quantitative real-time pcr Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher real time pcr system
    <t>Prox1</t> is associated with IL-2 promoter Chromatin was extracted from ( A ) Jurkat cells and ( B ) naïve CD4 + T cells unstimulated or stimulated with anti-CD3/CD28 Dynabeads for 24 h, and precipitated with anti-Prox1 antibody or isotype IgG. The DNA sequence containing minimal IL-2 promoter (–256 to -46, product size: 211 bp) was analyzed by <t>PCR.</t> Data represent one of three separate experiments.
    Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 16906 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time pcr system/product/Thermo Fisher
    Average 90 stars, based on 16906 article reviews
    Price from $9.99 to $1999.99
    real time pcr system - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher real time pcr quantitative real time pcr
    KLF15 is the major Kruppel-Like Factor in HPMEC and important regulator of critical endothelial enzymes- Arginase 2 and eNOS Total RNA from Human Pulmonary Microvascular endothelial cells was converted to <t>cDNA</t> and the relative mRNA expression of KLF15 was determined in quiescent HPMEC using real-time <t>PCR</t> (N=3), B) Cell lysates from HPMEC, human coronary artery endothelial cells (HCAEC), Human Aortic Endothelial Cells (HAEC), Human Aortic Smooth Muscle Cells (HASMC) were subjected to western blotting with KLF15, eNOS and β-tubulin antibodies (N=4). Cell lysates from HPMEC overexpressing HA-KLF15 was used as a positive control, C) Total RNA from Human Pulmonary Microvascular endothelial cells was converted to cDNA and the relative mRNA expression of KLF2, 4 and 15 was determined in quiescent HPMEC using real-time PCR (N=3) *p
    Real Time Pcr Quantitative Real Time Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1426 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time pcr quantitative real time pcr/product/Thermo Fisher
    Average 99 stars, based on 1426 article reviews
    Price from $9.99 to $1999.99
    real time pcr quantitative real time pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    79
    Sigma-Genosys quantitative real time pcr quantitative real time pcr primers
    KLF15 is the major Kruppel-Like Factor in HPMEC and important regulator of critical endothelial enzymes- Arginase 2 and eNOS Total RNA from Human Pulmonary Microvascular endothelial cells was converted to <t>cDNA</t> and the relative mRNA expression of KLF15 was determined in quiescent HPMEC using real-time <t>PCR</t> (N=3), B) Cell lysates from HPMEC, human coronary artery endothelial cells (HCAEC), Human Aortic Endothelial Cells (HAEC), Human Aortic Smooth Muscle Cells (HASMC) were subjected to western blotting with KLF15, eNOS and β-tubulin antibodies (N=4). Cell lysates from HPMEC overexpressing HA-KLF15 was used as a positive control, C) Total RNA from Human Pulmonary Microvascular endothelial cells was converted to cDNA and the relative mRNA expression of KLF2, 4 and 15 was determined in quiescent HPMEC using real-time PCR (N=3) *p
    Quantitative Real Time Pcr Quantitative Real Time Pcr Primers, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 79/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr quantitative real time pcr primers/product/Sigma-Genosys
    Average 79 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr quantitative real time pcr primers - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    99
    Roche quantitative real time pcr
    CTCF consensus motifs are found in HPV genomes. A). Schematic diagram of linear HPV 31 genome showing the location of the CTCF (CCCTC) consensus motifs that are also present in other high-risk HPV subtypes. Number indicates the location of the beginning of the pentamer sequence. B). Summary of analysis of 125 HPV types for the presence of CTCF core consensus motifs in L2, L1, E2 and E4 regions. Percentage of HPV type that are positive for these sequences is shown. (C,D). Chromatin immunoprecipitation analysis of SMC1 and γ-H2AX binding to URR region in undifferentiated cells and cells differentiated in calcium for 72 hours. (E,F) Chromatin immunoprecipitation analysis of SMC1 and γ-H2AX binding to the L2 region in undifferentiated cells and cells differentiated in high calcium media for 72 hours. SMC1 binds to the L2 region at similar levels in both undifferentiated or differentiated cells. γ-H2AX binding to HPV genomes increases upon differentiation at both URR and L2 regions Quantitative real-time <t>PCR</t> was performed using a <t>Lightcycler</t> 480 (Roche). Similar results were seen in three independent experiments.
    Quantitative Real Time Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 7218 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Roche
    Average 99 stars, based on 7218 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad quantitative real time pcr
    Transgenic overexpression of <t>Dlk1</t> modulates EAE severity and adaptive immune responses. A) Dlk1 mRNA expression in immune tissues in Dlk1 transgenic and wild type littermate control mice measured using TaqMan <t>PCR.</t> Relative Dlk1 expression was calculated in relation to the mean of housekeeping gene, beta-2 microglobulin, using 2-ΔΔCt method (N = 3–5 mice/group). B) Daily EAE scores in Dlk1 transgenic (N = 24) and wild type littermate control (N = 20) mice after immunization with MOG demonstrate that the higher levels of Dlk1 in transgenic mice are protective against EAE. Mean EAE clinical score (and the standard error of the mean) is given for each day post immunization (p.i.). The figure represents pooled data from three separate experiments. Mann-Whitney U-test was used to compare the daily EAE scores (p-value
    Quantitative Real Time Pcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 11967 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Bio-Rad
    Average 99 stars, based on 11967 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    PrimerDesign Inc quantitative real time pcr
    Transgenic overexpression of <t>Dlk1</t> modulates EAE severity and adaptive immune responses. A) Dlk1 mRNA expression in immune tissues in Dlk1 transgenic and wild type littermate control mice measured using TaqMan <t>PCR.</t> Relative Dlk1 expression was calculated in relation to the mean of housekeeping gene, beta-2 microglobulin, using 2-ΔΔCt method (N = 3–5 mice/group). B) Daily EAE scores in Dlk1 transgenic (N = 24) and wild type littermate control (N = 20) mice after immunization with MOG demonstrate that the higher levels of Dlk1 in transgenic mice are protective against EAE. Mean EAE clinical score (and the standard error of the mean) is given for each day post immunization (p.i.). The figure represents pooled data from three separate experiments. Mann-Whitney U-test was used to compare the daily EAE scores (p-value
    Quantitative Real Time Pcr, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 99/100, based on 75 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/PrimerDesign Inc
    Average 99 stars, based on 75 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    TaKaRa quantitative real time pcr
    MiR-9-1 is under CREB's control. (A) Location of putative CREs within the 5′ flanking regions of miR-9-1 and miR-9-2. MiR-9-1 is located in an intron of the gene c1orf61 (chromosome 1), whereas miR-9-2 is located in an exon of linc00461 (chromosome 5). Three pairs of primers (miR-9-1-a, miR-9-1-b and miR-9-2) were designed to detect the binding capacity of CREB to the predicted CREs of miR-9-1-a, miR-9-1-b and miR-9-2, respectively, by ChIP-qPCR assays. Both the 5′ flanking sequences (2 kb) and the pre-miRNA bodies of miR-9-1 and miR-9-2 were inserted upstream of the luciferase reporter (gray box shown by LUC). The arrows denote the positions of primers used for ChIP-qPCR. (B) ChIP-qPCR assays were performed in T98G and U251 cells to detect the binding capacity of CREB to the putative CREs of miR-9-1 and miR-9-2 (mean ± SD, n = 3). (C) In AD-shNC/AD-shcreb-infected T98G and U251 cells, ChIP-qPCR was performed to detect the binding capacity of CREB on CRE-miR-9-1-a (mean ± SD, n = 3). (D) CREB enhances the transcription of miR-9-1. The 5′ flanking sequences (−2 kb+miR-9-1; −2 kb, −570 bp; −560 bp+miR-9-1) without mutations or with a mutation of CRE-a (−569+miR-9-1, from TGACGGGC to TGGAGGGC ) in miR-9-1 were inserted upstream of the luciferase cassette. The luciferase reporter constructs were co-transfected with CREB expression plasmids or control vectors and the normalized luciferase activity was determined (mean ± SD, n = 4). (E) The mRNA expression levels of CREB, <t>pri-miR-9-1</t> and mature miR-9 were detected in T98G and U251 cells infected with AD-shcreb or AD-shNC by quantitative <t>RT-PCR</t> (mean ± SD, n = 3). *, P
    Quantitative Real Time Pcr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 5479 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/TaKaRa
    Average 99 stars, based on 5479 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Stratagene quantitative real time pcr
    Mutations in ref(2)P result in the accumulation of <t>mtDNA.</t> ( a ) Regular mitochondrial distribution is disrupted in ref(2)P mutants and the number of mtDNA nucleoids (mt) is increased. PicoGreen also labels the dsDNA of muscle nuclei (nuc). ( b ) ref(2)P mutants flies showed an increase in mtDNA. The ratio of mtDNA to nDNA was measured using real-time quantitative <t>PCR</t> in flies with the indicated ages (mean±S.D., n =9 per genotype). Statistically significant values relative to the control ( w 1118 ) are indicated by asterisks (one-way ANOVA with Dunnett's multiple comparison test). ( c and d ) Mutations in ref(2)P do not cause alterations in mitochondrial protein density. Protein density was determined in 26-day-old flies with the indicated genotypes by determining the concentration of Cyt c using an ELISA assay ( d ) and by measuring the activity of the mitochondrial matrix enzyme citrate synthase ( c ). Data are shown as the mean ±S.E.M ( n =3 in each group). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test). ( e ) Analysis of the mtTFA levels in ref(2)P mutants. Lysates prepared from adult flies were subjected to western blot analysis with the indicated antibodies. ( f ) Normal respiration in ref(2)P mutant flies. Activity of the indicated complexes in coupled mitochondria was measured in 3-day-old flies using high-resolution respirometry. Data are shown as the mean±S.E.M. ( n ≥4 in each genotype). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test)
    Quantitative Real Time Pcr, supplied by Stratagene, used in various techniques. Bioz Stars score: 99/100, based on 1081 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Stratagene
    Average 99 stars, based on 1081 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Agilent technologies quantitative real time pcr
    UBR3 affects Shh signaling in mammalian cells by poly-ubiquitinating Kif7. (A) The Gli::GFP reporter is induced by both Shh and purmorphamine (pur) in <t>C3H10T1/2</t> cells. (A’) Quantification of Gli::GFP expressing cells in response to Shh and pur. (B-B’). (B) Quantification of the proportion of Gli::GFP expressing C3H10T1/2 cells. (B’) Real time <t>PCR</t> to estimate the expression of UBR3 under the conditions shown in B. All values have been normalized to cells treated with pur and transfected with no siRNA. (C) C3H10T1/2 cells were transfected with the Kif7::GFP expression construct. Cells were transfected with various siRNAs and treated with pur (lanes 2–4) or DMSO (lane 1) and lysed, followed by immunoprecipitation against GFP. Western blots were performed with indicated antibodies. RFP expressions provided as transfection controls. (D) Kif7::GFP was immunoprecipitated from the lysate of the cells transfected with Kif7::GFP construct and shown siRNA followed by treatment of MG132. FK1 anti-ubiquitin antibody was used to detect ubiquitinated Kif7 in a Western blot. (E) A model shows the regulation of Hh signaling by Ubr3. Ubr3 regulates the proteasomal degradation of Cos2 via K48-mediated poly-ubiquitination of Cos2. ubr3 is one of the target genes activated by Hh signaling, forming a positive feedback to promote further activation of Hh signaling. Hh signaling also promotes physical association between Ubr3 and Cos2, increasing the ubiquitination of Cos2. (F) Diagram shows parallel regulations of Cos2 protein levels downstream of Hh activation.
    Quantitative Real Time Pcr, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 99/100, based on 525 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Agilent technologies
    Average 99 stars, based on 525 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    90
    Thermo Fisher steponeplus real time pcr system
    Analysis of mRNA and protein levels for pRb and E2F1 during EBV primary infection at 2, 5, and 7 dpi A. Human PBMCs were infected by BACEBV-GFPWT (WT) and EBVGFPΔE3C130-159 (ΔE3C130-159) virus and cells were harvested at 2, 5, and 7 days p.i. Total RNAs were extracted by using TRIzol (Invitrogen), and cDNAs were synthesized using a high capacity RNA-to-cDNA kit. The mRNA levels of pRb and E2F1 were quantified by <t>qRT-PCR</t> on a <t>StepOnePlus</t> real-time PCR system. B. The protein levels of pRb and E2F1 in PBMC infected with BACEBV-GFPWT and EBVGFPΔE3C130-159 virus at 2, 5 and 7 days p.i. were analyzed Western blot. dpi, days post-infection; RQ, relative quantity; RI, relative intensity. *P
    Steponeplus Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 39878 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/steponeplus real time pcr system/product/Thermo Fisher
    Average 90 stars, based on 39878 article reviews
    Price from $9.99 to $1999.99
    steponeplus real time pcr system - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher stepone plus rt pcr system
    Effect of fucoxanthin rich powder on mRNA expression of transcription factor and enzymes related to antioxidant system in the liver of rats. Total RNA was isolated using TRI-reagenet, and cDNA was synthesized using 3 ug of total RNA with SuperScript II reverse transcriptase. Realtime <t>PCR</t> was performed using SYBR green and standard procedures to assess the mRNA expression of the primer in liver samples obtained from each group. An Applied Biosystem <t>StepOne</t> softwere v2.1 was used. Each bar represents the mean ± S.E of three independent experiments. Different letters above each bar indicate significant differences among the groups at α = 0.05 as determined by Duncan's multiple range tests. HO-1: heme oxygenase (decycling) 1, Nrf2: nuclear factor, erythroid derived 2, like 2, NQO-1: NAD(P)H quinone oxidoreductase 1.
    Stepone Plus Rt Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 386 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stepone plus rt pcr system/product/Thermo Fisher
    Average 90 stars, based on 386 article reviews
    Price from $9.99 to $1999.99
    stepone plus rt pcr system - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    98
    Arraystar quantitative real time pcr
    Effect of fucoxanthin rich powder on mRNA expression of transcription factor and enzymes related to antioxidant system in the liver of rats. Total RNA was isolated using TRI-reagenet, and cDNA was synthesized using 3 ug of total RNA with SuperScript II reverse transcriptase. Realtime <t>PCR</t> was performed using SYBR green and standard procedures to assess the mRNA expression of the primer in liver samples obtained from each group. An Applied Biosystem <t>StepOne</t> softwere v2.1 was used. Each bar represents the mean ± S.E of three independent experiments. Different letters above each bar indicate significant differences among the groups at α = 0.05 as determined by Duncan's multiple range tests. HO-1: heme oxygenase (decycling) 1, Nrf2: nuclear factor, erythroid derived 2, like 2, NQO-1: NAD(P)H quinone oxidoreductase 1.
    Quantitative Real Time Pcr, supplied by Arraystar, used in various techniques. Bioz Stars score: 98/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Arraystar
    Average 98 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-02
    98/100 stars
      Buy from Supplier

