33a inhibitors (anti-miR-33a) or inhibitor NC (Ctrl RNA) and ( B ) NCI-H1299 cells was transfected with miR-33a mimics (miR-33a) or mimics NC (Ctrl RNA), the levels of mature miR-33a were confirmed by quantitative RT-PCR. Western Blotting was performed after the transfection of RNAs. The changes of epithelial cell biomarker E-cadherin and mesenchymal cell biomarker Vimentin were shown in SPC-A-1 ( C ) and NCI-H1299 ( D ) cells. The migration and invasion capability were respectively measured after the transfection of RNA oligos in SPC-A-1 ( E , G ) and NCI-H1299 ( F , H ) cells. * P

    Journal: Scientific Reports

    Article Title: MircoRNA-33a inhibits epithelial-to-mesenchymal transition and metastasis and could be a prognostic marker in non-small cell lung cancer

    doi: 10.1038/srep13677

    Figure Lengend Snippet: miR-33a knockdown induces EMT and metastasis and miR-33a overexpression blocks EMT and metastasis. ( A ) SPC-A-1 cells was transfected with miR-33a inhibitors (anti-miR-33a) or inhibitor NC (Ctrl RNA) and ( B ) NCI-H1299 cells was transfected with miR-33a mimics (miR-33a) or mimics NC (Ctrl RNA), the levels of mature miR-33a were confirmed by quantitative RT-PCR. Western Blotting was performed after the transfection of RNAs. The changes of epithelial cell biomarker E-cadherin and mesenchymal cell biomarker Vimentin were shown in SPC-A-1 ( C ) and NCI-H1299 ( D ) cells. The migration and invasion capability were respectively measured after the transfection of RNA oligos in SPC-A-1 ( E , G ) and NCI-H1299 ( F , H ) cells. * P

    Article Snippet: For the miR-33a quantification, real-time quantitative PCR of miR-33a was performed on a Mx3005P system (Stratagene, USA) using the Hairpin-itTM miR qPCR quantification kit (GenePharma, China) and the SYBR Premix ExTaq II reagent (Takara, Japan).

    Techniques: Over Expression, Transfection, Quantitative RT-PCR, Western Blot, Biomarker Assay, Migration

    Low-expression of miR-33a predicts poor prognosis in NSCLC patients. ( A ) Relative miR-33a expression levels were measured in 53 pairs of NSCLC tumor and non-tumor tissue samples by real-time quantitative RT-PCR. ( B ) The association of local invasion and overall survival in NSCLC patients. ( C ) The expression level of miR-33a in relation to overall survival in NSCLC patients. *** P

    Journal: Scientific Reports

    Article Title: MircoRNA-33a inhibits epithelial-to-mesenchymal transition and metastasis and could be a prognostic marker in non-small cell lung cancer

    doi: 10.1038/srep13677

    Figure Lengend Snippet: Low-expression of miR-33a predicts poor prognosis in NSCLC patients. ( A ) Relative miR-33a expression levels were measured in 53 pairs of NSCLC tumor and non-tumor tissue samples by real-time quantitative RT-PCR. ( B ) The association of local invasion and overall survival in NSCLC patients. ( C ) The expression level of miR-33a in relation to overall survival in NSCLC patients. *** P

    Article Snippet: For the miR-33a quantification, real-time quantitative PCR of miR-33a was performed on a Mx3005P system (Stratagene, USA) using the Hairpin-itTM miR qPCR quantification kit (GenePharma, China) and the SYBR Premix ExTaq II reagent (Takara, Japan).

