qrt pcr kit Thermo Fisher Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher qrt pcr fast sybr green master mix
    Transcript distribution profile of Trica- SKR1 and Trica -SKR2. Quantification of transcript levels by <t>qRT-PCR</t> in seven different tissues from adult T. castaneum . The data represent samples of central brain (n = 15), optic lobes (n = 15), salivary glands (n = 15), gut (n = 15), fat body (n = 20), testes (n = 50) and ovaries (n = 50), normalized relative to β-actin and ribosomal protein 3 (RPs3) transcript levels. Abbreviations: B = central brain, OL = optic lobes, SG = salivary glands, G = gut, FB = fat body, Te = testes, Ov = ovaria.
    Qrt Pcr Fast Sybr Green Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr fast sybr green master mix/product/Thermo Fisher
    Average 90 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    qrt pcr fast sybr green master mix - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    89
    Thermo Fisher transcript polymerase chain reaction qrt pcr kit
    Transcript distribution profile of Trica- SKR1 and Trica -SKR2. Quantification of transcript levels by <t>qRT-PCR</t> in seven different tissues from adult T. castaneum . The data represent samples of central brain (n = 15), optic lobes (n = 15), salivary glands (n = 15), gut (n = 15), fat body (n = 20), testes (n = 50) and ovaries (n = 50), normalized relative to β-actin and ribosomal protein 3 (RPs3) transcript levels. Abbreviations: B = central brain, OL = optic lobes, SG = salivary glands, G = gut, FB = fat body, Te = testes, Ov = ovaria.
    Transcript Polymerase Chain Reaction Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transcript polymerase chain reaction qrt pcr kit/product/Thermo Fisher
    Average 89 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    transcript polymerase chain reaction qrt pcr kit - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    78
    Thermo Fisher quantitative real time polymerase chain reaction qrt pcr assay kits
    Transcript distribution profile of Trica- SKR1 and Trica -SKR2. Quantification of transcript levels by <t>qRT-PCR</t> in seven different tissues from adult T. castaneum . The data represent samples of central brain (n = 15), optic lobes (n = 15), salivary glands (n = 15), gut (n = 15), fat body (n = 20), testes (n = 50) and ovaries (n = 50), normalized relative to β-actin and ribosomal protein 3 (RPs3) transcript levels. Abbreviations: B = central brain, OL = optic lobes, SG = salivary glands, G = gut, FB = fat body, Te = testes, Ov = ovaria.
    Quantitative Real Time Polymerase Chain Reaction Qrt Pcr Assay Kits, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time polymerase chain reaction qrt pcr assay kits/product/Thermo Fisher
    Average 78 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    quantitative real time polymerase chain reaction qrt pcr assay kits - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    87
    Thermo Fisher powersybr quantitative real time polymerase chain reaction qrt pcr kits
    HFD feeding increased the translocation to the nucleus of p65 and expression of NFκB‐related genes in Irf3 −/− mice. Male C57BL/6, Irf3 −/− , and Irf3 S1/S1 mice were fed an HFD or chow for 12 weeks. (A) Expressions of phospho‐IKKα∕β, IKKβ, phospho‐p65, p65, and IκBα were assessed by western blot and normalized to GAPDH, n = 4 per genotype. (B) Formalin‐fixed paraffin‐embedded sections of liver were deparaffinized, and localization of phospho‐p65 was assessed by immunohistochemistry. Images were acquired at 40×. White arrows indicate nonparenchymal cells, and black arrows indicate hepatocytes. Images are representative of triplicate images from eight mice per treatment group. Values represent means ± SEM. (C) Nuclear fractions were isolated from livers, and equal amounts of protein were assessed by western blot and probed against phosphor‐Ser 536 p65‐NFκB. Lamin A/C was used as a nuclei marker, and GAPDH was used as a cytosolic marker. (D) Expressions of CCL5, CXCL10, CXCL2, and CCL3 were analyzed by <t>qRT‐PCR.</t> Values were normalized to 18S and are shown as fold increase over the chow‐fed C57BL/6 control group, n = 12 per genotype. Values with different superscripts are significantly different from each other, P
    Powersybr Quantitative Real Time Polymerase Chain Reaction Qrt Pcr Kits, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/powersybr quantitative real time polymerase chain reaction qrt pcr kits/product/Thermo Fisher
    Average 87 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    powersybr quantitative real time polymerase chain reaction qrt pcr kits - by Bioz Stars, 2020-02
    87/100 stars
      Buy from Supplier

    77
    Thermo Fisher quantitative real time polymerase chain reaction qrt pcr rneasy mini kit
    GATA3 inhibits epithelial–mesenchymal transition (EMT) in gastric cancer cells. Notes: ( A ) CTC-141 cells were transfected with vector, GATA3 and GATA3 (R298Q), and the relative expressions of EMT-associated genes were detected by <t>qRT-PCR.</t> * P
    Quantitative Real Time Polymerase Chain Reaction Qrt Pcr Rneasy Mini Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time polymerase chain reaction qrt pcr rneasy mini kit/product/Thermo Fisher
    Average 77 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    quantitative real time polymerase chain reaction qrt pcr rneasy mini kit - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    82
    Thermo Fisher quantitative real time reverse transcriptional polymerase chain reaction qrt pcr kits
    GATA3 inhibits epithelial–mesenchymal transition (EMT) in gastric cancer cells. Notes: ( A ) CTC-141 cells were transfected with vector, GATA3 and GATA3 (R298Q), and the relative expressions of EMT-associated genes were detected by <t>qRT-PCR.</t> * P
    Quantitative Real Time Reverse Transcriptional Polymerase Chain Reaction Qrt Pcr Kits, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 82/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time reverse transcriptional polymerase chain reaction qrt pcr kits/product/Thermo Fisher
    Average 82 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    quantitative real time reverse transcriptional polymerase chain reaction qrt pcr kits - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    77
    Thermo Fisher superscript iii quantitative reverse transcription polymerase chain reaction qrt pcr kit
    GATA3 inhibits epithelial–mesenchymal transition (EMT) in gastric cancer cells. Notes: ( A ) CTC-141 cells were transfected with vector, GATA3 and GATA3 (R298Q), and the relative expressions of EMT-associated genes were detected by <t>qRT-PCR.</t> * P
    Superscript Iii Quantitative Reverse Transcription Polymerase Chain Reaction Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii quantitative reverse transcription polymerase chain reaction qrt pcr kit/product/Thermo Fisher
    Average 77 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    superscript iii quantitative reverse transcription polymerase chain reaction qrt pcr kit - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    89
    Thermo Fisher quantitative real time reverse transcription polymerase chain reaction qrt pcr express one step superscript qrt pcr kit
    GATA3 inhibits epithelial–mesenchymal transition (EMT) in gastric cancer cells. Notes: ( A ) CTC-141 cells were transfected with vector, GATA3 and GATA3 (R298Q), and the relative expressions of EMT-associated genes were detected by <t>qRT-PCR.</t> * P
    Quantitative Real Time Reverse Transcription Polymerase Chain Reaction Qrt Pcr Express One Step Superscript Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time reverse transcription polymerase chain reaction qrt pcr express one step superscript qrt pcr kit/product/Thermo Fisher
    Average 89 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    quantitative real time reverse transcription polymerase chain reaction qrt pcr express one step superscript qrt pcr kit - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    90
    Thermo Fisher mirvana qrt pcr mirna detection kit
    miR-155 promotes production of TNF-α and IL-1β in human PBMCs. ( A ) Fold changes of miR-155 expression were determined by <t>qRT-PCR</t> after the transfection of miR-control, or miR-155 mimics at 25 or 50 nM for 24 h; ( B ) and ( C ) Expression of TNF-α and IL-1β in supernatant of PBMCs 24 h post LPS treatment, or 24 h post transfection with 25 nM miR-155 mimics, 50 nM miR-155 mimics or 50 nM <t>miRNA</t> control. Results were expressed as pg/mL by an ELISA test; and ( D ) mRNA expression of TNF-α (group 1) and IL-1β (group 2) in PBMCs 24 h after LPS treatment or 24 h post transfection with 25 nM miR-155 mimics, 50 nM miR-155 mimics or 50 nM miRNA control. All results are the average of three independent experiments. Statistical significance is shown.
    Mirvana Qrt Pcr Mirna Detection Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 775 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mirvana qrt pcr mirna detection kit/product/Thermo Fisher
    Average 90 stars, based on 775 article reviews
    Price from $9.99 to $1999.99
    mirvana qrt pcr mirna detection kit - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher sybr greener mirna qrt pcr kit
    <t>miRNA</t> alternation induced by TGF-β1 treatment (n=3). A. The miRNA microarray clustering results of BGC823/0 h, BGC823/24 hrs and BGC823/36 hrs cell lines; B. <t>qRT-PCR</t> analysis of the relative expression levels of miR-193b, miR-130b and miR-27a
    Sybr Greener Mirna Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr greener mirna qrt pcr kit/product/Thermo Fisher
    Average 90 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    sybr greener mirna qrt pcr kit - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher agpath id one step rt pcr enzyme mix
    Effect of enzyme system on detection of pathogen targets in primary clinical specimens. Data shown are difference in Ct value between reactions using Quanta One-step <t>RT-PCR</t> ToughMix and <t>AgPath-ID</t> One-step RT-PCR kit when testing TNA extracted from NP/OP swabs (A) or blood (B). Each data point represents the difference in Ct value between the two reactions for an individual clinical specimen. Median difference is indicated ( ― ) for assays with ≥2 positive results. *Targets that were only detected using AgPath always occurred when Ct values were > 33.
    Agpath Id One Step Rt Pcr Enzyme Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agpath id one step rt pcr enzyme mix/product/Thermo Fisher
    Average 90 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    agpath id one step rt pcr enzyme mix - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript iii platinum sybr green one step qrt pcr kit
    Lack of correlation between telomere length and TERRA levels in cells with stable telomeres. Two independent, exponentially-dividing strains of each genotype were split and used to isolate RNA or DNA. ( A ) A map of single copy loci amplified during TERRA measurements (B-E) and Southern blot probes (F). Distance from the centromeric end of the TG repeats is indicated. Primers used in the <t>qRT-PCR</t> and to make the probes are described in S2 Table. ( B–E ) TERRA measured as in Figure 1B . ( F ) Telomeric Southern blots performed after XhoI (top two gels) or HindIII (bottom two gels) digestion. One membrane was first probed for telomere 15L and then Y’+TG sequences ( Supplementary Figure S3A ). The other membrane was first probed for telomere 10R and finally 13R. Loading control corresponds to <t>SYBR</t> Safe staining of the gel probed for telomeres 10R and 13R.
    Superscript Iii Platinum Sybr Green One Step Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1485 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii platinum sybr green one step qrt pcr kit/product/Thermo Fisher
    Average 90 stars, based on 1485 article reviews
    Price from $9.99 to $1999.99
    superscript iii platinum sybr green one step qrt pcr kit - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher maxima sybr green qpcr master mix
    An example of the <t>SYBR</t> Green <t>RD-qPCR</t> assay of 5-LOX DNA methylation (shown are graphs obtained from 10 cerebellar samples). The samples were digested with the methylation-sensitive endonucleases (AciI, BstUI, HinP1I, and HpaII) as described in Material and Methods. The PCR reaction for the promoter-5′UTR (10 samples each: AciI = blue, BstUI = red, HinP1I = green, and HpaII = gray) and corresponding input control regions (shown in yellow) were carried out in separate tubes. Panel A shows the dissociation curve data, which indicate the presence of only one PCR product (peak) for each specific set of primers (fluorescence (first derivative of the raw fluorescence reading multiplied by −1) on the Y-axis versus the PCR product melting temperature (°C) on the X-axis). Panel B shows examples of the amplification plots used for calculating the quantitative data (the amplification plots fluorescence (baseline-corrected raw fluorescence) on the Y-axis versus cycle number on the X-axis). In this assay, the threshold cycle is inversely proportional to the log of the initial copy number. In other words, the more template that is present initially, the fewer the number of cycles required for the fluorescence signal to be detectable above background.
    Maxima Sybr Green Qpcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 4584 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/maxima sybr green qpcr master mix/product/Thermo Fisher
    Average 90 stars, based on 4584 article reviews
    Price from $9.99 to $1999.99
    maxima sybr green qpcr master mix - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher absolute qpcr sybr green mix
    Expression pattern of the subunits of AMPK (PRKA) in steroidogenic tissues. RNA was extracted from human adrenal NCI-H295 cells, adult human adrenal tissue and human as well as porcine primary ovarian cell culture. A, semiquantitative RT-PCR (30 cycles) was performed on 100 ng of reverse-transcribed total RNA using specific primers and PCR products were separated on a 1.5% agarose gel and visualized with ethidium bromide. Shown is a representative gel of three independent experiments. B, QRT-PCR was performed on 50 ng cDNA obtained from NCI-H295R cells using ABsolute <t>QPCR</t> <t>SYBR</t> Green Mix. Data represent calculations of two independent experiments where 18S rRNA served as internal control.
    Absolute Qpcr Sybr Green Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 2034 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/absolute qpcr sybr green mix/product/Thermo Fisher
    Average 90 stars, based on 2034 article reviews
    Price from $9.99 to $1999.99
    absolute qpcr sybr green mix - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher qrt pcr kit
    miR-135a suppresses Thbs1/THBS1 transcription through its 3′UTR region. a miR-135a attenuates the expression of Thbs1. Induced miR135a in primary astrocytes with DOX-inducible miR-135a expression system; <t>qRT-PCR</t> and western blot analysis confirmed that miR-135a, Thbs1 mRNAs, and proteins levels, respectively. b Two positions of the Thbs1 3′-untranslated region are predicted to be targets of miR-135a. The seed regions were indicated by the open box (upper panel). Luciferase activity of reporter constructs was measured after co-transfected with pre-miR-135a. c Antisense of miR135a (A-135a) antagonize the effects of Cebpd. Induced A-135a in primary astrocytes with IPTG-inducible A-135a expression system and treated with or without IL-1β treatment. d Induced miR-135a expression repress the THBS1 expression. In stable U373MG cells with DOX-inducible miR-135a expression system, the expression of miR-135a and the level of THBS1 mRNAs and proteins were examined by qRT-PCR, RT-PCR, and Western blot, respectively. e IL-1β and CEBPD suppresses THBS1 transcription via miR-135a binding motif. The seed region was indicated by the open box (upper panel). Luciferase activity of reporter constructs was measured after co-transfected with pre-miR-135a, CEBPD expression vectors, or treated IL-1β. f Antagomir of miR135a (AM135a) dose-dependently antagonized the effects of CEBPD. AM135a or scramble antagomir were transfected into the U373MG stable cells with zinc-inducible CEBPD expression system and then incubated in the presence or absence of 100 μM ZnSO4 for 6 h. RT-PCR and Western blot analysis were performed to examine the expressions of THBS1 mRNA and protein. The data represent the mean ± standard error of three independent experiments, each performed in triplicate. (* P
    Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 756 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr kit/product/Thermo Fisher
    Average 99 stars, based on 756 article reviews
    Price from $9.99 to $1999.99
    qrt pcr kit - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher step qrt pcr kit
    Effects of resveratrol (80 μM) or ONX-0914 (0.25 μM) on proteasome subunits gene expression using CD14 + human blood monocytes. CD14 + monocytes (2×10 6 cells/well) were treated for Vehicle, LPS, Res, Res+LPS, ONX and ONX+LPS conditions, as described in the methods section. Gene expression of proteasome subunits PSMB5 (X), PSMB6 (Y), PSMB7 (Z), PSMB8 (LMP7), PSMB9 (LMP2) and PSMB10 (LMP10) were analyzed by <t>qRT-PCR.</t> Data are shown as means ±SE (n=3). *Statistically significant difference of LPS treatment vs veh, Res, Res+LPS, ONX and ONX+LPS (p≤ 0.05).
    Step Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 110 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/step qrt pcr kit/product/Thermo Fisher
    Average 99 stars, based on 110 article reviews
    Price from $9.99 to $1999.99
    step qrt pcr kit - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher powersybr qrt pcr kits
    Short-chain fatty acid transporter and anion exchanger expression in the proximal colon. Mice were treated as described in Figure 1 . Proximal colon was collected and whole tissue was flash frozen for immunoblotting, fixed in formalin and paraffin embedded for histology, or RNA was prepared and used for <t>qRT-PCR</t> analysis. ( A ) SLC5A8 (green) was visualized by immunohistochemistry and ( B ) immunoblot of SLC5A8 using HSC70 as internal control; ( C ) MCT1 (green) was visualized by immunohistochemistry and ( D ) immunoblot of MCT1 using HSC70 as internal control; ( E ) NHE3 (green) was visualized by immunohistochemistry; ( F ) NHE3 mRNA expressed in proximal colon presented as fold change. A selected area was cropped and enlarged. All images were acquired using a 20× objective. Images are representative of at least replicate images captured per mouse in 8 to 12 mice per treatment group. Band densities were analyzed using ImageJ software and normalized to HSC70. Values represent means ± SEM. * p
    Powersybr Qrt Pcr Kits, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/powersybr qrt pcr kits/product/Thermo Fisher
    Average 99 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    powersybr qrt pcr kits - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    94
    Thermo Fisher sybergreen qrt pcr kit
    Short-chain fatty acid transporter and anion exchanger expression in the proximal colon. Mice were treated as described in Figure 1 . Proximal colon was collected and whole tissue was flash frozen for immunoblotting, fixed in formalin and paraffin embedded for histology, or RNA was prepared and used for <t>qRT-PCR</t> analysis. ( A ) SLC5A8 (green) was visualized by immunohistochemistry and ( B ) immunoblot of SLC5A8 using HSC70 as internal control; ( C ) MCT1 (green) was visualized by immunohistochemistry and ( D ) immunoblot of MCT1 using HSC70 as internal control; ( E ) NHE3 (green) was visualized by immunohistochemistry; ( F ) NHE3 mRNA expressed in proximal colon presented as fold change. A selected area was cropped and enlarged. All images were acquired using a 20× objective. Images are representative of at least replicate images captured per mouse in 8 to 12 mice per treatment group. Band densities were analyzed using ImageJ software and normalized to HSC70. Values represent means ± SEM. * p
    Sybergreen Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybergreen qrt pcr kit/product/Thermo Fisher
    Average 94 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    sybergreen qrt pcr kit - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    77
    Thermo Fisher ncode qrt pcr kit
    Short-chain fatty acid transporter and anion exchanger expression in the proximal colon. Mice were treated as described in Figure 1 . Proximal colon was collected and whole tissue was flash frozen for immunoblotting, fixed in formalin and paraffin embedded for histology, or RNA was prepared and used for <t>qRT-PCR</t> analysis. ( A ) SLC5A8 (green) was visualized by immunohistochemistry and ( B ) immunoblot of SLC5A8 using HSC70 as internal control; ( C ) MCT1 (green) was visualized by immunohistochemistry and ( D ) immunoblot of MCT1 using HSC70 as internal control; ( E ) NHE3 (green) was visualized by immunohistochemistry; ( F ) NHE3 mRNA expressed in proximal colon presented as fold change. A selected area was cropped and enlarged. All images were acquired using a 20× objective. Images are representative of at least replicate images captured per mouse in 8 to 12 mice per treatment group. Band densities were analyzed using ImageJ software and normalized to HSC70. Values represent means ± SEM. * p
    Ncode Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ncode qrt pcr kit/product/Thermo Fisher
    Average 77 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    ncode qrt pcr kit - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    76
    Thermo Fisher ncodetm qrt pcr kit
    Short-chain fatty acid transporter and anion exchanger expression in the proximal colon. Mice were treated as described in Figure 1 . Proximal colon was collected and whole tissue was flash frozen for immunoblotting, fixed in formalin and paraffin embedded for histology, or RNA was prepared and used for <t>qRT-PCR</t> analysis. ( A ) SLC5A8 (green) was visualized by immunohistochemistry and ( B ) immunoblot of SLC5A8 using HSC70 as internal control; ( C ) MCT1 (green) was visualized by immunohistochemistry and ( D ) immunoblot of MCT1 using HSC70 as internal control; ( E ) NHE3 (green) was visualized by immunohistochemistry; ( F ) NHE3 mRNA expressed in proximal colon presented as fold change. A selected area was cropped and enlarged. All images were acquired using a 20× objective. Images are representative of at least replicate images captured per mouse in 8 to 12 mice per treatment group. Band densities were analyzed using ImageJ software and normalized to HSC70. Values represent means ± SEM. * p
    Ncodetm Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 76/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ncodetm qrt pcr kit/product/Thermo Fisher
    Average 76 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    ncodetm qrt pcr kit - by Bioz Stars, 2020-02
    76/100 stars
      Buy from Supplier