    95
    Luminex quantitative real time pcr
    Pterodontic acid inhibited pro-inflammatory expr ession in influenza virus A/PR/8/34 (H1N1)-infected A549 cells. ( A ) A549 cells were infected with influenza virus (MOI = 0.2) in the presence or absence of different concentration of pterodontic acid for 24 h. Then, Total RNA was extracted and measured by <t>qRT-PCR</t> for the expression levels of IL-6, IP-10, MIP-1β, and MCP-1. The expression of each target gene was normalized to GAPDH; ( B ) The protein levels of cytokines and chemokines in the culture supernatant were assayed by <t>luminex</t> 24 h post A/PR/8/34 infection alone or in combination with pterodontic acid at 25 and 100 µg/mL. Each experiment was repeated in triplicate. * p
    Quantitative Real Time Pcr, supplied by Luminex, used in various techniques. Bioz Stars score: 95/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Luminex
    Average 95 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    99
    Abbott Laboratories quantitative real time pcr
    Pterodontic acid inhibited pro-inflammatory expr ession in influenza virus A/PR/8/34 (H1N1)-infected A549 cells. ( A ) A549 cells were infected with influenza virus (MOI = 0.2) in the presence or absence of different concentration of pterodontic acid for 24 h. Then, Total RNA was extracted and measured by <t>qRT-PCR</t> for the expression levels of IL-6, IP-10, MIP-1β, and MCP-1. The expression of each target gene was normalized to GAPDH; ( B ) The protein levels of cytokines and chemokines in the culture supernatant were assayed by <t>luminex</t> 24 h post A/PR/8/34 infection alone or in combination with pterodontic acid at 25 and 100 µg/mL. Each experiment was repeated in triplicate. * p
    Quantitative Real Time Pcr, supplied by Abbott Laboratories, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr/product/Abbott Laboratories
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    90
    Thermo Fisher viia 7 real time pcr system
    Platform comparison. Allelic discrimination plots of the four GBA mutations. Water was used as the no template control. Fig. 1A: Validation on the ABI PRISM® 7900 HT Sequence Detection System. Fig. 1B: Validation on the Applied Biosystems ViiA™ 7 Real-Time <t>PCR</t> System. Fig. 1C: Blind validation on the ABI PRISM® 7900 HT Sequence Detection System.
    Viia 7 Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 10752 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/viia 7 real time pcr system/product/Thermo Fisher
    Average 90 stars, based on 10752 article reviews
    Price from $9.99 to $1999.99
    viia 7 real time pcr system - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher fast real time pcr system
    Profiling of methylglyoxal (MGO)-regulated microRNAs (miRs) in A10 cells. A10 cells were treated with 300 μM MGO for 6 h. Real-time quantitative <t>PCR</t> (qPCR) analysis was then performed to show changes in expression levels of candidate miRs targeting Kir6.1 ( A ) and SUR2B mRNA ( B ). RNU6 (U6) was used for normalization. ** P
    Fast Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 2672 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fast real time pcr system/product/Thermo Fisher
    Average 90 stars, based on 2672 article reviews
    Price from $9.99 to $1999.99
    fast real time pcr system - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher real time pcr systems
    The tissue RARRES2 gene expression level is down-regulated in ACC but is not associated with patient prognosis. A, <t>TaqMan</t> real-time quantitative <t>PCR</t> reveals down-regulation of the RARRES2 gene expression level in our cohort of ACC samples as compared
    Real Time Pcr Systems, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 649 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time pcr systems/product/Thermo Fisher
    Average 90 stars, based on 649 article reviews
    Price from $9.99 to $1999.99
    real time pcr systems - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Bio-Rad quantitative real time pcr qrt pcr
    IPA Network Analysis Genes in Cluster 4. (a) IPA Network analysis was generated by seeding the genes within cluster 4 (blue highlighted genes) and “growing” those genes into a network by displaying direct (solid lines) and indirect (dashed lines) connections. All orphan genes were removed. Genes added to the network are illustrated with purple lines. (b) <t>qRT-PCR</t> was performed for node genes IRS1, OPA3, and POU6F1 to identify the associated gene expression profiles. The average ΔCt was calculated for each experimental group, where ΔCt = Ct (gene of interest)–Ct (Housekeeper gene–GAPDH). Data are shown ± S.D.
    Quantitative Real Time Pcr Qrt Pcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 2714 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr qrt pcr/product/Bio-Rad
    Average 99 stars, based on 2714 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr qrt pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    94
    Beijing ACCB Biotech Ltd quantitative real time pcr qrt pcr
    IPA Network Analysis Genes in Cluster 4. (a) IPA Network analysis was generated by seeding the genes within cluster 4 (blue highlighted genes) and “growing” those genes into a network by displaying direct (solid lines) and indirect (dashed lines) connections. All orphan genes were removed. Genes added to the network are illustrated with purple lines. (b) <t>qRT-PCR</t> was performed for node genes IRS1, OPA3, and POU6F1 to identify the associated gene expression profiles. The average ΔCt was calculated for each experimental group, where ΔCt = Ct (gene of interest)–Ct (Housekeeper gene–GAPDH). Data are shown ± S.D.
    Quantitative Real Time Pcr Qrt Pcr, supplied by Beijing ACCB Biotech Ltd, used in various techniques. Bioz Stars score: 94/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr qrt pcr/product/Beijing ACCB Biotech Ltd
    Average 94 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr qrt pcr - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    99
    TaKaRa quantitative real time pcr qrt pcr
    The biological function of MCM2 in LUSC cells. Notes: ( A ) The efficiency of siRNA-MCM2 is confirmed by <t>qRT-PCR</t> in LUSC cells. ( B ) The efficiency of siRNA-MCM2 is confirmed by Western blot in LUSC cells. ( C ) Downregulation of MCM2 decreases SK-MES-1 and H2170 viability in comparison to control cells after transfection for 48, 72 and 96 h. ( D ) Downregulation of MCM2 reduces the number of colonies in SK-MES-1 and H2170 cells. ( E ) Downregulation of MCM2 decreases the percentage of S-phase cells and increases the percentage of G0/G1-phase cells. Each experiment was performed in triplicate (* P
    Quantitative Real Time Pcr Qrt Pcr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1889 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr qrt pcr/product/TaKaRa
    Average 99 stars, based on 1889 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr qrt pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    TaKaRa quantitative real time pcr kit
    The biological function of MCM2 in LUSC cells. Notes: ( A ) The efficiency of siRNA-MCM2 is confirmed by <t>qRT-PCR</t> in LUSC cells. ( B ) The efficiency of siRNA-MCM2 is confirmed by Western blot in LUSC cells. ( C ) Downregulation of MCM2 decreases SK-MES-1 and H2170 viability in comparison to control cells after transfection for 48, 72 and 96 h. ( D ) Downregulation of MCM2 reduces the number of colonies in SK-MES-1 and H2170 cells. ( E ) Downregulation of MCM2 decreases the percentage of S-phase cells and increases the percentage of G0/G1-phase cells. Each experiment was performed in triplicate (* P
    Quantitative Real Time Pcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr kit/product/TaKaRa
    Average 99 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr kit - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Roche quantitative real time pcr analysis
    Tamoxifen treatment restores B cell development from E2A ER/ER pre-proB cells . Sorted E2A ER/+ and E2A ER/ER pre-proB cells were plated in hormone-free media on S17 stromal cells on Day 0 in the presence of IL-7 with tamoxifen or DMSO (untreated control). (A) Cells are pre-gated on 7AAD - B220 + lymphocytes. Percents of CD19 + cells on Day 1, 3, and 5 are displayed. Data are representative of 4 independent experiments. (B) Expression of <t>Pax5</t> was analyzed by quantitative <t>RT-PCR</t> from RNA collected from Day 1, 3, and 5 cultures shown in (A). Samples were normalized to the expression of GAPDH. Graphed results are means from triplicate runs (n = 3) with error bars representing standard error of the mean (SEM).
    Quantitative Real Time Pcr Analysis, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 413 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr analysis/product/Roche
    Average 99 stars, based on 413 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr analysis - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher quantitative real time pcr trizol
    Tamoxifen treatment restores B cell development from E2A ER/ER pre-proB cells . Sorted E2A ER/+ and E2A ER/ER pre-proB cells were plated in hormone-free media on S17 stromal cells on Day 0 in the presence of IL-7 with tamoxifen or DMSO (untreated control). (A) Cells are pre-gated on 7AAD - B220 + lymphocytes. Percents of CD19 + cells on Day 1, 3, and 5 are displayed. Data are representative of 4 independent experiments. (B) Expression of <t>Pax5</t> was analyzed by quantitative <t>RT-PCR</t> from RNA collected from Day 1, 3, and 5 cultures shown in (A). Samples were normalized to the expression of GAPDH. Graphed results are means from triplicate runs (n = 3) with error bars representing standard error of the mean (SEM).
    Quantitative Real Time Pcr Trizol, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 41 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr trizol/product/Thermo Fisher
    Average 99 stars, based on 41 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr trizol - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    4Gene quantitative real time pcr detection
    Tamoxifen treatment restores B cell development from E2A ER/ER pre-proB cells . Sorted E2A ER/+ and E2A ER/ER pre-proB cells were plated in hormone-free media on S17 stromal cells on Day 0 in the presence of IL-7 with tamoxifen or DMSO (untreated control). (A) Cells are pre-gated on 7AAD - B220 + lymphocytes. Percents of CD19 + cells on Day 1, 3, and 5 are displayed. Data are representative of 4 independent experiments. (B) Expression of <t>Pax5</t> was analyzed by quantitative <t>RT-PCR</t> from RNA collected from Day 1, 3, and 5 cultures shown in (A). Samples were normalized to the expression of GAPDH. Graphed results are means from triplicate runs (n = 3) with error bars representing standard error of the mean (SEM).
    Quantitative Real Time Pcr Detection, supplied by 4Gene, used in various techniques. Bioz Stars score: 99/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr detection/product/4Gene
    Average 99 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr detection - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Roche taqman quantitative real time pcr
    Tamoxifen treatment restores B cell development from E2A ER/ER pre-proB cells . Sorted E2A ER/+ and E2A ER/ER pre-proB cells were plated in hormone-free media on S17 stromal cells on Day 0 in the presence of IL-7 with tamoxifen or DMSO (untreated control). (A) Cells are pre-gated on 7AAD - B220 + lymphocytes. Percents of CD19 + cells on Day 1, 3, and 5 are displayed. Data are representative of 4 independent experiments. (B) Expression of <t>Pax5</t> was analyzed by quantitative <t>RT-PCR</t> from RNA collected from Day 1, 3, and 5 cultures shown in (A). Samples were normalized to the expression of GAPDH. Graphed results are means from triplicate runs (n = 3) with error bars representing standard error of the mean (SEM).
    Taqman Quantitative Real Time Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman quantitative real time pcr/product/Roche
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    taqman quantitative real time pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    82
    Eurofins Genomics quantitative real time pcr primers
    Tamoxifen treatment restores B cell development from E2A ER/ER pre-proB cells . Sorted E2A ER/+ and E2A ER/ER pre-proB cells were plated in hormone-free media on S17 stromal cells on Day 0 in the presence of IL-7 with tamoxifen or DMSO (untreated control). (A) Cells are pre-gated on 7AAD - B220 + lymphocytes. Percents of CD19 + cells on Day 1, 3, and 5 are displayed. Data are representative of 4 independent experiments. (B) Expression of <t>Pax5</t> was analyzed by quantitative <t>RT-PCR</t> from RNA collected from Day 1, 3, and 5 cultures shown in (A). Samples were normalized to the expression of GAPDH. Graphed results are means from triplicate runs (n = 3) with error bars representing standard error of the mean (SEM).
    Quantitative Real Time Pcr Primers, supplied by Eurofins Genomics, used in various techniques. Bioz Stars score: 82/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr primers/product/Eurofins Genomics
    Average 82 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr primers - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    99
    Bio-Rad semi quantitative real time pcr
    Tamoxifen treatment restores B cell development from E2A ER/ER pre-proB cells . Sorted E2A ER/+ and E2A ER/ER pre-proB cells were plated in hormone-free media on S17 stromal cells on Day 0 in the presence of IL-7 with tamoxifen or DMSO (untreated control). (A) Cells are pre-gated on 7AAD - B220 + lymphocytes. Percents of CD19 + cells on Day 1, 3, and 5 are displayed. Data are representative of 4 independent experiments. (B) Expression of <t>Pax5</t> was analyzed by quantitative <t>RT-PCR</t> from RNA collected from Day 1, 3, and 5 cultures shown in (A). Samples were normalized to the expression of GAPDH. Graphed results are means from triplicate runs (n = 3) with error bars representing standard error of the mean (SEM).
    Semi Quantitative Real Time Pcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 270 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/semi quantitative real time pcr/product/Bio-Rad
    Average 99 stars, based on 270 article reviews
    Price from $9.99 to $1999.99
    semi quantitative real time pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    79
    Kaneka Corp quantitative real time pcr mastermix
    Tamoxifen treatment restores B cell development from E2A ER/ER pre-proB cells . Sorted E2A ER/+ and E2A ER/ER pre-proB cells were plated in hormone-free media on S17 stromal cells on Day 0 in the presence of IL-7 with tamoxifen or DMSO (untreated control). (A) Cells are pre-gated on 7AAD - B220 + lymphocytes. Percents of CD19 + cells on Day 1, 3, and 5 are displayed. Data are representative of 4 independent experiments. (B) Expression of <t>Pax5</t> was analyzed by quantitative <t>RT-PCR</t> from RNA collected from Day 1, 3, and 5 cultures shown in (A). Samples were normalized to the expression of GAPDH. Graphed results are means from triplicate runs (n = 3) with error bars representing standard error of the mean (SEM).
    Quantitative Real Time Pcr Mastermix, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 79/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr mastermix/product/Kaneka Corp
    Average 79 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr mastermix - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    99
    TaKaRa quantitative real time pcr analysis
    Coefficient analysis of gene expression levels determined from <t>RNA-seq</t> and <t>qRT-PCR</t> data . The qRT-PCR log 2 values (x-axis) were plotted against onion bulb developmental stages (y-axis). ** Indicates a significant difference at p ≤ 0.01.
    Quantitative Real Time Pcr Analysis, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 434 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr analysis/product/TaKaRa
    Average 99 stars, based on 434 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr analysis - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    83
    Stratagene quantitative real time pcr system
    Transcript levels related to osteogenic differentiation markers (a) ALP, (b) <t>BSP,</t> (c) Collα1 and (d) OP and to metabolism (e) HIF-1α, quantified by real-time RT- <t>PCR</t> and normalized to GAPDH. Data are mean ± standard deviation from
    Quantitative Real Time Pcr System, supplied by Stratagene, used in various techniques. Bioz Stars score: 83/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr system/product/Stratagene
    Average 83 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr system - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    99
    Thermo Fisher taqman quantitative real time pcr
    Transcript levels related to osteogenic differentiation markers (a) ALP, (b) <t>BSP,</t> (c) Collα1 and (d) OP and to metabolism (e) HIF-1α, quantified by real-time RT- <t>PCR</t> and normalized to GAPDH. Data are mean ± standard deviation from
    Taqman Quantitative Real Time Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 287 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman quantitative real time pcr/product/Thermo Fisher
    Average 99 stars, based on 287 article reviews
    Price from $9.99 to $1999.99
    taqman quantitative real time pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    Prox1 is associated with IL-2 promoter Chromatin was extracted from ( A ) Jurkat cells and ( B ) naïve CD4 + T cells unstimulated or stimulated with anti-CD3/CD28 Dynabeads for 24 h, and precipitated with anti-Prox1 antibody or isotype IgG. The DNA sequence containing minimal IL-2 promoter (–256 to -46, product size: 211 bp) was analyzed by PCR. Data represent one of three separate experiments.

