q5 polymerase New England Biolabs Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs q5 dna polymerase
    PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for <t>Q5</t> DNA polymerase; the other three control amplicons are no larger than 3.4 kb.
    Q5 Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 2690 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 dna polymerase/product/New England Biolabs
    Average 95 stars, based on 2690 article reviews
    Price from $9.99 to $1999.99
    q5 dna polymerase - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    90
    Thermo Fisher high fidelity proofreading dna polymerase
    PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for <t>Q5</t> DNA polymerase; the other three control amplicons are no larger than 3.4 kb.
    High Fidelity Proofreading Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity proofreading dna polymerase/product/Thermo Fisher
    Average 90 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    high fidelity proofreading dna polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    95
    New England Biolabs q5 high fidelity master mix
    PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for <t>Q5</t> DNA polymerase; the other three control amplicons are no larger than 3.4 kb.
    Q5 High Fidelity Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 175 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 high fidelity master mix/product/New England Biolabs
    Average 95 stars, based on 175 article reviews
    Price from $9.99 to $1999.99
    q5 high fidelity master mix - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    90
    New England Biolabs q5 polymerase
    PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for <t>Q5</t> DNA polymerase; the other three control amplicons are no larger than 3.4 kb.
    Q5 Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 2576 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 polymerase/product/New England Biolabs
    Average 90 stars, based on 2576 article reviews
    Price from $9.99 to $1999.99
    q5 polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    95
    New England Biolabs q5 hot star high fidelity dna polymerase
    Performance of four thermostable <t>DNA</t> polymerases for the synthesis of gene B using PCA-DTF. Lane 1: negative control reaction performed at the same conditions, without addition of primers; lane 2: KOD Hot Start DNA polymerase; lane 3: <t>Q5</t> Hot Start High Fidelity DNA polymerase; lane 4: Pfu Turbo DNA polymerase and lane 5: Taq DNA polymerase. M2: NZYladder I
    Q5 Hot Star High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 hot star high fidelity dna polymerase/product/New England Biolabs
    Average 95 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    q5 hot star high fidelity dna polymerase - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    99
    New England Biolabs phusion polymerase
    Performance of four thermostable <t>DNA</t> polymerases for the synthesis of gene B using PCA-DTF. Lane 1: negative control reaction performed at the same conditions, without addition of primers; lane 2: KOD Hot Start DNA polymerase; lane 3: <t>Q5</t> Hot Start High Fidelity DNA polymerase; lane 4: Pfu Turbo DNA polymerase and lane 5: Taq DNA polymerase. M2: NZYladder I
    Phusion Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 8093 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion polymerase/product/New England Biolabs
    Average 99 stars, based on 8093 article reviews
    Price from $9.99 to $1999.99
    phusion polymerase - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    85
    New England Biolabs q5 hotstart polymerase
    Performance of four thermostable <t>DNA</t> polymerases for the synthesis of gene B using PCA-DTF. Lane 1: negative control reaction performed at the same conditions, without addition of primers; lane 2: KOD Hot Start DNA polymerase; lane 3: <t>Q5</t> Hot Start High Fidelity DNA polymerase; lane 4: Pfu Turbo DNA polymerase and lane 5: Taq DNA polymerase. M2: NZYladder I
    Q5 Hotstart Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 hotstart polymerase/product/New England Biolabs
    Average 85 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    q5 hotstart polymerase - by Bioz Stars, 2020-02
    85/100 stars
      Buy from Supplier

