quantitative real-time pcr Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher quantitative real time pcr
    Quantitative real-time <t>PCR</t> validation of microRNA microarray results in male breast cancers. Relative expression of microRNAs in male breast cancer compared with cases of gynecomastia by real-time PCR. miR-125b, miR-126, miR-10b, miR-10a and miR-191 were underexpressed in cancer samples, whereas miR-26b, miR-607 and miR-135b were overexpressed. Dots, normalized ratio microRNA gene expression values (breast cancers/gynecomastia); error bars, standard deviation.
    Quantitative Real Time Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 34944 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Thermo Fisher
    Average 99 stars, based on 34944 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    89
    Thermo Fisher real time pcr quantitative real time pcr
    Real-time <t>PCR</t> of OC <t>mRNA</t> expression. The expression in the immediate group was significantly higher than in the control and 1-wk group. Although a similar tendency of increased OC expression was seen in the 1-wk group as compared with the control group, there was no significant difference. * p
    Real Time Pcr Quantitative Real Time Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1787 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time pcr quantitative real time pcr/product/Thermo Fisher
    Average 89 stars, based on 1787 article reviews
    Price from $9.99 to $1999.99
    real time pcr quantitative real time pcr - by Bioz Stars, 2020-05
    89/100 stars
      Buy from Supplier

    88
    Thermo Fisher realtime quantitative pcr
    Real-time <t>PCR</t> of OC <t>mRNA</t> expression. The expression in the immediate group was significantly higher than in the control and 1-wk group. Although a similar tendency of increased OC expression was seen in the 1-wk group as compared with the control group, there was no significant difference. * p
    Realtime Quantitative Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 88 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/realtime quantitative pcr/product/Thermo Fisher
    Average 88 stars, based on 88 article reviews
    Price from $9.99 to $1999.99
    realtime quantitative pcr - by Bioz Stars, 2020-05
    88/100 stars
      Buy from Supplier

    85
    Sigma-Genosys quantitative real time pcr quantitative real time pcr primers
    Real-time <t>PCR</t> of OC <t>mRNA</t> expression. The expression in the immediate group was significantly higher than in the control and 1-wk group. Although a similar tendency of increased OC expression was seen in the 1-wk group as compared with the control group, there was no significant difference. * p
    Quantitative Real Time Pcr Quantitative Real Time Pcr Primers, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 85/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr quantitative real time pcr primers/product/Sigma-Genosys
    Average 85 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr quantitative real time pcr primers - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    97
    Bio-Rad quantitative real time pcr
    Transgenic overexpression of <t>Dlk1</t> modulates EAE severity and adaptive immune responses. A) Dlk1 mRNA expression in immune tissues in Dlk1 transgenic and wild type littermate control mice measured using TaqMan <t>PCR.</t> Relative Dlk1 expression was calculated in relation to the mean of housekeeping gene, beta-2 microglobulin, using 2-ΔΔCt method (N = 3–5 mice/group). B) Daily EAE scores in Dlk1 transgenic (N = 24) and wild type littermate control (N = 20) mice after immunization with MOG demonstrate that the higher levels of Dlk1 in transgenic mice are protective against EAE. Mean EAE clinical score (and the standard error of the mean) is given for each day post immunization (p.i.). The figure represents pooled data from three separate experiments. Mann-Whitney U-test was used to compare the daily EAE scores (p-value
    Quantitative Real Time Pcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 11965 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Bio-Rad
    Average 97 stars, based on 11965 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-05
    97/100 stars
      Buy from Supplier