    Journal: Oncotarget

    Article Title: Prox1 represses IL-2 gene expression by interacting with NFAT2

    doi: 10.18632/oncotarget.17278

    Figure Lengend Snippet: Prox1 is associated with IL-2 promoter Chromatin was extracted from ( A ) Jurkat cells and ( B ) naïve CD4 + T cells unstimulated or stimulated with anti-CD3/CD28 Dynabeads for 24 h, and precipitated with anti-Prox1 antibody or isotype IgG. The DNA sequence containing minimal IL-2 promoter (–256 to -46, product size: 211 bp) was analyzed by PCR. Data represent one of three separate experiments.

    Article Snippet: To check the mRNA levels of Prox1, IL-2 and GAPDH, real-time PCR was performed in triplicate with a real-time PCR system (ABI PRISM 7500; Applied Biosystems, Foster City, CA, USA) using a SYBR detection kit (Takara) according to the standard protocol.

    Techniques: Sequencing, Polymerase Chain Reaction

    Overexpression of Prox1 inhibits IL-2 expression ( A and B ) Lentiviral vector expressing Prox1 gene and GFP, or GFP alone, were generated. Jurkat cells were infected with Prox1 lentivirus or the control lentivirus. The GFP + Jurkat cells were sorted 48 h post-infection, and stimulated with anti-CD3/CD28 Dynabeads for indicated times. (A) Prox1 and (B) IL-2 mRNA levels were assessed by real-time PCR, while ( C ) IL-2 protein levels at 24 h were measured by ELISA. ( D ) Jurkat cells were transiently transfected with increasing amount of Prox1 plasmids (0.125, 0.25 and 0.5 μg/ml) or control vector (pcDNA3), and stimulated with anti-CD3/CD28 Dynabeads for 24 h. The IL-2 protein levels were measured by ELISA. The data from represent the mean ± SEM of three experiments, ** P

    Journal: Oncotarget

    Article Title: Prox1 represses IL-2 gene expression by interacting with NFAT2

    doi: 10.18632/oncotarget.17278

    Figure Lengend Snippet: Overexpression of Prox1 inhibits IL-2 expression ( A and B ) Lentiviral vector expressing Prox1 gene and GFP, or GFP alone, were generated. Jurkat cells were infected with Prox1 lentivirus or the control lentivirus. The GFP + Jurkat cells were sorted 48 h post-infection, and stimulated with anti-CD3/CD28 Dynabeads for indicated times. (A) Prox1 and (B) IL-2 mRNA levels were assessed by real-time PCR, while ( C ) IL-2 protein levels at 24 h were measured by ELISA. ( D ) Jurkat cells were transiently transfected with increasing amount of Prox1 plasmids (0.125, 0.25 and 0.5 μg/ml) or control vector (pcDNA3), and stimulated with anti-CD3/CD28 Dynabeads for 24 h. The IL-2 protein levels were measured by ELISA. The data from represent the mean ± SEM of three experiments, ** P

    Article Snippet: To check the mRNA levels of Prox1, IL-2 and GAPDH, real-time PCR was performed in triplicate with a real-time PCR system (ABI PRISM 7500; Applied Biosystems, Foster City, CA, USA) using a SYBR detection kit (Takara) according to the standard protocol.

    Techniques: Over Expression, Expressing, Plasmid Preparation, Generated, Infection, Real-time Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay, Transfection

    Expression of Prox1 mRNA and protein in T cells ( A, B and C ) PBMCs, naïve CD4 + T cells and Jurkat cells were isolated, and stimulated with PHA and anti-CD3/CD28 Dynabeads for 24 h respectively. (A) Prox1 and (C) IL-2 mRNA levels were measured by RT-PCR, while (B) Prox1 protein levels were assessed by Western blot. For (A), (B) and (C), the data represent one of three independent experiments. ( D and E ) Naïve CD4 + T cells were stimulated with anti-CD3/CD28 Dynabeads for indicated times. (D) Prox1 and (E) IL-2 mRNA levels were measured by real-time PCR. Gene expression is normalized against the amount of GAPDH mRNA. The data from represent the mean ± SEM of three experiments.

    Journal: Oncotarget

    Article Title: Prox1 represses IL-2 gene expression by interacting with NFAT2

    doi: 10.18632/oncotarget.17278

    Figure Lengend Snippet: Expression of Prox1 mRNA and protein in T cells ( A, B and C ) PBMCs, naïve CD4 + T cells and Jurkat cells were isolated, and stimulated with PHA and anti-CD3/CD28 Dynabeads for 24 h respectively. (A) Prox1 and (C) IL-2 mRNA levels were measured by RT-PCR, while (B) Prox1 protein levels were assessed by Western blot. For (A), (B) and (C), the data represent one of three independent experiments. ( D and E ) Naïve CD4 + T cells were stimulated with anti-CD3/CD28 Dynabeads for indicated times. (D) Prox1 and (E) IL-2 mRNA levels were measured by real-time PCR. Gene expression is normalized against the amount of GAPDH mRNA. The data from represent the mean ± SEM of three experiments.

    Article Snippet: To check the mRNA levels of Prox1, IL-2 and GAPDH, real-time PCR was performed in triplicate with a real-time PCR system (ABI PRISM 7500; Applied Biosystems, Foster City, CA, USA) using a SYBR detection kit (Takara) according to the standard protocol.

    Techniques: Expressing, Isolation, Reverse Transcription Polymerase Chain Reaction, Western Blot, Real-time Polymerase Chain Reaction

    KLF15 is the major Kruppel-Like Factor in HPMEC and important regulator of critical endothelial enzymes- Arginase 2 and eNOS Total RNA from Human Pulmonary Microvascular endothelial cells was converted to cDNA and the relative mRNA expression of KLF15 was determined in quiescent HPMEC using real-time PCR (N=3), B) Cell lysates from HPMEC, human coronary artery endothelial cells (HCAEC), Human Aortic Endothelial Cells (HAEC), Human Aortic Smooth Muscle Cells (HASMC) were subjected to western blotting with KLF15, eNOS and β-tubulin antibodies (N=4). Cell lysates from HPMEC overexpressing HA-KLF15 was used as a positive control, C) Total RNA from Human Pulmonary Microvascular endothelial cells was converted to cDNA and the relative mRNA expression of KLF2, 4 and 15 was determined in quiescent HPMEC using real-time PCR (N=3) *p

    Journal: Arteriosclerosis, thrombosis, and vascular biology

    Article Title: Hypoxia Triggers SENP1 Modulation of Kruppel-Like Factor 15 and Transcriptional Regulation of Arginase 2 in Pulmonary Endothelium

    doi: 10.1161/ATVBAHA.117.310660

    Figure Lengend Snippet: KLF15 is the major Kruppel-Like Factor in HPMEC and important regulator of critical endothelial enzymes- Arginase 2 and eNOS Total RNA from Human Pulmonary Microvascular endothelial cells was converted to cDNA and the relative mRNA expression of KLF15 was determined in quiescent HPMEC using real-time PCR (N=3), B) Cell lysates from HPMEC, human coronary artery endothelial cells (HCAEC), Human Aortic Endothelial Cells (HAEC), Human Aortic Smooth Muscle Cells (HASMC) were subjected to western blotting with KLF15, eNOS and β-tubulin antibodies (N=4). Cell lysates from HPMEC overexpressing HA-KLF15 was used as a positive control, C) Total RNA from Human Pulmonary Microvascular endothelial cells was converted to cDNA and the relative mRNA expression of KLF2, 4 and 15 was determined in quiescent HPMEC using real-time PCR (N=3) *p

    Article Snippet: RNA was then reverse transcribed with oligo dT primers to obtain cDNA and quantitative real time PCR (Applied Biosystems) was performed using SYBR Green Supermix mix (Applied Biosystems) whereas semi-quantitative RTPCR was performed using a conventional Biorad PCR machine and the following primer sets: Human Arg2 : Forward: 5′-GGG CCC TGA AGG CTG TAG-3′, Reverse: 5′-AAT GGA GCC ACT GCC ATC-3′.

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Western Blot, Positive Control

    Inflammatory profile. A-C: Serum levels of IL-6, TNF-α and IL-10; D-F: Renal protein levels of IL-6, TNF-α and IL-10. The serum and renal protein levels were determined by using the multiplex immunoassay (ELISA). G-H: Renal gene expression of IL-6 and TNF-α was measured by real-time PCR, and the mRNA levels were normalized to the housekeeping gene β-actin and calculated using the 2 ΔΔCT method. The data are expressed as the mean ± SEM, n = 6 per group, *p

    Journal: PLoS ONE

    Article Title: Precocious obesity predisposes the development of more severe cisplatin-induced acute kidney injury in young adult mice

    doi: 10.1371/journal.pone.0174721

    Figure Lengend Snippet: Inflammatory profile. A-C: Serum levels of IL-6, TNF-α and IL-10; D-F: Renal protein levels of IL-6, TNF-α and IL-10. The serum and renal protein levels were determined by using the multiplex immunoassay (ELISA). G-H: Renal gene expression of IL-6 and TNF-α was measured by real-time PCR, and the mRNA levels were normalized to the housekeeping gene β-actin and calculated using the 2 ΔΔCT method. The data are expressed as the mean ± SEM, n = 6 per group, *p

    Article Snippet: The mRNA expression levels were estimated using quantitative real-time PCR (QuantStudio Flex 7 Real-Time PCR System, Applied Biosystems, Carlsbad, CA, USA).