    94
    Thermo Fisher superscriptiii qrt pcr kit
    Short-chain fatty acid transporter and anion exchanger expression in the proximal colon. Mice were treated as described in Figure 1 . Proximal colon was collected and whole tissue was flash frozen for immunoblotting, fixed in formalin and paraffin embedded for histology, or RNA was prepared and used for <t>qRT-PCR</t> analysis. ( A ) SLC5A8 (green) was visualized by immunohistochemistry and ( B ) immunoblot of SLC5A8 using HSC70 as internal control; ( C ) MCT1 (green) was visualized by immunohistochemistry and ( D ) immunoblot of MCT1 using HSC70 as internal control; ( E ) NHE3 (green) was visualized by immunohistochemistry; ( F ) NHE3 mRNA expressed in proximal colon presented as fold change. A selected area was cropped and enlarged. All images were acquired using a 20× objective. Images are representative of at least replicate images captured per mouse in 8 to 12 mice per treatment group. Band densities were analyzed using ImageJ software and normalized to HSC70. Values represent means ± SEM. * p
    Superscriptiii Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscriptiii qrt pcr kit/product/Thermo Fisher
    Average 94 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    superscriptiii qrt pcr kit - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    97
    Thermo Fisher taqman qrt pcr kit
    Short-chain fatty acid transporter and anion exchanger expression in the proximal colon. Mice were treated as described in Figure 1 . Proximal colon was collected and whole tissue was flash frozen for immunoblotting, fixed in formalin and paraffin embedded for histology, or RNA was prepared and used for <t>qRT-PCR</t> analysis. ( A ) SLC5A8 (green) was visualized by immunohistochemistry and ( B ) immunoblot of SLC5A8 using HSC70 as internal control; ( C ) MCT1 (green) was visualized by immunohistochemistry and ( D ) immunoblot of MCT1 using HSC70 as internal control; ( E ) NHE3 (green) was visualized by immunohistochemistry; ( F ) NHE3 mRNA expressed in proximal colon presented as fold change. A selected area was cropped and enlarged. All images were acquired using a 20× objective. Images are representative of at least replicate images captured per mouse in 8 to 12 mice per treatment group. Band densities were analyzed using ImageJ software and normalized to HSC70. Values represent means ± SEM. * p
    Taqman Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman qrt pcr kit/product/Thermo Fisher
    Average 97 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    taqman qrt pcr kit - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    80
    Thermo Fisher qrt pcr sybr kit
    VD could also function directly on T cells to shape T cell responses. CD4 + CD62L + cells from C57BL/6J or C57BL6 Foxp3 gfp reporter mice were cultured in the Th0 or Th17-polarizing conditions with immobilized anti-CD3 and soluble anti-CD28 instead of APCs, in the presence or absence of 1uM VD. (A,B) <t>qRT-PCR</t> results showed VDR and CYP24 mRNA relative expression on CD4 + T cells stimulated in Th0 or Th17 conditions without APCs for 24 h in CTRL (without VD) and VD groups. Data are presented as the mean ± SEM. * P
    Qrt Pcr Sybr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr sybr kit/product/Thermo Fisher
    Average 80 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    qrt pcr sybr kit - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    78
    Thermo Fisher multiscribe qrt pcr kit
    VD could also function directly on T cells to shape T cell responses. CD4 + CD62L + cells from C57BL/6J or C57BL6 Foxp3 gfp reporter mice were cultured in the Th0 or Th17-polarizing conditions with immobilized anti-CD3 and soluble anti-CD28 instead of APCs, in the presence or absence of 1uM VD. (A,B) <t>qRT-PCR</t> results showed VDR and CYP24 mRNA relative expression on CD4 + T cells stimulated in Th0 or Th17 conditions without APCs for 24 h in CTRL (without VD) and VD groups. Data are presented as the mean ± SEM. * P
    Multiscribe Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiscribe qrt pcr kit/product/Thermo Fisher
    Average 78 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    multiscribe qrt pcr kit - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    78
    Thermo Fisher celldirect onestep qrt pcr kit
    VD could also function directly on T cells to shape T cell responses. CD4 + CD62L + cells from C57BL/6J or C57BL6 Foxp3 gfp reporter mice were cultured in the Th0 or Th17-polarizing conditions with immobilized anti-CD3 and soluble anti-CD28 instead of APCs, in the presence or absence of 1uM VD. (A,B) <t>qRT-PCR</t> results showed VDR and CYP24 mRNA relative expression on CD4 + T cells stimulated in Th0 or Th17 conditions without APCs for 24 h in CTRL (without VD) and VD groups. Data are presented as the mean ± SEM. * P
    Celldirect Onestep Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/celldirect onestep qrt pcr kit/product/Thermo Fisher
    Average 78 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    celldirect onestep qrt pcr kit - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    84
    Thermo Fisher qrt pcr sybr green kit
    MiR-140-5p serves as a target of CAGE. (A) MicroRNA array analysis was performed as described. (B) <t>QRT-PCR</t> analysis of the indicated cancer cells was performed. ** p
    Qrt Pcr Sybr Green Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 84/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr sybr green kit/product/Thermo Fisher
    Average 84 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    qrt pcr sybr green kit - by Bioz Stars, 2020-02
    84/100 stars
      Buy from Supplier

    96
    Thermo Fisher sybr qrt pcr reagent kit
    MiR-140-5p serves as a target of CAGE. (A) MicroRNA array analysis was performed as described. (B) <t>QRT-PCR</t> analysis of the indicated cancer cells was performed. ** p
    Sybr Qrt Pcr Reagent Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr qrt pcr reagent kit/product/Thermo Fisher
    Average 96 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    sybr qrt pcr reagent kit - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    91
    Thermo Fisher qrt pcr trizol reagent kit
    MiR-140-5p serves as a target of CAGE. (A) MicroRNA array analysis was performed as described. (B) <t>QRT-PCR</t> analysis of the indicated cancer cells was performed. ** p
    Qrt Pcr Trizol Reagent Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr trizol reagent kit/product/Thermo Fisher
    Average 91 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    qrt pcr trizol reagent kit - by Bioz Stars, 2020-02
    91/100 stars
      Buy from Supplier

    90
    Thermo Fisher single cell to ct qrt pcr kit
    In the Postnatal Suture, PRX1-Expressing Cells Overlap with GLI1-Expressing Cells (A) Comparative evaluation of tdTOMATO expression in 4-week-old Prx1-creER-EGFP +/− ;tdTOMATO +/− and Gli1-creER +/− ;tdTOMATO +/− mice treated with tamoxifen for 5 days (short-pulsing). S, suture space (n = 2 mice). Scale bars, 100 μm. (B) Ex vivo <t>qRT-PCR</t> analysis of Gli1 and Axin2 expression in pnPRX1 + cells (EGFP + ), (EGFP − ), and in pnCOL1 + cells isolated from the sutures (n = 3 independent experiments). Relative expression values ± SD are reported. ∗∗ p
    Single Cell To Ct Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 125 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single cell to ct qrt pcr kit/product/Thermo Fisher
    Average 90 stars, based on 125 article reviews
    Price from $9.99 to $1999.99
    single cell to ct qrt pcr kit - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    77
    Thermo Fisher celldirect one step qrt pcr kits
    Single-cell profiles map cardiogenic gene expression to Sca1 + SP cells co-expressing Pdgfra. ( a ) Left, flow sorting of fresh cardiac Lin − Sca1 + cells after immunomagnetic enrichment for Sca1. Center, further purification of Lin − Sca1 + cells for the SP phenotype by Hoechst 33324 staining±ABC transporter inhibitors: FTC, fumitremorgin C; Res, reserpine; Ver, verapamil. Right, bar graph, mean±s.e.m.; n =4; * P ≤0.0001. ( b ) Single-cell <t>qRT–PCR</t> profiles of fresh total Sca1 + , SP and non-SP cells, compared with cardiomyocytes (CMC). The heatmap illustrates expression as −ΔCt values (blue, low or absent; red, high) and hierarchical clustering reveals the co-expression of functionally related genes in the populations indicated. Highlighted are: yellow, the Sca1 gene Ly6a ; blue, Kdr and Cdh5 , enriched in Sca1 + and non-SP cells; red, cardiogenic transcription factors, enriched in SP cells and CMC; green, Pdgfra and Tcf21 , enriched in SP cells; violet, CMC genes. Sca1 + , n =23; non-SP, n =44; SP, n =43; CMC, n =18. For the full set of 44 genes, see Supplementary Fig. 1 . ( c ) Density plots of expression (−ΔCt) for selected genes in SP (light red) versus non-SP (light blue) cell populations. Genes are ordered according to increasing P -values. Those with a significantly divergent prevalence of expression between SP and non-SP cells are indicated by an asterisk. ( d ) PCA of the single-cell expression profiles. (Top) PC2 (19% variability) separates SP from non-SP sample scores, whereas PC3 (9% variability) establishes a distinct separation between SP/non-SP/Sca1 + cells and CMC. Non-SP and unfractionated Sca1 + cells cluster together in the PC projection. (Bottom) Gene loadings contributing to each PC indicate that a small subset of genes explain the cross-group variability captured by PC2 and PC3. Cdh5 and Kdr are predominantly associated with non-SP and unfractionated Sca1 + cells, while Pdgfra and Tcf21 are correlated with SP cells (as given by PC2). Differences between CMCs and the remaining samples are strongly reflected in PC3, with cardiac structural genes ( Myh6 and Myl2 ) clustered consistently.
    Celldirect One Step Qrt Pcr Kits, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/celldirect one step qrt pcr kits/product/Thermo Fisher
    Average 77 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    celldirect one step qrt pcr kits - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    99
    Thermo Fisher cellsdirect one step qrt pcr kit
    ROS- and mitochondrial ROS (mROS)-mediated apoptosis signaling in copper-stressed macrophages and neutrophils. ROS red labeling [ (A1–A4) , in red boxes] and relative ROS fluorescence (A5) in macrophages and neutrophils in copper-stressed coro1a -driven GFP transgenic larvae. (B) Schematic view for testing the mROS-mediated apoptosis gene expression in copper-stressed macrophages and neutrophils via cell direct <t>qRT-PCR.</t> (C) Expression of different caspase genes in macrophages and neutrophils from copper-stressed coro1a -driven GFP transgenic larvae before and after A. hydrophila infection. (D) Expression of mROS-mediated apoptotic genes in aforementioned cells. Three biological replicates were performed. ANOVA post-hoc Tukey's test. Data are presented as mean ± SD. *** P
    Cellsdirect One Step Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 491 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cellsdirect one step qrt pcr kit/product/Thermo Fisher
    Average 99 stars, based on 491 article reviews
    Price from $9.99 to $1999.99
    cellsdirect one step qrt pcr kit - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    Transcript distribution profile of Trica- SKR1 and Trica -SKR2. Quantification of transcript levels by qRT-PCR in seven different tissues from adult T. castaneum . The data represent samples of central brain (n = 15), optic lobes (n = 15), salivary glands (n = 15), gut (n = 15), fat body (n = 20), testes (n = 50) and ovaries (n = 50), normalized relative to β-actin and ribosomal protein 3 (RPs3) transcript levels. Abbreviations: B = central brain, OL = optic lobes, SG = salivary glands, G = gut, FB = fat body, Te = testes, Ov = ovaria.