    99
    Roche quantitative real time pcr
    CTCF consensus motifs are found in HPV genomes. A). Schematic diagram of linear HPV 31 genome showing the location of the CTCF (CCCTC) consensus motifs that are also present in other high-risk HPV subtypes. Number indicates the location of the beginning of the pentamer sequence. B). Summary of analysis of 125 HPV types for the presence of CTCF core consensus motifs in L2, L1, E2 and E4 regions. Percentage of HPV type that are positive for these sequences is shown. (C,D). Chromatin immunoprecipitation analysis of SMC1 and γ-H2AX binding to URR region in undifferentiated cells and cells differentiated in calcium for 72 hours. (E,F) Chromatin immunoprecipitation analysis of SMC1 and γ-H2AX binding to the L2 region in undifferentiated cells and cells differentiated in high calcium media for 72 hours. SMC1 binds to the L2 region at similar levels in both undifferentiated or differentiated cells. γ-H2AX binding to HPV genomes increases upon differentiation at both URR and L2 regions Quantitative real-time <t>PCR</t> was performed using a <t>Lightcycler</t> 480 (Roche). Similar results were seen in three independent experiments.
    Quantitative Real Time Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 7176 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Roche
    Average 99 stars, based on 7176 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    99
    TaKaRa quantitative real time pcr
    Identification of PDE4D as a miR-203a-3p target. A. Quantitative <t>RT-PCR</t> analysis of PDE4D expression levels in the same 8 pairs of CRC and normal tissue samples and in the same CRC cell lines. B. Over-expression of miR-203a-3p significantly suppressed PDE4D at both the <t>mRNA</t> and protein levels in SW480 and SW1116 cells. C. Silence of endogenous miR-203a-3p significantly increased PDE4D at both the mRNA and protein levels in HCT116 and SW1116 cells. D. Binding sites of miR-203a-3p at the 3’-UTR of PDE4D mRNA. E. PDE4D is a target gene of miR-203a-3p in HCT116 and SW480 cells based on the luciferase reporter assay. Each assay was repeated three times. The data represent means ± SD of three independent experiments. *P
    Quantitative Real Time Pcr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 5478 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/TaKaRa
    Average 99 stars, based on 5478 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher real time quantitative pcr real time pcr system
    Identification of PDE4D as a miR-203a-3p target. A. Quantitative <t>RT-PCR</t> analysis of PDE4D expression levels in the same 8 pairs of CRC and normal tissue samples and in the same CRC cell lines. B. Over-expression of miR-203a-3p significantly suppressed PDE4D at both the <t>mRNA</t> and protein levels in SW480 and SW1116 cells. C. Silence of endogenous miR-203a-3p significantly increased PDE4D at both the mRNA and protein levels in HCT116 and SW1116 cells. D. Binding sites of miR-203a-3p at the 3’-UTR of PDE4D mRNA. E. PDE4D is a target gene of miR-203a-3p in HCT116 and SW480 cells based on the luciferase reporter assay. Each assay was repeated three times. The data represent means ± SD of three independent experiments. *P
    Real Time Quantitative Pcr Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time quantitative pcr real time pcr system/product/Thermo Fisher
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    real time quantitative pcr real time pcr system - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    98
    Thermo Fisher taqman real time pcr
    Identification of PDE4D as a miR-203a-3p target. A. Quantitative <t>RT-PCR</t> analysis of PDE4D expression levels in the same 8 pairs of CRC and normal tissue samples and in the same CRC cell lines. B. Over-expression of miR-203a-3p significantly suppressed PDE4D at both the <t>mRNA</t> and protein levels in SW480 and SW1116 cells. C. Silence of endogenous miR-203a-3p significantly increased PDE4D at both the mRNA and protein levels in HCT116 and SW1116 cells. D. Binding sites of miR-203a-3p at the 3’-UTR of PDE4D mRNA. E. PDE4D is a target gene of miR-203a-3p in HCT116 and SW480 cells based on the luciferase reporter assay. Each assay was repeated three times. The data represent means ± SD of three independent experiments. *P
    Taqman Real Time Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 2333 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman real time pcr/product/Thermo Fisher
    Average 98 stars, based on 2333 article reviews
    Price from $9.99 to $1999.99
    taqman real time pcr - by Bioz Stars, 2020-05
    98/100 stars
      Buy from Supplier

    99
    Thermo Fisher sybr green based quantitative real time pcr
    Identification of PDE4D as a miR-203a-3p target. A. Quantitative <t>RT-PCR</t> analysis of PDE4D expression levels in the same 8 pairs of CRC and normal tissue samples and in the same CRC cell lines. B. Over-expression of miR-203a-3p significantly suppressed PDE4D at both the <t>mRNA</t> and protein levels in SW480 and SW1116 cells. C. Silence of endogenous miR-203a-3p significantly increased PDE4D at both the mRNA and protein levels in HCT116 and SW1116 cells. D. Binding sites of miR-203a-3p at the 3’-UTR of PDE4D mRNA. E. PDE4D is a target gene of miR-203a-3p in HCT116 and SW480 cells based on the luciferase reporter assay. Each assay was repeated three times. The data represent means ± SD of three independent experiments. *P
    Sybr Green Based Quantitative Real Time Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 80 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr green based quantitative real time pcr/product/Thermo Fisher
    Average 99 stars, based on 80 article reviews
    Price from $9.99 to $1999.99
    sybr green based quantitative real time pcr - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    93
    Arraystar quantitative real time pcr
    Identification of PDE4D as a miR-203a-3p target. A. Quantitative <t>RT-PCR</t> analysis of PDE4D expression levels in the same 8 pairs of CRC and normal tissue samples and in the same CRC cell lines. B. Over-expression of miR-203a-3p significantly suppressed PDE4D at both the <t>mRNA</t> and protein levels in SW480 and SW1116 cells. C. Silence of endogenous miR-203a-3p significantly increased PDE4D at both the mRNA and protein levels in HCT116 and SW1116 cells. D. Binding sites of miR-203a-3p at the 3’-UTR of PDE4D mRNA. E. PDE4D is a target gene of miR-203a-3p in HCT116 and SW480 cells based on the luciferase reporter assay. Each assay was repeated three times. The data represent means ± SD of three independent experiments. *P
    Quantitative Real Time Pcr, supplied by Arraystar, used in various techniques. Bioz Stars score: 93/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Arraystar
    Average 93 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-05
    93/100 stars
      Buy from Supplier