    Techniques: Multiplex Assay, Enzyme-linked Immunosorbent Assay, Expressing, Real-time Polymerase Chain Reaction

    Renal expression of oxidative stress markers. A: Malondialdehyde, a marker of lipid peroxidation, was quantified by ELISA; B and C: the gene expression levels of the NADPH system enzyme gp91phox and the antioxidant enzyme SOD1 were determined by real-time RT-PCR. The mRNA levels were normalized to β-actin expression and quantified using the 2 ΔΔCT method. D-E: Representative western blot and densitometry analysis of glutathione peroxidase expression. The data are expressed as the mean ± SEM, n = 3–6 per group. *p

    Journal: PLoS ONE

    Article Title: Precocious obesity predisposes the development of more severe cisplatin-induced acute kidney injury in young adult mice

    doi: 10.1371/journal.pone.0174721

    Figure Lengend Snippet: Renal expression of oxidative stress markers. A: Malondialdehyde, a marker of lipid peroxidation, was quantified by ELISA; B and C: the gene expression levels of the NADPH system enzyme gp91phox and the antioxidant enzyme SOD1 were determined by real-time RT-PCR. The mRNA levels were normalized to β-actin expression and quantified using the 2 ΔΔCT method. D-E: Representative western blot and densitometry analysis of glutathione peroxidase expression. The data are expressed as the mean ± SEM, n = 3–6 per group. *p

    Article Snippet: The mRNA expression levels were estimated using quantitative real-time PCR (QuantStudio Flex 7 Real-Time PCR System, Applied Biosystems, Carlsbad, CA, USA).

    Techniques: Expressing, Marker, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR, Western Blot

    CTCF consensus motifs are found in HPV genomes. A). Schematic diagram of linear HPV 31 genome showing the location of the CTCF (CCCTC) consensus motifs that are also present in other high-risk HPV subtypes. Number indicates the location of the beginning of the pentamer sequence. B). Summary of analysis of 125 HPV types for the presence of CTCF core consensus motifs in L2, L1, E2 and E4 regions. Percentage of HPV type that are positive for these sequences is shown. (C,D). Chromatin immunoprecipitation analysis of SMC1 and γ-H2AX binding to URR region in undifferentiated cells and cells differentiated in calcium for 72 hours. (E,F) Chromatin immunoprecipitation analysis of SMC1 and γ-H2AX binding to the L2 region in undifferentiated cells and cells differentiated in high calcium media for 72 hours. SMC1 binds to the L2 region at similar levels in both undifferentiated or differentiated cells. γ-H2AX binding to HPV genomes increases upon differentiation at both URR and L2 regions Quantitative real-time PCR was performed using a Lightcycler 480 (Roche). Similar results were seen in three independent experiments.

    Journal: PLoS Pathogens

    Article Title: Human Papillomaviruses Activate and Recruit SMC1 Cohesin Proteins for the Differentiation-Dependent Life Cycle through Association with CTCF Insulators

    doi: 10.1371/journal.ppat.1004763

    Figure Lengend Snippet: CTCF consensus motifs are found in HPV genomes. A). Schematic diagram of linear HPV 31 genome showing the location of the CTCF (CCCTC) consensus motifs that are also present in other high-risk HPV subtypes. Number indicates the location of the beginning of the pentamer sequence. B). Summary of analysis of 125 HPV types for the presence of CTCF core consensus motifs in L2, L1, E2 and E4 regions. Percentage of HPV type that are positive for these sequences is shown. (C,D). Chromatin immunoprecipitation analysis of SMC1 and γ-H2AX binding to URR region in undifferentiated cells and cells differentiated in calcium for 72 hours. (E,F) Chromatin immunoprecipitation analysis of SMC1 and γ-H2AX binding to the L2 region in undifferentiated cells and cells differentiated in high calcium media for 72 hours. SMC1 binds to the L2 region at similar levels in both undifferentiated or differentiated cells. γ-H2AX binding to HPV genomes increases upon differentiation at both URR and L2 regions Quantitative real-time PCR was performed using a Lightcycler 480 (Roche). Similar results were seen in three independent experiments.

    Article Snippet: Quantitative real-time PCR was performed using a Lightcycler 480 (Roche).

    Techniques: Sequencing, Chromatin Immunoprecipitation, Binding Assay, Real-time Polymerase Chain Reaction

    Transgenic overexpression of Dlk1 modulates EAE severity and adaptive immune responses. A) Dlk1 mRNA expression in immune tissues in Dlk1 transgenic and wild type littermate control mice measured using TaqMan PCR. Relative Dlk1 expression was calculated in relation to the mean of housekeeping gene, beta-2 microglobulin, using 2-ΔΔCt method (N = 3–5 mice/group). B) Daily EAE scores in Dlk1 transgenic (N = 24) and wild type littermate control (N = 20) mice after immunization with MOG demonstrate that the higher levels of Dlk1 in transgenic mice are protective against EAE. Mean EAE clinical score (and the standard error of the mean) is given for each day post immunization (p.i.). The figure represents pooled data from three separate experiments. Mann-Whitney U-test was used to compare the daily EAE scores (p-value

    Journal: PLoS Genetics

    Article Title: Parent-of-Origin Effects Implicate Epigenetic Regulation of Experimental Autoimmune Encephalomyelitis and Identify Imprinted Dlk1 as a Novel Risk Gene

    doi: 10.1371/journal.pgen.1004265

    Figure Lengend Snippet: Transgenic overexpression of Dlk1 modulates EAE severity and adaptive immune responses. A) Dlk1 mRNA expression in immune tissues in Dlk1 transgenic and wild type littermate control mice measured using TaqMan PCR. Relative Dlk1 expression was calculated in relation to the mean of housekeeping gene, beta-2 microglobulin, using 2-ΔΔCt method (N = 3–5 mice/group). B) Daily EAE scores in Dlk1 transgenic (N = 24) and wild type littermate control (N = 20) mice after immunization with MOG demonstrate that the higher levels of Dlk1 in transgenic mice are protective against EAE. Mean EAE clinical score (and the standard error of the mean) is given for each day post immunization (p.i.). The figure represents pooled data from three separate experiments. Mann-Whitney U-test was used to compare the daily EAE scores (p-value

    Article Snippet: Quantitative real-time PCR of rat Dlk1 , Rtl1 and Dio3 in the BC material was performed using a BioRad CFX384 Touch real-time PCR system with a two-step PCR protocol (95°C for 3 min. followed by 40 cycles of 95°C for 10 sec., 60°C for 30 sec. followed by melt curve analysis), using SYBR Green as the fluorophore (Bio-Rad).

    Techniques: Transgenic Assay, Over Expression, Expressing, Mouse Assay, Polymerase Chain Reaction, MANN-WHITNEY, Significance Assay

    a. Combined bisulfite restriction analysis of LINE-1 in symptomatic BPH TURP samples, asymptomatic BPH, and donors. Lane 1 is a 100 base pair (bp) molecular weight marker (mwm), lane 2 is the calibrator, lanes 3–5 are symptomatic BPH TURP samples, lanes 6–8 are asymptomatic BPH, lanes 9–11 are donor and lane 12 is undigested PCR product. DNA samples were bisulfite treated, subjected to Line1 PCR and subsequent digestion with HinfI. The undigested top band at 450bp represents unmethylated DNA whereas the digestion products at 275bp and 180bp indicate methylated DNA. b. Quantification of the percent methylation compared to the calibrator of 11 symptomatic BPH from TURP, 10 asymptomatic BPH and 9 donors. Data is represented as a box and whisker plot. A statistically significant difference exists between symptomatic BPH and donors groups (p = 0.040, Mann Whitney), whereas there is no statistically significant difference between symptomatic BPH and asymptomatic BPH. c. APOBEC3G real time PCR results for symptomatic BPH, asymptomatic BPH, and donor samples. The Mann-Whitney rank-sum test was used to determine the statistically significant p value of 0.011 between symptomatic BPH and donors and the t-test was used to determine the statistically significant difference between symptomatic BPH and donors (p = 0.043).

    Journal: Genes and immunity

    Article Title: Activation of innate anti-viral immune response genes in symptomatic benign prostatic hyperplasia

    doi: 10.1038/gene.2012.40

    Figure Lengend Snippet: a. Combined bisulfite restriction analysis of LINE-1 in symptomatic BPH TURP samples, asymptomatic BPH, and donors. Lane 1 is a 100 base pair (bp) molecular weight marker (mwm), lane 2 is the calibrator, lanes 3–5 are symptomatic BPH TURP samples, lanes 6–8 are asymptomatic BPH, lanes 9–11 are donor and lane 12 is undigested PCR product. DNA samples were bisulfite treated, subjected to Line1 PCR and subsequent digestion with HinfI. The undigested top band at 450bp represents unmethylated DNA whereas the digestion products at 275bp and 180bp indicate methylated DNA. b. Quantification of the percent methylation compared to the calibrator of 11 symptomatic BPH from TURP, 10 asymptomatic BPH and 9 donors. Data is represented as a box and whisker plot. A statistically significant difference exists between symptomatic BPH and donors groups (p = 0.040, Mann Whitney), whereas there is no statistically significant difference between symptomatic BPH and asymptomatic BPH. c. APOBEC3G real time PCR results for symptomatic BPH, asymptomatic BPH, and donor samples. The Mann-Whitney rank-sum test was used to determine the statistically significant p value of 0.011 between symptomatic BPH and donors and the t-test was used to determine the statistically significant difference between symptomatic BPH and donors (p = 0.043).

    Article Snippet: Real time PCR Quantitative real time PCR for APOBEC3G, IFIT1, LINE1ORF2 and glyceraldehyde 2-phosphate dehydrogenase (GAPDH) was performed on a Bio-Rad (Hercules, CA, USA) iQ5 Multicolor Real Time PCR detection system real time PCR machine whereas real time PCR for CFI and OAS2 was performed on the Applied Biosystems Step One Plus real time PCR system/machine (Carlsbad, CA, USA).

    Techniques: Molecular Weight, Marker, Polymerase Chain Reaction, Methylation, Whisker Assay, MANN-WHITNEY, Real-time Polymerase Chain Reaction

    a. LINE1ORF2 real time PCR for symptomatic BPH, asymptomatic BPH and normal prostate tissue from organ donors. The Mann-Whitney statistical test was performed, determining that a statistically significant difference exists between symptomatic BPH and donors (p = 0.015), however there is no statistically significant difference between symptomatic and asymptomatic BPH.

    Journal: Genes and immunity

    Article Title: Activation of innate anti-viral immune response genes in symptomatic benign prostatic hyperplasia

    doi: 10.1038/gene.2012.40

    Figure Lengend Snippet: a. LINE1ORF2 real time PCR for symptomatic BPH, asymptomatic BPH and normal prostate tissue from organ donors. The Mann-Whitney statistical test was performed, determining that a statistically significant difference exists between symptomatic BPH and donors (p = 0.015), however there is no statistically significant difference between symptomatic and asymptomatic BPH.

    Article Snippet: Real time PCR Quantitative real time PCR for APOBEC3G, IFIT1, LINE1ORF2 and glyceraldehyde 2-phosphate dehydrogenase (GAPDH) was performed on a Bio-Rad (Hercules, CA, USA) iQ5 Multicolor Real Time PCR detection system real time PCR machine whereas real time PCR for CFI and OAS2 was performed on the Applied Biosystems Step One Plus real time PCR system/machine (Carlsbad, CA, USA).

    Techniques: Real-time Polymerase Chain Reaction, MANN-WHITNEY

    a. IFIT1 real time PCR with symptomatic and asymptomatic BPH samples. The Mann-Whitney statistical test was utilized for statistical analysis and determined that there was no statistically significant difference between the two groups. b. Real time PCR for IFIT1 in symptomatic BPH and asymptomatic BPH samples in which the prostate mass was less than 60g. Statistical analysis using the Mann-Whitney rank-sum test demonstrates a statistically significant difference between the two groups, p = 0.0118.

    Journal: Genes and immunity

    Article Title: Activation of innate anti-viral immune response genes in symptomatic benign prostatic hyperplasia

    doi: 10.1038/gene.2012.40

    Figure Lengend Snippet: a. IFIT1 real time PCR with symptomatic and asymptomatic BPH samples. The Mann-Whitney statistical test was utilized for statistical analysis and determined that there was no statistically significant difference between the two groups. b. Real time PCR for IFIT1 in symptomatic BPH and asymptomatic BPH samples in which the prostate mass was less than 60g. Statistical analysis using the Mann-Whitney rank-sum test demonstrates a statistically significant difference between the two groups, p = 0.0118.