    92
    New England Biolabs q5 hifi polymerase
    Performance of four thermostable <t>DNA</t> polymerases for the synthesis of gene B using PCA-DTF. Lane 1: negative control reaction performed at the same conditions, without addition of primers; lane 2: KOD Hot Start DNA polymerase; lane 3: <t>Q5</t> Hot Start High Fidelity DNA polymerase; lane 4: Pfu Turbo DNA polymerase and lane 5: Taq DNA polymerase. M2: NZYladder I
    Q5 Hifi Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 47 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 hifi polymerase/product/New England Biolabs
    Average 92 stars, based on 47 article reviews
    Price from $9.99 to $1999.99
    q5 hifi polymerase - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    90
    New England Biolabs nebnext q5
    Performance of four thermostable <t>DNA</t> polymerases for the synthesis of gene B using PCA-DTF. Lane 1: negative control reaction performed at the same conditions, without addition of primers; lane 2: KOD Hot Start DNA polymerase; lane 3: <t>Q5</t> Hot Start High Fidelity DNA polymerase; lane 4: Pfu Turbo DNA polymerase and lane 5: Taq DNA polymerase. M2: NZYladder I
    Nebnext Q5, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nebnext q5/product/New England Biolabs
    Average 90 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    nebnext q5 - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    95
    New England Biolabs ultra ii q5 master mix
    Performance of four thermostable <t>DNA</t> polymerases for the synthesis of gene B using PCA-DTF. Lane 1: negative control reaction performed at the same conditions, without addition of primers; lane 2: KOD Hot Start DNA polymerase; lane 3: <t>Q5</t> Hot Start High Fidelity DNA polymerase; lane 4: Pfu Turbo DNA polymerase and lane 5: Taq DNA polymerase. M2: NZYladder I
    Ultra Ii Q5 Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 247 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ultra ii q5 master mix/product/New England Biolabs
    Average 95 stars, based on 247 article reviews
    Price from $9.99 to $1999.99
    ultra ii q5 master mix - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    New England Biolabs pcr mutagenesis
    Phosphomimetic mutant of FOXO1 Ser-329 abrogates S. gordonii -mediated antagonism of FOXO1 activation. ( A ) TIGK cells were transiently transfected dually with FOXO1, FOXO1S329E, or FOXO1S329A, along with the FOXO promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Cells were challenged with P. gingivalis ( Pg ) and/or S. gordonii ( Sg ) at MOI:50 for each strain for 15 min. Control cells were noninfected (NI). FOXO luciferase was normalized to the level of Renilla luciferase. ( B ) TIGK cells were transiently transfected with FOXO1, FOXO1S329E, or FOXO1S329A and challenged with bacteria as in A for 24 h. <t>ZEB2</t> mRNA levels were measured by <t>qRT-PCR.</t> Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P
    Pcr Mutagenesis, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 324 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr mutagenesis/product/New England Biolabs
    Average 95 stars, based on 324 article reviews
    Price from $9.99 to $1999.99
    pcr mutagenesis - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    82
    New England Biolabs q5 polymerase amplification
    Phosphomimetic mutant of FOXO1 Ser-329 abrogates S. gordonii -mediated antagonism of FOXO1 activation. ( A ) TIGK cells were transiently transfected dually with FOXO1, FOXO1S329E, or FOXO1S329A, along with the FOXO promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Cells were challenged with P. gingivalis ( Pg ) and/or S. gordonii ( Sg ) at MOI:50 for each strain for 15 min. Control cells were noninfected (NI). FOXO luciferase was normalized to the level of Renilla luciferase. ( B ) TIGK cells were transiently transfected with FOXO1, FOXO1S329E, or FOXO1S329A and challenged with bacteria as in A for 24 h. <t>ZEB2</t> mRNA levels were measured by <t>qRT-PCR.</t> Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P
    Q5 Polymerase Amplification, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 82/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 polymerase amplification/product/New England Biolabs
    Average 82 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    q5 polymerase amplification - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    85
    New England Biolabs shs231 target site
    Stable expression, functional gene editing, and gene activation by <t>SHS231</t> integrated transgenes. (A) cultured in the absence of antibiotic selection. (B) Relative Cas9 expression level (cycle threshold [Ct]) from a SHS231 integrated Cas9 cassette compared to cells transduced with high-titer Cas9 expressing lentivirus or the endogenous expression level of GAPDH. Both SHS231 and lentiviral Cas9 variants were expressed from the human EF1α promoter. (C) Targeted deletion of a 17,188 bp gDNA segment of the PAX3 / FOXO1 fusion oncogene in a third RMS cell line, Rh30, by Cas9 protein expressed from the SHS231 locus. Dual gRNA target sites ( blue and green triangles ) and deletion PCR primer sites ( purple arrows ) are identified. (D) Demonstration of endogenous MYF5 gene activation with SHS231 expressed dCas9-VPR and Cas9-VPR transgenes relative to wild-type (unmodified) RMS cells. Gene activation was achieved by targeting full-length (20 bp) or truncated (14 bp) gRNAs ( blue , green , and red triangles ) to the promoter region of the MYF5 gene.
    Shs231 Target Site, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shs231 target site/product/New England Biolabs
    Average 85 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    shs231 target site - by Bioz Stars, 2020-02
    85/100 stars
      Buy from Supplier

    95
    New England Biolabs high fidelity pcr kit
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    High Fidelity Pcr Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity pcr kit/product/New England Biolabs
    Average 95 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    high fidelity pcr kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    83
    New England Biolabs q5 polymerase reagents
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    Q5 Polymerase Reagents, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 83/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 polymerase reagents/product/New England Biolabs
    Average 83 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    q5 polymerase reagents - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    79
    New England Biolabs 2x q5 polymerase
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    2x Q5 Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 79/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/2x q5 polymerase/product/New England Biolabs
    Average 79 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    2x q5 polymerase - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    80
    New England Biolabs q5 polymerase mastermix
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    Q5 Polymerase Mastermix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 80/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 polymerase mastermix/product/New England Biolabs
    Average 80 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    q5 polymerase mastermix - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    94
    New England Biolabs apha3 cassette
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    Apha3 Cassette, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/apha3 cassette/product/New England Biolabs
    Average 94 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    apha3 cassette - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    93
    New England Biolabs 5x q5 buffer
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    5x Q5 Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5x q5 buffer/product/New England Biolabs
    Average 93 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    5x q5 buffer - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    91
    New England Biolabs q5 enzyme
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    Q5 Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 91/100, based on 41 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 enzyme/product/New England Biolabs
    Average 91 stars, based on 41 article reviews
    Price from $9.99 to $1999.99
    q5 enzyme - by Bioz Stars, 2020-02
    91/100 stars
      Buy from Supplier