    Techniques: Expressing, Quantitative RT-PCR

    CNM affected expression of osteoclastogenic markers in M-CSF+RANKL induced osteoclastogenesis. (A-G) mouse bone marrow macrophages (BMM) were incubated in the presence of M-CSF (30ng/mL) and RANKL, (10ng/mL) and with or without CNM (2.5, 5 and 10μg/mL). At day three, RNA was extracted and the mRNA expression of NFATc1(A), Trap/Acp5 (B), Itgb3 (C), V-ATPase (D), Ctsk(E) and Mmp9 (F) was analyzed by quantitative PCR (RT-qPCR). The graphs represents mean ± SEM. For protein levels, BMMs were cultured as describes above and the total cell lysates were subjected to Western blots with the indicate specific antibodies (G). β-Actin was used as a loading control. The graph represents the densitometric measurement normalized by β-Actin and bars represents mean ± SEM (H). All gels were run under the same experimental conditions. All results are representative of at least three independent experiments. One-way ANOVA with Bonferroni’s multiple comparison tests was used to determine statistical significance. *p

    Journal: Journal of natural products

    Article Title: Effects of cinnamoyloxy-mammeisin from geopropolis on osteoclast differentiation and Porphyromonas gingivalis-induced periodontitis

    doi: 10.1021/acs.jnatprod.7b00194

    Figure Lengend Snippet: CNM affected expression of osteoclastogenic markers in M-CSF+RANKL induced osteoclastogenesis. (A-G) mouse bone marrow macrophages (BMM) were incubated in the presence of M-CSF (30ng/mL) and RANKL, (10ng/mL) and with or without CNM (2.5, 5 and 10μg/mL). At day three, RNA was extracted and the mRNA expression of NFATc1(A), Trap/Acp5 (B), Itgb3 (C), V-ATPase (D), Ctsk(E) and Mmp9 (F) was analyzed by quantitative PCR (RT-qPCR). The graphs represents mean ± SEM. For protein levels, BMMs were cultured as describes above and the total cell lysates were subjected to Western blots with the indicate specific antibodies (G). β-Actin was used as a loading control. The graph represents the densitometric measurement normalized by β-Actin and bars represents mean ± SEM (H). All gels were run under the same experimental conditions. All results are representative of at least three independent experiments. One-way ANOVA with Bonferroni’s multiple comparison tests was used to determine statistical significance. *p

    Article Snippet: Quantitative real-time PCR (qPCR) was performed on StepOnePlus™ system using a predesigned TaqMan® primers/probes set (ThermoScientific-Applied Biosystems).

    Techniques: Expressing, Incubation, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Cell Culture, Western Blot

    The preventive effects of AMPK on the senescence associated with NAD + synthesis. (A) Cellular concentrations of NAD + on day 3 or day 5 after H 2 O 2 treatment. (B) Representative images of SA ‐β‐Gal staining of cells (left) and percentage of SA ‐β‐Gal‐positive cells (right). (C) Cellular concentrations of NAD + in the cells incubated with nicotinamide mononucleotide ( NMN ) for 3 days after H 2 O 2 treatment. (D) H 2 O 2 ‐treated cells were incubated with Met (10 mM ), BBR (10 μM), or CC (10 μM) for 3 days. The concentrations of NAD + are shown. (E) A schematic diagram of two pathways of NAD + synthesis. Red ones indicate rate‐limiting enzymes, and blue ones illustrate the enzyme inhibitors we used. (F) Relative fold‐changes in the mRNA levels of NAMPT , as monitored by qRT ‐ PCR (left), and representative images from immunoblot assays against NAMPT are shown (right). The ratio of NAMPT to actin was quantified by densitometry, based on the immunoblot images from three independent experiments. (G) Cells were incubated with Met, BBR , and CC for 3 days. Representative images from immunoblots against NAMPT are shown. The ratio of NAMPT to β‐actin was quantified by densitometry based on the immunoblot images from three independent experiments. (H) H 2 O 2 ‐treated NIH 3T3 cells were incubated with NAMPT inhibitor ( FK 866, 5 nM ), QPRT inhibitor ( PHTH , 1 mM ), Met (10 mM ), and BBR (10 μM) alone or in combination as indicated for 3 days. The percentages of SA ‐β‐Gal‐positive cells are shown. (I) The mRNA levels of NMNAT 1 , NMNAT 2 , and NMNAT 3 genes in the cells infected with corresponding lentivirus‐sh RNA or nontargeting sh RNA (sh CON ) as determined by qRT ‐ PCR . (J) Cellular concentrations of NAD + in sh RNA ‐infected cells. (K) Cells infected with sh RNA s were treated with H 2 O 2 and incubated with BBR for 3 days. Representative images of SA ‐β‐Gal staining of cells (left) and percentages of SA ‐β‐Gal‐positive cells (right). * P