    95
    Stratagene quantitative real time pcr
    Mutations in ref(2)P result in the accumulation of <t>mtDNA.</t> ( a ) Regular mitochondrial distribution is disrupted in ref(2)P mutants and the number of mtDNA nucleoids (mt) is increased. PicoGreen also labels the dsDNA of muscle nuclei (nuc). ( b ) ref(2)P mutants flies showed an increase in mtDNA. The ratio of mtDNA to nDNA was measured using real-time quantitative <t>PCR</t> in flies with the indicated ages (mean±S.D., n =9 per genotype). Statistically significant values relative to the control ( w 1118 ) are indicated by asterisks (one-way ANOVA with Dunnett's multiple comparison test). ( c and d ) Mutations in ref(2)P do not cause alterations in mitochondrial protein density. Protein density was determined in 26-day-old flies with the indicated genotypes by determining the concentration of Cyt c using an ELISA assay ( d ) and by measuring the activity of the mitochondrial matrix enzyme citrate synthase ( c ). Data are shown as the mean ±S.E.M ( n =3 in each group). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test). ( e ) Analysis of the mtTFA levels in ref(2)P mutants. Lysates prepared from adult flies were subjected to western blot analysis with the indicated antibodies. ( f ) Normal respiration in ref(2)P mutant flies. Activity of the indicated complexes in coupled mitochondria was measured in 3-day-old flies using high-resolution respirometry. Data are shown as the mean±S.E.M. ( n ≥4 in each genotype). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test)
    Quantitative Real Time Pcr, supplied by Stratagene, used in various techniques. Bioz Stars score: 95/100, based on 1081 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Stratagene
    Average 95 stars, based on 1081 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-05
    95/100 stars
      Buy from Supplier

    92
    PrimerDesign Inc real time pcr
    Mutations in ref(2)P result in the accumulation of <t>mtDNA.</t> ( a ) Regular mitochondrial distribution is disrupted in ref(2)P mutants and the number of mtDNA nucleoids (mt) is increased. PicoGreen also labels the dsDNA of muscle nuclei (nuc). ( b ) ref(2)P mutants flies showed an increase in mtDNA. The ratio of mtDNA to nDNA was measured using real-time quantitative <t>PCR</t> in flies with the indicated ages (mean±S.D., n =9 per genotype). Statistically significant values relative to the control ( w 1118 ) are indicated by asterisks (one-way ANOVA with Dunnett's multiple comparison test). ( c and d ) Mutations in ref(2)P do not cause alterations in mitochondrial protein density. Protein density was determined in 26-day-old flies with the indicated genotypes by determining the concentration of Cyt c using an ELISA assay ( d ) and by measuring the activity of the mitochondrial matrix enzyme citrate synthase ( c ). Data are shown as the mean ±S.E.M ( n =3 in each group). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test). ( e ) Analysis of the mtTFA levels in ref(2)P mutants. Lysates prepared from adult flies were subjected to western blot analysis with the indicated antibodies. ( f ) Normal respiration in ref(2)P mutant flies. Activity of the indicated complexes in coupled mitochondria was measured in 3-day-old flies using high-resolution respirometry. Data are shown as the mean±S.E.M. ( n ≥4 in each genotype). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test)
    Real Time Pcr, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 92/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time pcr/product/PrimerDesign Inc
    Average 92 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    real time pcr - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    92
    Luminex real time pcr
    Mutations in ref(2)P result in the accumulation of <t>mtDNA.</t> ( a ) Regular mitochondrial distribution is disrupted in ref(2)P mutants and the number of mtDNA nucleoids (mt) is increased. PicoGreen also labels the dsDNA of muscle nuclei (nuc). ( b ) ref(2)P mutants flies showed an increase in mtDNA. The ratio of mtDNA to nDNA was measured using real-time quantitative <t>PCR</t> in flies with the indicated ages (mean±S.D., n =9 per genotype). Statistically significant values relative to the control ( w 1118 ) are indicated by asterisks (one-way ANOVA with Dunnett's multiple comparison test). ( c and d ) Mutations in ref(2)P do not cause alterations in mitochondrial protein density. Protein density was determined in 26-day-old flies with the indicated genotypes by determining the concentration of Cyt c using an ELISA assay ( d ) and by measuring the activity of the mitochondrial matrix enzyme citrate synthase ( c ). Data are shown as the mean ±S.E.M ( n =3 in each group). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test). ( e ) Analysis of the mtTFA levels in ref(2)P mutants. Lysates prepared from adult flies were subjected to western blot analysis with the indicated antibodies. ( f ) Normal respiration in ref(2)P mutant flies. Activity of the indicated complexes in coupled mitochondria was measured in 3-day-old flies using high-resolution respirometry. Data are shown as the mean±S.E.M. ( n ≥4 in each genotype). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test)
    Real Time Pcr, supplied by Luminex, used in various techniques. Bioz Stars score: 92/100, based on 45 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time pcr/product/Luminex
    Average 92 stars, based on 45 article reviews
    Price from $9.99 to $1999.99
    real time pcr - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    96
    Agilent technologies quantitative real time pcr
    Mutations in ref(2)P result in the accumulation of <t>mtDNA.</t> ( a ) Regular mitochondrial distribution is disrupted in ref(2)P mutants and the number of mtDNA nucleoids (mt) is increased. PicoGreen also labels the dsDNA of muscle nuclei (nuc). ( b ) ref(2)P mutants flies showed an increase in mtDNA. The ratio of mtDNA to nDNA was measured using real-time quantitative <t>PCR</t> in flies with the indicated ages (mean±S.D., n =9 per genotype). Statistically significant values relative to the control ( w 1118 ) are indicated by asterisks (one-way ANOVA with Dunnett's multiple comparison test). ( c and d ) Mutations in ref(2)P do not cause alterations in mitochondrial protein density. Protein density was determined in 26-day-old flies with the indicated genotypes by determining the concentration of Cyt c using an ELISA assay ( d ) and by measuring the activity of the mitochondrial matrix enzyme citrate synthase ( c ). Data are shown as the mean ±S.E.M ( n =3 in each group). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test). ( e ) Analysis of the mtTFA levels in ref(2)P mutants. Lysates prepared from adult flies were subjected to western blot analysis with the indicated antibodies. ( f ) Normal respiration in ref(2)P mutant flies. Activity of the indicated complexes in coupled mitochondria was measured in 3-day-old flies using high-resolution respirometry. Data are shown as the mean±S.E.M. ( n ≥4 in each genotype). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test)
    Quantitative Real Time Pcr, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 96/100, based on 525 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Agilent technologies
    Average 96 stars, based on 525 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-05
    96/100 stars
      Buy from Supplier