    Article Snippet: Real time PCR Quantitative real time PCR for APOBEC3G, IFIT1, LINE1ORF2 and glyceraldehyde 2-phosphate dehydrogenase (GAPDH) was performed on a Bio-Rad (Hercules, CA, USA) iQ5 Multicolor Real Time PCR detection system real time PCR machine whereas real time PCR for CFI and OAS2 was performed on the Applied Biosystems Step One Plus real time PCR system/machine (Carlsbad, CA, USA).

    Techniques: Real-time Polymerase Chain Reaction, MANN-WHITNEY

    a. Correlation between IFIT1 real time PCR results (IFIT1 relative gene expression – IFIT1/GAPDH) and mass in grams of the asymptomatic BPH samples. Statistical analysis was carried out using a Pearson’s correlation, with the Pearson’s r = 0.65 and p = 0.0172. b. Correlation between APOBEC3G and IFIT1 relative gene expression (normalized to GAPDH) in the symptomatic BPH samples. Pearson’s correlation statistical analysis resulted in a Pearson’s r = 0.65 and p = 0.0066.

    Journal: Genes and immunity

    Article Title: Activation of innate anti-viral immune response genes in symptomatic benign prostatic hyperplasia

    doi: 10.1038/gene.2012.40

    Figure Lengend Snippet: a. Correlation between IFIT1 real time PCR results (IFIT1 relative gene expression – IFIT1/GAPDH) and mass in grams of the asymptomatic BPH samples. Statistical analysis was carried out using a Pearson’s correlation, with the Pearson’s r = 0.65 and p = 0.0172. b. Correlation between APOBEC3G and IFIT1 relative gene expression (normalized to GAPDH) in the symptomatic BPH samples. Pearson’s correlation statistical analysis resulted in a Pearson’s r = 0.65 and p = 0.0066.

    Article Snippet: Real time PCR Quantitative real time PCR for APOBEC3G, IFIT1, LINE1ORF2 and glyceraldehyde 2-phosphate dehydrogenase (GAPDH) was performed on a Bio-Rad (Hercules, CA, USA) iQ5 Multicolor Real Time PCR detection system real time PCR machine whereas real time PCR for CFI and OAS2 was performed on the Applied Biosystems Step One Plus real time PCR system/machine (Carlsbad, CA, USA).

    Techniques: Real-time Polymerase Chain Reaction, Expressing

    MiR-9-1 is under CREB's control. (A) Location of putative CREs within the 5′ flanking regions of miR-9-1 and miR-9-2. MiR-9-1 is located in an intron of the gene c1orf61 (chromosome 1), whereas miR-9-2 is located in an exon of linc00461 (chromosome 5). Three pairs of primers (miR-9-1-a, miR-9-1-b and miR-9-2) were designed to detect the binding capacity of CREB to the predicted CREs of miR-9-1-a, miR-9-1-b and miR-9-2, respectively, by ChIP-qPCR assays. Both the 5′ flanking sequences (2 kb) and the pre-miRNA bodies of miR-9-1 and miR-9-2 were inserted upstream of the luciferase reporter (gray box shown by LUC). The arrows denote the positions of primers used for ChIP-qPCR. (B) ChIP-qPCR assays were performed in T98G and U251 cells to detect the binding capacity of CREB to the putative CREs of miR-9-1 and miR-9-2 (mean ± SD, n = 3). (C) In AD-shNC/AD-shcreb-infected T98G and U251 cells, ChIP-qPCR was performed to detect the binding capacity of CREB on CRE-miR-9-1-a (mean ± SD, n = 3). (D) CREB enhances the transcription of miR-9-1. The 5′ flanking sequences (−2 kb+miR-9-1; −2 kb, −570 bp; −560 bp+miR-9-1) without mutations or with a mutation of CRE-a (−569+miR-9-1, from TGACGGGC to TGGAGGGC ) in miR-9-1 were inserted upstream of the luciferase cassette. The luciferase reporter constructs were co-transfected with CREB expression plasmids or control vectors and the normalized luciferase activity was determined (mean ± SD, n = 4). (E) The mRNA expression levels of CREB, pri-miR-9-1 and mature miR-9 were detected in T98G and U251 cells infected with AD-shcreb or AD-shNC by quantitative RT-PCR (mean ± SD, n = 3). *, P

    Journal: PLoS ONE

    Article Title: The CREB-miR-9 Negative Feedback Minicircuitry Coordinates the Migration and Proliferation of Glioma Cells

    doi: 10.1371/journal.pone.0049570

    Figure Lengend Snippet: MiR-9-1 is under CREB's control. (A) Location of putative CREs within the 5′ flanking regions of miR-9-1 and miR-9-2. MiR-9-1 is located in an intron of the gene c1orf61 (chromosome 1), whereas miR-9-2 is located in an exon of linc00461 (chromosome 5). Three pairs of primers (miR-9-1-a, miR-9-1-b and miR-9-2) were designed to detect the binding capacity of CREB to the predicted CREs of miR-9-1-a, miR-9-1-b and miR-9-2, respectively, by ChIP-qPCR assays. Both the 5′ flanking sequences (2 kb) and the pre-miRNA bodies of miR-9-1 and miR-9-2 were inserted upstream of the luciferase reporter (gray box shown by LUC). The arrows denote the positions of primers used for ChIP-qPCR. (B) ChIP-qPCR assays were performed in T98G and U251 cells to detect the binding capacity of CREB to the putative CREs of miR-9-1 and miR-9-2 (mean ± SD, n = 3). (C) In AD-shNC/AD-shcreb-infected T98G and U251 cells, ChIP-qPCR was performed to detect the binding capacity of CREB on CRE-miR-9-1-a (mean ± SD, n = 3). (D) CREB enhances the transcription of miR-9-1. The 5′ flanking sequences (−2 kb+miR-9-1; −2 kb, −570 bp; −560 bp+miR-9-1) without mutations or with a mutation of CRE-a (−569+miR-9-1, from TGACGGGC to TGGAGGGC ) in miR-9-1 were inserted upstream of the luciferase cassette. The luciferase reporter constructs were co-transfected with CREB expression plasmids or control vectors and the normalized luciferase activity was determined (mean ± SD, n = 4). (E) The mRNA expression levels of CREB, pri-miR-9-1 and mature miR-9 were detected in T98G and U251 cells infected with AD-shcreb or AD-shNC by quantitative RT-PCR (mean ± SD, n = 3). *, P

    Article Snippet: Quantitative real-time PCR The expression levels of pri-miR-9-1, -2, and -3 as well as CREB and NF1 mRNAs were determined by real-time PCR using a SYBR-green-containing PCR kit (Takara) according to the manufacturer's instructions.

    Techniques: Binding Assay, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Luciferase, Infection, Mutagenesis, Construct, Transfection, Expressing, Activity Assay, Quantitative RT-PCR

    A low concentration of glucose induces the expression of miR-9. (A and B) T98G cells were maintained in DMEM/high glucose (4.5 g/L, HG) or DMEM/low glucose (1.0 g/L, LG) DMEM for 24 h. Cells were then harvested for RNA and protein extraction. The mRNA expression levels of miR-9, pri-miR-9-1, pri-miR-9-2, CREB and NF1 were determined by quantitative RT-PCR (mean ± SD, n = 3), and the protein levels of CREB and NF1 were detected by western blotting. (C) The negative feedback minicircuitry comprised of miR-9 and CREB. MiR-9 is highly expressed in glioma cells with amplification of the miR-9-2 gene copy number. The up arrow denotes genomic amplification. The transcription of miR-9-1 is regulated by CREB and miR-9 can directly target the 3′UTR of CREB, forming negative feedback minicircuitry. CREB inhibits the migration of glioma cells by elevating the expression level of NF1, whereas miR-9 promotes migration by directly targeting NF1 and CREB. In addition, miR-9 inhibits the proliferation of glioma cells by directly targeting the proliferation-promoting transcription factor, CREB. (D) The balance between miR-9 and CREB coordinates the migration and proliferation of glioma cells. The glioma cells with low levels of miR-9 and high CREB protein levels prefer to proliferate rather than migrate. As the glioma progresses, certain events, such as glucose reduction and mir-9-2 gene copy number amplification trigger the substantial increase of miR-9. By targeting migration-inhibitory CREB and NF1, miR-9 promotes the migration of glioma cells accompanied by proliferation repression.

    Journal: PLoS ONE

    Article Title: The CREB-miR-9 Negative Feedback Minicircuitry Coordinates the Migration and Proliferation of Glioma Cells

    doi: 10.1371/journal.pone.0049570

    Figure Lengend Snippet: A low concentration of glucose induces the expression of miR-9. (A and B) T98G cells were maintained in DMEM/high glucose (4.5 g/L, HG) or DMEM/low glucose (1.0 g/L, LG) DMEM for 24 h. Cells were then harvested for RNA and protein extraction. The mRNA expression levels of miR-9, pri-miR-9-1, pri-miR-9-2, CREB and NF1 were determined by quantitative RT-PCR (mean ± SD, n = 3), and the protein levels of CREB and NF1 were detected by western blotting. (C) The negative feedback minicircuitry comprised of miR-9 and CREB. MiR-9 is highly expressed in glioma cells with amplification of the miR-9-2 gene copy number. The up arrow denotes genomic amplification. The transcription of miR-9-1 is regulated by CREB and miR-9 can directly target the 3′UTR of CREB, forming negative feedback minicircuitry. CREB inhibits the migration of glioma cells by elevating the expression level of NF1, whereas miR-9 promotes migration by directly targeting NF1 and CREB. In addition, miR-9 inhibits the proliferation of glioma cells by directly targeting the proliferation-promoting transcription factor, CREB. (D) The balance between miR-9 and CREB coordinates the migration and proliferation of glioma cells. The glioma cells with low levels of miR-9 and high CREB protein levels prefer to proliferate rather than migrate. As the glioma progresses, certain events, such as glucose reduction and mir-9-2 gene copy number amplification trigger the substantial increase of miR-9. By targeting migration-inhibitory CREB and NF1, miR-9 promotes the migration of glioma cells accompanied by proliferation repression.

    Article Snippet: Quantitative real-time PCR The expression levels of pri-miR-9-1, -2, and -3 as well as CREB and NF1 mRNAs were determined by real-time PCR using a SYBR-green-containing PCR kit (Takara) according to the manufacturer's instructions.

    Techniques: Concentration Assay, Expressing, Protein Extraction, Quantitative RT-PCR, Western Blot, Amplification, Migration

    MiR-9 is highly expressed in glioma cell lines. (A) Schematic representation showing that miR-9 can be generated by the processing of any of the three primary transcripts encoded by three distinct genes (miR-9-1, miR-9-2 and miR-9-3). (B and C) The expression levels of mature miR-9 as well as pri-miR-9-1, pri-miR-9-2 and pri-miR-9-3 were determined in the human cervical carcinoma cell line (HeLa), normal human glial cell line (HEB) and four glioma cell lines (U87MG, T98G, A172 and U251) by quantitative RT-PCR (mean ± SD, n = 3). (D) Genomic DNA was extracted from the six cell lines (HeLa, HEB, U87MG, T98G, A172 and U251), and the gene copy numbers of miR-9-1, miR-9-2 and miR-9-3 were determined by quantitative real-time PCR (mean ± SD, n = 3). *, P

    Journal: PLoS ONE

    Article Title: The CREB-miR-9 Negative Feedback Minicircuitry Coordinates the Migration and Proliferation of Glioma Cells

    doi: 10.1371/journal.pone.0049570

    Figure Lengend Snippet: MiR-9 is highly expressed in glioma cell lines. (A) Schematic representation showing that miR-9 can be generated by the processing of any of the three primary transcripts encoded by three distinct genes (miR-9-1, miR-9-2 and miR-9-3). (B and C) The expression levels of mature miR-9 as well as pri-miR-9-1, pri-miR-9-2 and pri-miR-9-3 were determined in the human cervical carcinoma cell line (HeLa), normal human glial cell line (HEB) and four glioma cell lines (U87MG, T98G, A172 and U251) by quantitative RT-PCR (mean ± SD, n = 3). (D) Genomic DNA was extracted from the six cell lines (HeLa, HEB, U87MG, T98G, A172 and U251), and the gene copy numbers of miR-9-1, miR-9-2 and miR-9-3 were determined by quantitative real-time PCR (mean ± SD, n = 3). *, P

    Article Snippet: Quantitative real-time PCR The expression levels of pri-miR-9-1, -2, and -3 as well as CREB and NF1 mRNAs were determined by real-time PCR using a SYBR-green-containing PCR kit (Takara) according to the manufacturer's instructions.