    Journal: Aging Cell

    Article Title: AMPK activation protects cells from oxidative stress‐induced senescence via autophagic flux restoration and intracellular NAD+ elevation

    doi: 10.1111/acel.12446

    Figure Lengend Snippet: The preventive effects of AMPK on the senescence associated with NAD + synthesis. (A) Cellular concentrations of NAD + on day 3 or day 5 after H 2 O 2 treatment. (B) Representative images of SA ‐β‐Gal staining of cells (left) and percentage of SA ‐β‐Gal‐positive cells (right). (C) Cellular concentrations of NAD + in the cells incubated with nicotinamide mononucleotide ( NMN ) for 3 days after H 2 O 2 treatment. (D) H 2 O 2 ‐treated cells were incubated with Met (10 mM ), BBR (10 μM), or CC (10 μM) for 3 days. The concentrations of NAD + are shown. (E) A schematic diagram of two pathways of NAD + synthesis. Red ones indicate rate‐limiting enzymes, and blue ones illustrate the enzyme inhibitors we used. (F) Relative fold‐changes in the mRNA levels of NAMPT , as monitored by qRT ‐ PCR (left), and representative images from immunoblot assays against NAMPT are shown (right). The ratio of NAMPT to actin was quantified by densitometry, based on the immunoblot images from three independent experiments. (G) Cells were incubated with Met, BBR , and CC for 3 days. Representative images from immunoblots against NAMPT are shown. The ratio of NAMPT to β‐actin was quantified by densitometry based on the immunoblot images from three independent experiments. (H) H 2 O 2 ‐treated NIH 3T3 cells were incubated with NAMPT inhibitor ( FK 866, 5 nM ), QPRT inhibitor ( PHTH , 1 mM ), Met (10 mM ), and BBR (10 μM) alone or in combination as indicated for 3 days. The percentages of SA ‐β‐Gal‐positive cells are shown. (I) The mRNA levels of NMNAT 1 , NMNAT 2 , and NMNAT 3 genes in the cells infected with corresponding lentivirus‐sh RNA or nontargeting sh RNA (sh CON ) as determined by qRT ‐ PCR . (J) Cellular concentrations of NAD + in sh RNA ‐infected cells. (K) Cells infected with sh RNA s were treated with H 2 O 2 and incubated with BBR for 3 days. Representative images of SA ‐β‐Gal staining of cells (left) and percentages of SA ‐β‐Gal‐positive cells (right). * P

    Article Snippet: Quantitative real‐time polymerase chain reaction (qRT‐PCR) was performed using SYBR Green Supermix kit (Bio‐Rad, CA, USA) on a Bio‐Rad IQ5 system.

    Techniques: Staining, Incubation, Quantitative RT-PCR, Western Blot, Infection

    AMPK restored the autophagic flux associated with the amelioration of lysosomal function, mTOR inactivation, but not the nuclear translocation of TFEB . A‐C: H 2 O 2 ‐treated NIH 3T3 cells were incubated in complete medium with different reagents for 3 days as indicated. (A) Representative images from immunoblot assays against Cathepsin B protein. (B) The acid phosphatase activity in cells. (C) Representative images from immunoblot assays against phosphorylated mTOR (pm TOR , Ser2448), phosphorylated 70S6K (P‐p70S6K, Thr389), pAMPK (Thr172), and β‐actin. (D) Immunofluorescent images of TFEB after treatment with indicated reagents. The bar represents 20 μm. (E) Immunoblot assays against TFEB protein of total cytoplasmic and nuclear subcellular fractions obtained from NIH 3T3 cells with the indicated treatment. (F) Relative fold‐changes in mRNA levels of two TFEB target genes ( GNS and LAMP ‐1 ) were monitored by qRT ‐ PCR assays.* P