    92
    Abbott Laboratories real time pcr
    Mutations in ref(2)P result in the accumulation of <t>mtDNA.</t> ( a ) Regular mitochondrial distribution is disrupted in ref(2)P mutants and the number of mtDNA nucleoids (mt) is increased. PicoGreen also labels the dsDNA of muscle nuclei (nuc). ( b ) ref(2)P mutants flies showed an increase in mtDNA. The ratio of mtDNA to nDNA was measured using real-time quantitative <t>PCR</t> in flies with the indicated ages (mean±S.D., n =9 per genotype). Statistically significant values relative to the control ( w 1118 ) are indicated by asterisks (one-way ANOVA with Dunnett's multiple comparison test). ( c and d ) Mutations in ref(2)P do not cause alterations in mitochondrial protein density. Protein density was determined in 26-day-old flies with the indicated genotypes by determining the concentration of Cyt c using an ELISA assay ( d ) and by measuring the activity of the mitochondrial matrix enzyme citrate synthase ( c ). Data are shown as the mean ±S.E.M ( n =3 in each group). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test). ( e ) Analysis of the mtTFA levels in ref(2)P mutants. Lysates prepared from adult flies were subjected to western blot analysis with the indicated antibodies. ( f ) Normal respiration in ref(2)P mutant flies. Activity of the indicated complexes in coupled mitochondria was measured in 3-day-old flies using high-resolution respirometry. Data are shown as the mean±S.E.M. ( n ≥4 in each genotype). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test)
    Real Time Pcr, supplied by Abbott Laboratories, used in various techniques. Bioz Stars score: 92/100, based on 139 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time pcr/product/Abbott Laboratories
    Average 92 stars, based on 139 article reviews
    Price from $9.99 to $1999.99
    real time pcr - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    92
    Vazyme Biotech Co real time pcr
    Mutations in ref(2)P result in the accumulation of <t>mtDNA.</t> ( a ) Regular mitochondrial distribution is disrupted in ref(2)P mutants and the number of mtDNA nucleoids (mt) is increased. PicoGreen also labels the dsDNA of muscle nuclei (nuc). ( b ) ref(2)P mutants flies showed an increase in mtDNA. The ratio of mtDNA to nDNA was measured using real-time quantitative <t>PCR</t> in flies with the indicated ages (mean±S.D., n =9 per genotype). Statistically significant values relative to the control ( w 1118 ) are indicated by asterisks (one-way ANOVA with Dunnett's multiple comparison test). ( c and d ) Mutations in ref(2)P do not cause alterations in mitochondrial protein density. Protein density was determined in 26-day-old flies with the indicated genotypes by determining the concentration of Cyt c using an ELISA assay ( d ) and by measuring the activity of the mitochondrial matrix enzyme citrate synthase ( c ). Data are shown as the mean ±S.E.M ( n =3 in each group). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test). ( e ) Analysis of the mtTFA levels in ref(2)P mutants. Lysates prepared from adult flies were subjected to western blot analysis with the indicated antibodies. ( f ) Normal respiration in ref(2)P mutant flies. Activity of the indicated complexes in coupled mitochondria was measured in 3-day-old flies using high-resolution respirometry. Data are shown as the mean±S.E.M. ( n ≥4 in each genotype). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test)
    Real Time Pcr, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 92/100, based on 83 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time pcr/product/Vazyme Biotech Co
    Average 92 stars, based on 83 article reviews
    Price from $9.99 to $1999.99
    real time pcr - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    Image Search Results


    Quantitative real-time PCR validation of microRNA microarray results in male breast cancers. Relative expression of microRNAs in male breast cancer compared with cases of gynecomastia by real-time PCR. miR-125b, miR-126, miR-10b, miR-10a and miR-191 were underexpressed in cancer samples, whereas miR-26b, miR-607 and miR-135b were overexpressed. Dots, normalized ratio microRNA gene expression values (breast cancers/gynecomastia); error bars, standard deviation.