    93
    New England Biolabs q5 polymerase master mix
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    Q5 Polymerase Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 polymerase master mix/product/New England Biolabs
    Average 93 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    q5 polymerase master mix - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    91
    New England Biolabs q5 sdm kit
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    Q5 Sdm Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 91/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 sdm kit/product/New England Biolabs
    Average 91 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    q5 sdm kit - by Bioz Stars, 2020-02
    91/100 stars
      Buy from Supplier

    79
    New England Biolabs hot start hifi mix
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    Hot Start Hifi Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 79/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hot start hifi mix/product/New England Biolabs
    Average 79 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    hot start hifi mix - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    78
    New England Biolabs 1×q5 reaction buffer
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    1×Q5 Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 78/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1×q5 reaction buffer/product/New England Biolabs
    Average 78 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    1×q5 reaction buffer - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    89
    New England Biolabs q5 high gc enhancer buffer
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    Q5 High Gc Enhancer Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 89/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 high gc enhancer buffer/product/New England Biolabs
    Average 89 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    q5 high gc enhancer buffer - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    96
    New England Biolabs pcr reaction
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    Pcr Reaction, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 3893 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr reaction/product/New England Biolabs
    Average 96 stars, based on 3893 article reviews
    Price from $9.99 to $1999.99
    pcr reaction - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    93
    New England Biolabs 1x q5 buffer
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    1x Q5 Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 52 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x q5 buffer/product/New England Biolabs
    Average 93 stars, based on 52 article reviews
    Price from $9.99 to $1999.99
    1x q5 buffer - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    83
    New England Biolabs q5 dna polymerase master mix
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    Q5 Dna Polymerase Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 83/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 dna polymerase master mix/product/New England Biolabs
    Average 83 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    q5 dna polymerase master mix - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    94
    New England Biolabs pcr amplified
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    Pcr Amplified, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 2906 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/New England Biolabs
    Average 94 stars, based on 2906 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    86
    New England Biolabs q5 pcr mutagenesis
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    Q5 Pcr Mutagenesis, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 pcr mutagenesis/product/New England Biolabs
    Average 86 stars, based on 32 article reviews
    Price from $9.99 to $1999.99
    q5 pcr mutagenesis - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    95
    New England Biolabs dna polymerases
    Dependence of the transformation efficiency on the incubation time with the donor <t>DNA.</t> The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic <t>PCR</t> fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.
    Dna Polymerases, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 589 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerases/product/New England Biolabs
    Average 95 stars, based on 589 article reviews
    Price from $9.99 to $1999.99
    dna polymerases - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for Q5 DNA polymerase; the other three control amplicons are no larger than 3.4 kb.

    Journal: Bio-protocol

    Article Title: CRISPR/Cas9 Editing of the Bacillus subtilis Genome

    doi: 10.21769/BioProtoc.2272

    Figure Lengend Snippet: PCR based verification of genome edit A. A schematic representation showing the locations of PCR primers used in panel B; B. Agarose gel stained with ethidium bromide of amplified PCR products using primers specific to the point mutation (H743A, for which we changed CAC→GCT) and the B. subtilis chromosome (left panel), and using primers specific to the editing plasmid (right panel). Of twelve isolates screened all were found to have the predicted point mutation, and two of twelve retained resistance to spectinomycin (asterisks). The slow migrating band in the PY79 lane corresponds to nonspecific PCR amplification in the wild type background. The editing plasmid was detectable in spectinomycin resistant isolates, but not in the remaining ten. C. Agarose gel stained with ethidium bromide of PCR reactions using primers specific for deletion of four B. subtilis genes. Primers were designed outside of the editing template, and are therefore specific to chromosomal DNA. For all four deletions, all isolates were found to be spectinomycin sensitive, and PCR genotyping of three isolates for each deletion found that all isolates tested had the intended deletion. Note that for the control reaction for ponA , the PCR product is faint because the amplicon is approximately 5 kb and the extension time of the PCR was 3 min, which is near the limit for complete extension for Q5 DNA polymerase; the other three control amplicons are no larger than 3.4 kb.