    Journal: PLoS ONE

    Article Title: Signaling Properties and Pharmacological Analysis of Two Sulfakinin Receptors from the Red Flour Beetle, Tribolium castaneum

    doi: 10.1371/journal.pone.0094502

    Figure Lengend Snippet: Transcript distribution profile of Trica- SKR1 and Trica -SKR2. Quantification of transcript levels by qRT-PCR in seven different tissues from adult T. castaneum . The data represent samples of central brain (n = 15), optic lobes (n = 15), salivary glands (n = 15), gut (n = 15), fat body (n = 20), testes (n = 50) and ovaries (n = 50), normalized relative to β-actin and ribosomal protein 3 (RPs3) transcript levels. Abbreviations: B = central brain, OL = optic lobes, SG = salivary glands, G = gut, FB = fat body, Te = testes, Ov = ovaria.

    Article Snippet: For qRT-PCR Fast SYBR Green Master Mix (Applied Biosystems) as per manufacturer’s instruction and the StepOnePlus Real-Time PCR system (Applied Biosystems) were used.

    Techniques: Quantitative RT-PCR

    HFD feeding increased the translocation to the nucleus of p65 and expression of NFκB‐related genes in Irf3 −/− mice. Male C57BL/6, Irf3 −/− , and Irf3 S1/S1 mice were fed an HFD or chow for 12 weeks. (A) Expressions of phospho‐IKKα∕β, IKKβ, phospho‐p65, p65, and IκBα were assessed by western blot and normalized to GAPDH, n = 4 per genotype. (B) Formalin‐fixed paraffin‐embedded sections of liver were deparaffinized, and localization of phospho‐p65 was assessed by immunohistochemistry. Images were acquired at 40×. White arrows indicate nonparenchymal cells, and black arrows indicate hepatocytes. Images are representative of triplicate images from eight mice per treatment group. Values represent means ± SEM. (C) Nuclear fractions were isolated from livers, and equal amounts of protein were assessed by western blot and probed against phosphor‐Ser 536 p65‐NFκB. Lamin A/C was used as a nuclei marker, and GAPDH was used as a cytosolic marker. (D) Expressions of CCL5, CXCL10, CXCL2, and CCL3 were analyzed by qRT‐PCR. Values were normalized to 18S and are shown as fold increase over the chow‐fed C57BL/6 control group, n = 12 per genotype. Values with different superscripts are significantly different from each other, P

    Journal: Hepatology Communications

    Article Title: Nontranscriptional Activity of Interferon Regulatory Factor 3 Protects Mice From High‐Fat Diet‐Induced Liver Injury

    doi: 10.1002/hep4.1441

    Figure Lengend Snippet: HFD feeding increased the translocation to the nucleus of p65 and expression of NFκB‐related genes in Irf3 −/− mice. Male C57BL/6, Irf3 −/− , and Irf3 S1/S1 mice were fed an HFD or chow for 12 weeks. (A) Expressions of phospho‐IKKα∕β, IKKβ, phospho‐p65, p65, and IκBα were assessed by western blot and normalized to GAPDH, n = 4 per genotype. (B) Formalin‐fixed paraffin‐embedded sections of liver were deparaffinized, and localization of phospho‐p65 was assessed by immunohistochemistry. Images were acquired at 40×. White arrows indicate nonparenchymal cells, and black arrows indicate hepatocytes. Images are representative of triplicate images from eight mice per treatment group. Values represent means ± SEM. (C) Nuclear fractions were isolated from livers, and equal amounts of protein were assessed by western blot and probed against phosphor‐Ser 536 p65‐NFκB. Lamin A/C was used as a nuclei marker, and GAPDH was used as a cytosolic marker. (D) Expressions of CCL5, CXCL10, CXCL2, and CCL3 were analyzed by qRT‐PCR. Values were normalized to 18S and are shown as fold increase over the chow‐fed C57BL/6 control group, n = 12 per genotype. Values with different superscripts are significantly different from each other, P

    Article Snippet: Two micrograms of liver RNA was reverse transcribed and analyzed with PowerSYBR quantitative real‐time polymerase chain reaction (qRT‐PCR) kits (Applied Biosystems, Foster City, CA) on a QuantStudio5 RT‐PCR Machine (Applied Biosystems).

    Techniques: Translocation Assay, Expressing, Mouse Assay, Western Blot, Formalin-fixed Paraffin-Embedded, Immunohistochemistry, Isolation, Marker, Quantitative RT-PCR

    Irf3 S1/S1 mice reduced HFD‐induced liver injury, steatosis, and markers of inflammation. Male C57BL/6, Irf3 −/− , and Irf3 S1/S1 mice were fed an HFD or chow for 12 weeks. (A,B) ALT and AST activities were measured in plasma, n = 12 per genotype. (C) Hepatic triglyceride content was measured in whole‐liver homogenates, n = 12 per genotype. (D) Paraffin‐embedded liver sections were stained with hematoxylin and eosin. Images were acquired using 10× and 40× objectives, n = 4 per genotype. Expressions of (E) TNFα, (F) IL‐1β, and (G) MCP‐1 mRNA were analyzed by qRT‐PCR. Values were normalized to 18S and are shown as fold increase over the chow‐fed C57BL/6 control group, n = 12 per genotype. Values represent means ± SEM. Values with different alphabetical superscripts are significantly different, P

    Journal: Hepatology Communications

    Article Title: Nontranscriptional Activity of Interferon Regulatory Factor 3 Protects Mice From High‐Fat Diet‐Induced Liver Injury

    doi: 10.1002/hep4.1441

    Figure Lengend Snippet: Irf3 S1/S1 mice reduced HFD‐induced liver injury, steatosis, and markers of inflammation. Male C57BL/6, Irf3 −/− , and Irf3 S1/S1 mice were fed an HFD or chow for 12 weeks. (A,B) ALT and AST activities were measured in plasma, n = 12 per genotype. (C) Hepatic triglyceride content was measured in whole‐liver homogenates, n = 12 per genotype. (D) Paraffin‐embedded liver sections were stained with hematoxylin and eosin. Images were acquired using 10× and 40× objectives, n = 4 per genotype. Expressions of (E) TNFα, (F) IL‐1β, and (G) MCP‐1 mRNA were analyzed by qRT‐PCR. Values were normalized to 18S and are shown as fold increase over the chow‐fed C57BL/6 control group, n = 12 per genotype. Values represent means ± SEM. Values with different alphabetical superscripts are significantly different, P

    Article Snippet: Two micrograms of liver RNA was reverse transcribed and analyzed with PowerSYBR quantitative real‐time polymerase chain reaction (qRT‐PCR) kits (Applied Biosystems, Foster City, CA) on a QuantStudio5 RT‐PCR Machine (Applied Biosystems).

    Techniques: Mouse Assay, AST Assay, Staining, Quantitative RT-PCR

    HFD enhanced CD45 + infiltration in Irf3 −/− but not in wild‐type and Irf3 S1/S1 livers. Male C57BL/6, Irf3 −/− , and Irf3 S1/S1 mice were fed an HFD or chow for 12 weeks. (A) Expression of CD45 mRNA was analyzed by qRT‐PCR. Values were normalized to 18S and are shown as fold increase over the chow‐fed C57BL/6 control group, n = 8 per genotype. (B) Hepatic CD45 + leukocytes were gated in isolated liver NPCs by flow cytometry, and total number of cells were quantified in isolated liver NPCs, n = 4 per genotype. (C) Paraffin‐embedded liver sections were stained for CD45. Images were acquired using a 20× objective, n = 4 per genotype. Values represent means ± SEM. Values with different alphabetical superscripts are significantly different, P

    Journal: Hepatology Communications

    Article Title: Nontranscriptional Activity of Interferon Regulatory Factor 3 Protects Mice From High‐Fat Diet‐Induced Liver Injury

    doi: 10.1002/hep4.1441

    Figure Lengend Snippet: HFD enhanced CD45 + infiltration in Irf3 −/− but not in wild‐type and Irf3 S1/S1 livers. Male C57BL/6, Irf3 −/− , and Irf3 S1/S1 mice were fed an HFD or chow for 12 weeks. (A) Expression of CD45 mRNA was analyzed by qRT‐PCR. Values were normalized to 18S and are shown as fold increase over the chow‐fed C57BL/6 control group, n = 8 per genotype. (B) Hepatic CD45 + leukocytes were gated in isolated liver NPCs by flow cytometry, and total number of cells were quantified in isolated liver NPCs, n = 4 per genotype. (C) Paraffin‐embedded liver sections were stained for CD45. Images were acquired using a 20× objective, n = 4 per genotype. Values represent means ± SEM. Values with different alphabetical superscripts are significantly different, P

    Article Snippet: Two micrograms of liver RNA was reverse transcribed and analyzed with PowerSYBR quantitative real‐time polymerase chain reaction (qRT‐PCR) kits (Applied Biosystems, Foster City, CA) on a QuantStudio5 RT‐PCR Machine (Applied Biosystems).

    Techniques: Mouse Assay, Expressing, Quantitative RT-PCR, Isolation, Flow Cytometry, Cytometry, Staining

    Enhanced markers of hepatocellular death and fibrosis in Irf3 −/− mice compared with wild‐type and Irf3 S1/S1 mice after HFD feeding. Male C57BL/6, Irf3 −/− , and Irf3 S1/S1 mice were fed an HFD or chow for 12 weeks. (A,B) Paraffin‐embedded liver sections were stained for M30, a caspase‐dependent cleavage product of cytokeratin 18. Images were acquired using 10× and 40× objectives, and the positive area was quantified, n = 4 per genotype. (C,D) Paraffin‐embedded liver sections were stained with sirius red. Images were acquired using a 40× objective, and the positive area was quantified, n = 4 per genotype. (E) Expression of Col1α1 mRNA was analyzed by qRT‐PCR. Values were normalized to 18S and are shown as fold increase over the chow‐fed C57BL/6 control group, n = 8 per genotype. Values represent means ± SEM. Values with different alphabetical superscripts are significantly different, P

    Journal: Hepatology Communications

    Article Title: Nontranscriptional Activity of Interferon Regulatory Factor 3 Protects Mice From High‐Fat Diet‐Induced Liver Injury

    doi: 10.1002/hep4.1441

    Figure Lengend Snippet: Enhanced markers of hepatocellular death and fibrosis in Irf3 −/− mice compared with wild‐type and Irf3 S1/S1 mice after HFD feeding. Male C57BL/6, Irf3 −/− , and Irf3 S1/S1 mice were fed an HFD or chow for 12 weeks. (A,B) Paraffin‐embedded liver sections were stained for M30, a caspase‐dependent cleavage product of cytokeratin 18. Images were acquired using 10× and 40× objectives, and the positive area was quantified, n = 4 per genotype. (C,D) Paraffin‐embedded liver sections were stained with sirius red. Images were acquired using a 40× objective, and the positive area was quantified, n = 4 per genotype. (E) Expression of Col1α1 mRNA was analyzed by qRT‐PCR. Values were normalized to 18S and are shown as fold increase over the chow‐fed C57BL/6 control group, n = 8 per genotype. Values represent means ± SEM. Values with different alphabetical superscripts are significantly different, P

    Article Snippet: Two micrograms of liver RNA was reverse transcribed and analyzed with PowerSYBR quantitative real‐time polymerase chain reaction (qRT‐PCR) kits (Applied Biosystems, Foster City, CA) on a QuantStudio5 RT‐PCR Machine (Applied Biosystems).

    Techniques: Mouse Assay, Staining, Expressing, Quantitative RT-PCR

    Hepatic IRF3 activation after HFD feeding. Male C57BL/6, Irf3 −/− , and Irf3 S1/S1 mice were fed an HFD or chow for 12 weeks. (A) Expression of IFIT1 and IFIT3 mRNA was analyzed by qRT‐PCR. Values were normalized to 18S and are shown as fold increase over the chow‐fed C57BL/6 control group, n = 12 per genotype. (B) Expression of IRF3 was assessed by western blot and normalized to GAPDH, n = 4 per genotype. (C) Expression of IRF3 mRNA was analyzed by qRT‐PCR. Values were normalized to 18S and are shown as fold increase over the chow‐fed C57BL/6 control group, n = 12 per genotype. Values represent means ± SEM. Values with different alphabetical superscripts are significantly different, P

    Journal: Hepatology Communications

    Article Title: Nontranscriptional Activity of Interferon Regulatory Factor 3 Protects Mice From High‐Fat Diet‐Induced Liver Injury

    doi: 10.1002/hep4.1441

    Figure Lengend Snippet: Hepatic IRF3 activation after HFD feeding. Male C57BL/6, Irf3 −/− , and Irf3 S1/S1 mice were fed an HFD or chow for 12 weeks. (A) Expression of IFIT1 and IFIT3 mRNA was analyzed by qRT‐PCR. Values were normalized to 18S and are shown as fold increase over the chow‐fed C57BL/6 control group, n = 12 per genotype. (B) Expression of IRF3 was assessed by western blot and normalized to GAPDH, n = 4 per genotype. (C) Expression of IRF3 mRNA was analyzed by qRT‐PCR. Values were normalized to 18S and are shown as fold increase over the chow‐fed C57BL/6 control group, n = 12 per genotype. Values represent means ± SEM. Values with different alphabetical superscripts are significantly different, P

    Article Snippet: Two micrograms of liver RNA was reverse transcribed and analyzed with PowerSYBR quantitative real‐time polymerase chain reaction (qRT‐PCR) kits (Applied Biosystems, Foster City, CA) on a QuantStudio5 RT‐PCR Machine (Applied Biosystems).

    Techniques: Activation Assay, Mouse Assay, Expressing, Quantitative RT-PCR, Western Blot

    GATA3 inhibits epithelial–mesenchymal transition (EMT) in gastric cancer cells. Notes: ( A ) CTC-141 cells were transfected with vector, GATA3 and GATA3 (R298Q), and the relative expressions of EMT-associated genes were detected by qRT-PCR. * P

    Journal: Cancer Management and Research

    Article Title: Low expression of GATA3 promotes cell proliferation and metastasis in gastric cancer

    doi: 10.2147/CMAR.S147973

    Figure Lengend Snippet: GATA3 inhibits epithelial–mesenchymal transition (EMT) in gastric cancer cells. Notes: ( A ) CTC-141 cells were transfected with vector, GATA3 and GATA3 (R298Q), and the relative expressions of EMT-associated genes were detected by qRT-PCR. * P

    Article Snippet: Quantitative real time polymerase chain reaction (qRT-PCR) RNeasy Mini kit (Thermo Fisher Scientific, Waltham, MA, USA) was used to extract total RNA from tissue samples and cells according to our protocol.

    Techniques: Transfection, Plasmid Preparation, Quantitative RT-PCR

    GATA3 is downregulated in gastric cancer tissues. Notes: ( A ) Total mRNA was extracted from 83 pairs of tumor tissue samples and adjacent normal tissue samples. qRT-PCR was performed to determine the relative mRNA level of GATA3. * P

    Journal: Cancer Management and Research

    Article Title: Low expression of GATA3 promotes cell proliferation and metastasis in gastric cancer

    doi: 10.2147/CMAR.S147973

    Figure Lengend Snippet: GATA3 is downregulated in gastric cancer tissues. Notes: ( A ) Total mRNA was extracted from 83 pairs of tumor tissue samples and adjacent normal tissue samples. qRT-PCR was performed to determine the relative mRNA level of GATA3. * P

    Article Snippet: Quantitative real time polymerase chain reaction (qRT-PCR) RNeasy Mini kit (Thermo Fisher Scientific, Waltham, MA, USA) was used to extract total RNA from tissue samples and cells according to our protocol.