    Journal: Breast Cancer Research : BCR

    Article Title: MicroRNA expression profiling of male breast cancer

    doi: 10.1186/bcr2348

    Figure Lengend Snippet: Quantitative real-time PCR validation of microRNA microarray results in male breast cancers. Relative expression of microRNAs in male breast cancer compared with cases of gynecomastia by real-time PCR. miR-125b, miR-126, miR-10b, miR-10a and miR-191 were underexpressed in cancer samples, whereas miR-26b, miR-607 and miR-135b were overexpressed. Dots, normalized ratio microRNA gene expression values (breast cancers/gynecomastia); error bars, standard deviation.

    Article Snippet: Quantitative real-time PCR The single-tube TaqMan miRNA Assay (Applied Biosystems, Foster City, CA, USA) was used to detect and quantify mature miRNAs on Applied Biosystems real-time PCR instruments in accordance with the manufacturer's instructions.

    Techniques: Real-time Polymerase Chain Reaction, Microarray, Expressing, Standard Deviation

    Functional analysis showing that miR-370 regulates NF1 . (A) miRNAs expression analysis by real-time PCR after transfection with pre-miRs-370, −379, −432 and −494. (B) Western blot showing NF1 after transfection with pre-miR-370. (C) Luciferase assay showing changes in luciferase activity after transfection with pre-miR– (negative control) or pre-miR-370 in cells expressing the 3′UTR region of NF1 that includes the miR-370 seed region [pRL-NF1(3′UTR)wt]. Transfection with the 3′UTR region of NF1 including a mutated seed region for miR-370 was used as control.

    Journal: PLoS ONE

    Article Title: Integration of SNP and mRNA Arrays with MicroRNA Profiling Reveals That MiR-370 Is Upregulated and Targets NF1 in Acute Myeloid Leukemia

    doi: 10.1371/journal.pone.0047717

    Figure Lengend Snippet: Functional analysis showing that miR-370 regulates NF1 . (A) miRNAs expression analysis by real-time PCR after transfection with pre-miRs-370, −379, −432 and −494. (B) Western blot showing NF1 after transfection with pre-miR-370. (C) Luciferase assay showing changes in luciferase activity after transfection with pre-miR– (negative control) or pre-miR-370 in cells expressing the 3′UTR region of NF1 that includes the miR-370 seed region [pRL-NF1(3′UTR)wt]. Transfection with the 3′UTR region of NF1 including a mutated seed region for miR-370 was used as control.

    Article Snippet: Quantification of the expression of NF1 was performed by SYBR Green I real time PCR assays (Applied Biosystems), using specific primers for each gene (NF1_Fwd: AAGCCCTCACAACA-ACCAAC; NF1 Rv: GACAATACACAGCATCAATCT ; HPRT Fwd: TGACAC-TGGCAAAACAATGCA; HPRT Rv: GGTCCTTTTCACCAGCAAGCT ).

    Techniques: Functional Assay, Expressing, Real-time Polymerase Chain Reaction, Transfection, Western Blot, Luciferase, Activity Assay, Negative Control

    Analysis of gene expression of contractile proteins in isolated SMCs and VICs from RMCAs. (A) Primers for α-SM-actin (product size 550 bp) and calponin (product size 633 bp) were tested on rat brain tissue by RT-PCR (a); RT-PCR showed that both SMCs (b) and VICs (c) express α-SM-actin and calponin. As a positive control primers for β-actin (721 bp) were also used. (B) (a) Real-time RT-PCR amplification graph shows a plot of number of cycles versus fluorescence for the genes calponin and β-actin for VICs and SMCs. The fluorescence data are baseline-corrected, normalized and averaged. Whereas there was no significant difference in β-actin expression between VICs and SMCs, there was a clear difference between VICs and SMCs for calponin. (b) VICs expression of calponin was 27 ± 5% ( n = 4, P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: Interstitial cells from rat middle cerebral artery belong to smooth muscle cell type

    doi: 10.1111/j.1582-4934.2008.00567.x

    Figure Lengend Snippet: Analysis of gene expression of contractile proteins in isolated SMCs and VICs from RMCAs. (A) Primers for α-SM-actin (product size 550 bp) and calponin (product size 633 bp) were tested on rat brain tissue by RT-PCR (a); RT-PCR showed that both SMCs (b) and VICs (c) express α-SM-actin and calponin. As a positive control primers for β-actin (721 bp) were also used. (B) (a) Real-time RT-PCR amplification graph shows a plot of number of cycles versus fluorescence for the genes calponin and β-actin for VICs and SMCs. The fluorescence data are baseline-corrected, normalized and averaged. Whereas there was no significant difference in β-actin expression between VICs and SMCs, there was a clear difference between VICs and SMCs for calponin. (b) VICs expression of calponin was 27 ± 5% ( n = 4, P

    Article Snippet: Assay-on-demand (predesigned primer and probe sets for Calponin and β-actin (3 prime located; spanning exon-intron boundary) was applied for quantitative real-time PCR reactions according to the procedure described by the manufacturer (Applied Biosystems). β-actin was used as a calibrator.