    Article Snippet: The PCR program used to linearize pPB41 is: PCR amplify CRISPR/Cas9 using plasmid generated in step B1 ( ) Amplify plasmid generated in step B1 (pPB43 in the example) via PCR using Q5 DNA polymerase (NEB) and primers oPEB232 and oPEB234.

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining, Amplification, Mutagenesis, Plasmid Preparation

    Performance of four thermostable DNA polymerases for the synthesis of gene B using PCA-DTF. Lane 1: negative control reaction performed at the same conditions, without addition of primers; lane 2: KOD Hot Start DNA polymerase; lane 3: Q5 Hot Start High Fidelity DNA polymerase; lane 4: Pfu Turbo DNA polymerase and lane 5: Taq DNA polymerase. M2: NZYladder I

    Journal: BMC Biotechnology

    Article Title: Development of a gene synthesis platform for the efficient large scale production of small genes encoding animal toxins

    doi: 10.1186/s12896-016-0316-3

    Figure Lengend Snippet: Performance of four thermostable DNA polymerases for the synthesis of gene B using PCA-DTF. Lane 1: negative control reaction performed at the same conditions, without addition of primers; lane 2: KOD Hot Start DNA polymerase; lane 3: Q5 Hot Start High Fidelity DNA polymerase; lane 4: Pfu Turbo DNA polymerase and lane 5: Taq DNA polymerase. M2: NZYladder I

    Article Snippet: Finally, extension was performed at 70 °C for 3 s for KOD Hot Start DNA polymerase, 72 °C for 30 s for Pfu Turbo and Taq, and 72 °C for 15 s for Q5® Hot Star High Fidelity DNA polymerase.

    Techniques: Negative Control

    Phosphomimetic mutant of FOXO1 Ser-329 abrogates S. gordonii -mediated antagonism of FOXO1 activation. ( A ) TIGK cells were transiently transfected dually with FOXO1, FOXO1S329E, or FOXO1S329A, along with the FOXO promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Cells were challenged with P. gingivalis ( Pg ) and/or S. gordonii ( Sg ) at MOI:50 for each strain for 15 min. Control cells were noninfected (NI). FOXO luciferase was normalized to the level of Renilla luciferase. ( B ) TIGK cells were transiently transfected with FOXO1, FOXO1S329E, or FOXO1S329A and challenged with bacteria as in A for 24 h. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: Phosphomimetic mutant of FOXO1 Ser-329 abrogates S. gordonii -mediated antagonism of FOXO1 activation. ( A ) TIGK cells were transiently transfected dually with FOXO1, FOXO1S329E, or FOXO1S329A, along with the FOXO promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Cells were challenged with P. gingivalis ( Pg ) and/or S. gordonii ( Sg ) at MOI:50 for each strain for 15 min. Control cells were noninfected (NI). FOXO luciferase was normalized to the level of Renilla luciferase. ( B ) TIGK cells were transiently transfected with FOXO1, FOXO1S329E, or FOXO1S329A and challenged with bacteria as in A for 24 h. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Mutagenesis, Activation Assay, Transfection, Luciferase, Plasmid Preparation, Expressing, Quantitative RT-PCR

    Impact of dual species challenge on ZEB2 mRNA and associated phenotypic properties. ( A and B ) ZEB2 mRNA levels measured by qRT-PCR in TIGK cells infected with P. gingivalis 33277 ( Pg ) alone or together with F. nucleatum ( Fn ) or with oral streptococcal species. Sc , S. cristatus ; Sg , S. gordonii ; So , S. oralis ; Ss , S. sanguinis . Monoinfection was MOI:100 for 24 h. Dual species infection was MOI:100 for each strain for 24 h. ( C ) Quantitative analysis of TIGK migration through matrigel-coated transwells. TIGK cells were transiently transfected with siRNA to ZEB2 (siZEB2) or scrambled siRNA (siControl) ( Left ) or nontransfected ( Right ). TIGKs were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Control cells were not infected (NI). Data are presented as the mean number of cells invading through the transwell. ( D ) ZEB2 was silenced with siRNA ( Left ), and TIGKs were challenged with bacteria as in C for 2 h. IL-6 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. ** P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: Impact of dual species challenge on ZEB2 mRNA and associated phenotypic properties. ( A and B ) ZEB2 mRNA levels measured by qRT-PCR in TIGK cells infected with P. gingivalis 33277 ( Pg ) alone or together with F. nucleatum ( Fn ) or with oral streptococcal species. Sc , S. cristatus ; Sg , S. gordonii ; So , S. oralis ; Ss , S. sanguinis . Monoinfection was MOI:100 for 24 h. Dual species infection was MOI:100 for each strain for 24 h. ( C ) Quantitative analysis of TIGK migration through matrigel-coated transwells. TIGK cells were transiently transfected with siRNA to ZEB2 (siZEB2) or scrambled siRNA (siControl) ( Left ) or nontransfected ( Right ). TIGKs were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Control cells were not infected (NI). Data are presented as the mean number of cells invading through the transwell. ( D ) ZEB2 was silenced with siRNA ( Left ), and TIGKs were challenged with bacteria as in C for 2 h. IL-6 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. ** P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Quantitative RT-PCR, Infection, Migration, Transfection