    Journal: Aging Cell

    Article Title: AMPK activation protects cells from oxidative stress‐induced senescence via autophagic flux restoration and intracellular NAD+ elevation

    doi: 10.1111/acel.12446

    Figure Lengend Snippet: AMPK restored the autophagic flux associated with the amelioration of lysosomal function, mTOR inactivation, but not the nuclear translocation of TFEB . A‐C: H 2 O 2 ‐treated NIH 3T3 cells were incubated in complete medium with different reagents for 3 days as indicated. (A) Representative images from immunoblot assays against Cathepsin B protein. (B) The acid phosphatase activity in cells. (C) Representative images from immunoblot assays against phosphorylated mTOR (pm TOR , Ser2448), phosphorylated 70S6K (P‐p70S6K, Thr389), pAMPK (Thr172), and β‐actin. (D) Immunofluorescent images of TFEB after treatment with indicated reagents. The bar represents 20 μm. (E) Immunoblot assays against TFEB protein of total cytoplasmic and nuclear subcellular fractions obtained from NIH 3T3 cells with the indicated treatment. (F) Relative fold‐changes in mRNA levels of two TFEB target genes ( GNS and LAMP ‐1 ) were monitored by qRT ‐ PCR assays.* P

    Article Snippet: Quantitative real‐time polymerase chain reaction (qRT‐PCR) was performed using SYBR Green Supermix kit (Bio‐Rad, CA, USA) on a Bio‐Rad IQ5 system.

    Techniques: Translocation Assay, Incubation, Activity Assay, Quantitative RT-PCR

    Activation of AMPK prevented H 2 O 2 ‐induced senescence. A to D: H 2 O 2 ‐treated NIH 3T3 cells were incubated in complete medium with metformin (Met, 5 to 10 mM ) or berberine ( BBR , 5 to 10 μM) for 3 days. (A) Representative images from immunoblot assays against pAMPK α (Thr172), AMPK α1, pACC (Ser79), and β‐actin. (B) Relative fold‐changes in mRNA levels of CPT ‐1 and FAS as determined by qRT ‐ PCR . (C) Representative images of SA ‐β‐Gal staining of cells (left), and percentages of SA ‐β‐Gal‐positive cells. D‐F: NIH 3T3 cells were treated with H 2 O 2 and incubated with Met (10 mM ), BBR (10 μM) and an AMPK inhibitor, Compound C ( CC , 10 μM), alone or in combination for 3 days. (D) Representative images from immunoblot assays. (E) Relative mRNA levels of CPT ‐1 and FAS as determined by qRT ‐ PCR . (F) Representative images of SA ‐β‐Gal staining of cells (left) and percentages of SA ‐β‐Gal‐positive cells (right). G‐I: NIH 3T3 cells without H 2 O 2 treatment were used. (G) The decrease in AMPK activity in DN ‐ AMPK ‐expressing NIH 3T3 cells was shown by the decrease in AMPK α phosphorylation. (H) Representative images of SA ‐β‐Gal staining of the nontransfected cells with or without CC (upper) and cells transfection with DN ‐ AMPK (lower). (I) The percentages of SA ‐β‐Gal‐positive cells were calculated based on the images represented in H. (J) H 2 O 2 ‐treated cells incubated with or without Met (10 mM ) or BBR (10 μM) for 3 days, representative images of SA ‐β‐Gal staining of cells transfected with empty vector (upper) or DN ‐ AMPK (lower). (K) The percentages of SA ‐β‐Gal‐positive cells were calculated based on the images presented in J. * P