    Techniques: Generated, Expressing, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

    HOTAIRM1 regulates autophagy-associated gene expression by competing with the binding sites of miRNAs. ( a ) HOTAIRM1 transcripts bind to AGO2 directly. AGO2 was assayed by western blotting after acquiring the possible protein complex binding to HOTAIRM1. Proteins bound to the antisense of HOTAIRM1 served as loading controls. ( b ) RNA immunoprecipitation was performed to acquire the RNA that interacted with AGO2 protein. The qRT-PCR product of HOTAIRM1 was tested by agarose gel electrophoresis. ( c ) Luciferase reporter assays analyzing the binding of HOTAIRM1 to miRNAs. NC and miRNAs duplexes were co-transfected with psiCHECH-2 plasmids containing the 59 nt of HOTAIRM1-WT or HOTAIRM1-MUT. The firefly luciferase activity of each sample was normalized to the Renilla luciferase activity ( n =3 independent experiments performed in triplicate). ( d ) Luciferase reporter assays analyzing the genes potentially influenced by HOTAIRM1. NC and two HOTAIRM1-siRNAs were co-transfected with psiCHECH-2 plasmids with the 59-nt of miRNAs targeting the wild-type or mutant gene position in HEK-293 T cells. The firefly luciferase activity of each sample was normalized to the Renilla luciferase activity. Values are derived from n =3 independent experiments, and data are reported as the mean±S.D. ( e ) Western blotting detecting the proteins expression levels of genes regulated by HOTAIRM1. ULK1, E2F1 and DRAM2 were all downregulated when HOTAIRM1 was knocked down in NB4 cells with or without 1 μ M ATRA treatment; GAPDH was used as a loading control. The densitometric ratio normalized to GAPDH was recorded by quantity one. Values are derived from n =3 independent experiments, and data are reported as the mean±S.D. (down). ( f–h ) The qRT-PCR testing of DRMA1, LC3B and ULK1, three direct targets of E2F1. Experiments were performed in triplicate and are reported as the mean±S.D. ( i ) The qRT-PCR testing of miRNAs in NB4-Lv-NC and NB4-Lv-shHOTAIRM1 cells after treatment with ATRA (1 μ M, 48 h). Experiments were performed in triplicate and normalized to GAPDH. ( j ) The detection of PML-RARA by western bloting after transient overexpression of miR-20a and miR-106b mimics in NB4 cells. Experiments were performed in triplicate. PML-RARA/GAPDH densitometric ratios were recorded. Differences in c - i were considered significant at * P

    Journal: Cell Death and Differentiation

    Article Title: The lncRNA HOTAIRM1 regulates the degradation of PML-RARA oncoprotein and myeloid cell differentiation by enhancing the autophagy pathway

    doi: 10.1038/cdd.2016.111

    Figure Lengend Snippet: HOTAIRM1 regulates autophagy-associated gene expression by competing with the binding sites of miRNAs. ( a ) HOTAIRM1 transcripts bind to AGO2 directly. AGO2 was assayed by western blotting after acquiring the possible protein complex binding to HOTAIRM1. Proteins bound to the antisense of HOTAIRM1 served as loading controls. ( b ) RNA immunoprecipitation was performed to acquire the RNA that interacted with AGO2 protein. The qRT-PCR product of HOTAIRM1 was tested by agarose gel electrophoresis. ( c ) Luciferase reporter assays analyzing the binding of HOTAIRM1 to miRNAs. NC and miRNAs duplexes were co-transfected with psiCHECH-2 plasmids containing the 59 nt of HOTAIRM1-WT or HOTAIRM1-MUT. The firefly luciferase activity of each sample was normalized to the Renilla luciferase activity ( n =3 independent experiments performed in triplicate). ( d ) Luciferase reporter assays analyzing the genes potentially influenced by HOTAIRM1. NC and two HOTAIRM1-siRNAs were co-transfected with psiCHECH-2 plasmids with the 59-nt of miRNAs targeting the wild-type or mutant gene position in HEK-293 T cells. The firefly luciferase activity of each sample was normalized to the Renilla luciferase activity. Values are derived from n =3 independent experiments, and data are reported as the mean±S.D. ( e ) Western blotting detecting the proteins expression levels of genes regulated by HOTAIRM1. ULK1, E2F1 and DRAM2 were all downregulated when HOTAIRM1 was knocked down in NB4 cells with or without 1 μ M ATRA treatment; GAPDH was used as a loading control. The densitometric ratio normalized to GAPDH was recorded by quantity one. Values are derived from n =3 independent experiments, and data are reported as the mean±S.D. (down). ( f–h ) The qRT-PCR testing of DRMA1, LC3B and ULK1, three direct targets of E2F1. Experiments were performed in triplicate and are reported as the mean±S.D. ( i ) The qRT-PCR testing of miRNAs in NB4-Lv-NC and NB4-Lv-shHOTAIRM1 cells after treatment with ATRA (1 μ M, 48 h). Experiments were performed in triplicate and normalized to GAPDH. ( j ) The detection of PML-RARA by western bloting after transient overexpression of miR-20a and miR-106b mimics in NB4 cells. Experiments were performed in triplicate. PML-RARA/GAPDH densitometric ratios were recorded. Differences in c - i were considered significant at * P

    Article Snippet: RNA isolation and quantitative real-time PCR Real-time PCR was performed to quantify mRNA expression using SYBR Premix Ex Taq (TliRNaseH Plus) (Takara) according to the manufacturer's instructions.

    Techniques: Expressing, Binding Assay, Western Blot, Immunoprecipitation, Quantitative RT-PCR, Agarose Gel Electrophoresis, Luciferase, Transfection, Activity Assay, Mutagenesis, Derivative Assay, Over Expression

    PTTG3P stimulates GC tumour cell proliferation. ( A ) PTTG3P expression was quantitated in 5 GC cell lines and the GES‐1 cell line using qRT–PCR. ( B ) The GC cell lines AGC and HGC‐27 were transfected with either PTTG3P or a vector control, and PTTG3P overexpression was verified by qRT–PCR. ( C ) Cell viability of AGS and HGC‐27 cells transfected with PTTG3P or a vector control was measured using a CCK8 assay. ( D ) The cell colony‐formation ability of AGS and HGC‐27 cells transfected with PTTG3P or the vector control was measured. Data are shown as the mean ± SD of three replicates; * P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: PTTG3P promotes gastric tumour cell proliferation and invasion and is an indicator of poor prognosis

    doi: 10.1111/jcmm.13239

    Figure Lengend Snippet: PTTG3P stimulates GC tumour cell proliferation. ( A ) PTTG3P expression was quantitated in 5 GC cell lines and the GES‐1 cell line using qRT–PCR. ( B ) The GC cell lines AGC and HGC‐27 were transfected with either PTTG3P or a vector control, and PTTG3P overexpression was verified by qRT–PCR. ( C ) Cell viability of AGS and HGC‐27 cells transfected with PTTG3P or a vector control was measured using a CCK8 assay. ( D ) The cell colony‐formation ability of AGS and HGC‐27 cells transfected with PTTG3P or the vector control was measured. Data are shown as the mean ± SD of three replicates; * P

    Article Snippet: Reverse transcription (RT) and quantitative real‐time PCR (qRT–PCR) kits (Takara, Dalian, China) were utilized to evaluate PTTG3P expression.

    Techniques: Expressing, Quantitative RT-PCR, Transfection, Plasmid Preparation, Over Expression, CCK-8 Assay

    PTTG3P is up‐regulated in GC tissues and is correlated with patient prognosis. ( A ) PTTG3P expression was evaluated using TCGA RNA‐seq data and compared between GC tissues and normal tissues. ( B ) The expression of PTTG3P in adjacent non‐tumour (ANT) and GC tissues was determined by qRT–PCR. β‐actin was used as an endogenous control to normalize the data. ( C ) Kaplan–Meier curves for DFS and OS of patients with GC based on PTTG3P expression.

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: PTTG3P promotes gastric tumour cell proliferation and invasion and is an indicator of poor prognosis

    doi: 10.1111/jcmm.13239

    Figure Lengend Snippet: PTTG3P is up‐regulated in GC tissues and is correlated with patient prognosis. ( A ) PTTG3P expression was evaluated using TCGA RNA‐seq data and compared between GC tissues and normal tissues. ( B ) The expression of PTTG3P in adjacent non‐tumour (ANT) and GC tissues was determined by qRT–PCR. β‐actin was used as an endogenous control to normalize the data. ( C ) Kaplan–Meier curves for DFS and OS of patients with GC based on PTTG3P expression.

    Article Snippet: Reverse transcription (RT) and quantitative real‐time PCR (qRT–PCR) kits (Takara, Dalian, China) were utilized to evaluate PTTG3P expression.

    Techniques: Expressing, RNA Sequencing Assay, Quantitative RT-PCR

    PTTG3P overexpression is not correlated with PTTG1 or PTTG2 expression. ( A ) The expression of PTTG1 and PTTG2 in adjacent non‐tumour (ANT) and GC tissues was determined by qRT–PCR. ( B ) Correlations between PTTG3P expression and PTTG1 or PTTG2 expression were evaluated. ( C ) mRNA expression levels of PTTG1 and PTTG2 in cells overexpressing PTTG3P were evaluated by qRT–PCR. ( D ) Protein expression levels of PTTG1 and PTTG2 in cells overexpressing PTTG3P were evaluated by Western blotting; GAPDH was used as a reference. Data are shown as the mean ± SD of three replicates; ** P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: PTTG3P promotes gastric tumour cell proliferation and invasion and is an indicator of poor prognosis

    doi: 10.1111/jcmm.13239

    Figure Lengend Snippet: PTTG3P overexpression is not correlated with PTTG1 or PTTG2 expression. ( A ) The expression of PTTG1 and PTTG2 in adjacent non‐tumour (ANT) and GC tissues was determined by qRT–PCR. ( B ) Correlations between PTTG3P expression and PTTG1 or PTTG2 expression were evaluated. ( C ) mRNA expression levels of PTTG1 and PTTG2 in cells overexpressing PTTG3P were evaluated by qRT–PCR. ( D ) Protein expression levels of PTTG1 and PTTG2 in cells overexpressing PTTG3P were evaluated by Western blotting; GAPDH was used as a reference. Data are shown as the mean ± SD of three replicates; ** P

    Article Snippet: Reverse transcription (RT) and quantitative real‐time PCR (qRT–PCR) kits (Takara, Dalian, China) were utilized to evaluate PTTG3P expression.

    Techniques: Over Expression, Expressing, Quantitative RT-PCR, Western Blot

    Mutations in ref(2)P result in the accumulation of mtDNA. ( a ) Regular mitochondrial distribution is disrupted in ref(2)P mutants and the number of mtDNA nucleoids (mt) is increased. PicoGreen also labels the dsDNA of muscle nuclei (nuc). ( b ) ref(2)P mutants flies showed an increase in mtDNA. The ratio of mtDNA to nDNA was measured using real-time quantitative PCR in flies with the indicated ages (mean±S.D., n =9 per genotype). Statistically significant values relative to the control ( w 1118 ) are indicated by asterisks (one-way ANOVA with Dunnett's multiple comparison test). ( c and d ) Mutations in ref(2)P do not cause alterations in mitochondrial protein density. Protein density was determined in 26-day-old flies with the indicated genotypes by determining the concentration of Cyt c using an ELISA assay ( d ) and by measuring the activity of the mitochondrial matrix enzyme citrate synthase ( c ). Data are shown as the mean ±S.E.M ( n =3 in each group). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test). ( e ) Analysis of the mtTFA levels in ref(2)P mutants. Lysates prepared from adult flies were subjected to western blot analysis with the indicated antibodies. ( f ) Normal respiration in ref(2)P mutant flies. Activity of the indicated complexes in coupled mitochondria was measured in 3-day-old flies using high-resolution respirometry. Data are shown as the mean±S.E.M. ( n ≥4 in each genotype). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test)

    Journal: Cell Death & Disease

    Article Title: Drosophila ref(2)P is required for the parkin-mediated suppression of mitochondrial dysfunction in pink1 mutants

    doi: 10.1038/cddis.2013.394

    Figure Lengend Snippet: Mutations in ref(2)P result in the accumulation of mtDNA. ( a ) Regular mitochondrial distribution is disrupted in ref(2)P mutants and the number of mtDNA nucleoids (mt) is increased. PicoGreen also labels the dsDNA of muscle nuclei (nuc). ( b ) ref(2)P mutants flies showed an increase in mtDNA. The ratio of mtDNA to nDNA was measured using real-time quantitative PCR in flies with the indicated ages (mean±S.D., n =9 per genotype). Statistically significant values relative to the control ( w 1118 ) are indicated by asterisks (one-way ANOVA with Dunnett's multiple comparison test). ( c and d ) Mutations in ref(2)P do not cause alterations in mitochondrial protein density. Protein density was determined in 26-day-old flies with the indicated genotypes by determining the concentration of Cyt c using an ELISA assay ( d ) and by measuring the activity of the mitochondrial matrix enzyme citrate synthase ( c ). Data are shown as the mean ±S.E.M ( n =3 in each group). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test). ( e ) Analysis of the mtTFA levels in ref(2)P mutants. Lysates prepared from adult flies were subjected to western blot analysis with the indicated antibodies. ( f ) Normal respiration in ref(2)P mutant flies. Activity of the indicated complexes in coupled mitochondria was measured in 3-day-old flies using high-resolution respirometry. Data are shown as the mean±S.E.M. ( n ≥4 in each genotype). Statistical significance relative to the control ( w 1118 ) is indicated (one-way ANOVA with Dunnett's multiple comparison test)

    Article Snippet: PCR amplification of mtDNA Analysis of the mtDNA content was performed using quantitative real-time PCR on an Mx4000 (Stratagene, Santa Clara, CA, USA) real-time cycler using QuantiTect SYBR Green PCR system (QIAGEN, Manchester, UK).