    P. gingivalis up-regulates transcription factors controlling EMT. ( A and B ) TIGK cells were infected with P. gingivalis 33277 at the times and MOIs indicated. ZEB2 ( A ) or TWIST1/2 ( B ) mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( C ) Fluorescent confocal microscopy of TIGK cells infected with P. gingivalis 33277 ( Pg ) at the MOI indicated for 24 h. Control cells were noninfected (NI). Cells were fixed and probed with ZEB2 antibodies (green). Actin (red) was stained with Texas Red-phalloidin, and nuclei (blue) were stained with DAPI. Cells were imaged at magnification 63×. Shown are merged images of projections of z-stacks ( Left ) and Pearson’s correlation coefficient of ZEB2 with nuclei ( Right ) obtained with Volocity software. ( D ) TIGK cells were infected with P. gingivalis strains at MOI:100 for 24 h. ZEB2 mRNA levels were determined as in A . ( E ) ZEB2 mRNA levels in different cell types following P. gingivalis 33277 infection for 24 h. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: P. gingivalis up-regulates transcription factors controlling EMT. ( A and B ) TIGK cells were infected with P. gingivalis 33277 at the times and MOIs indicated. ZEB2 ( A ) or TWIST1/2 ( B ) mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( C ) Fluorescent confocal microscopy of TIGK cells infected with P. gingivalis 33277 ( Pg ) at the MOI indicated for 24 h. Control cells were noninfected (NI). Cells were fixed and probed with ZEB2 antibodies (green). Actin (red) was stained with Texas Red-phalloidin, and nuclei (blue) were stained with DAPI. Cells were imaged at magnification 63×. Shown are merged images of projections of z-stacks ( Left ) and Pearson’s correlation coefficient of ZEB2 with nuclei ( Right ) obtained with Volocity software. ( D ) TIGK cells were infected with P. gingivalis strains at MOI:100 for 24 h. ZEB2 mRNA levels were determined as in A . ( E ) ZEB2 mRNA levels in different cell types following P. gingivalis 33277 infection for 24 h. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Infection, Quantitative RT-PCR, Confocal Microscopy, Staining, Software

    ZEB2 responses to P. gingivalis are controlled by β-catenin and FOXO1 pathways. ( A ) TIGK cells were transiently transfected with siRNA to β-catenin or scrambled siRNA (siControl) and infected with P. gingivalis 33277 for 24 h at the MOI indicated. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( B ) TIGK cells were transiently transfected with plasmid expressing full-length β-catenin, a Δ151 truncation derivative, or with empty vector. Cells were challenged with P. gingivalis and ZEB2 mRNA measured as described in A . ( C ) TIGK cells were challenged with P. gingivalis strains for 24 h at the MOI indicated. WT, P. gingivalis 33277; ΔrgpA/B, deletion mutant of the rgpA and rgpB arginine gingipain genes; Δkgp, deletion mutant of the kgp lysine gingipain gene; ΔrgpAB Δkgp, triple gingipain deletion mutant; TLCK, WT preincubated with the protease inhibitor TLCK (100 µM, 2 h). ZEB2 mRNA was measured as described in A . ( D and E ) TIGK cells were transiently transfected with siRNA to TCF7L2/TCF7L3/TCF7, or TCF7L1 ( D ), FOXO1 or FOXO3 ( E ), or control scrambled siRNA. Cells were challenged with P. gingivalis , and ZEB2 mRNA was measured as described in A . ( F ) TIGK cells were transiently transfected with siRNA to FOXO1 or control scrambled siRNA. Cells were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Quantitative analysis of TIGK migration through matrigel-coated transwells is presented as the mean number of migrated cells. ( G ) TIGK cells were challenged with P. gingivalis 33277 MOI:100 for 24 h, or left uninfected (NI), and subjected to chromatin immunoprecipitation (ChIP) using anti-FOXO1 IgG, anti-TCF7L1 IgG, or preimmune IgG. The precipitated DNA was subsequently analyzed by end point PCR and by qPCR with primers to the ZEB2 promoter region or the GAPDH promoter as a control. qPCR was expressed relative to the input DNA. ( H ) Luciferase assay for ZEB2 promoter activity in TIGKs challenged with P. gingivalis 33277 MOI:100 for 30 min, or left uninfected (NI). Cells were transiently transfected with a ZEB2 promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Derivatives of the ZEB2 promoter included serial deletions and site-specific mutations (denoted X) in the FOXO1 binding sites. FOXO luciferase activity was normalized to the level of Renilla luciferase. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Streptococcus gordonii programs epithelial cells to resist ZEB2 induction by Porphyromonas gingivalis

