qpcr amplification Thermo Fisher Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher platinum quantitative pcr supermix udg
    Platinum Quantitative Pcr Supermix Udg, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1843 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/platinum quantitative pcr supermix udg/product/Thermo Fisher
    Average 90 stars, based on 1843 article reviews
    Price from $9.99 to $1999.99
    platinum quantitative pcr supermix udg - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher transcription quantitative polymerase chain reaction rt qpcr trizol reagent
    Transcription Quantitative Polymerase Chain Reaction Rt Qpcr Trizol Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 51 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transcription quantitative polymerase chain reaction rt qpcr trizol reagent/product/Thermo Fisher
    Average 99 stars, based on 51 article reviews
    Price from $9.99 to $1999.99
    transcription quantitative polymerase chain reaction rt qpcr trizol reagent - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher quantitative real time polymerase chain reaction qrt pcr
    <t>QRT-PCR</t> for 27-hydroxylase and ABCA1 message in NS398-treated THP-1 cells exposed to prostaglandins. (a) 27-Hydroxylase message is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 1 , E 2 , and D 2 . THP-1 human monocytes were exposed to the following conditions represented by the six bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 1 (0.1 μM) + NS398 (50 μM), (4) PGE 2 (0.1 μM) + NS398 (50 μM), (5) PGE 1 (0.1 μM) + PGE 2 (0.1 μM) + NS398 (50 μM), and (6) PGD 2 (14 μM) + NS398 (50 μM) (all 18-hour exposures). Cells were extracted for total RNA and were evaluated for 27-hydroxylase mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. (b) ABCA1 message is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 1 , E 2 , and D 2 . THP-1 human monocytes were exposed to the following conditions represented by the six bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 1 (0.1 μM) + NS398 (50 μM), (4) PGE 2 (0.1 μM) + NS398 (50 μM), (5) PGE 1 (0.1 μM) + PGE 2 (0.1 μM) + NS398 (50 μM), and (6) PGD 2 (14 μM) + NS398 (50 μM) (all 18-hour exposures). Cells were extracted for total RNA and were evaluated for ABCA1 mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. ** p
    Quantitative Real Time Polymerase Chain Reaction Qrt Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2163 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time polymerase chain reaction qrt pcr/product/Thermo Fisher
    Average 99 stars, based on 2163 article reviews
    Price from $9.99 to $1999.99
    quantitative real time polymerase chain reaction qrt pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    87
    Thermo Fisher taqman quantitative pcr qpcr mix
    Purified basal epithelial cells in the adult gland comprise a lineage-primed subset. a Heatmap showing expression of the top 200 DE basal (blue) and top 200 DE luminal (purple) lineage genes in 145 sorted basal epithelial cells (Lin – CD29 hi CD24 + ) from adult mammary glands that were captured on the Fluidigm C1 platform (red = high expression, blue = low expression) ( n = 4 mice). Mixed-lineage intermediate cells are marked in the box. b Heatmap showing <t>qRT-PCR</t> expression for 96 sorted adult basal cells ( n = 6 mice; 4 independent experiments). <t>Taqman</t> assays for 13 basal and 11 luminal lineage genes were applied using the Fluidigm Biomark multiplexed <t>qPCR</t> platform. The color key shows Ct values from black (Ct > 40, no expression) to yellow (highest expression). Mixed-lineage cells expressing both basal and luminal genes are marked by the orange bar
    Taqman Quantitative Pcr Qpcr Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman quantitative pcr qpcr mix/product/Thermo Fisher
    Average 87 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    taqman quantitative pcr qpcr mix - by Bioz Stars, 2020-02
    87/100 stars
      Buy from Supplier