    Journal: Aging Cell

    Article Title: AMPK activation protects cells from oxidative stress‐induced senescence via autophagic flux restoration and intracellular NAD+ elevation

    doi: 10.1111/acel.12446

    Figure Lengend Snippet: Activation of AMPK prevented H 2 O 2 ‐induced senescence. A to D: H 2 O 2 ‐treated NIH 3T3 cells were incubated in complete medium with metformin (Met, 5 to 10 mM ) or berberine ( BBR , 5 to 10 μM) for 3 days. (A) Representative images from immunoblot assays against pAMPK α (Thr172), AMPK α1, pACC (Ser79), and β‐actin. (B) Relative fold‐changes in mRNA levels of CPT ‐1 and FAS as determined by qRT ‐ PCR . (C) Representative images of SA ‐β‐Gal staining of cells (left), and percentages of SA ‐β‐Gal‐positive cells. D‐F: NIH 3T3 cells were treated with H 2 O 2 and incubated with Met (10 mM ), BBR (10 μM) and an AMPK inhibitor, Compound C ( CC , 10 μM), alone or in combination for 3 days. (D) Representative images from immunoblot assays. (E) Relative mRNA levels of CPT ‐1 and FAS as determined by qRT ‐ PCR . (F) Representative images of SA ‐β‐Gal staining of cells (left) and percentages of SA ‐β‐Gal‐positive cells (right). G‐I: NIH 3T3 cells without H 2 O 2 treatment were used. (G) The decrease in AMPK activity in DN ‐ AMPK ‐expressing NIH 3T3 cells was shown by the decrease in AMPK α phosphorylation. (H) Representative images of SA ‐β‐Gal staining of the nontransfected cells with or without CC (upper) and cells transfection with DN ‐ AMPK (lower). (I) The percentages of SA ‐β‐Gal‐positive cells were calculated based on the images represented in H. (J) H 2 O 2 ‐treated cells incubated with or without Met (10 mM ) or BBR (10 μM) for 3 days, representative images of SA ‐β‐Gal staining of cells transfected with empty vector (upper) or DN ‐ AMPK (lower). (K) The percentages of SA ‐β‐Gal‐positive cells were calculated based on the images presented in J. * P

    Article Snippet: Quantitative real‐time polymerase chain reaction (qRT‐PCR) was performed using SYBR Green Supermix kit (Bio‐Rad, CA, USA) on a Bio‐Rad IQ5 system.

    Techniques: Activation Assay, Incubation, Cycling Probe Technology, Quantitative RT-PCR, Staining, Activity Assay, Expressing, Transfection, Plasmid Preparation

    H 2 O 2 induced senescence and AMPK pathway inhibition in NIH 3T3 Cells. Cells were treated with H 2 O 2 and incubated in complete medium without H 2 O 2 for 3‐5 days. CTL means untreated cells. (A) Representative images of SA ‐β‐Gal staining of the cells (left) and percentages of SA ‐β‐Gal‐positive cells in a total of 1000 cells (right). (B) Representative images of SAHF s in cells (left) and percentages of SAHF s‐positive cells in 1000 cells (right). (C) Representative images from immunoblot assays against p53 and β‐actin. (D) Relative fold‐changes in the mRNA levels of the genes encoding p21, IL 6 and IL 8 , as determined by qRT ‐ PCR . (E) Representative images from immunoblot assays against phosphorylated AMPK α ( pAMPK , Thr172), AMPK α1, phosphorylated ACC ( pACC , Ser79), and β‐actin. (F) The ratio of pAMPK to total AMPK was quantified by densitometry based on immunoblot images from three independent experiments. (G) Relative fold‐changes in the mRNA levels of two AMPK target genes ( CPT ‐1 and FAS ) were monitored by qRT ‐ PCR assays. * P