    doi: 10.1073/pnas.1900101116

    Figure Lengend Snippet: ZEB2 responses to P. gingivalis are controlled by β-catenin and FOXO1 pathways. ( A ) TIGK cells were transiently transfected with siRNA to β-catenin or scrambled siRNA (siControl) and infected with P. gingivalis 33277 for 24 h at the MOI indicated. ZEB2 mRNA levels were measured by qRT-PCR. Data were normalized to GAPDH mRNA and are expressed relative to noninfected (NI) controls. ( B ) TIGK cells were transiently transfected with plasmid expressing full-length β-catenin, a Δ151 truncation derivative, or with empty vector. Cells were challenged with P. gingivalis and ZEB2 mRNA measured as described in A . ( C ) TIGK cells were challenged with P. gingivalis strains for 24 h at the MOI indicated. WT, P. gingivalis 33277; ΔrgpA/B, deletion mutant of the rgpA and rgpB arginine gingipain genes; Δkgp, deletion mutant of the kgp lysine gingipain gene; ΔrgpAB Δkgp, triple gingipain deletion mutant; TLCK, WT preincubated with the protease inhibitor TLCK (100 µM, 2 h). ZEB2 mRNA was measured as described in A . ( D and E ) TIGK cells were transiently transfected with siRNA to TCF7L2/TCF7L3/TCF7, or TCF7L1 ( D ), FOXO1 or FOXO3 ( E ), or control scrambled siRNA. Cells were challenged with P. gingivalis , and ZEB2 mRNA was measured as described in A . ( F ) TIGK cells were transiently transfected with siRNA to FOXO1 or control scrambled siRNA. Cells were challenged with P. gingivalis 33277 and/or S. gordonii at MOI:50 for each strain for 24 h. Quantitative analysis of TIGK migration through matrigel-coated transwells is presented as the mean number of migrated cells. ( G ) TIGK cells were challenged with P. gingivalis 33277 MOI:100 for 24 h, or left uninfected (NI), and subjected to chromatin immunoprecipitation (ChIP) using anti-FOXO1 IgG, anti-TCF7L1 IgG, or preimmune IgG. The precipitated DNA was subsequently analyzed by end point PCR and by qPCR with primers to the ZEB2 promoter region or the GAPDH promoter as a control. qPCR was expressed relative to the input DNA. ( H ) Luciferase assay for ZEB2 promoter activity in TIGKs challenged with P. gingivalis 33277 MOI:100 for 30 min, or left uninfected (NI). Cells were transiently transfected with a ZEB2 promoter–luciferase reporter plasmid, or a constitutively expressing Renilla luciferase reporter. Derivatives of the ZEB2 promoter included serial deletions and site-specific mutations (denoted X) in the FOXO1 binding sites. FOXO luciferase activity was normalized to the level of Renilla luciferase. Quantitative data represent three independent experiments with three replicates. Error bars represent the SEM. * P > 0.05, ** P

    Article Snippet: A series of ZEB2 promoter fragments containing mutations were generated by PCR mutagenesis (Q5 Site-Directed Mutagenesis Kit from NEB).

    Techniques: Transfection, Infection, Quantitative RT-PCR, Plasmid Preparation, Expressing, Mutagenesis, Protease Inhibitor, Migration, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Luciferase, Activity Assay, Binding Assay

    Stable expression, functional gene editing, and gene activation by SHS231 integrated transgenes. (A) cultured in the absence of antibiotic selection. (B) Relative Cas9 expression level (cycle threshold [Ct]) from a SHS231 integrated Cas9 cassette compared to cells transduced with high-titer Cas9 expressing lentivirus or the endogenous expression level of GAPDH. Both SHS231 and lentiviral Cas9 variants were expressed from the human EF1α promoter. (C) Targeted deletion of a 17,188 bp gDNA segment of the PAX3 / FOXO1 fusion oncogene in a third RMS cell line, Rh30, by Cas9 protein expressed from the SHS231 locus. Dual gRNA target sites ( blue and green triangles ) and deletion PCR primer sites ( purple arrows ) are identified. (D) Demonstration of endogenous MYF5 gene activation with SHS231 expressed dCas9-VPR and Cas9-VPR transgenes relative to wild-type (unmodified) RMS cells. Gene activation was achieved by targeting full-length (20 bp) or truncated (14 bp) gRNAs ( blue , green , and red triangles ) to the promoter region of the MYF5 gene.