    99
    Thermo Fisher quantitative reverse transcription polymerase chain reaction qrt pcr trizol reagent
    miR-628 suppressed the mRNA and protein expression of SOS1 . Notes: The breast CSCs of MDA-MB-231 ( A ) and MCF-7 ( B ) cells were transfected with the miR-628 mimic and miR-628 inhibitor, and SOS1 mRNA level was determined by <t>qRT-PCR.</t> ( C ) The breast CSCs of MDA-MB-231 and MCF-7 cells were transfected with miR-628 mimic and miR-628 inhibitor, and SOS1 protein level was analyzed by Western blotting. The protein expression levels were statistically analyzed by quantitating the intensity of the protein bands relative to that of the internal loading control (α-tubulin). Values indicate mean ± SD; * P
    Quantitative Reverse Transcription Polymerase Chain Reaction Qrt Pcr Trizol Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative reverse transcription polymerase chain reaction qrt pcr trizol reagent/product/Thermo Fisher
    Average 99 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    quantitative reverse transcription polymerase chain reaction qrt pcr trizol reagent - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher reverse transcription quantitative polymerase chain reaction rt qpcr analysis trizol reagent
    miR-628 suppressed the mRNA and protein expression of SOS1 . Notes: The breast CSCs of MDA-MB-231 ( A ) and MCF-7 ( B ) cells were transfected with the miR-628 mimic and miR-628 inhibitor, and SOS1 mRNA level was determined by <t>qRT-PCR.</t> ( C ) The breast CSCs of MDA-MB-231 and MCF-7 cells were transfected with miR-628 mimic and miR-628 inhibitor, and SOS1 protein level was analyzed by Western blotting. The protein expression levels were statistically analyzed by quantitating the intensity of the protein bands relative to that of the internal loading control (α-tubulin). Values indicate mean ± SD; * P
    Reverse Transcription Quantitative Polymerase Chain Reaction Rt Qpcr Analysis Trizol Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse transcription quantitative polymerase chain reaction rt qpcr analysis trizol reagent/product/Thermo Fisher
    Average 99 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    reverse transcription quantitative polymerase chain reaction rt qpcr analysis trizol reagent - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher taqman quantitative pcr
    miR-628 suppressed the mRNA and protein expression of SOS1 . Notes: The breast CSCs of MDA-MB-231 ( A ) and MCF-7 ( B ) cells were transfected with the miR-628 mimic and miR-628 inhibitor, and SOS1 mRNA level was determined by <t>qRT-PCR.</t> ( C ) The breast CSCs of MDA-MB-231 and MCF-7 cells were transfected with miR-628 mimic and miR-628 inhibitor, and SOS1 protein level was analyzed by Western blotting. The protein expression levels were statistically analyzed by quantitating the intensity of the protein bands relative to that of the internal loading control (α-tubulin). Values indicate mean ± SD; * P
    Taqman Quantitative Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 608 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman quantitative pcr/product/Thermo Fisher
    Average 99 stars, based on 608 article reviews
    Price from $9.99 to $1999.99
    taqman quantitative pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    89
    Thermo Fisher abi7300 real time fluorescence quantitative polymerase chain reaction qpcr 7300 applied biosystems
    miR-628 suppressed the mRNA and protein expression of SOS1 . Notes: The breast CSCs of MDA-MB-231 ( A ) and MCF-7 ( B ) cells were transfected with the miR-628 mimic and miR-628 inhibitor, and SOS1 mRNA level was determined by <t>qRT-PCR.</t> ( C ) The breast CSCs of MDA-MB-231 and MCF-7 cells were transfected with miR-628 mimic and miR-628 inhibitor, and SOS1 protein level was analyzed by Western blotting. The protein expression levels were statistically analyzed by quantitating the intensity of the protein bands relative to that of the internal loading control (α-tubulin). Values indicate mean ± SD; * P
    Abi7300 Real Time Fluorescence Quantitative Polymerase Chain Reaction Qpcr 7300 Applied Biosystems, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi7300 real time fluorescence quantitative polymerase chain reaction qpcr 7300 applied biosystems/product/Thermo Fisher
    Average 89 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    abi7300 real time fluorescence quantitative polymerase chain reaction qpcr 7300 applied biosystems - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    99
    Thermo Fisher quantitative pcr machine
    Klar is in complex with Staufen, but its posterior accumulation does not depend on Oskar or Staufen. (A) oskar RNA–null oocytes in which the oskar 3′UTR was overexpressed ( UASoskar3′UTR; oskar-Gal4; osk A87 /Df(3R)pXT 103 ) to overcome the early arrest of oogenesis in these mutants ( Jenny et al., 2006 ). The oskar 3′UTR on its own fails to localize at the posterior pole, as reflected by a fairly homogenous distribution of Staufen (Stau). Klar still robustly accumulates at the posterior. (B) Staufen and Klar colocalize at the posterior pole in the presence of oskar mRNA. (A and B) Colocalizing pixels are shown in white. (C) In klar YG3 homozygous oocytes, both Staufen and Khc localize to the posterior pole. The arrowhead indicates ectopic Staufen patch. (D) In the wild-type ovarian lysate, Klar (detected by the Klar-M antibody) coprecipitated with Staufen but was not precipitated by generic IgG. (E) Anti-GFP antibody coprecipitated Staufen from ovarian samples expressing GFP–Klar β (detected by GFP antibody) in the female germline but not from the wild type. (F) <t>qRT-PCR</t> results of RNA immunoprecipitation experiments amplifying oskar and rp49 mRNAs from anti-GFP and control IgG precipitates of EGFP-, GFP–Klar β-, and Staufen-GFP–containing ovarian lysates. Bars represent the mean difference of take-off cycles (Ct) relative to the EGFP immunoprecipitation (first lane) normalized to the Ct values measured in the input (ΔΔCt method). Error bars indicate SDs. ***, P
    Quantitative Pcr Machine, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 96 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative pcr machine/product/Thermo Fisher
    Average 99 stars, based on 96 article reviews
    Price from $9.99 to $1999.99
    quantitative pcr machine - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher quantitative pcr instrument
    Assay LODs using model CTC samples. Varying levels of KRAS <t>G13D</t> mutation-positive tumor cells (MDA-MB-231) were spiked into healthy donor blood and processed on the IsoFlux System. gDNA was amplified, purified, and tested for KRAS mutations. The C t difference between KRAS mutant and wild-type assays (d C t ) was calculated. Samples having as few as nine recovered tumor cells were detectable using the <t>qPCR</t> assay. Healthy control samples remained above the mutation detection cutoff.
    Quantitative Pcr Instrument, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 186 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative pcr instrument/product/Thermo Fisher
    Average 99 stars, based on 186 article reviews
    Price from $9.99 to $1999.99
    quantitative pcr instrument - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher real time quantitative reverse transcription polymerase chain reaction
    <t>Quantitative</t> analysis of expression of microRNA(miR)‐92a and other endogenous miRs as controls (miR‐123, miR‐203, and miR‐126) in ischemic myocardial tissue compared to nonischemic control myocardium of 2 replicate samples obtained at 1, 3, and 10 days after induction of ischemia (49 minutes) and intracoronary injection of encapsulated antagomir‐92a. Myocardial tissue was snap‐frozen and stored at −80°C for RNA analysis. Expression of miRs is represented as difference in cycles of amplification (ΔCt) in control versus ischemic zone assessed by <t>real‐time</t> RT‐PCR <t>reaction.</t> d indicates day. Data are mean±SEM. n=3. RT‐PCR indicates <t>reverse</t> <t>transcription</t> <t>polymerase</t> <t>chain</t> reaction.
    Real Time Quantitative Reverse Transcription Polymerase Chain Reaction, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 174 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time quantitative reverse transcription polymerase chain reaction/product/Thermo Fisher
    Average 99 stars, based on 174 article reviews
    Price from $9.99 to $1999.99
    real time quantitative reverse transcription polymerase chain reaction - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher fluorescence quantitative pcr
    UL144 and UL146 genes in patients with congenital cytomegalovirus hepatic involvement. (A, B) <t>PCR</t> detection and identification of human cytomegalovirus (HCMV) UL144 and UL146 in urinary sediment, with expected size of 740 bp and 721 bp, respectively. M, 100 bp <t>DNA</t> marker; (A) Lane 1–9, UL144, from the sample 2H, 5H, 6H, 10H, 12H, 14H, 22H, 23H, and 25H, respectively; Lane 10, negative control (NC, HCMV negative urine sample); (B) Lane 1–6, UL146, from the sample 58H, 59H, 60H, 61H, 62H, and 63H, respectively; Lane 7, negative control (NC, HCMV negative urine sample). (C, D) PCR Sensitivity. UL144 and UL146 were amplified by PCR, and separated on 1.5% agarose. Lane 1–5, reactions with 10 4 , 10 3 , 10 2 , 10 1 , and 10 0 copies, respectively; M, D2000 DNA marker.
    Fluorescence Quantitative Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 70 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorescence quantitative pcr/product/Thermo Fisher
    Average 99 stars, based on 70 article reviews
    Price from $9.99 to $1999.99
    fluorescence quantitative pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    78
    Thermo Fisher taqman quantitative pcr amplification
    UL144 and UL146 genes in patients with congenital cytomegalovirus hepatic involvement. (A, B) <t>PCR</t> detection and identification of human cytomegalovirus (HCMV) UL144 and UL146 in urinary sediment, with expected size of 740 bp and 721 bp, respectively. M, 100 bp <t>DNA</t> marker; (A) Lane 1–9, UL144, from the sample 2H, 5H, 6H, 10H, 12H, 14H, 22H, 23H, and 25H, respectively; Lane 10, negative control (NC, HCMV negative urine sample); (B) Lane 1–6, UL146, from the sample 58H, 59H, 60H, 61H, 62H, and 63H, respectively; Lane 7, negative control (NC, HCMV negative urine sample). (C, D) PCR Sensitivity. UL144 and UL146 were amplified by PCR, and separated on 1.5% agarose. Lane 1–5, reactions with 10 4 , 10 3 , 10 2 , 10 1 , and 10 0 copies, respectively; M, D2000 DNA marker.
    Taqman Quantitative Pcr Amplification, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman quantitative pcr amplification/product/Thermo Fisher
    Average 78 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    taqman quantitative pcr amplification - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    99
    Thermo Fisher sybr green quantitative pcr
    UL144 and UL146 genes in patients with congenital cytomegalovirus hepatic involvement. (A, B) <t>PCR</t> detection and identification of human cytomegalovirus (HCMV) UL144 and UL146 in urinary sediment, with expected size of 740 bp and 721 bp, respectively. M, 100 bp <t>DNA</t> marker; (A) Lane 1–9, UL144, from the sample 2H, 5H, 6H, 10H, 12H, 14H, 22H, 23H, and 25H, respectively; Lane 10, negative control (NC, HCMV negative urine sample); (B) Lane 1–6, UL146, from the sample 58H, 59H, 60H, 61H, 62H, and 63H, respectively; Lane 7, negative control (NC, HCMV negative urine sample). (C, D) PCR Sensitivity. UL144 and UL146 were amplified by PCR, and separated on 1.5% agarose. Lane 1–5, reactions with 10 4 , 10 3 , 10 2 , 10 1 , and 10 0 copies, respectively; M, D2000 DNA marker.
    Sybr Green Quantitative Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 365 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr green quantitative pcr/product/Thermo Fisher
    Average 99 stars, based on 365 article reviews
    Price from $9.99 to $1999.99
    sybr green quantitative pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher abi7500 quantitative pcr instrument
    UL144 and UL146 genes in patients with congenital cytomegalovirus hepatic involvement. (A, B) <t>PCR</t> detection and identification of human cytomegalovirus (HCMV) UL144 and UL146 in urinary sediment, with expected size of 740 bp and 721 bp, respectively. M, 100 bp <t>DNA</t> marker; (A) Lane 1–9, UL144, from the sample 2H, 5H, 6H, 10H, 12H, 14H, 22H, 23H, and 25H, respectively; Lane 10, negative control (NC, HCMV negative urine sample); (B) Lane 1–6, UL146, from the sample 58H, 59H, 60H, 61H, 62H, and 63H, respectively; Lane 7, negative control (NC, HCMV negative urine sample). (C, D) PCR Sensitivity. UL144 and UL146 were amplified by PCR, and separated on 1.5% agarose. Lane 1–5, reactions with 10 4 , 10 3 , 10 2 , 10 1 , and 10 0 copies, respectively; M, D2000 DNA marker.
    Abi7500 Quantitative Pcr Instrument, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 139 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi7500 quantitative pcr instrument/product/Thermo Fisher
    Average 99 stars, based on 139 article reviews
    Price from $9.99 to $1999.99
    abi7500 quantitative pcr instrument - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    80
    Thermo Fisher taqman quantitative pcr system
    UL144 and UL146 genes in patients with congenital cytomegalovirus hepatic involvement. (A, B) <t>PCR</t> detection and identification of human cytomegalovirus (HCMV) UL144 and UL146 in urinary sediment, with expected size of 740 bp and 721 bp, respectively. M, 100 bp <t>DNA</t> marker; (A) Lane 1–9, UL144, from the sample 2H, 5H, 6H, 10H, 12H, 14H, 22H, 23H, and 25H, respectively; Lane 10, negative control (NC, HCMV negative urine sample); (B) Lane 1–6, UL146, from the sample 58H, 59H, 60H, 61H, 62H, and 63H, respectively; Lane 7, negative control (NC, HCMV negative urine sample). (C, D) PCR Sensitivity. UL144 and UL146 were amplified by PCR, and separated on 1.5% agarose. Lane 1–5, reactions with 10 4 , 10 3 , 10 2 , 10 1 , and 10 0 copies, respectively; M, D2000 DNA marker.