    Journal: Aging Cell

    Article Title: AMPK activation protects cells from oxidative stress‐induced senescence via autophagic flux restoration and intracellular NAD+ elevation

    doi: 10.1111/acel.12446

    Figure Lengend Snippet: H 2 O 2 induced senescence and AMPK pathway inhibition in NIH 3T3 Cells. Cells were treated with H 2 O 2 and incubated in complete medium without H 2 O 2 for 3‐5 days. CTL means untreated cells. (A) Representative images of SA ‐β‐Gal staining of the cells (left) and percentages of SA ‐β‐Gal‐positive cells in a total of 1000 cells (right). (B) Representative images of SAHF s in cells (left) and percentages of SAHF s‐positive cells in 1000 cells (right). (C) Representative images from immunoblot assays against p53 and β‐actin. (D) Relative fold‐changes in the mRNA levels of the genes encoding p21, IL 6 and IL 8 , as determined by qRT ‐ PCR . (E) Representative images from immunoblot assays against phosphorylated AMPK α ( pAMPK , Thr172), AMPK α1, phosphorylated ACC ( pACC , Ser79), and β‐actin. (F) The ratio of pAMPK to total AMPK was quantified by densitometry based on immunoblot images from three independent experiments. (G) Relative fold‐changes in the mRNA levels of two AMPK target genes ( CPT ‐1 and FAS ) were monitored by qRT ‐ PCR assays. * P

    Article Snippet: Quantitative real‐time polymerase chain reaction (qRT‐PCR) was performed using SYBR Green Supermix kit (Bio‐Rad, CA, USA) on a Bio‐Rad IQ5 system.

    Techniques: Inhibition, Incubation, CTL Assay, Staining, Quantitative RT-PCR, Cycling Probe Technology

    Stable knockdown of BCORL1 in A375 cells (A-C) and A375-p47BRAF V600E [clone E9] (D-F). (A, D) Efficiency of shRNA-mediated BCORL1 silencing as shown by quantitative PCR using GAPDH as a reference gene. (B, E) Dose-response curves obtained in the presence of increasing concentrations of vemurafenib, with cells expressing a nontargeting ( shNT , blue curves) or a BCORL1-specific ( shBCORL1 , red curves) shRNA. (C, F) CRISPR/Cas9 system was used to disrupt BCORL1 gene; vemurafenib dose-response curves are shown comparing knockout ( KO ) with parental ( WT ) cells. (G) CRISPR/Cas9-mediated gene editing was used to introduce the Q1076H substitution in the endogenous BCORL1 locus; vemurafenib dose-response curves are shown comparing two mutated clones ( C8 and D7 ) with a wild-type clone ( WT ) and with parental A375 cells ( Par ). All curves are representative of at least three experiments. For all panels, extra-sum-of-squares F test was run to compare the two curves; P values are indicated at the lower-left corner, where P

    Journal: Neoplasia (New York, N.Y.)

    Article Title: Concomitant BCORL1 and BRAF Mutations in Vemurafenib-Resistant Melanoma Cells

    doi: 10.1016/j.neo.2018.02.009

    Figure Lengend Snippet: Stable knockdown of BCORL1 in A375 cells (A-C) and A375-p47BRAF V600E [clone E9] (D-F). (A, D) Efficiency of shRNA-mediated BCORL1 silencing as shown by quantitative PCR using GAPDH as a reference gene. (B, E) Dose-response curves obtained in the presence of increasing concentrations of vemurafenib, with cells expressing a nontargeting ( shNT , blue curves) or a BCORL1-specific ( shBCORL1 , red curves) shRNA. (C, F) CRISPR/Cas9 system was used to disrupt BCORL1 gene; vemurafenib dose-response curves are shown comparing knockout ( KO ) with parental ( WT ) cells. (G) CRISPR/Cas9-mediated gene editing was used to introduce the Q1076H substitution in the endogenous BCORL1 locus; vemurafenib dose-response curves are shown comparing two mutated clones ( C8 and D7 ) with a wild-type clone ( WT ) and with parental A375 cells ( Par ). All curves are representative of at least three experiments. For all panels, extra-sum-of-squares F test was run to compare the two curves; P values are indicated at the lower-left corner, where P

    Article Snippet: Real-time quantitative PCR was performed on Agilent Mx3005P QPCR System using the primers listed in Supplementary Table 1 and Brilliant III Ultra-Fast SYBR QPCR Master Mix (Agilent), following the recommended protocol.