    Journal: Human Gene Therapy

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion

    doi: 10.1089/hum.2018.169

    Figure Lengend Snippet: Stable expression, functional gene editing, and gene activation by SHS231 integrated transgenes. (A) cultured in the absence of antibiotic selection. (B) Relative Cas9 expression level (cycle threshold [Ct]) from a SHS231 integrated Cas9 cassette compared to cells transduced with high-titer Cas9 expressing lentivirus or the endogenous expression level of GAPDH. Both SHS231 and lentiviral Cas9 variants were expressed from the human EF1α promoter. (C) Targeted deletion of a 17,188 bp gDNA segment of the PAX3 / FOXO1 fusion oncogene in a third RMS cell line, Rh30, by Cas9 protein expressed from the SHS231 locus. Dual gRNA target sites ( blue and green triangles ) and deletion PCR primer sites ( purple arrows ) are identified. (D) Demonstration of endogenous MYF5 gene activation with SHS231 expressed dCas9-VPR and Cas9-VPR transgenes relative to wild-type (unmodified) RMS cells. Gene activation was achieved by targeting full-length (20 bp) or truncated (14 bp) gRNAs ( blue , green , and red triangles ) to the promoter region of the MYF5 gene.

    Article Snippet: SHS231-specific targeted integration was confirmed with PCR amplification of the SHS231 target site (Q5 polymerase; New England Biolabs) using a transgene-specific and adjacent, genome-anchored primer pair (SHS231 gFwd: GAACCAGAGCCACCCAGTTG, and Bxb1 rev; GTTTGTACCGTACACCACTGAGAC).

    Techniques: Expressing, Functional Assay, Activation Assay, Cell Culture, Selection, Transduction, Polymerase Chain Reaction

    Structure of three representative new target sites indicating location of mCreI, Cas9, and TALEN target sites. The top two sequence diagrams detail features of the chr2 SHS229 and SHS253, whereas the bottom diagram provides additional detail and results on the chr 4q SHS231. Locations of cleavage sites for mCreI, TALEN, and CRISPR/Cas9 nucleases centered on mCreI target/cleavage sites (key shown top right ). The SHS231 repair template is shown below the chr 4 target site region, which also indicates the location of the variable 108 bp SINE-derived insertion sequence identified in one or both alleles of a subset of the cell lines examined. The bottom panel shows independently cloned and sequenced inserts from targeted SHS231 insertions by all three nucleases. The mCreI targeting experiments used an expression vector that encoded both mCreI and the TREX2 nuclease (see text), and Cas9 targeting was performed using a common guide RNA and either a Cas9 cleavase or nickase. Numbers to the right of each row indicate the number of independent targeting events that were cloned and sequenced (see text for additional details).

    Journal: Human Gene Therapy

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion

    doi: 10.1089/hum.2018.169

    Figure Lengend Snippet: Structure of three representative new target sites indicating location of mCreI, Cas9, and TALEN target sites. The top two sequence diagrams detail features of the chr2 SHS229 and SHS253, whereas the bottom diagram provides additional detail and results on the chr 4q SHS231. Locations of cleavage sites for mCreI, TALEN, and CRISPR/Cas9 nucleases centered on mCreI target/cleavage sites (key shown top right ). The SHS231 repair template is shown below the chr 4 target site region, which also indicates the location of the variable 108 bp SINE-derived insertion sequence identified in one or both alleles of a subset of the cell lines examined. The bottom panel shows independently cloned and sequenced inserts from targeted SHS231 insertions by all three nucleases. The mCreI targeting experiments used an expression vector that encoded both mCreI and the TREX2 nuclease (see text), and Cas9 targeting was performed using a common guide RNA and either a Cas9 cleavase or nickase. Numbers to the right of each row indicate the number of independent targeting events that were cloned and sequenced (see text for additional details).

    Article Snippet: SHS231-specific targeted integration was confirmed with PCR amplification of the SHS231 target site (Q5 polymerase; New England Biolabs) using a transgene-specific and adjacent, genome-anchored primer pair (SHS231 gFwd: GAACCAGAGCCACCCAGTTG, and Bxb1 rev; GTTTGTACCGTACACCACTGAGAC).

    Techniques: Sequencing, CRISPR, Derivative Assay, Clone Assay, Expressing, Plasmid Preparation

    Integration of transgenes into chromosome 4q SHS231 locus using homology-independent non-homologous end joining (NHEJ) DNA repair mechanisms. (A) Homology-independent transgene integration is mediated by targeting both the repair template and genomic target site using dual CRISPR guide RNAs (gRNAs; blue and green triangles represent gRNA target sites). The structure of a SH231 repair template expressing the puromycin resistance gene is indicated, including the size of a puromycin transgene cassette and locations of CRISPR gRNAs. Representative sequences from the 5′ transgene integration site after knock-in-specific polymerase chain reaction (PCR) amplification (PCR primers; purple arrows ). (B) Crystal violet staining was used to visualize the percentage of stable puromycin-resistant colonies resulting from 3 × 10 4 transfected cells after 10 days in culture. No colonies were identified from CRISPR only or repair template only controls. (C) Quantification of crystal violet staining from SHS231 knock-in stable cells generated from the same RMS cell lines used in (B) above. Asterisk indicates significant difference between NHEJ- and HDR-mediated SHS231 knock-in approaches, p