    Techniques: Expressing, Isolation, Reverse Transcription Polymerase Chain Reaction, Positive Control, Quantitative RT-PCR, Amplification, Fluorescence

    RT-PCR from separately collected VICs and SMCs shows that VICs from RMCAs express SMC marker. The following primers were designed to amplify genes associated with certain cell types: SM-MHC (745 bp) for SMCs, c-kit (861 bp) for ICCs, PGP9.5 (510 bp) for neurons, VEGF A (556 bp) for endothelial cells, CD34 (852 bp) for fibroblasts and endothelial cells, P4H (808 bp) for fibroblasts, CD68 (802 bp) for macrophages, NG2 (996 bp) for pericytes, prominin 1 (881 bp) for stem cells, MC-CPA (998 bp) for mast cells. As a positive control primers for β-actin (721 bp) were used. (A) Primers were tested for their specificity using cDNA preparations of rat brain tissue. (B) SMCs showed the presence of the β-actin and SM-MHC. (C) Isolated VICs also showed the expression of SMC marker only suggesting that they belong to SMC type.

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: Interstitial cells from rat middle cerebral artery belong to smooth muscle cell type

    doi: 10.1111/j.1582-4934.2008.00567.x

    Figure Lengend Snippet: RT-PCR from separately collected VICs and SMCs shows that VICs from RMCAs express SMC marker. The following primers were designed to amplify genes associated with certain cell types: SM-MHC (745 bp) for SMCs, c-kit (861 bp) for ICCs, PGP9.5 (510 bp) for neurons, VEGF A (556 bp) for endothelial cells, CD34 (852 bp) for fibroblasts and endothelial cells, P4H (808 bp) for fibroblasts, CD68 (802 bp) for macrophages, NG2 (996 bp) for pericytes, prominin 1 (881 bp) for stem cells, MC-CPA (998 bp) for mast cells. As a positive control primers for β-actin (721 bp) were used. (A) Primers were tested for their specificity using cDNA preparations of rat brain tissue. (B) SMCs showed the presence of the β-actin and SM-MHC. (C) Isolated VICs also showed the expression of SMC marker only suggesting that they belong to SMC type.

    Article Snippet: Assay-on-demand (predesigned primer and probe sets for Calponin and β-actin (3 prime located; spanning exon-intron boundary) was applied for quantitative real-time PCR reactions according to the procedure described by the manufacturer (Applied Biosystems). β-actin was used as a calibrator.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Marker, Positive Control, Isolation, Expressing

    Real-time PCR of OC mRNA expression. The expression in the immediate group was significantly higher than in the control and 1-wk group. Although a similar tendency of increased OC expression was seen in the 1-wk group as compared with the control group, there was no significant difference. * p

    Journal: International Journal of Stem Cells

    Article Title: Cell Sheet Injection as a Technique of Osteogenic Supply

    doi:

    Figure Lengend Snippet: Real-time PCR of OC mRNA expression. The expression in the immediate group was significantly higher than in the control and 1-wk group. Although a similar tendency of increased OC expression was seen in the 1-wk group as compared with the control group, there was no significant difference. * p

    Article Snippet: To measure the mRNA expression levels, we conducted real-time quantitative PCR (ABI PRISM 7700 Sequence Detection System; Applied Biosystems, Norwalk, CT, USA), using the respective primers and specific fluorogenic probes of OC and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, internal standard) for rat cDNAs as described previously ( , ).

    Techniques: Real-time Polymerase Chain Reaction, Expressing

    Transgenic overexpression of Dlk1 modulates EAE severity and adaptive immune responses. A) Dlk1 mRNA expression in immune tissues in Dlk1 transgenic and wild type littermate control mice measured using TaqMan PCR. Relative Dlk1 expression was calculated in relation to the mean of housekeeping gene, beta-2 microglobulin, using 2-ΔΔCt method (N = 3–5 mice/group). B) Daily EAE scores in Dlk1 transgenic (N = 24) and wild type littermate control (N = 20) mice after immunization with MOG demonstrate that the higher levels of Dlk1 in transgenic mice are protective against EAE. Mean EAE clinical score (and the standard error of the mean) is given for each day post immunization (p.i.). The figure represents pooled data from three separate experiments. Mann-Whitney U-test was used to compare the daily EAE scores (p-value