    Taqman Quantitative Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman quantitative pcr system/product/Thermo Fisher
    Average 80 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    taqman quantitative pcr system - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    80
    Thermo Fisher fluorescent quantitative pcr amplifier
    UL144 and UL146 genes in patients with congenital cytomegalovirus hepatic involvement. (A, B) <t>PCR</t> detection and identification of human cytomegalovirus (HCMV) UL144 and UL146 in urinary sediment, with expected size of 740 bp and 721 bp, respectively. M, 100 bp <t>DNA</t> marker; (A) Lane 1–9, UL144, from the sample 2H, 5H, 6H, 10H, 12H, 14H, 22H, 23H, and 25H, respectively; Lane 10, negative control (NC, HCMV negative urine sample); (B) Lane 1–6, UL146, from the sample 58H, 59H, 60H, 61H, 62H, and 63H, respectively; Lane 7, negative control (NC, HCMV negative urine sample). (C, D) PCR Sensitivity. UL144 and UL146 were amplified by PCR, and separated on 1.5% agarose. Lane 1–5, reactions with 10 4 , 10 3 , 10 2 , 10 1 , and 10 0 copies, respectively; M, D2000 DNA marker.
    Fluorescent Quantitative Pcr Amplifier, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorescent quantitative pcr amplifier/product/Thermo Fisher
    Average 80 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    fluorescent quantitative pcr amplifier - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    79
    Thermo Fisher quantitative pcr detection kit
    <t>RT/PCR</t> amplification of LAS GP1 and <t>TNF-α</t> mRNAs in MDM. RNAs from MDM infected with LAS (lanes 1–6) or MOP (lanes 8–11) were extracted at 12 (lanes 1, 3, 5, 8, 10) or 24 (lanes 2, 4, 6, 9, 11) hours p. i. and used in RT-PCR with LAS GP1, GAPDH or TNF-α primers. RNA from mock-infected cells treated with LPS was used as a positive control for natural TNF-α mRNA expression ( lane 7 , 382-bp amplicon). 2,000 copies of exogenous synthesized DNA was included in PCR as TNF-α internal calibration standard, ICS ( lanes 5–8 , 482-bp amplicon). M, positions of DNA markers: ICS, TNF standard; TNF, wild type TNF-α cDNA. Note that wild type TNF-α cDNA and GAPDH cDNA amplicons have the same size, 382 bp.
    Quantitative Pcr Detection Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 51 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative pcr detection kit/product/Thermo Fisher
    Average 79 stars, based on 51 article reviews
    Price from $9.99 to $1999.99
    quantitative pcr detection kit - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    81
    Thermo Fisher one step real time quantitative reverse transcription polymerase chain reaction rt pcr kit
    <t>RT/PCR</t> amplification of LAS GP1 and <t>TNF-α</t> mRNAs in MDM. RNAs from MDM infected with LAS (lanes 1–6) or MOP (lanes 8–11) were extracted at 12 (lanes 1, 3, 5, 8, 10) or 24 (lanes 2, 4, 6, 9, 11) hours p. i. and used in RT-PCR with LAS GP1, GAPDH or TNF-α primers. RNA from mock-infected cells treated with LPS was used as a positive control for natural TNF-α mRNA expression ( lane 7 , 382-bp amplicon). 2,000 copies of exogenous synthesized DNA was included in PCR as TNF-α internal calibration standard, ICS ( lanes 5–8 , 482-bp amplicon). M, positions of DNA markers: ICS, TNF standard; TNF, wild type TNF-α cDNA. Note that wild type TNF-α cDNA and GAPDH cDNA amplicons have the same size, 382 bp.
    One Step Real Time Quantitative Reverse Transcription Polymerase Chain Reaction Rt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 81/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one step real time quantitative reverse transcription polymerase chain reaction rt pcr kit/product/Thermo Fisher
    Average 81 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    one step real time quantitative reverse transcription polymerase chain reaction rt pcr kit - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    81
    Thermo Fisher ab7900 real time quantitative pcr rt qpcr system
    <t>RT/PCR</t> amplification of LAS GP1 and <t>TNF-α</t> mRNAs in MDM. RNAs from MDM infected with LAS (lanes 1–6) or MOP (lanes 8–11) were extracted at 12 (lanes 1, 3, 5, 8, 10) or 24 (lanes 2, 4, 6, 9, 11) hours p. i. and used in RT-PCR with LAS GP1, GAPDH or TNF-α primers. RNA from mock-infected cells treated with LPS was used as a positive control for natural TNF-α mRNA expression ( lane 7 , 382-bp amplicon). 2,000 copies of exogenous synthesized DNA was included in PCR as TNF-α internal calibration standard, ICS ( lanes 5–8 , 482-bp amplicon). M, positions of DNA markers: ICS, TNF standard; TNF, wild type TNF-α cDNA. Note that wild type TNF-α cDNA and GAPDH cDNA amplicons have the same size, 382 bp.
    Ab7900 Real Time Quantitative Pcr Rt Qpcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 81/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ab7900 real time quantitative pcr rt qpcr system/product/Thermo Fisher
    Average 81 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    ab7900 real time quantitative pcr rt qpcr system - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    99
    Thermo Fisher real time quantitative pcr
    <t>RT/PCR</t> amplification of LAS GP1 and <t>TNF-α</t> mRNAs in MDM. RNAs from MDM infected with LAS (lanes 1–6) or MOP (lanes 8–11) were extracted at 12 (lanes 1, 3, 5, 8, 10) or 24 (lanes 2, 4, 6, 9, 11) hours p. i. and used in RT-PCR with LAS GP1, GAPDH or TNF-α primers. RNA from mock-infected cells treated with LPS was used as a positive control for natural TNF-α mRNA expression ( lane 7 , 382-bp amplicon). 2,000 copies of exogenous synthesized DNA was included in PCR as TNF-α internal calibration standard, ICS ( lanes 5–8 , 482-bp amplicon). M, positions of DNA markers: ICS, TNF standard; TNF, wild type TNF-α cDNA. Note that wild type TNF-α cDNA and GAPDH cDNA amplicons have the same size, 382 bp.
    Real Time Quantitative Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 16205 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time quantitative pcr/product/Thermo Fisher
    Average 99 stars, based on 16205 article reviews
    Price from $9.99 to $1999.99
    real time quantitative pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    96
    Thermo Fisher real time quantitative pcr qpcr system
    <t>RT/PCR</t> amplification of LAS GP1 and <t>TNF-α</t> mRNAs in MDM. RNAs from MDM infected with LAS (lanes 1–6) or MOP (lanes 8–11) were extracted at 12 (lanes 1, 3, 5, 8, 10) or 24 (lanes 2, 4, 6, 9, 11) hours p. i. and used in RT-PCR with LAS GP1, GAPDH or TNF-α primers. RNA from mock-infected cells treated with LPS was used as a positive control for natural TNF-α mRNA expression ( lane 7 , 382-bp amplicon). 2,000 copies of exogenous synthesized DNA was included in PCR as TNF-α internal calibration standard, ICS ( lanes 5–8 , 482-bp amplicon). M, positions of DNA markers: ICS, TNF standard; TNF, wild type TNF-α cDNA. Note that wild type TNF-α cDNA and GAPDH cDNA amplicons have the same size, 382 bp.
    Real Time Quantitative Pcr Qpcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time quantitative pcr qpcr system/product/Thermo Fisher
    Average 96 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    real time quantitative pcr qpcr system - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    99
    Thermo Fisher quantitative pcr amplification
    <t>cccDNA</t> detection using quantitative PCR <t>(qPCR)</t>
    Quantitative Pcr Amplification, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 842 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative pcr amplification/product/Thermo Fisher
    Average 99 stars, based on 842 article reviews
    Price from $9.99 to $1999.99
    quantitative pcr amplification - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher semi quantitative pcr
    Allele specific analysis of α-zeins . (A) <t>PCR</t> and RT-PCR analysis of <t>DNA</t> and cDNA, respectively, of N o2It , NR, RN, and R o2R with primers specific to zL1a , zH1b , zH1c , zH1d alleles. (B) PCR and RT-PCR analysis of DNA and cDNA, respectively, of N o2It , NM, MN, and M o2R with primers specific to zL1a , zH1b alleles. For PCR analysis two independent genomic extractions were analyzed. Gene expression of G RMZM2G023418 ( HK2 ) was used as endogenous reference. RT-PCR (-RT) indicates that the reverse transcriptase enzyme was omitted in the cDNA reaction. Data are representative of two biological replicates. M1 and M2 indicate different molecular markers.
    Semi Quantitative Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 908 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/semi quantitative pcr/product/Thermo Fisher
    Average 99 stars, based on 908 article reviews
    Price from $9.99 to $1999.99
    semi quantitative pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher qpcr primers
    miRNA-24 expression after hypoxia. Expression levels (average +/− SD, n = 4) measured by <t>RT-qPCR</t> of miRNA-24 controlled for <t>RNU6</t> expression in MDA-MB-231 cells exposed to 0.5%, 0.2% or 0.1% oxygen during 24 hours.
    Qpcr Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1136 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qpcr primers/product/Thermo Fisher
    Average 99 stars, based on 1136 article reviews
    Price from $9.99 to $1999.99
    qpcr primers - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher qpcr analysis
    miRNA-24 expression after hypoxia. Expression levels (average +/− SD, n = 4) measured by <t>RT-qPCR</t> of miRNA-24 controlled for <t>RNU6</t> expression in MDA-MB-231 cells exposed to 0.5%, 0.2% or 0.1% oxygen during 24 hours.
    Qpcr Analysis, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 6608 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qpcr analysis/product/Thermo Fisher
    Average 99 stars, based on 6608 article reviews
    Price from $9.99 to $1999.99
    qpcr analysis - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher qpcr system
    miRNA-24 expression after hypoxia. Expression levels (average +/− SD, n = 4) measured by <t>RT-qPCR</t> of miRNA-24 controlled for <t>RNU6</t> expression in MDA-MB-231 cells exposed to 0.5%, 0.2% or 0.1% oxygen during 24 hours.
    Qpcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 185 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qpcr system/product/Thermo Fisher
    Average 99 stars, based on 185 article reviews
    Price from $9.99 to $1999.99
    qpcr system - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    86
    Thermo Fisher abi prism 7000 quantitative pcr system
    miRNA-24 expression after hypoxia. Expression levels (average +/− SD, n = 4) measured by <t>RT-qPCR</t> of miRNA-24 controlled for <t>RNU6</t> expression in MDA-MB-231 cells exposed to 0.5%, 0.2% or 0.1% oxygen during 24 hours.
    Abi Prism 7000 Quantitative Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 46 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi prism 7000 quantitative pcr system/product/Thermo Fisher
    Average 86 stars, based on 46 article reviews
    Price from $9.99 to $1999.99
    abi prism 7000 quantitative pcr system - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    90
    Thermo Fisher express qpcr supermix
    miRNA-24 expression after hypoxia. Expression levels (average +/− SD, n = 4) measured by <t>RT-qPCR</t> of miRNA-24 controlled for <t>RNU6</t> expression in MDA-MB-231 cells exposed to 0.5%, 0.2% or 0.1% oxygen during 24 hours.
    Express Qpcr Supermix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 300 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/express qpcr supermix/product/Thermo Fisher
    Average 90 stars, based on 300 article reviews
    Price from $9.99 to $1999.99
    express qpcr supermix - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher abi 7500 fluorescence quantitative pcr instrument
    miRNA-24 expression after hypoxia. Expression levels (average +/− SD, n = 4) measured by <t>RT-qPCR</t> of miRNA-24 controlled for <t>RNU6</t> expression in MDA-MB-231 cells exposed to 0.5%, 0.2% or 0.1% oxygen during 24 hours.
    Abi 7500 Fluorescence Quantitative Pcr Instrument, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 83 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi 7500 fluorescence quantitative pcr instrument/product/Thermo Fisher
    Average 99 stars, based on 83 article reviews
    Price from $9.99 to $1999.99
    abi 7500 fluorescence quantitative pcr instrument - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    QRT-PCR for 27-hydroxylase and ABCA1 message in NS398-treated THP-1 cells exposed to prostaglandins. (a) 27-Hydroxylase message is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 1 , E 2 , and D 2 . THP-1 human monocytes were exposed to the following conditions represented by the six bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 1 (0.1 μM) + NS398 (50 μM), (4) PGE 2 (0.1 μM) + NS398 (50 μM), (5) PGE 1 (0.1 μM) + PGE 2 (0.1 μM) + NS398 (50 μM), and (6) PGD 2 (14 μM) + NS398 (50 μM) (all 18-hour exposures). Cells were extracted for total RNA and were evaluated for 27-hydroxylase mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. (b) ABCA1 message is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 1 , E 2 , and D 2 . THP-1 human monocytes were exposed to the following conditions represented by the six bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 1 (0.1 μM) + NS398 (50 μM), (4) PGE 2 (0.1 μM) + NS398 (50 μM), (5) PGE 1 (0.1 μM) + PGE 2 (0.1 μM) + NS398 (50 μM), and (6) PGD 2 (14 μM) + NS398 (50 μM) (all 18-hour exposures). Cells were extracted for total RNA and were evaluated for ABCA1 mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. ** p