    Journal: Human Gene Therapy

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion

    doi: 10.1089/hum.2018.169

    Figure Lengend Snippet: Integration of transgenes into chromosome 4q SHS231 locus using homology-independent non-homologous end joining (NHEJ) DNA repair mechanisms. (A) Homology-independent transgene integration is mediated by targeting both the repair template and genomic target site using dual CRISPR guide RNAs (gRNAs; blue and green triangles represent gRNA target sites). The structure of a SH231 repair template expressing the puromycin resistance gene is indicated, including the size of a puromycin transgene cassette and locations of CRISPR gRNAs. Representative sequences from the 5′ transgene integration site after knock-in-specific polymerase chain reaction (PCR) amplification (PCR primers; purple arrows ). (B) Crystal violet staining was used to visualize the percentage of stable puromycin-resistant colonies resulting from 3 × 10 4 transfected cells after 10 days in culture. No colonies were identified from CRISPR only or repair template only controls. (C) Quantification of crystal violet staining from SHS231 knock-in stable cells generated from the same RMS cell lines used in (B) above. Asterisk indicates significant difference between NHEJ- and HDR-mediated SHS231 knock-in approaches, p

    Article Snippet: SHS231-specific targeted integration was confirmed with PCR amplification of the SHS231 target site (Q5 polymerase; New England Biolabs) using a transgene-specific and adjacent, genome-anchored primer pair (SHS231 gFwd: GAACCAGAGCCACCCAGTTG, and Bxb1 rev; GTTTGTACCGTACACCACTGAGAC).

    Techniques: Non-Homologous End Joining, CRISPR, Expressing, Knock-In, Polymerase Chain Reaction, Amplification, Staining, Transfection, Generated

    Dependence of the transformation efficiency on the incubation time with the donor DNA. The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic PCR fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.

    Journal: Applied and Environmental Microbiology

    Article Title: Use of Natural Transformation To Establish an Easy Knockout Method in Riemerella anatipestifer

    doi: 10.1128/AEM.00127-17

    Figure Lengend Snippet: Dependence of the transformation efficiency on the incubation time with the donor DNA. The recipient cell was R. anatipestifer ATCC 11845, and the donors were the RA0C_1193 mutagenic PCR fragments. DNase I (50 μg/ml) was added at the indicated times after the addition of DNA. Erm r transformants were selected after 1 h of incubation.

    Article Snippet: The DNA fragments were amplified in a Hybaid PCR thermocycler using the high-fidelity PCR kit (NEB, USA).

    Techniques: Transformation Assay, Incubation, Polymerase Chain Reaction

    Transformation competition experiments. Competent R. anatipestifer ATCC 11845 was transformed with 1 μg RA0C_1193 mutagenic PCR fragments alone (control), 1 μg of RA0C_1193 mutagenic PCR fragments mixed with 1 μg of competing chromosomal DNA of E. coli XL1-Blue, or chromosomal DNA of R. anatipestifer ATCC 11845 as indicated for 1 h. The averages and standard deviations of three independent experiments are shown. The numbers above each data point represent P values from comparisons (paired one-tailed Student's t test) of the average relative transformation frequencies with E. coli DNA as the competing DNA and R. anatipestifer ATCC 11845 DNA as the competing DNA.

    Journal: Applied and Environmental Microbiology

    Article Title: Use of Natural Transformation To Establish an Easy Knockout Method in Riemerella anatipestifer

    doi: 10.1128/AEM.00127-17

    Figure Lengend Snippet: Transformation competition experiments. Competent R. anatipestifer ATCC 11845 was transformed with 1 μg RA0C_1193 mutagenic PCR fragments alone (control), 1 μg of RA0C_1193 mutagenic PCR fragments mixed with 1 μg of competing chromosomal DNA of E. coli XL1-Blue, or chromosomal DNA of R. anatipestifer ATCC 11845 as indicated for 1 h. The averages and standard deviations of three independent experiments are shown. The numbers above each data point represent P values from comparisons (paired one-tailed Student's t test) of the average relative transformation frequencies with E. coli DNA as the competing DNA and R. anatipestifer ATCC 11845 DNA as the competing DNA.

    Article Snippet: The DNA fragments were amplified in a Hybaid PCR thermocycler using the high-fidelity PCR kit (NEB, USA).

    Techniques: Transformation Assay, Polymerase Chain Reaction, One-tailed Test