    Journal: PLoS Genetics

    Article Title: Parent-of-Origin Effects Implicate Epigenetic Regulation of Experimental Autoimmune Encephalomyelitis and Identify Imprinted Dlk1 as a Novel Risk Gene

    doi: 10.1371/journal.pgen.1004265

    Figure Lengend Snippet: Transgenic overexpression of Dlk1 modulates EAE severity and adaptive immune responses. A) Dlk1 mRNA expression in immune tissues in Dlk1 transgenic and wild type littermate control mice measured using TaqMan PCR. Relative Dlk1 expression was calculated in relation to the mean of housekeeping gene, beta-2 microglobulin, using 2-ΔΔCt method (N = 3–5 mice/group). B) Daily EAE scores in Dlk1 transgenic (N = 24) and wild type littermate control (N = 20) mice after immunization with MOG demonstrate that the higher levels of Dlk1 in transgenic mice are protective against EAE. Mean EAE clinical score (and the standard error of the mean) is given for each day post immunization (p.i.). The figure represents pooled data from three separate experiments. Mann-Whitney U-test was used to compare the daily EAE scores (p-value

    Article Snippet: Quantitative real-time PCR of rat Dlk1 , Rtl1 and Dio3 in the BC material was performed using a BioRad CFX384 Touch real-time PCR system with a two-step PCR protocol (95°C for 3 min. followed by 40 cycles of 95°C for 10 sec., 60°C for 30 sec. followed by melt curve analysis), using SYBR Green as the fluorophore (Bio-Rad).

    Techniques: Transgenic Assay, Over Expression, Expressing, Mouse Assay, Polymerase Chain Reaction, MANN-WHITNEY, Significance Assay

    CTCF consensus motifs are found in HPV genomes. A). Schematic diagram of linear HPV 31 genome showing the location of the CTCF (CCCTC) consensus motifs that are also present in other high-risk HPV subtypes. Number indicates the location of the beginning of the pentamer sequence. B). Summary of analysis of 125 HPV types for the presence of CTCF core consensus motifs in L2, L1, E2 and E4 regions. Percentage of HPV type that are positive for these sequences is shown. (C,D). Chromatin immunoprecipitation analysis of SMC1 and γ-H2AX binding to URR region in undifferentiated cells and cells differentiated in calcium for 72 hours. (E,F) Chromatin immunoprecipitation analysis of SMC1 and γ-H2AX binding to the L2 region in undifferentiated cells and cells differentiated in high calcium media for 72 hours. SMC1 binds to the L2 region at similar levels in both undifferentiated or differentiated cells. γ-H2AX binding to HPV genomes increases upon differentiation at both URR and L2 regions Quantitative real-time PCR was performed using a Lightcycler 480 (Roche). Similar results were seen in three independent experiments.

    Journal: PLoS Pathogens

    Article Title: Human Papillomaviruses Activate and Recruit SMC1 Cohesin Proteins for the Differentiation-Dependent Life Cycle through Association with CTCF Insulators

    doi: 10.1371/journal.ppat.1004763

    Figure Lengend Snippet: CTCF consensus motifs are found in HPV genomes. A). Schematic diagram of linear HPV 31 genome showing the location of the CTCF (CCCTC) consensus motifs that are also present in other high-risk HPV subtypes. Number indicates the location of the beginning of the pentamer sequence. B). Summary of analysis of 125 HPV types for the presence of CTCF core consensus motifs in L2, L1, E2 and E4 regions. Percentage of HPV type that are positive for these sequences is shown. (C,D). Chromatin immunoprecipitation analysis of SMC1 and γ-H2AX binding to URR region in undifferentiated cells and cells differentiated in calcium for 72 hours. (E,F) Chromatin immunoprecipitation analysis of SMC1 and γ-H2AX binding to the L2 region in undifferentiated cells and cells differentiated in high calcium media for 72 hours. SMC1 binds to the L2 region at similar levels in both undifferentiated or differentiated cells. γ-H2AX binding to HPV genomes increases upon differentiation at both URR and L2 regions Quantitative real-time PCR was performed using a Lightcycler 480 (Roche). Similar results were seen in three independent experiments.

    Article Snippet: Quantitative real-time PCR was performed using a Lightcycler 480 (Roche).

    Techniques: Sequencing, Chromatin Immunoprecipitation, Binding Assay, Real-time Polymerase Chain Reaction

    Identification of PDE4D as a miR-203a-3p target. A. Quantitative RT-PCR analysis of PDE4D expression levels in the same 8 pairs of CRC and normal tissue samples and in the same CRC cell lines. B. Over-expression of miR-203a-3p significantly suppressed PDE4D at both the mRNA and protein levels in SW480 and SW1116 cells. C. Silence of endogenous miR-203a-3p significantly increased PDE4D at both the mRNA and protein levels in HCT116 and SW1116 cells. D. Binding sites of miR-203a-3p at the 3’-UTR of PDE4D mRNA. E. PDE4D is a target gene of miR-203a-3p in HCT116 and SW480 cells based on the luciferase reporter assay. Each assay was repeated three times. The data represent means ± SD of three independent experiments. *P