    Techniques: Quantitative RT-PCR

    GATA3 transcriptionally regulates ZEB1 in G cells. Notes: ( A ) CTC-141 cells were transfected with vector, GATA3 and GATA3 (R298Q), and the relative expressions of EMT-associated transcription factors were detected by qRT-PCR. ** P

    Journal: Cancer Management and Research

    Article Title: Low expression of GATA3 promotes cell proliferation and metastasis in gastric cancer

    doi: 10.2147/CMAR.S147973

    Figure Lengend Snippet: GATA3 transcriptionally regulates ZEB1 in G cells. Notes: ( A ) CTC-141 cells were transfected with vector, GATA3 and GATA3 (R298Q), and the relative expressions of EMT-associated transcription factors were detected by qRT-PCR. ** P

    Article Snippet: Quantitative real time polymerase chain reaction (qRT-PCR) RNeasy Mini kit (Thermo Fisher Scientific, Waltham, MA, USA) was used to extract total RNA from tissue samples and cells according to our protocol.

    Techniques: Transfection, Plasmid Preparation, Quantitative RT-PCR

    Overexpression of ZEB1 suppresses the migratory and invasive behavior of gastric cancer cells. Notes: ( A ) ZEB1 was knocked down in CTC-141 cells. After transfection for 48 h, the expression of ZEB1 was determined by qRT-PCR. * P

    Journal: Cancer Management and Research

    Article Title: Low expression of GATA3 promotes cell proliferation and metastasis in gastric cancer

    doi: 10.2147/CMAR.S147973

    Figure Lengend Snippet: Overexpression of ZEB1 suppresses the migratory and invasive behavior of gastric cancer cells. Notes: ( A ) ZEB1 was knocked down in CTC-141 cells. After transfection for 48 h, the expression of ZEB1 was determined by qRT-PCR. * P

    Article Snippet: Quantitative real time polymerase chain reaction (qRT-PCR) RNeasy Mini kit (Thermo Fisher Scientific, Waltham, MA, USA) was used to extract total RNA from tissue samples and cells according to our protocol.

    Techniques: Over Expression, Transfection, Expressing, Quantitative RT-PCR

    GATA3 is downregulated in GC cells. Notes: ( A ) Expression of GATA3 in GC cell lines, CTC-141 and MKN45, and human normal gastric mucosal cell line GES-1 was detected by qRT-PCR and Western blotting, respectively. * P

    Journal: Cancer Management and Research

    Article Title: Low expression of GATA3 promotes cell proliferation and metastasis in gastric cancer

    doi: 10.2147/CMAR.S147973

    Figure Lengend Snippet: GATA3 is downregulated in GC cells. Notes: ( A ) Expression of GATA3 in GC cell lines, CTC-141 and MKN45, and human normal gastric mucosal cell line GES-1 was detected by qRT-PCR and Western blotting, respectively. * P

    Article Snippet: Quantitative real time polymerase chain reaction (qRT-PCR) RNeasy Mini kit (Thermo Fisher Scientific, Waltham, MA, USA) was used to extract total RNA from tissue samples and cells according to our protocol.

    Techniques: Expressing, Quantitative RT-PCR, Western Blot

    miR-155 promotes production of TNF-α and IL-1β in human PBMCs. ( A ) Fold changes of miR-155 expression were determined by qRT-PCR after the transfection of miR-control, or miR-155 mimics at 25 or 50 nM for 24 h; ( B ) and ( C ) Expression of TNF-α and IL-1β in supernatant of PBMCs 24 h post LPS treatment, or 24 h post transfection with 25 nM miR-155 mimics, 50 nM miR-155 mimics or 50 nM miRNA control. Results were expressed as pg/mL by an ELISA test; and ( D ) mRNA expression of TNF-α (group 1) and IL-1β (group 2) in PBMCs 24 h after LPS treatment or 24 h post transfection with 25 nM miR-155 mimics, 50 nM miR-155 mimics or 50 nM miRNA control. All results are the average of three independent experiments. Statistical significance is shown.

    Journal: International Journal of Molecular Sciences

    Article Title: Rheumatoid Arthritis-Associated MicroRNA-155 Targets SOCS1 and Upregulates TNF-? and IL-1? in PBMCs

    doi: 10.3390/ijms141223910

    Figure Lengend Snippet: miR-155 promotes production of TNF-α and IL-1β in human PBMCs. ( A ) Fold changes of miR-155 expression were determined by qRT-PCR after the transfection of miR-control, or miR-155 mimics at 25 or 50 nM for 24 h; ( B ) and ( C ) Expression of TNF-α and IL-1β in supernatant of PBMCs 24 h post LPS treatment, or 24 h post transfection with 25 nM miR-155 mimics, 50 nM miR-155 mimics or 50 nM miRNA control. Results were expressed as pg/mL by an ELISA test; and ( D ) mRNA expression of TNF-α (group 1) and IL-1β (group 2) in PBMCs 24 h after LPS treatment or 24 h post transfection with 25 nM miR-155 mimics, 50 nM miR-155 mimics or 50 nM miRNA control. All results are the average of three independent experiments. Statistical significance is shown.

    Article Snippet: Quantification of miR-155 expression was conducted using the mirVana qRT-PCR miRNA Detection Kit (Ambion, Austin, TX, USA), and the U6 small nuclear RNA was used as internal control.

    Techniques: Expressing, Quantitative RT-PCR, Transfection, Enzyme-linked Immunosorbent Assay

    15 microRNA (miRNA) differentially expressed in the plasma of systemic lupus erythematosus (SLE), rheumatoid arthritis (RA) patients, and healthy control (HC). Expressions of the selected miRNAs in the plasma obtained from patients with SLE ( n = 50), RA ( n = 16), and HC ( n = 20) were determined by qRT-PCR. The expression levels of miRNAs were normalized to cel-miR-39.

    Journal: Frontiers in Immunology

    Article Title: B Cell-Related Circulating MicroRNAs With the Potential Value of Biomarkers in the Differential Diagnosis, and Distinguishment Between the Disease Activity and Lupus Nephritis for Systemic Lupus Erythematosus

    doi: 10.3389/fimmu.2018.01473

    Figure Lengend Snippet: 15 microRNA (miRNA) differentially expressed in the plasma of systemic lupus erythematosus (SLE), rheumatoid arthritis (RA) patients, and healthy control (HC). Expressions of the selected miRNAs in the plasma obtained from patients with SLE ( n = 50), RA ( n = 16), and HC ( n = 20) were determined by qRT-PCR. The expression levels of miRNAs were normalized to cel-miR-39.

    Article Snippet: The expressions of miRNAs in the 80 plama samples from Ruijin Hospital were detected using mirVana qRT-PCR miRNA Detection Kit (Cat#AM1558, Ambion, US).

    Techniques: Quantitative RT-PCR, Expressing

    miRNA alternation induced by TGF-β1 treatment (n=3). A. The miRNA microarray clustering results of BGC823/0 h, BGC823/24 hrs and BGC823/36 hrs cell lines; B. qRT-PCR analysis of the relative expression levels of miR-193b, miR-130b and miR-27a

    Journal: Chinese Journal of Cancer Research

    Article Title: TGF-?1 alters microRNA profile in human gastric cancer cells

    doi: 10.3978/j.issn.1000-9604.2013.01.09

    Figure Lengend Snippet: miRNA alternation induced by TGF-β1 treatment (n=3). A. The miRNA microarray clustering results of BGC823/0 h, BGC823/24 hrs and BGC823/36 hrs cell lines; B. qRT-PCR analysis of the relative expression levels of miR-193b, miR-130b and miR-27a

    Article Snippet: Real-time PCR was performed using express SYBR GreenER miRNA qRT-PCR Kit (Invitrogen) on 7,500 real-time PCR system (ABI, USA).

    Techniques: Microarray, Quantitative RT-PCR, Expressing

    Effect of enzyme system on detection of pathogen targets in primary clinical specimens. Data shown are difference in Ct value between reactions using Quanta One-step RT-PCR ToughMix and AgPath-ID One-step RT-PCR kit when testing TNA extracted from NP/OP swabs (A) or blood (B). Each data point represents the difference in Ct value between the two reactions for an individual clinical specimen. Median difference is indicated ( ― ) for assays with ≥2 positive results. *Targets that were only detected using AgPath always occurred when Ct values were > 33.

    Journal: PLoS ONE

    Article Title: Optimization of Multiple Pathogen Detection Using the TaqMan Array Card: Application for a Population-Based Study of Neonatal Infection

    doi: 10.1371/journal.pone.0066183

    Figure Lengend Snippet: Effect of enzyme system on detection of pathogen targets in primary clinical specimens. Data shown are difference in Ct value between reactions using Quanta One-step RT-PCR ToughMix and AgPath-ID One-step RT-PCR kit when testing TNA extracted from NP/OP swabs (A) or blood (B). Each data point represents the difference in Ct value between the two reactions for an individual clinical specimen. Median difference is indicated ( ― ) for assays with ≥2 positive results. *Targets that were only detected using AgPath always occurred when Ct values were > 33.

    Article Snippet: Each reaction consisted of 1× AgPath-ID One-step RT-PCR buffer and 1× AgPath-ID One-step RT-PCR enzyme mix (Applied Biosystems, Foster City, CA, USA) or 1× qScript XLT One-step RT-qPCR ToughMix, low ROX (Quanta Biosciences, Gaithersburg, MD, USA), forward and reverse primers and FAM-labeled hydrolysis probe at the concentrations listed in Table S1 in , and nuclease-free water to final volume of 20 µL.

    Techniques: Reverse Transcription Polymerase Chain Reaction

    Lack of correlation between telomere length and TERRA levels in cells with stable telomeres. Two independent, exponentially-dividing strains of each genotype were split and used to isolate RNA or DNA. ( A ) A map of single copy loci amplified during TERRA measurements (B-E) and Southern blot probes (F). Distance from the centromeric end of the TG repeats is indicated. Primers used in the qRT-PCR and to make the probes are described in S2 Table. ( B–E ) TERRA measured as in Figure 1B . ( F ) Telomeric Southern blots performed after XhoI (top two gels) or HindIII (bottom two gels) digestion. One membrane was first probed for telomere 15L and then Y’+TG sequences ( Supplementary Figure S3A ). The other membrane was first probed for telomere 10R and finally 13R. Loading control corresponds to SYBR Safe staining of the gel probed for telomeres 10R and 13R.

    Journal: Nucleic Acids Research

    Article Title: Paf1 and Ctr9, core components of the PAF1 complex, maintain low levels of telomeric repeat containing RNA

    doi: 10.1093/nar/gkx1131

    Figure Lengend Snippet: Lack of correlation between telomere length and TERRA levels in cells with stable telomeres. Two independent, exponentially-dividing strains of each genotype were split and used to isolate RNA or DNA. ( A ) A map of single copy loci amplified during TERRA measurements (B-E) and Southern blot probes (F). Distance from the centromeric end of the TG repeats is indicated. Primers used in the qRT-PCR and to make the probes are described in S2 Table. ( B–E ) TERRA measured as in Figure 1B . ( F ) Telomeric Southern blots performed after XhoI (top two gels) or HindIII (bottom two gels) digestion. One membrane was first probed for telomere 15L and then Y’+TG sequences ( Supplementary Figure S3A ). The other membrane was first probed for telomere 10R and finally 13R. Loading control corresponds to SYBR Safe staining of the gel probed for telomeres 10R and 13R.

    Article Snippet: Next, one-step qRT-PCR was carried out in the presence of forward and reverse primers, directed to specific telomeres, using the Superscript III Platinum SYBR Green One-Step qRT-PCR kit (Invitrogen).

    Techniques: Amplification, Southern Blot, Quantitative RT-PCR, Staining

    An example of the SYBR Green RD-qPCR assay of 5-LOX DNA methylation (shown are graphs obtained from 10 cerebellar samples). The samples were digested with the methylation-sensitive endonucleases (AciI, BstUI, HinP1I, and HpaII) as described in Material and Methods. The PCR reaction for the promoter-5′UTR (10 samples each: AciI = blue, BstUI = red, HinP1I = green, and HpaII = gray) and corresponding input control regions (shown in yellow) were carried out in separate tubes. Panel A shows the dissociation curve data, which indicate the presence of only one PCR product (peak) for each specific set of primers (fluorescence (first derivative of the raw fluorescence reading multiplied by −1) on the Y-axis versus the PCR product melting temperature (°C) on the X-axis). Panel B shows examples of the amplification plots used for calculating the quantitative data (the amplification plots fluorescence (baseline-corrected raw fluorescence) on the Y-axis versus cycle number on the X-axis). In this assay, the threshold cycle is inversely proportional to the log of the initial copy number. In other words, the more template that is present initially, the fewer the number of cycles required for the fluorescence signal to be detectable above background.

    Journal: Neural Plasticity

    Article Title: 5-Lipoxygenase DNA Methylation and mRNA Content in the Brain and Heart of Young and Old Mice

    doi: 10.1155/2009/209596

    Figure Lengend Snippet: An example of the SYBR Green RD-qPCR assay of 5-LOX DNA methylation (shown are graphs obtained from 10 cerebellar samples). The samples were digested with the methylation-sensitive endonucleases (AciI, BstUI, HinP1I, and HpaII) as described in Material and Methods. The PCR reaction for the promoter-5′UTR (10 samples each: AciI = blue, BstUI = red, HinP1I = green, and HpaII = gray) and corresponding input control regions (shown in yellow) were carried out in separate tubes. Panel A shows the dissociation curve data, which indicate the presence of only one PCR product (peak) for each specific set of primers (fluorescence (first derivative of the raw fluorescence reading multiplied by −1) on the Y-axis versus the PCR product melting temperature (°C) on the X-axis). Panel B shows examples of the amplification plots used for calculating the quantitative data (the amplification plots fluorescence (baseline-corrected raw fluorescence) on the Y-axis versus cycle number on the X-axis). In this assay, the threshold cycle is inversely proportional to the log of the initial copy number. In other words, the more template that is present initially, the fewer the number of cycles required for the fluorescence signal to be detectable above background.

    Article Snippet: Digested DNA samples were diluted with water and an aliquot (100 ng DNA) was used for qPCR (Stratagene) with the Maxima SYBR Green qPCR Master Mix (Fermentas) according to the manufacturer's protocol.

    Techniques: SYBR Green Assay, Real-time Polymerase Chain Reaction, DNA Methylation Assay, Methylation, Polymerase Chain Reaction, Fluorescence, Amplification

    Expression pattern of the subunits of AMPK (PRKA) in steroidogenic tissues. RNA was extracted from human adrenal NCI-H295 cells, adult human adrenal tissue and human as well as porcine primary ovarian cell culture. A, semiquantitative RT-PCR (30 cycles) was performed on 100 ng of reverse-transcribed total RNA using specific primers and PCR products were separated on a 1.5% agarose gel and visualized with ethidium bromide. Shown is a representative gel of three independent experiments. B, QRT-PCR was performed on 50 ng cDNA obtained from NCI-H295R cells using ABsolute QPCR SYBR Green Mix. Data represent calculations of two independent experiments where 18S rRNA served as internal control.

    Journal: PLoS ONE

    Article Title: Role of AMP-Activated Protein Kinase on Steroid Hormone Biosynthesis in Adrenal NCI-H295R Cells

    doi: 10.1371/journal.pone.0030956

    Figure Lengend Snippet: Expression pattern of the subunits of AMPK (PRKA) in steroidogenic tissues. RNA was extracted from human adrenal NCI-H295 cells, adult human adrenal tissue and human as well as porcine primary ovarian cell culture. A, semiquantitative RT-PCR (30 cycles) was performed on 100 ng of reverse-transcribed total RNA using specific primers and PCR products were separated on a 1.5% agarose gel and visualized with ethidium bromide. Shown is a representative gel of three independent experiments. B, QRT-PCR was performed on 50 ng cDNA obtained from NCI-H295R cells using ABsolute QPCR SYBR Green Mix. Data represent calculations of two independent experiments where 18S rRNA served as internal control.