    Techniques: Real-time Polymerase Chain Reaction, Concentration Assay, Enzyme-linked Immunosorbent Assay, Activity Assay, Western Blot, Mutagenesis

    UBR3 affects Shh signaling in mammalian cells by poly-ubiquitinating Kif7. (A) The Gli::GFP reporter is induced by both Shh and purmorphamine (pur) in C3H10T1/2 cells. (A’) Quantification of Gli::GFP expressing cells in response to Shh and pur. (B-B’). (B) Quantification of the proportion of Gli::GFP expressing C3H10T1/2 cells. (B’) Real time PCR to estimate the expression of UBR3 under the conditions shown in B. All values have been normalized to cells treated with pur and transfected with no siRNA. (C) C3H10T1/2 cells were transfected with the Kif7::GFP expression construct. Cells were transfected with various siRNAs and treated with pur (lanes 2–4) or DMSO (lane 1) and lysed, followed by immunoprecipitation against GFP. Western blots were performed with indicated antibodies. RFP expressions provided as transfection controls. (D) Kif7::GFP was immunoprecipitated from the lysate of the cells transfected with Kif7::GFP construct and shown siRNA followed by treatment of MG132. FK1 anti-ubiquitin antibody was used to detect ubiquitinated Kif7 in a Western blot. (E) A model shows the regulation of Hh signaling by Ubr3. Ubr3 regulates the proteasomal degradation of Cos2 via K48-mediated poly-ubiquitination of Cos2. ubr3 is one of the target genes activated by Hh signaling, forming a positive feedback to promote further activation of Hh signaling. Hh signaling also promotes physical association between Ubr3 and Cos2, increasing the ubiquitination of Cos2. (F) Diagram shows parallel regulations of Cos2 protein levels downstream of Hh activation.

    Journal: PLoS Genetics

    Article Title: Ubr3, a Novel Modulator of Hh Signaling Affects the Degradation of Costal-2 and Kif7 through Poly-ubiquitination

    doi: 10.1371/journal.pgen.1006054

    Figure Lengend Snippet: UBR3 affects Shh signaling in mammalian cells by poly-ubiquitinating Kif7. (A) The Gli::GFP reporter is induced by both Shh and purmorphamine (pur) in C3H10T1/2 cells. (A’) Quantification of Gli::GFP expressing cells in response to Shh and pur. (B-B’). (B) Quantification of the proportion of Gli::GFP expressing C3H10T1/2 cells. (B’) Real time PCR to estimate the expression of UBR3 under the conditions shown in B. All values have been normalized to cells treated with pur and transfected with no siRNA. (C) C3H10T1/2 cells were transfected with the Kif7::GFP expression construct. Cells were transfected with various siRNAs and treated with pur (lanes 2–4) or DMSO (lane 1) and lysed, followed by immunoprecipitation against GFP. Western blots were performed with indicated antibodies. RFP expressions provided as transfection controls. (D) Kif7::GFP was immunoprecipitated from the lysate of the cells transfected with Kif7::GFP construct and shown siRNA followed by treatment of MG132. FK1 anti-ubiquitin antibody was used to detect ubiquitinated Kif7 in a Western blot. (E) A model shows the regulation of Hh signaling by Ubr3. Ubr3 regulates the proteasomal degradation of Cos2 via K48-mediated poly-ubiquitination of Cos2. ubr3 is one of the target genes activated by Hh signaling, forming a positive feedback to promote further activation of Hh signaling. Hh signaling also promotes physical association between Ubr3 and Cos2, increasing the ubiquitination of Cos2. (F) Diagram shows parallel regulations of Cos2 protein levels downstream of Hh activation.

    Article Snippet: Quantitative real-time PCR For RNA extraction, total RNA from C3H10T1/2 cells was isolated by using Absolutely RNA miniprep Kit (Agilent Technologies). cDNA was synthesized using Superscript III First Strand Synthesis System for RT-PCR (Invitrogen).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Transfection, Construct, Immunoprecipitation, Western Blot, Activation Assay

    Analysis of mRNA and protein levels for pRb and E2F1 during EBV primary infection at 2, 5, and 7 dpi A. Human PBMCs were infected by BACEBV-GFPWT (WT) and EBVGFPΔE3C130-159 (ΔE3C130-159) virus and cells were harvested at 2, 5, and 7 days p.i. Total RNAs were extracted by using TRIzol (Invitrogen), and cDNAs were synthesized using a high capacity RNA-to-cDNA kit. The mRNA levels of pRb and E2F1 were quantified by qRT-PCR on a StepOnePlus real-time PCR system. B. The protein levels of pRb and E2F1 in PBMC infected with BACEBV-GFPWT and EBVGFPΔE3C130-159 virus at 2, 5 and 7 days p.i. were analyzed Western blot. dpi, days post-infection; RQ, relative quantity; RI, relative intensity. *P

    Journal: Oncotarget

    Article Title: An EBV recombinant deleted for residues 130-159 in EBNA3C can deregulate p53/Mdm2 and Cyclin D1/CDK6 which results in apoptosis and reduced cell proliferation

    doi: 10.18632/oncotarget.7502

    Figure Lengend Snippet: Analysis of mRNA and protein levels for pRb and E2F1 during EBV primary infection at 2, 5, and 7 dpi A. Human PBMCs were infected by BACEBV-GFPWT (WT) and EBVGFPΔE3C130-159 (ΔE3C130-159) virus and cells were harvested at 2, 5, and 7 days p.i. Total RNAs were extracted by using TRIzol (Invitrogen), and cDNAs were synthesized using a high capacity RNA-to-cDNA kit. The mRNA levels of pRb and E2F1 were quantified by qRT-PCR on a StepOnePlus real-time PCR system. B. The protein levels of pRb and E2F1 in PBMC infected with BACEBV-GFPWT and EBVGFPΔE3C130-159 virus at 2, 5 and 7 days p.i. were analyzed Western blot. dpi, days post-infection; RQ, relative quantity; RI, relative intensity. *P

    Article Snippet: RT-qPCR was performed on a StepOnePlus real-time PCR System (Applied Biosystems Inc, Carlsbad, CA).

    Techniques: Infection, Synthesized, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Western Blot

    Analysis of mRNA and protein levels for p53, Mdm2, CyclinD1 and Cdk6 during EBV primary infection at 2, 5, and 7 dpi A. Human PBMCs were infected by BACEBV-GFPWT (WT) and EBVGFPΔE3C130-159 (ΔE3C130-159) virus and cells were harvested at 2, 5, and 7 days p.i. Total RNAs were extracted by using TRIzol (Invitrogen), and cDNAs were synthesized using a high capacity RNA-to-cDNA kit. The mRNA levels of p53, Mdm2, CyclinD1 and Cdk6 were quantified by qRT-PCR on a StepOnePlus real-time PCR system. B. The protein levels of p53, Mdm2, CyclinD1 and Cdk6 in PBMC infected with BACEBV-GFPWT and EBVGFPΔE3C130-159 virus at 2, 5 and 7 days p.i. were analyzed Western blot. dpi, days post-infection; RQ, relative quantity; RI, relative intensity. *P

    Journal: Oncotarget

    Article Title: An EBV recombinant deleted for residues 130-159 in EBNA3C can deregulate p53/Mdm2 and Cyclin D1/CDK6 which results in apoptosis and reduced cell proliferation

    doi: 10.18632/oncotarget.7502

    Figure Lengend Snippet: Analysis of mRNA and protein levels for p53, Mdm2, CyclinD1 and Cdk6 during EBV primary infection at 2, 5, and 7 dpi A. Human PBMCs were infected by BACEBV-GFPWT (WT) and EBVGFPΔE3C130-159 (ΔE3C130-159) virus and cells were harvested at 2, 5, and 7 days p.i. Total RNAs were extracted by using TRIzol (Invitrogen), and cDNAs were synthesized using a high capacity RNA-to-cDNA kit. The mRNA levels of p53, Mdm2, CyclinD1 and Cdk6 were quantified by qRT-PCR on a StepOnePlus real-time PCR system. B. The protein levels of p53, Mdm2, CyclinD1 and Cdk6 in PBMC infected with BACEBV-GFPWT and EBVGFPΔE3C130-159 virus at 2, 5 and 7 days p.i. were analyzed Western blot. dpi, days post-infection; RQ, relative quantity; RI, relative intensity. *P

    Article Snippet: RT-qPCR was performed on a StepOnePlus real-time PCR System (Applied Biosystems Inc, Carlsbad, CA).

    Techniques: Infection, Synthesized, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Western Blot

    Effect of fucoxanthin rich powder on mRNA expression of transcription factor and enzymes related to antioxidant system in the liver of rats. Total RNA was isolated using TRI-reagenet, and cDNA was synthesized using 3 ug of total RNA with SuperScript II reverse transcriptase. Realtime PCR was performed using SYBR green and standard procedures to assess the mRNA expression of the primer in liver samples obtained from each group. An Applied Biosystem StepOne softwere v2.1 was used. Each bar represents the mean ± S.E of three independent experiments. Different letters above each bar indicate significant differences among the groups at α = 0.05 as determined by Duncan's multiple range tests. HO-1: heme oxygenase (decycling) 1, Nrf2: nuclear factor, erythroid derived 2, like 2, NQO-1: NAD(P)H quinone oxidoreductase 1.

    Journal: Nutrition Research and Practice

    Article Title: Antioxidant effects of fucoxanthin rich powder in rats fed with high fat diet

    doi: 10.4162/nrp.2013.7.6.475

    Figure Lengend Snippet: Effect of fucoxanthin rich powder on mRNA expression of transcription factor and enzymes related to antioxidant system in the liver of rats. Total RNA was isolated using TRI-reagenet, and cDNA was synthesized using 3 ug of total RNA with SuperScript II reverse transcriptase. Realtime PCR was performed using SYBR green and standard procedures to assess the mRNA expression of the primer in liver samples obtained from each group. An Applied Biosystem StepOne softwere v2.1 was used. Each bar represents the mean ± S.E of three independent experiments. Different letters above each bar indicate significant differences among the groups at α = 0.05 as determined by Duncan's multiple range tests. HO-1: heme oxygenase (decycling) 1, Nrf2: nuclear factor, erythroid derived 2, like 2, NQO-1: NAD(P)H quinone oxidoreductase 1.

    Article Snippet: Ct-values of target genes and the reference gene were obtained using an Applied Biosystems StepOne Plus RT-PCR system (Applied biosystems, CA, USA).

    Techniques: Expressing, Isolation, Synthesized, Polymerase Chain Reaction, SYBR Green Assay, Derivative Assay

    Pterodontic acid inhibited pro-inflammatory expr ession in influenza virus A/PR/8/34 (H1N1)-infected A549 cells. ( A ) A549 cells were infected with influenza virus (MOI = 0.2) in the presence or absence of different concentration of pterodontic acid for 24 h. Then, Total RNA was extracted and measured by qRT-PCR for the expression levels of IL-6, IP-10, MIP-1β, and MCP-1. The expression of each target gene was normalized to GAPDH; ( B ) The protein levels of cytokines and chemokines in the culture supernatant were assayed by luminex 24 h post A/PR/8/34 infection alone or in combination with pterodontic acid at 25 and 100 µg/mL. Each experiment was repeated in triplicate. * p

    Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

    Article Title: Pterodontic Acid Isolated from Laggera pterodonta Inhibits Viral Replication and Inflammation Induced by Influenza A Virus

    doi: 10.3390/molecules22101738

    Figure Lengend Snippet: Pterodontic acid inhibited pro-inflammatory expr ession in influenza virus A/PR/8/34 (H1N1)-infected A549 cells. ( A ) A549 cells were infected with influenza virus (MOI = 0.2) in the presence or absence of different concentration of pterodontic acid for 24 h. Then, Total RNA was extracted and measured by qRT-PCR for the expression levels of IL-6, IP-10, MIP-1β, and MCP-1. The expression of each target gene was normalized to GAPDH; ( B ) The protein levels of cytokines and chemokines in the culture supernatant were assayed by luminex 24 h post A/PR/8/34 infection alone or in combination with pterodontic acid at 25 and 100 µg/mL. Each experiment was repeated in triplicate. * p

    Article Snippet: The anti-virus and anti-inflammation effects were determined using dual-luciferase reporter assay, immunofluorescence, quantitative real-time PCR and luminex assay.

    Techniques: Infection, Concentration Assay, Quantitative RT-PCR, Expressing, Luminex

    Pterodontic acid inhibited pro-inflammatory expression in influenza virus A/Chicken/Guangdong/1996/ (H9N2)—infected A549 cells. ( A ) A549 cells were infected with influenza virus (MOI = 0.2) in the presence or absence of different concentration of pterodontic acid for 24 h. Then, Total RNA was extracted and measured by qRT-PCR for the expression levels of CCL-5, IP-10, TNF-α, and MIP-1β. The expression of each target gene was normalized to GAPDH; ( B ) The protein levels of cytokines and chemokines in the culture supernatant were assayed by luminex 24 h post A/Chicken/Guangdong/1996/ (H9N2) infection alone or in combination with pterodontic acid at 25 100 µg/mL. Each experiment was repeated in triplicate. * p

    Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

    Article Title: Pterodontic Acid Isolated from Laggera pterodonta Inhibits Viral Replication and Inflammation Induced by Influenza A Virus

    doi: 10.3390/molecules22101738

    Figure Lengend Snippet: Pterodontic acid inhibited pro-inflammatory expression in influenza virus A/Chicken/Guangdong/1996/ (H9N2)—infected A549 cells. ( A ) A549 cells were infected with influenza virus (MOI = 0.2) in the presence or absence of different concentration of pterodontic acid for 24 h. Then, Total RNA was extracted and measured by qRT-PCR for the expression levels of CCL-5, IP-10, TNF-α, and MIP-1β. The expression of each target gene was normalized to GAPDH; ( B ) The protein levels of cytokines and chemokines in the culture supernatant were assayed by luminex 24 h post A/Chicken/Guangdong/1996/ (H9N2) infection alone or in combination with pterodontic acid at 25 100 µg/mL. Each experiment was repeated in triplicate. * p

    Article Snippet: The anti-virus and anti-inflammation effects were determined using dual-luciferase reporter assay, immunofluorescence, quantitative real-time PCR and luminex assay.