    Journal: Arthritis Research & Therapy

    Article Title: Effect of cyclooxygenase inhibition on cholesterol efflux proteins and atheromatous foam cell transformation in THP-1 human macrophages: a possible mechanism for increased cardiovascular risk

    doi: 10.1186/ar2109

    Figure Lengend Snippet: QRT-PCR for 27-hydroxylase and ABCA1 message in NS398-treated THP-1 cells exposed to prostaglandins. (a) 27-Hydroxylase message is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 1 , E 2 , and D 2 . THP-1 human monocytes were exposed to the following conditions represented by the six bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 1 (0.1 μM) + NS398 (50 μM), (4) PGE 2 (0.1 μM) + NS398 (50 μM), (5) PGE 1 (0.1 μM) + PGE 2 (0.1 μM) + NS398 (50 μM), and (6) PGD 2 (14 μM) + NS398 (50 μM) (all 18-hour exposures). Cells were extracted for total RNA and were evaluated for 27-hydroxylase mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. (b) ABCA1 message is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 1 , E 2 , and D 2 . THP-1 human monocytes were exposed to the following conditions represented by the six bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 1 (0.1 μM) + NS398 (50 μM), (4) PGE 2 (0.1 μM) + NS398 (50 μM), (5) PGE 1 (0.1 μM) + PGE 2 (0.1 μM) + NS398 (50 μM), and (6) PGD 2 (14 μM) + NS398 (50 μM) (all 18-hour exposures). Cells were extracted for total RNA and were evaluated for ABCA1 mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. ** p

    Article Snippet: All reagents for reverse transcription and quantitative real-time polymerase chain reaction (QRT-PCR) were purchased from Applied Biosystems (Foster City, CA, USA).

    Techniques: Quantitative RT-PCR, Expressing, Amplification

    QRT-PCR for 27-hydroxylase and ABCA1 message in indomethacin-treated THP-1 cells. (a) 27-Hydroxylase mRNA expression is decreased by the non-specific COX inhibitor indomethacin in a dose-dependent fashion in THP-1 monocytes. Cultured THP-1 monocytic cells were untreated or exposed to increasing doses of indomethacin for 18 hours. After isolation of total RNA, the RNA was reverse-transcribed and the cDNA amplified by QRT-PCR as described. Signals obtained from the amplification of GAPDH message were used as internal controls. (b) ABCA1 mRNA expression is decreased by the non-specific COX inhibitor indomethacin in a dose-dependent fashion in THP-1 monocytes. Cultured THP-1 monocytic cells were untreated or exposed to increasing doses of indomethacin for 18 hours. After isolation of total RNA, the RNA was reverse-transcribed and the cDNA amplified by QRT-PCR as described. Signals obtained from the amplification of GAPDH message were used as internal controls. At 50 mM indomethacin concentration, cell death was statistically significant (16.8% ± 1.0%). ABCA1, ATP-binding cassette transporter A1; COX, cyclooxygenase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; QRT-PCR, quantitative real-time polymerase chain reaction. * p

    Journal: Arthritis Research & Therapy

    Article Title: Effect of cyclooxygenase inhibition on cholesterol efflux proteins and atheromatous foam cell transformation in THP-1 human macrophages: a possible mechanism for increased cardiovascular risk

    doi: 10.1186/ar2109

    Figure Lengend Snippet: QRT-PCR for 27-hydroxylase and ABCA1 message in indomethacin-treated THP-1 cells. (a) 27-Hydroxylase mRNA expression is decreased by the non-specific COX inhibitor indomethacin in a dose-dependent fashion in THP-1 monocytes. Cultured THP-1 monocytic cells were untreated or exposed to increasing doses of indomethacin for 18 hours. After isolation of total RNA, the RNA was reverse-transcribed and the cDNA amplified by QRT-PCR as described. Signals obtained from the amplification of GAPDH message were used as internal controls. (b) ABCA1 mRNA expression is decreased by the non-specific COX inhibitor indomethacin in a dose-dependent fashion in THP-1 monocytes. Cultured THP-1 monocytic cells were untreated or exposed to increasing doses of indomethacin for 18 hours. After isolation of total RNA, the RNA was reverse-transcribed and the cDNA amplified by QRT-PCR as described. Signals obtained from the amplification of GAPDH message were used as internal controls. At 50 mM indomethacin concentration, cell death was statistically significant (16.8% ± 1.0%). ABCA1, ATP-binding cassette transporter A1; COX, cyclooxygenase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; QRT-PCR, quantitative real-time polymerase chain reaction. * p

    Article Snippet: All reagents for reverse transcription and quantitative real-time polymerase chain reaction (QRT-PCR) were purchased from Applied Biosystems (Foster City, CA, USA).

    Techniques: Quantitative RT-PCR, Expressing, Cell Culture, Isolation, Amplification, Concentration Assay, Binding Assay, Real-time Polymerase Chain Reaction

    QRT-PCR for 27-hydroxylase and ABCA1 message in NS398-treated THP-1 macrophages exposed to prostaglandins or TXA 2 . (a) 27-Hydroxylase message in THP-1 macrophages is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 2 and D 2 , but not TXA 2 . THP-1 human macrophages were exposed to the following conditions represented by the five bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 2 (0.1 μM) + NS398 (50 μM), (4) PGD 2 (14 μM) + NS398 (50 μM), and (5) TXA 2 (3 μM) + NS398 (50 μM) (24-hour exposures to NS398 alone followed by addition of indicated PG or TXA 2 for a further 24 hours). Cells were extracted for total RNA and were evaluated for 27-hydroxylase mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. (b) ABCA1 message is decreased by the COX-2 inhibitor NS398 in THP-1 macrophages and this decrease is reversed by prostaglandins E 2 and D 2 , but not TXA 2 . THP-1 human macrophages were exposed to the following conditions represented by the five bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 2 (0.1 μM) + NS398 (50 μM), (4) PGD 2 (14 μM) + NS398 (50 μM), and (5) TXA 2 (3 μM) + NS398 (50 μM) (24-hour exposures to NS398 alone followed by addition of indicated PG or TXA 2 for a further 24 hours). Cells were extracted for total RNA and were evaluated for ABCA1 mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. * p