    Article Snippet: We used ABsolute QPCR SYBR Green Mix (ABgene, Thermo Fisher Scientific, Wohlen, Switzerland), 1 µl (20 pmol/µl) specific primers (Microsynth, Balgach, Switzerland) and 50 ng cDNA in a total volume of 25 µl.

    Techniques: Expressing, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, SYBR Green Assay

    miR-135a suppresses Thbs1/THBS1 transcription through its 3′UTR region. a miR-135a attenuates the expression of Thbs1. Induced miR135a in primary astrocytes with DOX-inducible miR-135a expression system; qRT-PCR and western blot analysis confirmed that miR-135a, Thbs1 mRNAs, and proteins levels, respectively. b Two positions of the Thbs1 3′-untranslated region are predicted to be targets of miR-135a. The seed regions were indicated by the open box (upper panel). Luciferase activity of reporter constructs was measured after co-transfected with pre-miR-135a. c Antisense of miR135a (A-135a) antagonize the effects of Cebpd. Induced A-135a in primary astrocytes with IPTG-inducible A-135a expression system and treated with or without IL-1β treatment. d Induced miR-135a expression repress the THBS1 expression. In stable U373MG cells with DOX-inducible miR-135a expression system, the expression of miR-135a and the level of THBS1 mRNAs and proteins were examined by qRT-PCR, RT-PCR, and Western blot, respectively. e IL-1β and CEBPD suppresses THBS1 transcription via miR-135a binding motif. The seed region was indicated by the open box (upper panel). Luciferase activity of reporter constructs was measured after co-transfected with pre-miR-135a, CEBPD expression vectors, or treated IL-1β. f Antagomir of miR135a (AM135a) dose-dependently antagonized the effects of CEBPD. AM135a or scramble antagomir were transfected into the U373MG stable cells with zinc-inducible CEBPD expression system and then incubated in the presence or absence of 100 μM ZnSO4 for 6 h. RT-PCR and Western blot analysis were performed to examine the expressions of THBS1 mRNA and protein. The data represent the mean ± standard error of three independent experiments, each performed in triplicate. (* P

    Journal: Molecular Neurobiology

    Article Title: Astrocytic CCAAT/Enhancer Binding Protein δ Regulates Neuronal Viability and Spatial Learning Ability via miR-135a

    doi: 10.1007/s12035-015-9359-z

    Figure Lengend Snippet: miR-135a suppresses Thbs1/THBS1 transcription through its 3′UTR region. a miR-135a attenuates the expression of Thbs1. Induced miR135a in primary astrocytes with DOX-inducible miR-135a expression system; qRT-PCR and western blot analysis confirmed that miR-135a, Thbs1 mRNAs, and proteins levels, respectively. b Two positions of the Thbs1 3′-untranslated region are predicted to be targets of miR-135a. The seed regions were indicated by the open box (upper panel). Luciferase activity of reporter constructs was measured after co-transfected with pre-miR-135a. c Antisense of miR135a (A-135a) antagonize the effects of Cebpd. Induced A-135a in primary astrocytes with IPTG-inducible A-135a expression system and treated with or without IL-1β treatment. d Induced miR-135a expression repress the THBS1 expression. In stable U373MG cells with DOX-inducible miR-135a expression system, the expression of miR-135a and the level of THBS1 mRNAs and proteins were examined by qRT-PCR, RT-PCR, and Western blot, respectively. e IL-1β and CEBPD suppresses THBS1 transcription via miR-135a binding motif. The seed region was indicated by the open box (upper panel). Luciferase activity of reporter constructs was measured after co-transfected with pre-miR-135a, CEBPD expression vectors, or treated IL-1β. f Antagomir of miR135a (AM135a) dose-dependently antagonized the effects of CEBPD. AM135a or scramble antagomir were transfected into the U373MG stable cells with zinc-inducible CEBPD expression system and then incubated in the presence or absence of 100 μM ZnSO4 for 6 h. RT-PCR and Western blot analysis were performed to examine the expressions of THBS1 mRNA and protein. The data represent the mean ± standard error of three independent experiments, each performed in triplicate. (* P

    Article Snippet: Forty cycles were set for qRT-PCR program and the abundances of interested gene expression were calculated following the formula (2 -ΔΔCt ) suggested in the instruction of qRT-PCR kit (Applied Biosystems).

    Techniques: Expressing, Quantitative RT-PCR, Western Blot, Luciferase, Activity Assay, Construct, Transfection, Reverse Transcription Polymerase Chain Reaction, Binding Assay, Incubation

    miR-135a is a CEBPD responsive miRNA. a CEBPD induces miR-135a expression. qRT-PCR and Western blot confirmed that miR-135a levels and the expression of HA-tagged CEBPD protein from stable U373MG cells with pMT-CEBPD expression vector, respectively. b CEBPD participate in IL-1β-induced miR-135a expression. qRT-PCR was performed with total RNA harvested from IL-1β-treated U373MG cells with or without attenuation of CEBPD. c miR-135a expression is unaltered in primary Cebpd − / − astrocytes. qRT-PCR was performed using total RNA harvested from primary Cebpd +/+ and Cebpd − / − astrocytes with or without IL-1β treatment. d CEBPD increases miR-135a promoter activities. Schematic representation of reporter constructs with the GLYCTK-AS1-001 promoter. The approximate location of putative CEBPD-binding motif was indicated by open box . A luciferase activity was conducted by co-transfected reporter and expression vectors as indicated in U373MG cells. e CEBPD can directly bind to the GLYCTK-AS1-001 promoter in vivo. A ChIP assay was performed with U373MG cells treated with IL-1β. Chromatin of U373MG cells was separately immunoprecipitated with specific antibody against CEBPD (CD) and control IgG [ 14 ]. The schematic on the top indicated the location of the primers used for detection of the GLYCTK-AS1-001 promoter by PCR. The precipitated DNAs were amplified by PCR with primer (FR-211) on the GLYCTK-AS1-001 promoter (−98/ +113) which contain putative CEBPD-binding motif and negative control primer (FR-250). The data represented the mean ± standard error of three independent experiments, each performed in triplicate. (* P

    Journal: Molecular Neurobiology

    Article Title: Astrocytic CCAAT/Enhancer Binding Protein δ Regulates Neuronal Viability and Spatial Learning Ability via miR-135a

    doi: 10.1007/s12035-015-9359-z

    Figure Lengend Snippet: miR-135a is a CEBPD responsive miRNA. a CEBPD induces miR-135a expression. qRT-PCR and Western blot confirmed that miR-135a levels and the expression of HA-tagged CEBPD protein from stable U373MG cells with pMT-CEBPD expression vector, respectively. b CEBPD participate in IL-1β-induced miR-135a expression. qRT-PCR was performed with total RNA harvested from IL-1β-treated U373MG cells with or without attenuation of CEBPD. c miR-135a expression is unaltered in primary Cebpd − / − astrocytes. qRT-PCR was performed using total RNA harvested from primary Cebpd +/+ and Cebpd − / − astrocytes with or without IL-1β treatment. d CEBPD increases miR-135a promoter activities. Schematic representation of reporter constructs with the GLYCTK-AS1-001 promoter. The approximate location of putative CEBPD-binding motif was indicated by open box . A luciferase activity was conducted by co-transfected reporter and expression vectors as indicated in U373MG cells. e CEBPD can directly bind to the GLYCTK-AS1-001 promoter in vivo. A ChIP assay was performed with U373MG cells treated with IL-1β. Chromatin of U373MG cells was separately immunoprecipitated with specific antibody against CEBPD (CD) and control IgG [ 14 ]. The schematic on the top indicated the location of the primers used for detection of the GLYCTK-AS1-001 promoter by PCR. The precipitated DNAs were amplified by PCR with primer (FR-211) on the GLYCTK-AS1-001 promoter (−98/ +113) which contain putative CEBPD-binding motif and negative control primer (FR-250). The data represented the mean ± standard error of three independent experiments, each performed in triplicate. (* P

    Article Snippet: Forty cycles were set for qRT-PCR program and the abundances of interested gene expression were calculated following the formula (2 -ΔΔCt ) suggested in the instruction of qRT-PCR kit (Applied Biosystems).

    Techniques: Expressing, Quantitative RT-PCR, Western Blot, Plasmid Preparation, Construct, Binding Assay, Luciferase, Activity Assay, Transfection, In Vivo, Chromatin Immunoprecipitation, Immunoprecipitation, Polymerase Chain Reaction, Amplification, Negative Control

    Expression of miR-124 in human glioma tissue samples and cell lines. miR-124 expression was measured by real-time qRT-PCR. A , relative expression level of miR-124 in glioma samples and non-tumor brain tissues. B , miR-124 expression in seven glioma cell

    Journal: The Journal of Biological Chemistry

    Article Title: Loss of Brain-enriched miR-124 MicroRNA Enhances Stem-like Traits and Invasiveness of Glioma Cells

    doi: 10.1074/jbc.M111.332627

    Figure Lengend Snippet: Expression of miR-124 in human glioma tissue samples and cell lines. miR-124 expression was measured by real-time qRT-PCR. A , relative expression level of miR-124 in glioma samples and non-tumor brain tissues. B , miR-124 expression in seven glioma cell

    Article Snippet: The isolated total RNA was polyadenylated and reverse-transcribed for two-step quantitative RT-PCR (qRT-PCR) using the NCodeTM miRNA first-strand synthesis and qRT-PCR kits (Invitrogen) according to the manufacturer's instructions.

    Techniques: Expressing, Quantitative RT-PCR

    SNAI2 is a direct downstream target of miR-124. A , the level of SNAI2 expression in stable U87 and U373 cells with miR-124 overexpression was analyzed by real-time qRT-PCR. NC refers to the non-treated cells. B , RT-PCR and Western blot ( WB ) analyses of

    Journal: The Journal of Biological Chemistry

    Article Title: Loss of Brain-enriched miR-124 MicroRNA Enhances Stem-like Traits and Invasiveness of Glioma Cells

    doi: 10.1074/jbc.M111.332627

    Figure Lengend Snippet: SNAI2 is a direct downstream target of miR-124. A , the level of SNAI2 expression in stable U87 and U373 cells with miR-124 overexpression was analyzed by real-time qRT-PCR. NC refers to the non-treated cells. B , RT-PCR and Western blot ( WB ) analyses of

    Article Snippet: The isolated total RNA was polyadenylated and reverse-transcribed for two-step quantitative RT-PCR (qRT-PCR) using the NCodeTM miRNA first-strand synthesis and qRT-PCR kits (Invitrogen) according to the manufacturer's instructions.

    Techniques: Expressing, Over Expression, Quantitative RT-PCR, Reverse Transcription Polymerase Chain Reaction, Western Blot

    Effect of miR-124 overexpression on glioma cell invasion. A , qRT-PCR analysis of miR-124 levels in U87 and U373 cells stably overexpressing miR-124 or plasmid controls. NC refers to the non-treated cells. B , Matrigel invasion assay. The bar graphs indicate

    Journal: The Journal of Biological Chemistry

    Article Title: Loss of Brain-enriched miR-124 MicroRNA Enhances Stem-like Traits and Invasiveness of Glioma Cells

    doi: 10.1074/jbc.M111.332627

    Figure Lengend Snippet: Effect of miR-124 overexpression on glioma cell invasion. A , qRT-PCR analysis of miR-124 levels in U87 and U373 cells stably overexpressing miR-124 or plasmid controls. NC refers to the non-treated cells. B , Matrigel invasion assay. The bar graphs indicate

    Article Snippet: The isolated total RNA was polyadenylated and reverse-transcribed for two-step quantitative RT-PCR (qRT-PCR) using the NCodeTM miRNA first-strand synthesis and qRT-PCR kits (Invitrogen) according to the manufacturer's instructions.

    Techniques: Over Expression, Quantitative RT-PCR, Stable Transfection, Plasmid Preparation, Invasion Assay

    Figure 3. Expression of VAMP3 in J774.A1 cells treated with siRNA VAMP3. (A) qRT-PCR was performed at 6 h intervals to determine the time lapse in which VAMP3 is inhibited at maximum. Control corresponds to siRNA negative in western blotting.

    Journal: Virulence

    Article Title: Silencing of VAMP3 expression does not affect Brucella melitensis infection in mouse macrophages

    doi: 10.4161/viru.21251

    Figure Lengend Snippet: Figure 3. Expression of VAMP3 in J774.A1 cells treated with siRNA VAMP3. (A) qRT-PCR was performed at 6 h intervals to determine the time lapse in which VAMP3 is inhibited at maximum. Control corresponds to siRNA negative in western blotting.

    Article Snippet: Quantitative real-time PCR (qRT-PCR) was performed with the Two-Step qRT-PCR kit (Invitrogen) according to the manufacturer’s instructions using total RNA extracted from infected or LPS-treated cells with Trizol (Invitrogen), according to company’s protocol.

    Techniques: Expressing, Quantitative RT-PCR, Western Blot

    THAP10 is down‐regulated in t(8;21) AML and correlates with adverse clinical outcome Relative qRT–PCR quantification of THAP10 mRNA levels in the indicated leukaemia cell lines (A) and mononuclear cells (MNC) isolated from leukaemia patients (B) ( n = 28). Sequential analyses of THAP10 mRNA levels in mononuclear cells isolated from bone marrow samples of four individual leukaemia patients at different stages of disease, including newly diagnosed, remission and relapse. Comparison of THAP10 mRNA levels in two categories of AML M2 subtype patients (total n = 124): AML1‐ETO + ( n = 76) and AML1‐ETO − ( n = 48) t(8;21) AML, P = 0.001. Data are represented as a boxplot, which shows the median value of mRNA levels (line in the middle of the box), the first and the third quartiles (lower and upper limits of each box, respectively). Wiskers display the highest and lowest data values. Correlations in gene expression between THAP10 and AML1‐ETO ( R = −0.288, P = 0.000, E) or c‐KIT ( R = −0.512, P = 0.000, F), the two‐sided paired Pearson test was used for the significance of association. Correlations of THAP10 expression (high, n = 56; low, n = 20) with overall survival ( P = 0.001, G), event‐free survival ( P = 0.046, H) and relapse‐free survival ( P = 0.039, I). The cut‐off value (dash line) is 2 × 10 1 of THAP10 level, by which high vs. low THAP10 mRNA expression is defined, the log‐rank test was used for the survival analysis. Data information: Data are expressed as the mean ± SEM. Source data are available online for this figure.

    Journal: EMBO Molecular Medicine

    Article Title: A novel epigenetic AML1‐ETO/THAP10/miR‐383 mini‐circuitry contributes to t(8;21) leukaemogenesis

    doi: 10.15252/emmm.201607180

    Figure Lengend Snippet: THAP10 is down‐regulated in t(8;21) AML and correlates with adverse clinical outcome Relative qRT–PCR quantification of THAP10 mRNA levels in the indicated leukaemia cell lines (A) and mononuclear cells (MNC) isolated from leukaemia patients (B) ( n = 28). Sequential analyses of THAP10 mRNA levels in mononuclear cells isolated from bone marrow samples of four individual leukaemia patients at different stages of disease, including newly diagnosed, remission and relapse. Comparison of THAP10 mRNA levels in two categories of AML M2 subtype patients (total n = 124): AML1‐ETO + ( n = 76) and AML1‐ETO − ( n = 48) t(8;21) AML, P = 0.001. Data are represented as a boxplot, which shows the median value of mRNA levels (line in the middle of the box), the first and the third quartiles (lower and upper limits of each box, respectively). Wiskers display the highest and lowest data values. Correlations in gene expression between THAP10 and AML1‐ETO ( R = −0.288, P = 0.000, E) or c‐KIT ( R = −0.512, P = 0.000, F), the two‐sided paired Pearson test was used for the significance of association. Correlations of THAP10 expression (high, n = 56; low, n = 20) with overall survival ( P = 0.001, G), event‐free survival ( P = 0.046, H) and relapse‐free survival ( P = 0.039, I). The cut‐off value (dash line) is 2 × 10 1 of THAP10 level, by which high vs. low THAP10 mRNA expression is defined, the log‐rank test was used for the survival analysis. Data information: Data are expressed as the mean ± SEM. Source data are available online for this figure.