    Techniques: Expressing, Infection, Concentration Assay, Quantitative RT-PCR, Luminex

    Platform comparison. Allelic discrimination plots of the four GBA mutations. Water was used as the no template control. Fig. 1A: Validation on the ABI PRISM® 7900 HT Sequence Detection System. Fig. 1B: Validation on the Applied Biosystems ViiA™ 7 Real-Time PCR System. Fig. 1C: Blind validation on the ABI PRISM® 7900 HT Sequence Detection System.

    Journal: PLoS ONE

    Article Title: High-Throughput Carrier Screening Using TaqMan Allelic Discrimination

    doi: 10.1371/journal.pone.0059722

    Figure Lengend Snippet: Platform comparison. Allelic discrimination plots of the four GBA mutations. Water was used as the no template control. Fig. 1A: Validation on the ABI PRISM® 7900 HT Sequence Detection System. Fig. 1B: Validation on the Applied Biosystems ViiA™ 7 Real-Time PCR System. Fig. 1C: Blind validation on the ABI PRISM® 7900 HT Sequence Detection System.

    Article Snippet: The plates were centrifuged for 1 minute, sealed, and then run in duplex real time PCR reactions using FAM and VIC as the detector probes for each assay on both the ABI PRISM® 7900 HT Sequence Detection System (LTI) and the Applied Biosystems ViiA™ 7 Real-Time PCR System (LTI).

    Techniques: Sequencing, Real-time Polymerase Chain Reaction

    Profiling of methylglyoxal (MGO)-regulated microRNAs (miRs) in A10 cells. A10 cells were treated with 300 μM MGO for 6 h. Real-time quantitative PCR (qPCR) analysis was then performed to show changes in expression levels of candidate miRs targeting Kir6.1 ( A ) and SUR2B mRNA ( B ). RNU6 (U6) was used for normalization. ** P

    Journal: American Journal of Physiology - Cell Physiology

    Article Title: The SUR2B subunit of rat vascular KATP channel is targeted by miR-9a-3p induced by prolonged exposure to methylglyoxal

    doi: 10.1152/ajpcell.00311.2014

    Figure Lengend Snippet: Profiling of methylglyoxal (MGO)-regulated microRNAs (miRs) in A10 cells. A10 cells were treated with 300 μM MGO for 6 h. Real-time quantitative PCR (qPCR) analysis was then performed to show changes in expression levels of candidate miRs targeting Kir6.1 ( A ) and SUR2B mRNA ( B ). RNU6 (U6) was used for normalization. ** P

    Article Snippet: The qPCR was performed with a Fast Real-time PCR system (Applied Biosystems 7500) for 40 cycles.

    Techniques: Real-time Polymerase Chain Reaction, Expressing

    The tissue RARRES2 gene expression level is down-regulated in ACC but is not associated with patient prognosis. A, TaqMan real-time quantitative PCR reveals down-regulation of the RARRES2 gene expression level in our cohort of ACC samples as compared

    Journal: The Journal of Clinical Endocrinology and Metabolism

    Article Title: Serum RARRES2 Is a Prognostic Marker in Patients With Adrenocortical Carcinoma

    doi: 10.1210/jc.2016-1781

    Figure Lengend Snippet: The tissue RARRES2 gene expression level is down-regulated in ACC but is not associated with patient prognosis. A, TaqMan real-time quantitative PCR reveals down-regulation of the RARRES2 gene expression level in our cohort of ACC samples as compared

    Article Snippet: TaqMan real-time quantitative polymerase chain reaction was performed on 7900HT fast real-time PCR systems (Applied Biosystems).

    Techniques: Expressing, Real-time Polymerase Chain Reaction

    IPA Network Analysis Genes in Cluster 4. (a) IPA Network analysis was generated by seeding the genes within cluster 4 (blue highlighted genes) and “growing” those genes into a network by displaying direct (solid lines) and indirect (dashed lines) connections. All orphan genes were removed. Genes added to the network are illustrated with purple lines. (b) qRT-PCR was performed for node genes IRS1, OPA3, and POU6F1 to identify the associated gene expression profiles. The average ΔCt was calculated for each experimental group, where ΔCt = Ct (gene of interest)–Ct (Housekeeper gene–GAPDH). Data are shown ± S.D.

    Journal: PLoS ONE

    Article Title: Transcriptomic analysis of neuregulin-1 regulated genes following ischemic stroke by computational identification of promoter binding sites: A role for the ETS-1 transcription factor

    doi: 10.1371/journal.pone.0197092

    Figure Lengend Snippet: IPA Network Analysis Genes in Cluster 4. (a) IPA Network analysis was generated by seeding the genes within cluster 4 (blue highlighted genes) and “growing” those genes into a network by displaying direct (solid lines) and indirect (dashed lines) connections. All orphan genes were removed. Genes added to the network are illustrated with purple lines. (b) qRT-PCR was performed for node genes IRS1, OPA3, and POU6F1 to identify the associated gene expression profiles. The average ΔCt was calculated for each experimental group, where ΔCt = Ct (gene of interest)–Ct (Housekeeper gene–GAPDH). Data are shown ± S.D.

    Article Snippet: Quantitative real-time PCR (qRT-PCR) was performed using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad Laboratories, Inc., Hercules, California) along with custom oligo primers for IRS1 (forward: CTGCATCGGACTCTACCAGG ; reverse: CGAGGACTAAGTCTCCCCCA ), OPA3 (forward: AGAGTGCAATTGATGCCCCA ; reverse: TGAGGGGATCTGTACAGGCA ) POU6F1 (forward: TGACTATGCTCTTCCTCCCCT ; reverse: CACAGGAGGGGAAATACAGTTGA ); SK1/Kcnn1 (forward: TCATCTCCATTACCTTCCTG ; reverse: AGCCTGGTGTGTTTGTAGAT ), SK2/Kcnn2 (forward: ACCTGCACGAGATGGACTCA ; reverse: TTGTGCTCCGGCTTAGACAC ); ERG1 (forward: CAACATCGCCACAGGAGA ; reverse: ACACGGTACTCAGGGTCCAT ) ERG2/Kcnh6/Kv11.2 (forward: AGATTGGAGTCCCGTGTGTC ; reverse: TCCCACCAGAAGCGTAGACT ) (Life Technologies, Rockville, MD), according to manufacturing guidelines.

    Techniques: Indirect Immunoperoxidase Assay, Generated, Quantitative RT-PCR, Expressing

    The biological function of MCM2 in LUSC cells. Notes: ( A ) The efficiency of siRNA-MCM2 is confirmed by qRT-PCR in LUSC cells. ( B ) The efficiency of siRNA-MCM2 is confirmed by Western blot in LUSC cells. ( C ) Downregulation of MCM2 decreases SK-MES-1 and H2170 viability in comparison to control cells after transfection for 48, 72 and 96 h. ( D ) Downregulation of MCM2 reduces the number of colonies in SK-MES-1 and H2170 cells. ( E ) Downregulation of MCM2 decreases the percentage of S-phase cells and increases the percentage of G0/G1-phase cells. Each experiment was performed in triplicate (* P

    Journal: OncoTargets and therapy

    Article Title: Minichromosome maintenance protein 2 correlates with the malignant status and regulates proliferation and cell cycle in lung squamous cell carcinoma

    doi: 10.2147/OTT.S169002

    Figure Lengend Snippet: The biological function of MCM2 in LUSC cells. Notes: ( A ) The efficiency of siRNA-MCM2 is confirmed by qRT-PCR in LUSC cells. ( B ) The efficiency of siRNA-MCM2 is confirmed by Western blot in LUSC cells. ( C ) Downregulation of MCM2 decreases SK-MES-1 and H2170 viability in comparison to control cells after transfection for 48, 72 and 96 h. ( D ) Downregulation of MCM2 reduces the number of colonies in SK-MES-1 and H2170 cells. ( E ) Downregulation of MCM2 decreases the percentage of S-phase cells and increases the percentage of G0/G1-phase cells. Each experiment was performed in triplicate (* P

    Article Snippet: RNA extraction and quantitative real-time PCR (qRT-PCR) The total RNA from cell or tissue was extracted with RNAiso Plus (TaKaRa, Otsu, Japan).

    Techniques: Quantitative RT-PCR, Western Blot, Transfection

    Tamoxifen treatment restores B cell development from E2A ER/ER pre-proB cells . Sorted E2A ER/+ and E2A ER/ER pre-proB cells were plated in hormone-free media on S17 stromal cells on Day 0 in the presence of IL-7 with tamoxifen or DMSO (untreated control). (A) Cells are pre-gated on 7AAD - B220 + lymphocytes. Percents of CD19 + cells on Day 1, 3, and 5 are displayed. Data are representative of 4 independent experiments. (B) Expression of Pax5 was analyzed by quantitative RT-PCR from RNA collected from Day 1, 3, and 5 cultures shown in (A). Samples were normalized to the expression of GAPDH. Graphed results are means from triplicate runs (n = 3) with error bars representing standard error of the mean (SEM).

    Journal: BMC Developmental Biology

    Article Title: A tamoxifen inducible knock-in allele for investigation of E2A function

    doi: 10.1186/1471-213X-9-51

    Figure Lengend Snippet: Tamoxifen treatment restores B cell development from E2A ER/ER pre-proB cells . Sorted E2A ER/+ and E2A ER/ER pre-proB cells were plated in hormone-free media on S17 stromal cells on Day 0 in the presence of IL-7 with tamoxifen or DMSO (untreated control). (A) Cells are pre-gated on 7AAD - B220 + lymphocytes. Percents of CD19 + cells on Day 1, 3, and 5 are displayed. Data are representative of 4 independent experiments. (B) Expression of Pax5 was analyzed by quantitative RT-PCR from RNA collected from Day 1, 3, and 5 cultures shown in (A). Samples were normalized to the expression of GAPDH. Graphed results are means from triplicate runs (n = 3) with error bars representing standard error of the mean (SEM).

    Article Snippet: Quantitative real-time PCR analysis for Pax5 expression was performed using a Roche LightCycler and Fast-Start DNA master SYBR green kit I (Roche) as per manufacturer's instructions.

    Techniques: Expressing, Quantitative RT-PCR

    Coefficient analysis of gene expression levels determined from RNA-seq and qRT-PCR data . The qRT-PCR log 2 values (x-axis) were plotted against onion bulb developmental stages (y-axis). ** Indicates a significant difference at p ≤ 0.01.

    Journal: Frontiers in Plant Science

    Article Title: Transcriptome Analysis of Sucrose Metabolism during Bulb Swelling and Development in Onion (Allium cepa L.)

    doi: 10.3389/fpls.2016.01425

    Figure Lengend Snippet: Coefficient analysis of gene expression levels determined from RNA-seq and qRT-PCR data . The qRT-PCR log 2 values (x-axis) were plotted against onion bulb developmental stages (y-axis). ** Indicates a significant difference at p ≤ 0.01.

    Article Snippet: Quantitative real-time PCR analysis To confirm RNA-seq results (DEGs selected) and to determine the roles of key enzymes involved in sucrose, glucose and fructose metabolism, quantitative real-time PCR (qRT-PCR) was performed using SYBR® green (TaKaRa, Dalian, China).

    Techniques: Expressing, RNA Sequencing Assay, Quantitative RT-PCR

    Transcript levels related to osteogenic differentiation markers (a) ALP, (b) BSP, (c) Collα1 and (d) OP and to metabolism (e) HIF-1α, quantified by real-time RT- PCR and normalized to GAPDH. Data are mean ± standard deviation from

    Journal: Biomaterials

    Article Title: Relationships Between Degradability of Silk Scaffolds and Osteogenesis

    doi: 10.1016/j.biomaterials.2010.04.028

    Figure Lengend Snippet: Transcript levels related to osteogenic differentiation markers (a) ALP, (b) BSP, (c) Collα1 and (d) OP and to metabolism (e) HIF-1α, quantified by real-time RT- PCR and normalized to GAPDH. Data are mean ± standard deviation from

    Article Snippet: Collagen type Iα1 (ColIα1), ALP, bone sialoprotein (BSP) and osteopontin (OP) levels were quantified using the M×3000 Quantitative Real Time PCR system (Stratagene, La Jolla, CA) for osteogenesis.

    Techniques: ALP Assay, Quantitative RT-PCR, Standard Deviation