    Journal: Arthritis Research & Therapy

    Article Title: Effect of cyclooxygenase inhibition on cholesterol efflux proteins and atheromatous foam cell transformation in THP-1 human macrophages: a possible mechanism for increased cardiovascular risk

    doi: 10.1186/ar2109

    Figure Lengend Snippet: QRT-PCR for 27-hydroxylase and ABCA1 message in NS398-treated THP-1 macrophages exposed to prostaglandins or TXA 2 . (a) 27-Hydroxylase message in THP-1 macrophages is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 2 and D 2 , but not TXA 2 . THP-1 human macrophages were exposed to the following conditions represented by the five bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 2 (0.1 μM) + NS398 (50 μM), (4) PGD 2 (14 μM) + NS398 (50 μM), and (5) TXA 2 (3 μM) + NS398 (50 μM) (24-hour exposures to NS398 alone followed by addition of indicated PG or TXA 2 for a further 24 hours). Cells were extracted for total RNA and were evaluated for 27-hydroxylase mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. (b) ABCA1 message is decreased by the COX-2 inhibitor NS398 in THP-1 macrophages and this decrease is reversed by prostaglandins E 2 and D 2 , but not TXA 2 . THP-1 human macrophages were exposed to the following conditions represented by the five bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 2 (0.1 μM) + NS398 (50 μM), (4) PGD 2 (14 μM) + NS398 (50 μM), and (5) TXA 2 (3 μM) + NS398 (50 μM) (24-hour exposures to NS398 alone followed by addition of indicated PG or TXA 2 for a further 24 hours). Cells were extracted for total RNA and were evaluated for ABCA1 mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. * p

    Article Snippet: All reagents for reverse transcription and quantitative real-time polymerase chain reaction (QRT-PCR) were purchased from Applied Biosystems (Foster City, CA, USA).

    Techniques: Quantitative RT-PCR, Expressing, Amplification

    Purified basal epithelial cells in the adult gland comprise a lineage-primed subset. a Heatmap showing expression of the top 200 DE basal (blue) and top 200 DE luminal (purple) lineage genes in 145 sorted basal epithelial cells (Lin – CD29 hi CD24 + ) from adult mammary glands that were captured on the Fluidigm C1 platform (red = high expression, blue = low expression) ( n = 4 mice). Mixed-lineage intermediate cells are marked in the box. b Heatmap showing qRT-PCR expression for 96 sorted adult basal cells ( n = 6 mice; 4 independent experiments). Taqman assays for 13 basal and 11 luminal lineage genes were applied using the Fluidigm Biomark multiplexed qPCR platform. The color key shows Ct values from black (Ct > 40, no expression) to yellow (highest expression). Mixed-lineage cells expressing both basal and luminal genes are marked by the orange bar

    Journal: Nature Communications

    Article Title: Construction of developmental lineage relationships in the mouse mammary gland by single-cell RNA profiling

    doi: 10.1038/s41467-017-01560-x

    Figure Lengend Snippet: Purified basal epithelial cells in the adult gland comprise a lineage-primed subset. a Heatmap showing expression of the top 200 DE basal (blue) and top 200 DE luminal (purple) lineage genes in 145 sorted basal epithelial cells (Lin – CD29 hi CD24 + ) from adult mammary glands that were captured on the Fluidigm C1 platform (red = high expression, blue = low expression) ( n = 4 mice). Mixed-lineage intermediate cells are marked in the box. b Heatmap showing qRT-PCR expression for 96 sorted adult basal cells ( n = 6 mice; 4 independent experiments). Taqman assays for 13 basal and 11 luminal lineage genes were applied using the Fluidigm Biomark multiplexed qPCR platform. The color key shows Ct values from black (Ct > 40, no expression) to yellow (highest expression). Mixed-lineage cells expressing both basal and luminal genes are marked by the orange bar

    Article Snippet: A mixture containing 2.25 μl amplified cDNA (diluted 1:5), 2.5 μl TaqMan quantitative PCR (qPCR) mix (Applied Biosystems) and 0.25 μl Fluidigm sample loading agent was prepared and loaded onto the IFC chip.

    Techniques: Purification, Expressing, Mouse Assay, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

    miR-628 suppressed the mRNA and protein expression of SOS1 . Notes: The breast CSCs of MDA-MB-231 ( A ) and MCF-7 ( B ) cells were transfected with the miR-628 mimic and miR-628 inhibitor, and SOS1 mRNA level was determined by qRT-PCR. ( C ) The breast CSCs of MDA-MB-231 and MCF-7 cells were transfected with miR-628 mimic and miR-628 inhibitor, and SOS1 protein level was analyzed by Western blotting. The protein expression levels were statistically analyzed by quantitating the intensity of the protein bands relative to that of the internal loading control (α-tubulin). Values indicate mean ± SD; * P

    Journal: OncoTargets and therapy

    Article Title: MicroRNA 628 suppresses migration and invasion of breast cancer stem cells through targeting SOS1

    doi: 10.2147/OTT.S164575

    Figure Lengend Snippet: miR-628 suppressed the mRNA and protein expression of SOS1 . Notes: The breast CSCs of MDA-MB-231 ( A ) and MCF-7 ( B ) cells were transfected with the miR-628 mimic and miR-628 inhibitor, and SOS1 mRNA level was determined by qRT-PCR. ( C ) The breast CSCs of MDA-MB-231 and MCF-7 cells were transfected with miR-628 mimic and miR-628 inhibitor, and SOS1 protein level was analyzed by Western blotting. The protein expression levels were statistically analyzed by quantitating the intensity of the protein bands relative to that of the internal loading control (α-tubulin). Values indicate mean ± SD; * P

    Article Snippet: Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA following the manufacturer’s instructions.

    Techniques: Expressing, Multiple Displacement Amplification, Transfection, Quantitative RT-PCR, Western Blot

    Effect of miR-628 overexpression on migration and invasion of the breast CSC subpopulation in MCF-7 and MDA-MB-231 cell lines. Notes: ( A ) miR-628 expression after miR-628 mimic was transfected into CSCs of MCF-7 and MDA-MB-231 cells was determined by qRT-PCR. ( B – D ) Effects of miR-628 overexpression on migration ( B , C ) and invasion ( D , E ) of MCF-7 and MDA-MB-231 CSCs. ( F ) Cells were transfected with the miR-628 mimic. The effect of miR-628 mimic transfection on the protein levels of vimentin, Snail, and E-cadherin was analyzed by Western blotting. ( G ) Protein expression levels were statistically analyzed by quantitating the intensity of the protein bands relative to that of the internal loading control (α-tubulin). *Values indicate mean ± SD; P

    Journal: OncoTargets and therapy

    Article Title: MicroRNA 628 suppresses migration and invasion of breast cancer stem cells through targeting SOS1

    doi: 10.2147/OTT.S164575

    Figure Lengend Snippet: Effect of miR-628 overexpression on migration and invasion of the breast CSC subpopulation in MCF-7 and MDA-MB-231 cell lines. Notes: ( A ) miR-628 expression after miR-628 mimic was transfected into CSCs of MCF-7 and MDA-MB-231 cells was determined by qRT-PCR. ( B – D ) Effects of miR-628 overexpression on migration ( B , C ) and invasion ( D , E ) of MCF-7 and MDA-MB-231 CSCs. ( F ) Cells were transfected with the miR-628 mimic. The effect of miR-628 mimic transfection on the protein levels of vimentin, Snail, and E-cadherin was analyzed by Western blotting. ( G ) Protein expression levels were statistically analyzed by quantitating the intensity of the protein bands relative to that of the internal loading control (α-tubulin). *Values indicate mean ± SD; P

    Article Snippet: Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA following the manufacturer’s instructions.

    Techniques: Over Expression, Migration, Multiple Displacement Amplification, Expressing, Transfection, Quantitative RT-PCR, Western Blot

    Klar is in complex with Staufen, but its posterior accumulation does not depend on Oskar or Staufen. (A) oskar RNA–null oocytes in which the oskar 3′UTR was overexpressed ( UASoskar3′UTR; oskar-Gal4; osk A87 /Df(3R)pXT 103 ) to overcome the early arrest of oogenesis in these mutants ( Jenny et al., 2006 ). The oskar 3′UTR on its own fails to localize at the posterior pole, as reflected by a fairly homogenous distribution of Staufen (Stau). Klar still robustly accumulates at the posterior. (B) Staufen and Klar colocalize at the posterior pole in the presence of oskar mRNA. (A and B) Colocalizing pixels are shown in white. (C) In klar YG3 homozygous oocytes, both Staufen and Khc localize to the posterior pole. The arrowhead indicates ectopic Staufen patch. (D) In the wild-type ovarian lysate, Klar (detected by the Klar-M antibody) coprecipitated with Staufen but was not precipitated by generic IgG. (E) Anti-GFP antibody coprecipitated Staufen from ovarian samples expressing GFP–Klar β (detected by GFP antibody) in the female germline but not from the wild type. (F) qRT-PCR results of RNA immunoprecipitation experiments amplifying oskar and rp49 mRNAs from anti-GFP and control IgG precipitates of EGFP-, GFP–Klar β-, and Staufen-GFP–containing ovarian lysates. Bars represent the mean difference of take-off cycles (Ct) relative to the EGFP immunoprecipitation (first lane) normalized to the Ct values measured in the input (ΔΔCt method). Error bars indicate SDs. ***, P