    Article Snippet: The relative quantity of THAP10 mRNA was measured using 200 ng of total RNA by qRT–PCR with qRT‐PCR Detection Kit (Ambion, Applied Biosystems, Milan) and the ABI PRISM 7500 Sequence Detection System (Applied Biosystems).

    Techniques: Quantitative RT-PCR, Isolation, Expressing

    miR‐383 negatively correlates with THAP10 levels but positively correlates with AML1‐ETO The sequences indicating the putative interaction site between the miR‐383 seed region (nucleotides 2–8) and the 3′‐UTRs of THAP10 wild‐type (WT) or mutated derivatives. Western blot analysis monitoring the effect of synthetic miR‐383 on THAP10 protein levels. Relative qRT–PCR quantification of THAP10 mRNA levels in the indicated leukaemia cell lines (C) and mononuclear cells (MNC) isolated from leukaemia patients (D) ( n = 28). Triplicate values are defined as mean ± SD. Sequential analyses of miR‐383 levels in mononuclear cells isolated from bone marrow samples of four individual leukaemia patients at the newly diagnosed, remission and relapse stages, respectively. Triplicate values are defined as mean ± SD. Relative qRT–PCR quantification of THAP10 mRNA levels in two groups of AML M2 subtype patients (total n = 124): AML1‐ETO + and AML1‐ETO − t(8;21) AML ( P = 0.001). Data are represented as a boxplot, which shows the median value of mRNA levels (line in the middle of the box), the first and third quartiles (lower and upper limits of each box, respectively). Whiskers display the highest and lowest data values. Correlation of miR‐383 expression with THAP10 ( R = −0.689, P = 0.001, G) or AML1‐ETO levels ( R = 0.346, P = 0.002, H). Two‐sided paired Pearson test was used for the significance of association. Data information: All experiments were performed in triplicate. Source data are available online for this figure.

    Journal: EMBO Molecular Medicine

    Article Title: A novel epigenetic AML1‐ETO/THAP10/miR‐383 mini‐circuitry contributes to t(8;21) leukaemogenesis

    doi: 10.15252/emmm.201607180

    Figure Lengend Snippet: miR‐383 negatively correlates with THAP10 levels but positively correlates with AML1‐ETO The sequences indicating the putative interaction site between the miR‐383 seed region (nucleotides 2–8) and the 3′‐UTRs of THAP10 wild‐type (WT) or mutated derivatives. Western blot analysis monitoring the effect of synthetic miR‐383 on THAP10 protein levels. Relative qRT–PCR quantification of THAP10 mRNA levels in the indicated leukaemia cell lines (C) and mononuclear cells (MNC) isolated from leukaemia patients (D) ( n = 28). Triplicate values are defined as mean ± SD. Sequential analyses of miR‐383 levels in mononuclear cells isolated from bone marrow samples of four individual leukaemia patients at the newly diagnosed, remission and relapse stages, respectively. Triplicate values are defined as mean ± SD. Relative qRT–PCR quantification of THAP10 mRNA levels in two groups of AML M2 subtype patients (total n = 124): AML1‐ETO + and AML1‐ETO − t(8;21) AML ( P = 0.001). Data are represented as a boxplot, which shows the median value of mRNA levels (line in the middle of the box), the first and third quartiles (lower and upper limits of each box, respectively). Whiskers display the highest and lowest data values. Correlation of miR‐383 expression with THAP10 ( R = −0.689, P = 0.001, G) or AML1‐ETO levels ( R = 0.346, P = 0.002, H). Two‐sided paired Pearson test was used for the significance of association. Data information: All experiments were performed in triplicate. Source data are available online for this figure.

    Article Snippet: The relative quantity of THAP10 mRNA was measured using 200 ng of total RNA by qRT–PCR with qRT‐PCR Detection Kit (Ambion, Applied Biosystems, Milan) and the ABI PRISM 7500 Sequence Detection System (Applied Biosystems).

    Techniques: Western Blot, Quantitative RT-PCR, Isolation, Expressing

    AML1‐ETO epigenetically activates expression of miR‐383 Upper panel: Schematic diagrams of the AML1‐ and p300‐binding sites and the CpG islands along the pre‐miR‐383 genes. Numbers indicate the nucleotides relative to pre‐miR‐383 (+1 nt). Vertical arrowheads indicate AML1 (dark) and p300 (grey) binding sites; horizontal arrows indicate the location of the primers used for the ChIP assays; vertical lines indicate CpG dinucleotides. Lower panels: A series of constructs containing different AML1‐binding sites and their mutants. Luciferase reporter activities of human 293T cells transiently co‐transfected for 48 h with luciferase reporter constructs containing the wild‐type sequence of the miR‐383 regulatory regions or its mutant counterparts, together with increasing amounts of pcDNA3.0 containing AML1‐ETO or mock cDNA (293T‐Mock). Triplicate values are defined as mean ± SD. ChIP using the indicated antibodies or IgG, after which qRT–PCR was performed to evaluate the specificity of protein binding. Triplicate values are defined as mean ± SD. ChIP using Ac‐histone H3 antibody or IgG, after which qRT–PCR was performed for amplification of the region in miR‐383 containing the predicted AML1‐binding site in the upstream region of miR‐383 with the predicted p300‐binding site, to evaluate the specificity of protein binding. Triplicate values are defined as mean ± SD. Kasumi‐1 cells were treated with C646 (10 or 20 μM) for 24 h, after which acetylation of histone H3 was analysed by immunoprecipitation (IP) and Western blot. qRT–PCR quantification of miR‐383 and THAP10 mRNA levels in the Kasumi‐1 cells treated with or without C646 (10 μM) for 24 h. The results represent the mean of three independent evaluations ± SD (* P = 0.0001, # P = 0.002). Student's t ‐test was used for the comparisons. Data information: All experiments were performed in triplicate. Source data are available online for this figure.

    Journal: EMBO Molecular Medicine

    Article Title: A novel epigenetic AML1‐ETO/THAP10/miR‐383 mini‐circuitry contributes to t(8;21) leukaemogenesis

    doi: 10.15252/emmm.201607180

    Figure Lengend Snippet: AML1‐ETO epigenetically activates expression of miR‐383 Upper panel: Schematic diagrams of the AML1‐ and p300‐binding sites and the CpG islands along the pre‐miR‐383 genes. Numbers indicate the nucleotides relative to pre‐miR‐383 (+1 nt). Vertical arrowheads indicate AML1 (dark) and p300 (grey) binding sites; horizontal arrows indicate the location of the primers used for the ChIP assays; vertical lines indicate CpG dinucleotides. Lower panels: A series of constructs containing different AML1‐binding sites and their mutants. Luciferase reporter activities of human 293T cells transiently co‐transfected for 48 h with luciferase reporter constructs containing the wild‐type sequence of the miR‐383 regulatory regions or its mutant counterparts, together with increasing amounts of pcDNA3.0 containing AML1‐ETO or mock cDNA (293T‐Mock). Triplicate values are defined as mean ± SD. ChIP using the indicated antibodies or IgG, after which qRT–PCR was performed to evaluate the specificity of protein binding. Triplicate values are defined as mean ± SD. ChIP using Ac‐histone H3 antibody or IgG, after which qRT–PCR was performed for amplification of the region in miR‐383 containing the predicted AML1‐binding site in the upstream region of miR‐383 with the predicted p300‐binding site, to evaluate the specificity of protein binding. Triplicate values are defined as mean ± SD. Kasumi‐1 cells were treated with C646 (10 or 20 μM) for 24 h, after which acetylation of histone H3 was analysed by immunoprecipitation (IP) and Western blot. qRT–PCR quantification of miR‐383 and THAP10 mRNA levels in the Kasumi‐1 cells treated with or without C646 (10 μM) for 24 h. The results represent the mean of three independent evaluations ± SD (* P = 0.0001, # P = 0.002). Student's t ‐test was used for the comparisons. Data information: All experiments were performed in triplicate. Source data are available online for this figure.

    Article Snippet: The relative quantity of THAP10 mRNA was measured using 200 ng of total RNA by qRT–PCR with qRT‐PCR Detection Kit (Ambion, Applied Biosystems, Milan) and the ABI PRISM 7500 Sequence Detection System (Applied Biosystems).

    Techniques: Expressing, Binding Assay, Chromatin Immunoprecipitation, Construct, Luciferase, Transfection, Sequencing, Mutagenesis, Quantitative RT-PCR, Protein Binding, Amplification, Immunoprecipitation, Western Blot

    AML1‐ETO epigenetically suppresses THAP10 via direct binding to its promoter region Upper panel: Relative quantification of THAP10 mRNA levels in the indicated leukaemia cell lines. The results represent the mean of three independent evaluations ± SD (* P = 0.001, # P = 0.0007, Student's t ‐test was used for the comparisons). Middle and lower panels: mRNA and protein levels of THAP10 and AML1‐ETO , respectively. Upper panel: Schematic diagrams of the AML1‐binding sites and the CpG islands along the THAP10 genes. Numbers indicate the nucleotides relative to pre‐THAP10 (−1 nt). Vertical arrowheads indicate the AML1‐binding sites; vertical lines indicate CpG dinucleotides; horizontal bar illustrates the regions analysed by bisulphite sequencing. Lower panels: A series of constructs containing different AML1‐binding sites and their mutants. Luciferase reporter activities of human 293T cells transiently co‐transfected for 48 h with luciferase reporters containing the wild‐type sequence of the THAP10 promoter or its mutant counterparts, together with increasing amounts of pcDNA3.0 vectors containing AML1‐ETO or mock cDNA (293T‐Mock). Triplicate values are defined as mean ± SD. Chromatin immunoprecipitation (ChIP) using the indicated antibodies or IgG, after which qRT–PCR was performed to evaluate the specificity of protein binding. Triplicate values are defined as mean ± SD. Genomic bisulphite sequencing to detect the methylation status of the DNA sequences surrounding the AML1‐binding site (−280 nt) in the pre‐THAP10 gene upstream region in CD34 + haematopoietic progenitors isolated from peripheral blood (PB) of healthy donors, the indicated leukaemia cell lines and primary leukaemic blasts. Each row of circles represents the sequence of an individual clone. Solid and empty circles represent methylated and unmethylated CpG dinucleotides, respectively. Data information: All experiments were performed in triplicate. Source data are available online for this figure.

    Journal: EMBO Molecular Medicine

    Article Title: A novel epigenetic AML1‐ETO/THAP10/miR‐383 mini‐circuitry contributes to t(8;21) leukaemogenesis

    doi: 10.15252/emmm.201607180

    Figure Lengend Snippet: AML1‐ETO epigenetically suppresses THAP10 via direct binding to its promoter region Upper panel: Relative quantification of THAP10 mRNA levels in the indicated leukaemia cell lines. The results represent the mean of three independent evaluations ± SD (* P = 0.001, # P = 0.0007, Student's t ‐test was used for the comparisons). Middle and lower panels: mRNA and protein levels of THAP10 and AML1‐ETO , respectively. Upper panel: Schematic diagrams of the AML1‐binding sites and the CpG islands along the THAP10 genes. Numbers indicate the nucleotides relative to pre‐THAP10 (−1 nt). Vertical arrowheads indicate the AML1‐binding sites; vertical lines indicate CpG dinucleotides; horizontal bar illustrates the regions analysed by bisulphite sequencing. Lower panels: A series of constructs containing different AML1‐binding sites and their mutants. Luciferase reporter activities of human 293T cells transiently co‐transfected for 48 h with luciferase reporters containing the wild‐type sequence of the THAP10 promoter or its mutant counterparts, together with increasing amounts of pcDNA3.0 vectors containing AML1‐ETO or mock cDNA (293T‐Mock). Triplicate values are defined as mean ± SD. Chromatin immunoprecipitation (ChIP) using the indicated antibodies or IgG, after which qRT–PCR was performed to evaluate the specificity of protein binding. Triplicate values are defined as mean ± SD. Genomic bisulphite sequencing to detect the methylation status of the DNA sequences surrounding the AML1‐binding site (−280 nt) in the pre‐THAP10 gene upstream region in CD34 + haematopoietic progenitors isolated from peripheral blood (PB) of healthy donors, the indicated leukaemia cell lines and primary leukaemic blasts. Each row of circles represents the sequence of an individual clone. Solid and empty circles represent methylated and unmethylated CpG dinucleotides, respectively. Data information: All experiments were performed in triplicate. Source data are available online for this figure.

    Article Snippet: The relative quantity of THAP10 mRNA was measured using 200 ng of total RNA by qRT–PCR with qRT‐PCR Detection Kit (Ambion, Applied Biosystems, Milan) and the ABI PRISM 7500 Sequence Detection System (Applied Biosystems).

    Techniques: Binding Assay, Bisulfite Sequencing, Construct, Luciferase, Transfection, Sequencing, Mutagenesis, Chromatin Immunoprecipitation, Quantitative RT-PCR, Protein Binding, Methylation, Isolation

    Epigenetically down‐regulated THAP 10 can be reactivated by DNMT inhibitors and HDAC inhibitors Upper panel: Relative quantification of THAP10 levels in U937 (Mock and A/E‐HA) cells. The results represent the average of three independent evaluations ± SD (* P = 0.038, # P = 0.008, two‐sided Student's t ‐test was used for the comparisons). Middle panels: RNA levels of THAP10 analysed by agarose electrophoresis. GAPDH was used as a loading control. Lower panels: Protein levels of THAP10 and AML1‐ETO monitored by immunoblot analysis. β‐actin was used as a loading control. Treatment for 16 h with 100 μM Zn 2+ was employed to induce the expression of AML1‐ETO . Human 293T cells were transiently co‐transfected for 48 h with luciferase reporter containing wild‐type sequences of the THAP10 promoter regions, together with increasing amounts (10, 50 and 100 ng) of pcDNA3.0 with AML1‐ETO cDNA or without (293T‐Mock). Data represent the mean of three independent evaluations ± SD for luciferase activity relative to the empty vector (pGL3‐LUC) control. pRL‐TK was used as an internal control. Chromatin immunoprecipitation (ChIP) using the indicated antibodies or IgG in AML blasts, after which qRT–PCR was performed to evaluate the specificity of protein binding. Triplicate values are defined as mean ± SD. SKNO‐1 and Kasumi‐1 cells were treated with the DNMT inhibitor 5‐azacytidine (5‐Aza, 2.5 μM) +/− the HDAC inhibitor TSA (3.0 μM) for 40 h, after which RT–PCR was performed to detect the mRNA levels of THAP10 . Data represent the normalized values (mean ± SD) of relative THAP10 expression from three independent experiments. Normalized THAP10 level in SKNO‐1 cells was arbitrarily set to 1. AML‐ETO + patient blasts were treated with the DNMT inhibitor decitabine (Dac, 2.5 μM) +/− the HDAC inhibitor chidamide (Chi, 3.0 μM) for 40 h, after which RT–PCR was performed to detect the mRNA levels of THAP10. Data represent the normalized values (mean ± SD) of relative THAP10 expression from three independent experiments. Normalized THAP10 level in SKNO‐1 cells was arbitrarily set to 1. In primary blasts from clinical trial (NCT02886559) patients, qRT–PCR detected the THAP10 levels right after completion of the first therapeutic program. Normalized THAP10 level in patient blasts was arbitrarily set to 1. Triplicate values are defined as mean ± SD.