    Journal: American Journal of Cancer Research

    Article Title: miR-203a-3p promotes colorectal cancer proliferation and migration by targeting PDE4D

    doi:

    Figure Lengend Snippet: Identification of PDE4D as a miR-203a-3p target. A. Quantitative RT-PCR analysis of PDE4D expression levels in the same 8 pairs of CRC and normal tissue samples and in the same CRC cell lines. B. Over-expression of miR-203a-3p significantly suppressed PDE4D at both the mRNA and protein levels in SW480 and SW1116 cells. C. Silence of endogenous miR-203a-3p significantly increased PDE4D at both the mRNA and protein levels in HCT116 and SW1116 cells. D. Binding sites of miR-203a-3p at the 3’-UTR of PDE4D mRNA. E. PDE4D is a target gene of miR-203a-3p in HCT116 and SW480 cells based on the luciferase reporter assay. Each assay was repeated three times. The data represent means ± SD of three independent experiments. *P

    Article Snippet: Reverse transcription was performed using One step Prime Script miRNA and mRNA cDNA Synthesis Kit (Takara Biotechnology Co. Ltd, Dalian, China), and quantitative real-time PCR were performed using SYBR Premix Ex Taq II (Takara Biotechnology).

    Techniques: Quantitative RT-PCR, Expressing, Over Expression, Binding Assay, Luciferase, Reporter Assay

    Mutations in ref(2)P result in the accumulation of mtDNA. ( a ) Regular mitochondrial distribution is disrupted in ref(2)P mutants and the number of mtDNA nucleoids (mt) is increased. PicoGreen also labels the dsDNA of muscle nuclei (nuc). ( b ) ref(2)P mutants flies showed an increase in mtDNA. The ratio of mtDNA to nDNA was measured using real-time quantitative PCR in flies with the indicated ages (mean±S.D., n =9 per genotype). Statistically significant values relative to the control ( w 1118 ) are indicated by asterisks (one-way ANOVA with Dunnett's multiple comparison test). ( c and d ) Mutations in ref(2)P do not cause alterations in mitochondrial protein density. Protein density was determined in 26-day-old flies with the indicated genotypes by determining the concentration of Cyt c using an ELISA assay ( d ) and by measuring the activity of the mitochondrial matrix enzyme citrate synthase ( c ). Data are shown as the mean ±S.E.M ( n =3 in each group). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test). ( e ) Analysis of the mtTFA levels in ref(2)P mutants. Lysates prepared from adult flies were subjected to western blot analysis with the indicated antibodies. ( f ) Normal respiration in ref(2)P mutant flies. Activity of the indicated complexes in coupled mitochondria was measured in 3-day-old flies using high-resolution respirometry. Data are shown as the mean±S.E.M. ( n ≥4 in each genotype). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test)

    Journal: Cell Death & Disease

    Article Title: Drosophila ref(2)P is required for the parkin-mediated suppression of mitochondrial dysfunction in pink1 mutants

    doi: 10.1038/cddis.2013.394

    Figure Lengend Snippet: Mutations in ref(2)P result in the accumulation of mtDNA. ( a ) Regular mitochondrial distribution is disrupted in ref(2)P mutants and the number of mtDNA nucleoids (mt) is increased. PicoGreen also labels the dsDNA of muscle nuclei (nuc). ( b ) ref(2)P mutants flies showed an increase in mtDNA. The ratio of mtDNA to nDNA was measured using real-time quantitative PCR in flies with the indicated ages (mean±S.D., n =9 per genotype). Statistically significant values relative to the control ( w 1118 ) are indicated by asterisks (one-way ANOVA with Dunnett's multiple comparison test). ( c and d ) Mutations in ref(2)P do not cause alterations in mitochondrial protein density. Protein density was determined in 26-day-old flies with the indicated genotypes by determining the concentration of Cyt c using an ELISA assay ( d ) and by measuring the activity of the mitochondrial matrix enzyme citrate synthase ( c ). Data are shown as the mean ±S.E.M ( n =3 in each group). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test). ( e ) Analysis of the mtTFA levels in ref(2)P mutants. Lysates prepared from adult flies were subjected to western blot analysis with the indicated antibodies. ( f ) Normal respiration in ref(2)P mutant flies. Activity of the indicated complexes in coupled mitochondria was measured in 3-day-old flies using high-resolution respirometry. Data are shown as the mean±S.E.M. ( n ≥4 in each genotype). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test)

    Article Snippet: PCR amplification of mtDNA Analysis of the mtDNA content was performed using quantitative real-time PCR on an Mx4000 (Stratagene, Santa Clara, CA, USA) real-time cycler using QuantiTect SYBR Green PCR system (QIAGEN, Manchester, UK).

    Techniques: Real-time Polymerase Chain Reaction, Concentration Assay, Enzyme-linked Immunosorbent Assay, Activity Assay, Western Blot, Mutagenesis