    Journal: The Journal of Cell Biology

    Article Title: Klar ensures thermal robustness of oskar localization by restraining RNP motility

    doi: 10.1083/jcb.201310010

    Figure Lengend Snippet: Klar is in complex with Staufen, but its posterior accumulation does not depend on Oskar or Staufen. (A) oskar RNA–null oocytes in which the oskar 3′UTR was overexpressed ( UASoskar3′UTR; oskar-Gal4; osk A87 /Df(3R)pXT 103 ) to overcome the early arrest of oogenesis in these mutants ( Jenny et al., 2006 ). The oskar 3′UTR on its own fails to localize at the posterior pole, as reflected by a fairly homogenous distribution of Staufen (Stau). Klar still robustly accumulates at the posterior. (B) Staufen and Klar colocalize at the posterior pole in the presence of oskar mRNA. (A and B) Colocalizing pixels are shown in white. (C) In klar YG3 homozygous oocytes, both Staufen and Khc localize to the posterior pole. The arrowhead indicates ectopic Staufen patch. (D) In the wild-type ovarian lysate, Klar (detected by the Klar-M antibody) coprecipitated with Staufen but was not precipitated by generic IgG. (E) Anti-GFP antibody coprecipitated Staufen from ovarian samples expressing GFP–Klar β (detected by GFP antibody) in the female germline but not from the wild type. (F) qRT-PCR results of RNA immunoprecipitation experiments amplifying oskar and rp49 mRNAs from anti-GFP and control IgG precipitates of EGFP-, GFP–Klar β-, and Staufen-GFP–containing ovarian lysates. Bars represent the mean difference of take-off cycles (Ct) relative to the EGFP immunoprecipitation (first lane) normalized to the Ct values measured in the input (ΔΔCt method). Error bars indicate SDs. ***, P

    Article Snippet: qRT-PCR RNA was isolated from dissected ovaries using TRI Reagent according to the manufacturer’s recommendation (Molecular Research Center, Inc.), and cDNA was synthesized by first-strand synthesis kit (SuperScript III; Invitrogen) using random hexamer priming. oskar cDNA was amplified by using two oligos flanking the first splice junction (5′-GCAACTATATATCCGTGCGCG-3′ and 5′-CCCGTCAGTTTTCGATATTCA-3′), and the resulting signal was normalized to rp49 , encoding for a ribosomal protein (oligos: 5′-GCTAAGCTGTCGCACAAA-3′ and 5′-TCCGGTGGGCAGCATGTG-3′). qRT-PCR was performed on a quantitative PCR machine (7500; Applied Biosystems).

    Techniques: Expressing, Quantitative RT-PCR, Immunoprecipitation

    Semiquantitative analysis of oskar mRNA localization. (A) Schematic representation of the center of mass (COM) of the oskar signal and the posterior domain (PD), where oskar mRNA accumulates (see also Fig. S3 ). (B and C) Relative oskar mRNA distribution in stage 10 wild-type (B) and klar YG3 / klar YG3 (C) oocytes. oskar mRNA distribution within similarly developed oocytes of the same genotype was averaged (see details in Fig. S3), mean oskar signal is shown in green, and SD of the signal is in magenta to indicate variability (e.g., ectopically localizing mRNA). N (bottom left corner) indicates the number of oocytes analyzed and plotted. The images in B and C are shown again alongside additional genotypes in Fig. S3 (F and G), respectively. Bar indicates 10% of relative oocyte length. (D, F, and H) Boxplots of the distribution of the center of mass of bulk oskar mRNA in stage 9 (D) and stage 10 (F and H) oocytes along the AP axis in percentages relative (rel.) to the length of the AP axis at 25°C. The boxplots indicate the 10th, 25th, 50th, 75th, and the 90th percentiles of datasets, from left to right. (E, G, and I) The size of the posterior domain of oskar mRNA (black horizontal bars) and Oskar protein (gray horizontal bars) in stage 9 (E) and stages 10–11 (G and I) oocytes at 25°C. Bars indicate the mean; error bars represent SDs of the size of the posterior domain. Genotypes are indicated left of the boxplots, and number of oocytes analyzed are to the right of the bar plots. Asterisk and hash signs indicate significant difference relative to wild-type or klar YG3 homozygous oocytes, respectively (α = 0.05; see also Table 2 ). In stage 10 osk 54 /+ oocytes, the center of mass of oskar mRNA is closer to the posterior pole than in wild type, similar to klar YG3 . This shift might be a result of the reduced stability of the nonlocalized mutant oskar mRNA ( oskar levels are 72 ± 5% of wild type in osk 54 /+ ovaries as determined by qRT-PCR; mean ± SD). (see also Fig. S3, Fig. S4 , Fig. S5 , and Table 2 ). (J–M) Relative oskar mRNA distribution in stage 10 wild-type (J), klar YG3 / klar YG3 (K), Khc 17 /+; klar YG3 / klar YG3 (L), and klar YG3 , osk A87 / klar YG3 , osk + (M) oocytes. (M) Bar indicates 10% of relative oocyte length. (K) Note the “ragged” posterior domain in the absence of Klar β. (N) The relative amount of oskar found ectopically localizing outside the posterior domain. Ectopic localization is defined in Fig. S3. Dots represent individual oocytes; fractions on the top represent the number of oocytes with ectopically localizing oskar . wt, wild type.

    Journal: The Journal of Cell Biology

    Article Title: Klar ensures thermal robustness of oskar localization by restraining RNP motility

    doi: 10.1083/jcb.201310010

    Figure Lengend Snippet: Semiquantitative analysis of oskar mRNA localization. (A) Schematic representation of the center of mass (COM) of the oskar signal and the posterior domain (PD), where oskar mRNA accumulates (see also Fig. S3 ). (B and C) Relative oskar mRNA distribution in stage 10 wild-type (B) and klar YG3 / klar YG3 (C) oocytes. oskar mRNA distribution within similarly developed oocytes of the same genotype was averaged (see details in Fig. S3), mean oskar signal is shown in green, and SD of the signal is in magenta to indicate variability (e.g., ectopically localizing mRNA). N (bottom left corner) indicates the number of oocytes analyzed and plotted. The images in B and C are shown again alongside additional genotypes in Fig. S3 (F and G), respectively. Bar indicates 10% of relative oocyte length. (D, F, and H) Boxplots of the distribution of the center of mass of bulk oskar mRNA in stage 9 (D) and stage 10 (F and H) oocytes along the AP axis in percentages relative (rel.) to the length of the AP axis at 25°C. The boxplots indicate the 10th, 25th, 50th, 75th, and the 90th percentiles of datasets, from left to right. (E, G, and I) The size of the posterior domain of oskar mRNA (black horizontal bars) and Oskar protein (gray horizontal bars) in stage 9 (E) and stages 10–11 (G and I) oocytes at 25°C. Bars indicate the mean; error bars represent SDs of the size of the posterior domain. Genotypes are indicated left of the boxplots, and number of oocytes analyzed are to the right of the bar plots. Asterisk and hash signs indicate significant difference relative to wild-type or klar YG3 homozygous oocytes, respectively (α = 0.05; see also Table 2 ). In stage 10 osk 54 /+ oocytes, the center of mass of oskar mRNA is closer to the posterior pole than in wild type, similar to klar YG3 . This shift might be a result of the reduced stability of the nonlocalized mutant oskar mRNA ( oskar levels are 72 ± 5% of wild type in osk 54 /+ ovaries as determined by qRT-PCR; mean ± SD). (see also Fig. S3, Fig. S4 , Fig. S5 , and Table 2 ). (J–M) Relative oskar mRNA distribution in stage 10 wild-type (J), klar YG3 / klar YG3 (K), Khc 17 /+; klar YG3 / klar YG3 (L), and klar YG3 , osk A87 / klar YG3 , osk + (M) oocytes. (M) Bar indicates 10% of relative oocyte length. (K) Note the “ragged” posterior domain in the absence of Klar β. (N) The relative amount of oskar found ectopically localizing outside the posterior domain. Ectopic localization is defined in Fig. S3. Dots represent individual oocytes; fractions on the top represent the number of oocytes with ectopically localizing oskar . wt, wild type.

    Article Snippet: qRT-PCR RNA was isolated from dissected ovaries using TRI Reagent according to the manufacturer’s recommendation (Molecular Research Center, Inc.), and cDNA was synthesized by first-strand synthesis kit (SuperScript III; Invitrogen) using random hexamer priming. oskar cDNA was amplified by using two oligos flanking the first splice junction (5′-GCAACTATATATCCGTGCGCG-3′ and 5′-CCCGTCAGTTTTCGATATTCA-3′), and the resulting signal was normalized to rp49 , encoding for a ribosomal protein (oligos: 5′-GCTAAGCTGTCGCACAAA-3′ and 5′-TCCGGTGGGCAGCATGTG-3′). qRT-PCR was performed on a quantitative PCR machine (7500; Applied Biosystems).

    Techniques: Mutagenesis, Quantitative RT-PCR

    Assay LODs using model CTC samples. Varying levels of KRAS G13D mutation-positive tumor cells (MDA-MB-231) were spiked into healthy donor blood and processed on the IsoFlux System. gDNA was amplified, purified, and tested for KRAS mutations. The C t difference between KRAS mutant and wild-type assays (d C t ) was calculated. Samples having as few as nine recovered tumor cells were detectable using the qPCR assay. Healthy control samples remained above the mutation detection cutoff.