    Techniques: shRNA, Real-time Polymerase Chain Reaction, Expressing, CRISPR, Knock-Out, Introduce, Clone Assay

    Stable silencing of IGF1R confers epithelial-like phenotypes in mesenchymal TNBC cells (A) Endogenous expression of IGF1R-β and total FAK analyzed via Western blot analysis in a panel of mesenchymal human TNBC cells. (B) Western blot confirmation of stable lentiviral knockdown of IGF1R-α/β (IGF1R-KD) in MDA-MB-231 and BT549 TNBC cells. β-actin was used as a loading control. (C) Morphological changes in MDA-MB-231 and BT549 IGF1R-KD cells compared to EV control cells four to six passages post-lentiviral infections; brightfield magnification x20. (D) Western blot analyses of mesenchymal markers (vimentin, Snail-1, ZEB-1), motility marker pFAK, and epithelial markers (E-cadherin, claudin-1, and ZO-1) in cell lines stably expressing EV control plasmid or IGF1R-KD lentiviral plasmids using specific antibodies. β-actin was used as a loading control. (E) Relative mRNA expression levels of Vimentin, ZEB-1, and E-cadherin in MDA-MB-231 EV and IGF1R-KD cell lines was detected by TaqMan quantitative RT-PCR and normalized to RPLPO. The relative amounts of transcript were described using the 2–ΔΔCt method. Data are displayed in means ± standard deviation of at least three independent experiments of each group.

    Journal: Oncotarget

    Article Title: FAK activation is required for IGF1R-mediated regulation of EMT, migration, and invasion in mesenchymal triple negative breast cancer cells

    doi:

    Figure Lengend Snippet: Stable silencing of IGF1R confers epithelial-like phenotypes in mesenchymal TNBC cells (A) Endogenous expression of IGF1R-β and total FAK analyzed via Western blot analysis in a panel of mesenchymal human TNBC cells. (B) Western blot confirmation of stable lentiviral knockdown of IGF1R-α/β (IGF1R-KD) in MDA-MB-231 and BT549 TNBC cells. β-actin was used as a loading control. (C) Morphological changes in MDA-MB-231 and BT549 IGF1R-KD cells compared to EV control cells four to six passages post-lentiviral infections; brightfield magnification x20. (D) Western blot analyses of mesenchymal markers (vimentin, Snail-1, ZEB-1), motility marker pFAK, and epithelial markers (E-cadherin, claudin-1, and ZO-1) in cell lines stably expressing EV control plasmid or IGF1R-KD lentiviral plasmids using specific antibodies. β-actin was used as a loading control. (E) Relative mRNA expression levels of Vimentin, ZEB-1, and E-cadherin in MDA-MB-231 EV and IGF1R-KD cell lines was detected by TaqMan quantitative RT-PCR and normalized to RPLPO. The relative amounts of transcript were described using the 2–ΔΔCt method. Data are displayed in means ± standard deviation of at least three independent experiments of each group.

    Article Snippet: Relative levels of mRNA were determined by real-time quantitative PCR using an Eppendorf cycler and the TaqMan Universal PCR master Mix (Applied Biosystems, Carlsbad, CA).

    Techniques: Expressing, Western Blot, Multiple Displacement Amplification, Marker, Stable Transfection, Plasmid Preparation, Quantitative RT-PCR, Standard Deviation