    Journal: EMBO Molecular Medicine

    Article Title: A novel epigenetic AML1‐ETO/THAP10/miR‐383 mini‐circuitry contributes to t(8;21) leukaemogenesis

    doi: 10.15252/emmm.201607180

    Figure Lengend Snippet: Epigenetically down‐regulated THAP 10 can be reactivated by DNMT inhibitors and HDAC inhibitors Upper panel: Relative quantification of THAP10 levels in U937 (Mock and A/E‐HA) cells. The results represent the average of three independent evaluations ± SD (* P = 0.038, # P = 0.008, two‐sided Student's t ‐test was used for the comparisons). Middle panels: RNA levels of THAP10 analysed by agarose electrophoresis. GAPDH was used as a loading control. Lower panels: Protein levels of THAP10 and AML1‐ETO monitored by immunoblot analysis. β‐actin was used as a loading control. Treatment for 16 h with 100 μM Zn 2+ was employed to induce the expression of AML1‐ETO . Human 293T cells were transiently co‐transfected for 48 h with luciferase reporter containing wild‐type sequences of the THAP10 promoter regions, together with increasing amounts (10, 50 and 100 ng) of pcDNA3.0 with AML1‐ETO cDNA or without (293T‐Mock). Data represent the mean of three independent evaluations ± SD for luciferase activity relative to the empty vector (pGL3‐LUC) control. pRL‐TK was used as an internal control. Chromatin immunoprecipitation (ChIP) using the indicated antibodies or IgG in AML blasts, after which qRT–PCR was performed to evaluate the specificity of protein binding. Triplicate values are defined as mean ± SD. SKNO‐1 and Kasumi‐1 cells were treated with the DNMT inhibitor 5‐azacytidine (5‐Aza, 2.5 μM) +/− the HDAC inhibitor TSA (3.0 μM) for 40 h, after which RT–PCR was performed to detect the mRNA levels of THAP10 . Data represent the normalized values (mean ± SD) of relative THAP10 expression from three independent experiments. Normalized THAP10 level in SKNO‐1 cells was arbitrarily set to 1. AML‐ETO + patient blasts were treated with the DNMT inhibitor decitabine (Dac, 2.5 μM) +/− the HDAC inhibitor chidamide (Chi, 3.0 μM) for 40 h, after which RT–PCR was performed to detect the mRNA levels of THAP10. Data represent the normalized values (mean ± SD) of relative THAP10 expression from three independent experiments. Normalized THAP10 level in SKNO‐1 cells was arbitrarily set to 1. In primary blasts from clinical trial (NCT02886559) patients, qRT–PCR detected the THAP10 levels right after completion of the first therapeutic program. Normalized THAP10 level in patient blasts was arbitrarily set to 1. Triplicate values are defined as mean ± SD.

    Article Snippet: The relative quantity of THAP10 mRNA was measured using 200 ng of total RNA by qRT–PCR with qRT‐PCR Detection Kit (Ambion, Applied Biosystems, Milan) and the ABI PRISM 7500 Sequence Detection System (Applied Biosystems).

    Techniques: Electrophoresis, Expressing, Transfection, Luciferase, Activity Assay, Plasmid Preparation, Chromatin Immunoprecipitation, Quantitative RT-PCR, Protein Binding, Reverse Transcription Polymerase Chain Reaction

    Effect of miR-143 on apoptosis and autophagy of CPCs under normal conditions. (a) qRT-PCR analysis for the expression of miRNAs in CPCs after treatment with or without H 2 O 2 for 24 h in serum-free media. n ≥ 3, **p

    Journal: EBioMedicine

    Article Title: By Targeting Atg7 MicroRNA-143 Mediates Oxidative Stress-Induced Autophagy of c-Kit+ Mouse Cardiac Progenitor Cells

    doi: 10.1016/j.ebiom.2018.05.021

    Figure Lengend Snippet: Effect of miR-143 on apoptosis and autophagy of CPCs under normal conditions. (a) qRT-PCR analysis for the expression of miRNAs in CPCs after treatment with or without H 2 O 2 for 24 h in serum-free media. n ≥ 3, **p

    Article Snippet: PCR was performed using GreenER Two-Step qRT-PCR Kit Universal (Invitrogen).

    Techniques: Quantitative RT-PCR, Expressing

    Effects of resveratrol (80 μM) or ONX-0914 (0.25 μM) on proteasome subunits gene expression using CD14 + human blood monocytes. CD14 + monocytes (2×10 6 cells/well) were treated for Vehicle, LPS, Res, Res+LPS, ONX and ONX+LPS conditions, as described in the methods section. Gene expression of proteasome subunits PSMB5 (X), PSMB6 (Y), PSMB7 (Z), PSMB8 (LMP7), PSMB9 (LMP2) and PSMB10 (LMP10) were analyzed by qRT-PCR. Data are shown as means ±SE (n=3). *Statistically significant difference of LPS treatment vs veh, Res, Res+LPS, ONX and ONX+LPS (p≤ 0.05).

    Journal: Shock (Augusta, Ga.)

    Article Title: RESVERATROL DOWNREGULATES BIOMARKERS OF SEPSIS VIA INHIBITION OF PROTEASOME’S PROTEASES

    doi: 10.1097/SHK.0000000000001080

    Figure Lengend Snippet: Effects of resveratrol (80 μM) or ONX-0914 (0.25 μM) on proteasome subunits gene expression using CD14 + human blood monocytes. CD14 + monocytes (2×10 6 cells/well) were treated for Vehicle, LPS, Res, Res+LPS, ONX and ONX+LPS conditions, as described in the methods section. Gene expression of proteasome subunits PSMB5 (X), PSMB6 (Y), PSMB7 (Z), PSMB8 (LMP7), PSMB9 (LMP2) and PSMB10 (LMP10) were analyzed by qRT-PCR. Data are shown as means ±SE (n=3). *Statistically significant difference of LPS treatment vs veh, Res, Res+LPS, ONX and ONX+LPS (p≤ 0.05).

    Article Snippet: Primers-probes and One-Step qRT-PCR kit were obtained from Life Technologies (Foster City, California).

    Techniques: Expressing, Quantitative RT-PCR

    Effect of resveratrol (80 μM) or ONX-0914 (0.25 μM) on autophagy related genes expression using CD14 + human blood monocytes. After drug treatments, as described in the methods section, gene expression of atg5, atg7, beclin1, eIF2α, p53 and hdac6 were analyzed by qRT-PCR. Data are shown as means ±SE (n=3). *Statistically significant difference of LPS treatment vs veh, Res, Res+LPS, ONX and ONX+LPS (p≤ 0.05).

    Journal: Shock (Augusta, Ga.)

    Article Title: RESVERATROL DOWNREGULATES BIOMARKERS OF SEPSIS VIA INHIBITION OF PROTEASOME’S PROTEASES

    doi: 10.1097/SHK.0000000000001080

    Figure Lengend Snippet: Effect of resveratrol (80 μM) or ONX-0914 (0.25 μM) on autophagy related genes expression using CD14 + human blood monocytes. After drug treatments, as described in the methods section, gene expression of atg5, atg7, beclin1, eIF2α, p53 and hdac6 were analyzed by qRT-PCR. Data are shown as means ±SE (n=3). *Statistically significant difference of LPS treatment vs veh, Res, Res+LPS, ONX and ONX+LPS (p≤ 0.05).

    Article Snippet: Primers-probes and One-Step qRT-PCR kit were obtained from Life Technologies (Foster City, California).

    Techniques: Expressing, Quantitative RT-PCR

    Effect of resveratrol (80 μM) or ONX-0914 (0.25 μM) on adhesion molecule and cytokines gene expression using CD14 + human blood monocytes. CD14 + monocytes (2×10 6 cells/well) were treated for Vehicle, LPS, Res, Res+LPS, ONX and ONX+LPS conditions, as described in the methods section. Gene expression of ICAM1 , Sirt1 , TNF-α, RETN , IL-8 and IFNγ were analyzed by qRT-PCR. Data are shown as means ±SE (n=3). *Statistically significant difference of LPS treatment vs veh, Res, Res+LPS, ONX and ONX+LPS (p≤ 0.05).

    Journal: Shock (Augusta, Ga.)

    Article Title: RESVERATROL DOWNREGULATES BIOMARKERS OF SEPSIS VIA INHIBITION OF PROTEASOME’S PROTEASES

    doi: 10.1097/SHK.0000000000001080

    Figure Lengend Snippet: Effect of resveratrol (80 μM) or ONX-0914 (0.25 μM) on adhesion molecule and cytokines gene expression using CD14 + human blood monocytes. CD14 + monocytes (2×10 6 cells/well) were treated for Vehicle, LPS, Res, Res+LPS, ONX and ONX+LPS conditions, as described in the methods section. Gene expression of ICAM1 , Sirt1 , TNF-α, RETN , IL-8 and IFNγ were analyzed by qRT-PCR. Data are shown as means ±SE (n=3). *Statistically significant difference of LPS treatment vs veh, Res, Res+LPS, ONX and ONX+LPS (p≤ 0.05).

    Article Snippet: Primers-probes and One-Step qRT-PCR kit were obtained from Life Technologies (Foster City, California).

    Techniques: Expressing, Quantitative RT-PCR

    Short-chain fatty acid transporter and anion exchanger expression in the proximal colon. Mice were treated as described in Figure 1 . Proximal colon was collected and whole tissue was flash frozen for immunoblotting, fixed in formalin and paraffin embedded for histology, or RNA was prepared and used for qRT-PCR analysis. ( A ) SLC5A8 (green) was visualized by immunohistochemistry and ( B ) immunoblot of SLC5A8 using HSC70 as internal control; ( C ) MCT1 (green) was visualized by immunohistochemistry and ( D ) immunoblot of MCT1 using HSC70 as internal control; ( E ) NHE3 (green) was visualized by immunohistochemistry; ( F ) NHE3 mRNA expressed in proximal colon presented as fold change. A selected area was cropped and enlarged. All images were acquired using a 20× objective. Images are representative of at least replicate images captured per mouse in 8 to 12 mice per treatment group. Band densities were analyzed using ImageJ software and normalized to HSC70. Values represent means ± SEM. * p

    Journal: Nutrients

    Article Title: A Designer Synbiotic Attenuates Chronic-Binge Ethanol-Induced Gut-Liver Injury in Mice

    doi: 10.3390/nu11010097

    Figure Lengend Snippet: Short-chain fatty acid transporter and anion exchanger expression in the proximal colon. Mice were treated as described in Figure 1 . Proximal colon was collected and whole tissue was flash frozen for immunoblotting, fixed in formalin and paraffin embedded for histology, or RNA was prepared and used for qRT-PCR analysis. ( A ) SLC5A8 (green) was visualized by immunohistochemistry and ( B ) immunoblot of SLC5A8 using HSC70 as internal control; ( C ) MCT1 (green) was visualized by immunohistochemistry and ( D ) immunoblot of MCT1 using HSC70 as internal control; ( E ) NHE3 (green) was visualized by immunohistochemistry; ( F ) NHE3 mRNA expressed in proximal colon presented as fold change. A selected area was cropped and enlarged. All images were acquired using a 20× objective. Images are representative of at least replicate images captured per mouse in 8 to 12 mice per treatment group. Band densities were analyzed using ImageJ software and normalized to HSC70. Values represent means ± SEM. * p

    Article Snippet: A QuantStudio 5 analyzer (Applied Biosystems, Foster City, CA, USA) was used to perform real-time PCR amplification with PowerSYBR qRT-PCR kits (Applied Biosystems) for primers: sodium-hydrogen exchanger-3 (NHE3; FWD: CACCTTCAAATGGCACCACG/REV: TGTGGGACAGGTGAAAGACG) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH: FWD: AGGTCGGTGTGAACGGATTTG/REV: TGTAGACCATGTAGTTGAGGTCA).

    Techniques: Expressing, Mouse Assay, Quantitative RT-PCR, Immunohistochemistry, Software

    VD could also function directly on T cells to shape T cell responses. CD4 + CD62L + cells from C57BL/6J or C57BL6 Foxp3 gfp reporter mice were cultured in the Th0 or Th17-polarizing conditions with immobilized anti-CD3 and soluble anti-CD28 instead of APCs, in the presence or absence of 1uM VD. (A,B) qRT-PCR results showed VDR and CYP24 mRNA relative expression on CD4 + T cells stimulated in Th0 or Th17 conditions without APCs for 24 h in CTRL (without VD) and VD groups. Data are presented as the mean ± SEM. * P

    Journal: Frontiers in Immunology

    Article Title: 1,25-Dihydroxyvitamin D3 Ameliorates Collagen-Induced Arthritis via Suppression of Th17 Cells Through miR-124 Mediated Inhibition of IL-6 Signaling

    doi: 10.3389/fimmu.2019.00178

    Figure Lengend Snippet: VD could also function directly on T cells to shape T cell responses. CD4 + CD62L + cells from C57BL/6J or C57BL6 Foxp3 gfp reporter mice were cultured in the Th0 or Th17-polarizing conditions with immobilized anti-CD3 and soluble anti-CD28 instead of APCs, in the presence or absence of 1uM VD. (A,B) qRT-PCR results showed VDR and CYP24 mRNA relative expression on CD4 + T cells stimulated in Th0 or Th17 conditions without APCs for 24 h in CTRL (without VD) and VD groups. Data are presented as the mean ± SEM. * P

    Article Snippet: Quantitative PCR was performed using 2 ug total RNA and the qRT-PCR SYBR Kit (Applied Biosystems).

    Techniques: Mouse Assay, Cell Culture, Quantitative RT-PCR, Expressing

    VD restrained Th17 cells differentiation through miR-124 mediated inhibition of IL-6 signaling. CD4 + CD62L + cells from C57BL/6J were cultured in the Th17-polarizing conditions with immobilized anti-CD3 and soluble anti-CD28 with or without VD. In some experiments, naïve CD4 + T cells were transduced with 10 nM miR-124 inhibitor for 24 h using Lipofectamine® 3000 before polarized into Th17 cells. (A) qRT-PCR showed that VD upregulates miR-124 expression in Th17 cells (72 h). (B–D) naïve CD4 + T cells were transduced with miR-124 inhibitor (i) or inhibitor control (iNC) before Th17-polarization using immobilized anti-CD3 or APCs system and flow cytometry was used to confirm IL-17 expression at protein level. Data are presented as the mean ± SEM ( n = 4). (E,F) naïve CD4 + T cells were transduced with miR-124 inhibitor (+) or inhibitor control (–) before Th17-polarization using immobilized anti-CD3. CD126 expression and (p)-STAT3 activity were checked by western blots. Data are presented as the mean ± SEM. NS means no significance, * P

    Journal: Frontiers in Immunology

    Article Title: 1,25-Dihydroxyvitamin D3 Ameliorates Collagen-Induced Arthritis via Suppression of Th17 Cells Through miR-124 Mediated Inhibition of IL-6 Signaling

    doi: 10.3389/fimmu.2019.00178

    Figure Lengend Snippet: VD restrained Th17 cells differentiation through miR-124 mediated inhibition of IL-6 signaling. CD4 + CD62L + cells from C57BL/6J were cultured in the Th17-polarizing conditions with immobilized anti-CD3 and soluble anti-CD28 with or without VD. In some experiments, naïve CD4 + T cells were transduced with 10 nM miR-124 inhibitor for 24 h using Lipofectamine® 3000 before polarized into Th17 cells. (A) qRT-PCR showed that VD upregulates miR-124 expression in Th17 cells (72 h). (B–D) naïve CD4 + T cells were transduced with miR-124 inhibitor (i) or inhibitor control (iNC) before Th17-polarization using immobilized anti-CD3 or APCs system and flow cytometry was used to confirm IL-17 expression at protein level. Data are presented as the mean ± SEM ( n = 4). (E,F) naïve CD4 + T cells were transduced with miR-124 inhibitor (+) or inhibitor control (–) before Th17-polarization using immobilized anti-CD3. CD126 expression and (p)-STAT3 activity were checked by western blots. Data are presented as the mean ± SEM. NS means no significance, * P

    Article Snippet: Quantitative PCR was performed using 2 ug total RNA and the qRT-PCR SYBR Kit (Applied Biosystems).