    Journal: Translational Oncology

    Article Title: Mutational Analysis of Circulating Tumor Cells Using a Novel Microfluidic Collection Device and qPCR Assay 1Mutational Analysis of Circulating Tumor Cells Using a Novel Microfluidic Collection Device and qPCR Assay 1 2

    doi:

    Figure Lengend Snippet: Assay LODs using model CTC samples. Varying levels of KRAS G13D mutation-positive tumor cells (MDA-MB-231) were spiked into healthy donor blood and processed on the IsoFlux System. gDNA was amplified, purified, and tested for KRAS mutations. The C t difference between KRAS mutant and wild-type assays (d C t ) was calculated. Samples having as few as nine recovered tumor cells were detectable using the qPCR assay. Healthy control samples remained above the mutation detection cutoff.

    Article Snippet: Amplified gDNA was purified and eluted in 50 µl of AE buffer (QIAamp DNA Micro Kit; Qiagen) and used for qPCR. gDNA was tested for mutations using a panel of KRAS mutation assays (nucleotide changes of c.34G > T, c.34G > A, c.34G > C, c.35G > T, c.35G > A, c.35G > C, and c.38G > A, corresponding to amino acid changes of G12C, G12S, G12R, G12V, G12D, G12A, and G13D) using Competitive Allele-Specific TaqMan PCR (castPCR) reagents on a qPCR instrument (StepOne Plus; Life Technologies Inc) according to the manufacturer's recommended protocol [ ].

    Techniques: Mutagenesis, Multiple Displacement Amplification, Amplification, Purification, Real-time Polymerase Chain Reaction

    Quantitative analysis of expression of microRNA(miR)‐92a and other endogenous miRs as controls (miR‐123, miR‐203, and miR‐126) in ischemic myocardial tissue compared to nonischemic control myocardium of 2 replicate samples obtained at 1, 3, and 10 days after induction of ischemia (49 minutes) and intracoronary injection of encapsulated antagomir‐92a. Myocardial tissue was snap‐frozen and stored at −80°C for RNA analysis. Expression of miRs is represented as difference in cycles of amplification (ΔCt) in control versus ischemic zone assessed by real‐time RT‐PCR reaction. d indicates day. Data are mean±SEM. n=3. RT‐PCR indicates reverse transcription polymerase chain reaction.

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    Article Title: Single Intracoronary Injection of Encapsulated Antagomir‐92a Promotes Angiogenesis and Prevents Adverse Infarct Remodeling

    doi: 10.1161/JAHA.114.000946

    Figure Lengend Snippet: Quantitative analysis of expression of microRNA(miR)‐92a and other endogenous miRs as controls (miR‐123, miR‐203, and miR‐126) in ischemic myocardial tissue compared to nonischemic control myocardium of 2 replicate samples obtained at 1, 3, and 10 days after induction of ischemia (49 minutes) and intracoronary injection of encapsulated antagomir‐92a. Myocardial tissue was snap‐frozen and stored at −80°C for RNA analysis. Expression of miRs is represented as difference in cycles of amplification (ΔCt) in control versus ischemic zone assessed by real‐time RT‐PCR reaction. d indicates day. Data are mean±SEM. n=3. RT‐PCR indicates reverse transcription polymerase chain reaction.

    Article Snippet: For analysis of microRNA expression in heart samples, we carried out a SYBR® Green–based real‐time quantitative reverse transcription polymerase chain reaction (Applied Biosystems) with specific primer sets for amplification (miR‐92a, miR‐123, miR‐203, and miR‐126 [Exiqon]).

    Techniques: Expressing, Injection, RNA Expression, Amplification, Quantitative RT-PCR, Reverse Transcription Polymerase Chain Reaction

    UL144 and UL146 genes in patients with congenital cytomegalovirus hepatic involvement. (A, B) PCR detection and identification of human cytomegalovirus (HCMV) UL144 and UL146 in urinary sediment, with expected size of 740 bp and 721 bp, respectively. M, 100 bp DNA marker; (A) Lane 1–9, UL144, from the sample 2H, 5H, 6H, 10H, 12H, 14H, 22H, 23H, and 25H, respectively; Lane 10, negative control (NC, HCMV negative urine sample); (B) Lane 1–6, UL146, from the sample 58H, 59H, 60H, 61H, 62H, and 63H, respectively; Lane 7, negative control (NC, HCMV negative urine sample). (C, D) PCR Sensitivity. UL144 and UL146 were amplified by PCR, and separated on 1.5% agarose. Lane 1–5, reactions with 10 4 , 10 3 , 10 2 , 10 1 , and 10 0 copies, respectively; M, D2000 DNA marker.

    Journal: PLoS ONE

    Article Title: Polymorphisms and features of cytomegalovirus UL144 and UL146 in congenitally infected neonates with hepatic involvement

    doi: 10.1371/journal.pone.0171959

    Figure Lengend Snippet: UL144 and UL146 genes in patients with congenital cytomegalovirus hepatic involvement. (A, B) PCR detection and identification of human cytomegalovirus (HCMV) UL144 and UL146 in urinary sediment, with expected size of 740 bp and 721 bp, respectively. M, 100 bp DNA marker; (A) Lane 1–9, UL144, from the sample 2H, 5H, 6H, 10H, 12H, 14H, 22H, 23H, and 25H, respectively; Lane 10, negative control (NC, HCMV negative urine sample); (B) Lane 1–6, UL146, from the sample 58H, 59H, 60H, 61H, 62H, and 63H, respectively; Lane 7, negative control (NC, HCMV negative urine sample). (C, D) PCR Sensitivity. UL144 and UL146 were amplified by PCR, and separated on 1.5% agarose. Lane 1–5, reactions with 10 4 , 10 3 , 10 2 , 10 1 , and 10 0 copies, respectively; M, D2000 DNA marker.

    Article Snippet: Presence of cytomegalovirus DNA was tested by fluorescence quantitative PCR (Applied Biosystems 7500 Real−Time PCR System, Foster City, CA, USA).

    Techniques: Polymerase Chain Reaction, Marker, Negative Control, Amplification

    RT/PCR amplification of LAS GP1 and TNF-α mRNAs in MDM. RNAs from MDM infected with LAS (lanes 1–6) or MOP (lanes 8–11) were extracted at 12 (lanes 1, 3, 5, 8, 10) or 24 (lanes 2, 4, 6, 9, 11) hours p. i. and used in RT-PCR with LAS GP1, GAPDH or TNF-α primers. RNA from mock-infected cells treated with LPS was used as a positive control for natural TNF-α mRNA expression ( lane 7 , 382-bp amplicon). 2,000 copies of exogenous synthesized DNA was included in PCR as TNF-α internal calibration standard, ICS ( lanes 5–8 , 482-bp amplicon). M, positions of DNA markers: ICS, TNF standard; TNF, wild type TNF-α cDNA. Note that wild type TNF-α cDNA and GAPDH cDNA amplicons have the same size, 382 bp.

    Journal: Journal of medical virology

    Article Title: Lassa and Mopeia Virus Replication in Human Monocytes/Macrophages and in Endothelial Cells: Different Effects on IL-8 and TNF-? Gene Expression

    doi:

    Figure Lengend Snippet: RT/PCR amplification of LAS GP1 and TNF-α mRNAs in MDM. RNAs from MDM infected with LAS (lanes 1–6) or MOP (lanes 8–11) were extracted at 12 (lanes 1, 3, 5, 8, 10) or 24 (lanes 2, 4, 6, 9, 11) hours p. i. and used in RT-PCR with LAS GP1, GAPDH or TNF-α primers. RNA from mock-infected cells treated with LPS was used as a positive control for natural TNF-α mRNA expression ( lane 7 , 382-bp amplicon). 2,000 copies of exogenous synthesized DNA was included in PCR as TNF-α internal calibration standard, ICS ( lanes 5–8 , 482-bp amplicon). M, positions of DNA markers: ICS, TNF standard; TNF, wild type TNF-α cDNA. Note that wild type TNF-α cDNA and GAPDH cDNA amplicons have the same size, 382 bp.

    Article Snippet: Expression of TNF-α mRNA in MDM was measured using the Quantitative PCR Detection Kit (BioSource International, Camarillo, CA).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification, Infection, Positive Control, Expressing, Synthesized, Polymerase Chain Reaction

    Quantitation of TNF-α mRNA expression in human LPS-stimulated and Lassa-infected MDM by competitive PCR. A. Gel-based analysis of TNF-α mRNA expression in LPS-MDM infected with Lassa virus. MDM grown in T25 flasks were stimulated with LPS, infected with Lassa virus (MOI = 5) and incubated for 12 and 24 hours. At 12 and 24 hours p. i. RNA was extracted, converted into cDNA and equivalent amounts of cDNA (based on GAPDH) were amplified. Quantitative PCR was performed with biotin-labeled TNF-α primers using different concentrations of cytokine template (1, 1:10, and 1:100 dilutions) and a constant amount (2,000 copies) of ICS (BioSource). 5 ul-aliquots were analyzed on 2% agarose. M, positions of DNA markers, 500 and 250 bp. B. Quantitation of PCR products. 25 ul from each PCR reaction was denatured under alkaline pH and serial dilutions (1:40–1:320) of TNF-α and ICS amplicons were made in hybridization buffer in ICS- or TNF-α-specific oligonucleotide capture wells. After hybridization the captured amplicons were detected by streptavidin conjugates. Numbers of TNF-α mRNA copies were calculated as follows: Total TNF-α Optical Density (OD)/Total ICS OD × 2 × Input copy number of ICS × cDNA dilution.

    Journal: Journal of medical virology

    Article Title: Lassa and Mopeia Virus Replication in Human Monocytes/Macrophages and in Endothelial Cells: Different Effects on IL-8 and TNF-? Gene Expression

    doi:

    Figure Lengend Snippet: Quantitation of TNF-α mRNA expression in human LPS-stimulated and Lassa-infected MDM by competitive PCR. A. Gel-based analysis of TNF-α mRNA expression in LPS-MDM infected with Lassa virus. MDM grown in T25 flasks were stimulated with LPS, infected with Lassa virus (MOI = 5) and incubated for 12 and 24 hours. At 12 and 24 hours p. i. RNA was extracted, converted into cDNA and equivalent amounts of cDNA (based on GAPDH) were amplified. Quantitative PCR was performed with biotin-labeled TNF-α primers using different concentrations of cytokine template (1, 1:10, and 1:100 dilutions) and a constant amount (2,000 copies) of ICS (BioSource). 5 ul-aliquots were analyzed on 2% agarose. M, positions of DNA markers, 500 and 250 bp. B. Quantitation of PCR products. 25 ul from each PCR reaction was denatured under alkaline pH and serial dilutions (1:40–1:320) of TNF-α and ICS amplicons were made in hybridization buffer in ICS- or TNF-α-specific oligonucleotide capture wells. After hybridization the captured amplicons were detected by streptavidin conjugates. Numbers of TNF-α mRNA copies were calculated as follows: Total TNF-α Optical Density (OD)/Total ICS OD × 2 × Input copy number of ICS × cDNA dilution.

    Article Snippet: Expression of TNF-α mRNA in MDM was measured using the Quantitative PCR Detection Kit (BioSource International, Camarillo, CA).

    Techniques: Quantitation Assay, Expressing, Infection, Polymerase Chain Reaction, Incubation, Amplification, Real-time Polymerase Chain Reaction, Labeling, Hybridization

    cccDNA detection using quantitative PCR (qPCR)

    Journal: Oncology Letters

    Article Title: Antiviral therapy may decrease HBx, affecting cccDNA and MSL2 in hepatocarcinogenesis

    doi: 10.3892/ol.2019.10833

    Figure Lengend Snippet: cccDNA detection using quantitative PCR (qPCR)

    Article Snippet: A total of 1 ml of cccDNA was then used for qPCR amplification (7500 Real-time PCR Instrument system; Applied Biosystems; Thermo Fisher Scientific, Inc.), which was performed using TOPreal™ qPCR PreMIX SYBR Green (Enzynomics). β-actin amplicons were used as the internal reference for subsequent PCR analysis.

    Techniques: Real-time Polymerase Chain Reaction

    Allele specific analysis of α-zeins . (A) PCR and RT-PCR analysis of DNA and cDNA, respectively, of N o2It , NR, RN, and R o2R with primers specific to zL1a , zH1b , zH1c , zH1d alleles. (B) PCR and RT-PCR analysis of DNA and cDNA, respectively, of N o2It , NM, MN, and M o2R with primers specific to zL1a , zH1b alleles. For PCR analysis two independent genomic extractions were analyzed. Gene expression of G RMZM2G023418 ( HK2 ) was used as endogenous reference. RT-PCR (-RT) indicates that the reverse transcriptase enzyme was omitted in the cDNA reaction. Data are representative of two biological replicates. M1 and M2 indicate different molecular markers.

    Journal: PLoS ONE

    Article Title: Uniparental and transgressive expression of α-zeins in maize endosperm of o2 hybrid lines

    doi: 10.1371/journal.pone.0206993

    Figure Lengend Snippet: Allele specific analysis of α-zeins . (A) PCR and RT-PCR analysis of DNA and cDNA, respectively, of N o2It , NR, RN, and R o2R with primers specific to zL1a , zH1b , zH1c , zH1d alleles. (B) PCR and RT-PCR analysis of DNA and cDNA, respectively, of N o2It , NM, MN, and M o2R with primers specific to zL1a , zH1b alleles. For PCR analysis two independent genomic extractions were analyzed. Gene expression of G RMZM2G023418 ( HK2 ) was used as endogenous reference. RT-PCR (-RT) indicates that the reverse transcriptase enzyme was omitted in the cDNA reaction. Data are representative of two biological replicates. M1 and M2 indicate different molecular markers.

    Article Snippet: Semi-quantitative PCR (PlatinumTaq DNA Polymerase; Invitrogen) was performed with 3 μl of digested DNA (~30 ng) in a 30 μl reaction using specific primers ( ).

    Techniques: Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Expressing

    DNA methylation analysis of uniparental expressed α-zeins . (A) Schematic representation of the restriction maps of the zH1b , zH1c , zH1d and zL1a alleles. The positions of Hha I (H) restriction sites are shown. The solid bar indicates the nucleotides from the ATG to the stop codon. The dotted lines represent nucleotide deletions between zL1a and the other three sequences. Arrowheads indicate the positions of the primers that were used in the PCR amplification of the coding (black) and promoter regions (gray). The positions of the O2 site and the prolamin-binding site (PBS) are reported. (B) Methylation-sensitive ( Hha I) and methylation-dependent (McrBC and MspPIJ) PCR analyses. Undigested DNA was used as a control (c). White letters indicate the parental origin of the α-zein alleles in the reciprocals: maternal (M), paternal (P). (C) Bisulfite sequencing analysis of the promoter and coding region of zL1a in the NR and RN and the NM and MN hybrid endosperms. Each line represents a single sequence. The red, blue and green colors indicate CG, CHG and CHH sites, respectively. The portion of the promoter and coding region analyzed is indicated by the graph.

    Journal: PLoS ONE

    Article Title: Uniparental and transgressive expression of α-zeins in maize endosperm of o2 hybrid lines

    doi: 10.1371/journal.pone.0206993

    Figure Lengend Snippet: DNA methylation analysis of uniparental expressed α-zeins . (A) Schematic representation of the restriction maps of the zH1b , zH1c , zH1d and zL1a alleles. The positions of Hha I (H) restriction sites are shown. The solid bar indicates the nucleotides from the ATG to the stop codon. The dotted lines represent nucleotide deletions between zL1a and the other three sequences. Arrowheads indicate the positions of the primers that were used in the PCR amplification of the coding (black) and promoter regions (gray). The positions of the O2 site and the prolamin-binding site (PBS) are reported. (B) Methylation-sensitive ( Hha I) and methylation-dependent (McrBC and MspPIJ) PCR analyses. Undigested DNA was used as a control (c). White letters indicate the parental origin of the α-zein alleles in the reciprocals: maternal (M), paternal (P). (C) Bisulfite sequencing analysis of the promoter and coding region of zL1a in the NR and RN and the NM and MN hybrid endosperms. Each line represents a single sequence. The red, blue and green colors indicate CG, CHG and CHH sites, respectively. The portion of the promoter and coding region analyzed is indicated by the graph.

    Article Snippet: Semi-quantitative PCR (PlatinumTaq DNA Polymerase; Invitrogen) was performed with 3 μl of digested DNA (~30 ng) in a 30 μl reaction using specific primers ( ).

    Techniques: DNA Methylation Assay, Polymerase Chain Reaction, Amplification, Binding Assay, Methylation, Methylation Sequencing, Sequencing

    miRNA-24 expression after hypoxia. Expression levels (average +/− SD, n = 4) measured by RT-qPCR of miRNA-24 controlled for RNU6 expression in MDA-MB-231 cells exposed to 0.5%, 0.2% or 0.1% oxygen during 24 hours.

    Journal: PLoS ONE

    Article Title: Regulation of TRIB3 mRNA and Protein in Breast Cancer

    doi: 10.1371/journal.pone.0049439

    Figure Lengend Snippet: miRNA-24 expression after hypoxia. Expression levels (average +/− SD, n = 4) measured by RT-qPCR of miRNA-24 controlled for RNU6 expression in MDA-MB-231 cells exposed to 0.5%, 0.2% or 0.1% oxygen during 24 hours.

    Article Snippet: Reverse transcriptase reaction was performed with NCode™ VILO™ miRNA cDNA Synthesis Kit (Invitrogen, Carlsbad, CA, USA) and miRNA expression was determined using Sybr Green Master Mix (Applied Biosystems, Nieuwerkerk a/d lJssel, the Netherlands) with miRNA-24 forward primer (gctcagttcagcaggaac) or RNU6 forward primer (cgcaaggatgacacgcaaattc, both Biolegio BV, Nijmegen, the Netherlands) and Universal qPCR primer (Invitrogen) on an CFX96 realtime PCR detection system (Bio-Rad Laboratories BV, Veenendaal, the Netherlands).

    Techniques: Expressing, Quantitative RT-PCR, Multiple Displacement Amplification