    Techniques: Inhibition, Cell Culture, Transduction, Quantitative RT-PCR, Expressing, Flow Cytometry, Cytometry, Activity Assay, Western Blot

    MiR-140-5p serves as a target of CAGE. (A) MicroRNA array analysis was performed as described. (B) QRT-PCR analysis of the indicated cancer cells was performed. ** p

    Journal: Frontiers in Oncology

    Article Title: CAGE-miR-140-5p-Wnt1 Axis Regulates Autophagic Flux, Tumorigenic Potential of Mouse Colon Cancer Cells and Cellular Interactions Mediated by Exosomes

    doi: 10.3389/fonc.2019.01240

    Figure Lengend Snippet: MiR-140-5p serves as a target of CAGE. (A) MicroRNA array analysis was performed as described. (B) QRT-PCR analysis of the indicated cancer cells was performed. ** p

    Article Snippet: Expression levels of miR-140-5p was quantified with a SYBR Green qRT-PCR kit (Ambion) using a miRNA-specific forward primer and a universal poly (T) adaptor reverse primer.

    Techniques: Quantitative RT-PCR

    In the Postnatal Suture, PRX1-Expressing Cells Overlap with GLI1-Expressing Cells (A) Comparative evaluation of tdTOMATO expression in 4-week-old Prx1-creER-EGFP +/− ;tdTOMATO +/− and Gli1-creER +/− ;tdTOMATO +/− mice treated with tamoxifen for 5 days (short-pulsing). S, suture space (n = 2 mice). Scale bars, 100 μm. (B) Ex vivo qRT-PCR analysis of Gli1 and Axin2 expression in pnPRX1 + cells (EGFP + ), (EGFP − ), and in pnCOL1 + cells isolated from the sutures (n = 3 independent experiments). Relative expression values ± SD are reported. ∗∗ p

    Journal: Stem Cell Reports

    Article Title: Postnatal Calvarial Skeletal Stem Cells Expressing PRX1 Reside Exclusively in the Calvarial Sutures and Are Required for Bone Regeneration

    doi: 10.1016/j.stemcr.2017.03.002

    Figure Lengend Snippet: In the Postnatal Suture, PRX1-Expressing Cells Overlap with GLI1-Expressing Cells (A) Comparative evaluation of tdTOMATO expression in 4-week-old Prx1-creER-EGFP +/− ;tdTOMATO +/− and Gli1-creER +/− ;tdTOMATO +/− mice treated with tamoxifen for 5 days (short-pulsing). S, suture space (n = 2 mice). Scale bars, 100 μm. (B) Ex vivo qRT-PCR analysis of Gli1 and Axin2 expression in pnPRX1 + cells (EGFP + ), (EGFP − ), and in pnCOL1 + cells isolated from the sutures (n = 3 independent experiments). Relative expression values ± SD are reported. ∗∗ p

    Article Snippet: After 24 hr, EGFP+ cells were isolated from calvarial bones by FACS and qRT-PCR was performed using the Single Cell to CT kit (Thermo Fisher Scientific; cat. #4458237).

    Techniques: Expressing, Mouse Assay, Ex Vivo, Quantitative RT-PCR, Isolation

    Single-cell profiles map cardiogenic gene expression to Sca1 + SP cells co-expressing Pdgfra. ( a ) Left, flow sorting of fresh cardiac Lin − Sca1 + cells after immunomagnetic enrichment for Sca1. Center, further purification of Lin − Sca1 + cells for the SP phenotype by Hoechst 33324 staining±ABC transporter inhibitors: FTC, fumitremorgin C; Res, reserpine; Ver, verapamil. Right, bar graph, mean±s.e.m.; n =4; * P ≤0.0001. ( b ) Single-cell qRT–PCR profiles of fresh total Sca1 + , SP and non-SP cells, compared with cardiomyocytes (CMC). The heatmap illustrates expression as −ΔCt values (blue, low or absent; red, high) and hierarchical clustering reveals the co-expression of functionally related genes in the populations indicated. Highlighted are: yellow, the Sca1 gene Ly6a ; blue, Kdr and Cdh5 , enriched in Sca1 + and non-SP cells; red, cardiogenic transcription factors, enriched in SP cells and CMC; green, Pdgfra and Tcf21 , enriched in SP cells; violet, CMC genes. Sca1 + , n =23; non-SP, n =44; SP, n =43; CMC, n =18. For the full set of 44 genes, see Supplementary Fig. 1 . ( c ) Density plots of expression (−ΔCt) for selected genes in SP (light red) versus non-SP (light blue) cell populations. Genes are ordered according to increasing P -values. Those with a significantly divergent prevalence of expression between SP and non-SP cells are indicated by an asterisk. ( d ) PCA of the single-cell expression profiles. (Top) PC2 (19% variability) separates SP from non-SP sample scores, whereas PC3 (9% variability) establishes a distinct separation between SP/non-SP/Sca1 + cells and CMC. Non-SP and unfractionated Sca1 + cells cluster together in the PC projection. (Bottom) Gene loadings contributing to each PC indicate that a small subset of genes explain the cross-group variability captured by PC2 and PC3. Cdh5 and Kdr are predominantly associated with non-SP and unfractionated Sca1 + cells, while Pdgfra and Tcf21 are correlated with SP cells (as given by PC2). Differences between CMCs and the remaining samples are strongly reflected in PC3, with cardiac structural genes ( Myh6 and Myl2 ) clustered consistently.

    Journal: Nature Communications

    Article Title: PDGFRα demarcates the cardiogenic clonogenic Sca1+ stem/progenitor cell in adult murine myocardium

    doi: 10.1038/ncomms7930

    Figure Lengend Snippet: Single-cell profiles map cardiogenic gene expression to Sca1 + SP cells co-expressing Pdgfra. ( a ) Left, flow sorting of fresh cardiac Lin − Sca1 + cells after immunomagnetic enrichment for Sca1. Center, further purification of Lin − Sca1 + cells for the SP phenotype by Hoechst 33324 staining±ABC transporter inhibitors: FTC, fumitremorgin C; Res, reserpine; Ver, verapamil. Right, bar graph, mean±s.e.m.; n =4; * P ≤0.0001. ( b ) Single-cell qRT–PCR profiles of fresh total Sca1 + , SP and non-SP cells, compared with cardiomyocytes (CMC). The heatmap illustrates expression as −ΔCt values (blue, low or absent; red, high) and hierarchical clustering reveals the co-expression of functionally related genes in the populations indicated. Highlighted are: yellow, the Sca1 gene Ly6a ; blue, Kdr and Cdh5 , enriched in Sca1 + and non-SP cells; red, cardiogenic transcription factors, enriched in SP cells and CMC; green, Pdgfra and Tcf21 , enriched in SP cells; violet, CMC genes. Sca1 + , n =23; non-SP, n =44; SP, n =43; CMC, n =18. For the full set of 44 genes, see Supplementary Fig. 1 . ( c ) Density plots of expression (−ΔCt) for selected genes in SP (light red) versus non-SP (light blue) cell populations. Genes are ordered according to increasing P -values. Those with a significantly divergent prevalence of expression between SP and non-SP cells are indicated by an asterisk. ( d ) PCA of the single-cell expression profiles. (Top) PC2 (19% variability) separates SP from non-SP sample scores, whereas PC3 (9% variability) establishes a distinct separation between SP/non-SP/Sca1 + cells and CMC. Non-SP and unfractionated Sca1 + cells cluster together in the PC projection. (Bottom) Gene loadings contributing to each PC indicate that a small subset of genes explain the cross-group variability captured by PC2 and PC3. Cdh5 and Kdr are predominantly associated with non-SP and unfractionated Sca1 + cells, while Pdgfra and Tcf21 are correlated with SP cells (as given by PC2). Differences between CMCs and the remaining samples are strongly reflected in PC3, with cardiac structural genes ( Myh6 and Myl2 ) clustered consistently.

    Article Snippet: Single-cell qRT–PCR Single cells were sorted directly (FACSAria II) into 96-well plates containing 10 μl of the reaction mixture for pre-amplification, using CellDirect One-Step qRT–PCR Kits (Invitrogen).

    Techniques: Expressing, Flow Cytometry, Purification, Staining, Quantitative RT-PCR

    ROS- and mitochondrial ROS (mROS)-mediated apoptosis signaling in copper-stressed macrophages and neutrophils. ROS red labeling [ (A1–A4) , in red boxes] and relative ROS fluorescence (A5) in macrophages and neutrophils in copper-stressed coro1a -driven GFP transgenic larvae. (B) Schematic view for testing the mROS-mediated apoptosis gene expression in copper-stressed macrophages and neutrophils via cell direct qRT-PCR. (C) Expression of different caspase genes in macrophages and neutrophils from copper-stressed coro1a -driven GFP transgenic larvae before and after A. hydrophila infection. (D) Expression of mROS-mediated apoptotic genes in aforementioned cells. Three biological replicates were performed. ANOVA post-hoc Tukey's test. Data are presented as mean ± SD. *** P

    Journal: Frontiers in Immunology

    Article Title: Copper Regulates the Susceptibility of Zebrafish Larvae to Inflammatory Stimuli by Controlling Neutrophil/Macrophage Survival

    doi: 10.3389/fimmu.2019.02599

    Figure Lengend Snippet: ROS- and mitochondrial ROS (mROS)-mediated apoptosis signaling in copper-stressed macrophages and neutrophils. ROS red labeling [ (A1–A4) , in red boxes] and relative ROS fluorescence (A5) in macrophages and neutrophils in copper-stressed coro1a -driven GFP transgenic larvae. (B) Schematic view for testing the mROS-mediated apoptosis gene expression in copper-stressed macrophages and neutrophils via cell direct qRT-PCR. (C) Expression of different caspase genes in macrophages and neutrophils from copper-stressed coro1a -driven GFP transgenic larvae before and after A. hydrophila infection. (D) Expression of mROS-mediated apoptotic genes in aforementioned cells. Three biological replicates were performed. ANOVA post-hoc Tukey's test. Data are presented as mean ± SD. *** P

    Article Snippet: Finally, the lysed solution was used as template for one step cell direct qRT-PCR using CellsDirect™ One-Step qRT-PCR Kit (Invitrogen) as reported previously ( , ).

    Techniques: Labeling, Fluorescence, Transgenic Assay, Expressing, Quantitative RT-PCR, Infection

    A novel mouse model for inducible interleukin (IL)-10 expression: pMT-10 mice. (A) Schematic representation showing the targeting vector and insertion site. (B) Kinetics of IL-10 overexpression in the serum at different time points post Zn administration and Zn withdrawal. pMT-10 mice were fed with normal (pMT-10-Zn) or Zn-enriched (pMT-10 + Zn) water and at the indicated time points blood was harvested and the amount of IL-10 in serum measured by immunoassay. (C) qRT-PCR identified CD45 − TER119 − cell subsets from skin, bone marrow, and small intestine (SI) as the main producers of IL-10 in pMT-10 mice fed for 8 days with Zn-enriched water. In both (B,C) , each point or bar represents the mean ± SEM for three independent mice. Data were analyzed with (B) two-way analysis of variance (Sidak’s multiple comparisons test) or (C) Student’s t -test, * p

    Journal: Frontiers in Immunology

    Article Title: The Dynamics of Interleukin-10-Afforded Protection during Dextran Sulfate Sodium-Induced Colitis

    doi: 10.3389/fimmu.2018.00400

    Figure Lengend Snippet: A novel mouse model for inducible interleukin (IL)-10 expression: pMT-10 mice. (A) Schematic representation showing the targeting vector and insertion site. (B) Kinetics of IL-10 overexpression in the serum at different time points post Zn administration and Zn withdrawal. pMT-10 mice were fed with normal (pMT-10-Zn) or Zn-enriched (pMT-10 + Zn) water and at the indicated time points blood was harvested and the amount of IL-10 in serum measured by immunoassay. (C) qRT-PCR identified CD45 − TER119 − cell subsets from skin, bone marrow, and small intestine (SI) as the main producers of IL-10 in pMT-10 mice fed for 8 days with Zn-enriched water. In both (B,C) , each point or bar represents the mean ± SEM for three independent mice. Data were analyzed with (B) two-way analysis of variance (Sidak’s multiple comparisons test) or (C) Student’s t -test, * p

    Article Snippet: CD45.2+ CD11b+ Ly6C+ cells were sorted directly into a mix of 9 µl of CellsDirect One-Step qRT-PCR kit (Life Technologies), containing a mixture of diluted primers (0.05× final concentration, see Table S1 in Supplementary Material for references).

    Techniques: Expressing, Mouse Assay, Plasmid Preparation, Over Expression, Quantitative RT-PCR

    Ly6C + cells preexposed to interleukin (IL)-10 reveal a less inflammatory profile upon DSS-induced colitis than those preexposed to Zn. (A) pMT-10 or BL/6 mice were fed with Zn-enriched water for 8 days, followed by 4 days of 3% DSS administration. (B) At the end of the DSS treatment, Lamina propria leukocytes (LPLs) were isolated and Ly6C + cells sort-purified. Shown is the gating strategy for Ly6C + cells purification. (C) Sort-purified Ly6C + cells ( n = 25 cells) were analyzed by qRT-PCR for a total of 22 genes using the BioMark HD system. Samples were normalized for Hprt expression. Represented is the expression heatmap compiling the genes which expression was detected in either mouse group. Each heatmap rectangle represents the mean of gene expression obtained for cells isolated from five independent mice. (D) The frequency of the different leukocyte subsets was determined upon staining of LPLs for Ly6C + cell sorting. Each dot represents one independent animal; represented is also mean ± SEM. Data were analyzed with Student’s t -test, * p

    Journal: Frontiers in Immunology

    Article Title: The Dynamics of Interleukin-10-Afforded Protection during Dextran Sulfate Sodium-Induced Colitis

    doi: 10.3389/fimmu.2018.00400

    Figure Lengend Snippet: Ly6C + cells preexposed to interleukin (IL)-10 reveal a less inflammatory profile upon DSS-induced colitis than those preexposed to Zn. (A) pMT-10 or BL/6 mice were fed with Zn-enriched water for 8 days, followed by 4 days of 3% DSS administration. (B) At the end of the DSS treatment, Lamina propria leukocytes (LPLs) were isolated and Ly6C + cells sort-purified. Shown is the gating strategy for Ly6C + cells purification. (C) Sort-purified Ly6C + cells ( n = 25 cells) were analyzed by qRT-PCR for a total of 22 genes using the BioMark HD system. Samples were normalized for Hprt expression. Represented is the expression heatmap compiling the genes which expression was detected in either mouse group. Each heatmap rectangle represents the mean of gene expression obtained for cells isolated from five independent mice. (D) The frequency of the different leukocyte subsets was determined upon staining of LPLs for Ly6C + cell sorting. Each dot represents one independent animal; represented is also mean ± SEM. Data were analyzed with Student’s t -test, * p

    Article Snippet: CD45.2+ CD11b+ Ly6C+ cells were sorted directly into a mix of 9 µl of CellsDirect One-Step qRT-PCR kit (Life Technologies), containing a mixture of diluted primers (0.05× final concentration, see Table S1 in Supplementary Material for references).

    Techniques: Mouse Assay, Isolation, Purification, Quantitative RT-PCR, Expressing, Staining, FACS