q-solution Qiagen Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher trizol reagent
    HPSE1, HER2 and Syndecan-1 mRNA expression in MCF10A, SKBR3, MCF7 and MCF7-HPSE1. The <t>RNA</t> was extracted using <t>TRIzol</t> reagent, converted into cDNA by RT-PCR and submitted to qRT-PCR using specific primers for HER2, Syn-1 and HPSE1, as described in methods. The values were corrected by RPL13a (ribosomal protein) and GAPDH expressions. Each bar indicates the mean ± SD of triplicate assays. *P
    Trizol Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 635164 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trizol reagent/product/Thermo Fisher
    Average 99 stars, based on 635164 article reviews
    Price from $9.99 to $1999.99
    trizol reagent - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen taq dna polymerase
    Slowly migrating DNAs are converted into ocDNA by <t>Taq</t> (A) or T4 (B) <t>DNA</t> polymerase treatment. The blots were hybridized with a C1-sense RNA probe. The positions of ocDNA, linear DNA (linDNA), scDNA, and cssDNA forms of viral DNA are indicated. Slowly migrating viral DNAs are indicated with an asterisk (∗). (A) TNAs were extracted from wt protoplasts at 72 h posttransfection with pTOM6 alone (the two lanes on the right) or together with pTOM100C4(−) or pTOM100NT and analyzed directly (−) or following incubation with Taq DNA polymerase for the time indicated below. (B) TNAs were extracted from wt or transgenic (102.22) protoplasts at 72 h posttransfection with pSP97 (TYLCSV-ES[1]) and analyzed following a 1-h incubation with (+) or without (−) T4 DNA polymerase. Lane C, TNAs from a TYLCSV-infected tomato plant digested with Bgl II to show migration of linear DNA.
    Taq Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 9405 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Qiagen
    Average 99 stars, based on 9405 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen onestep rt pcr kit
    Validation of model predictions using targeted amplification of editable sites from single cells. ( a ) Wiggle plots showing coverage in 3′-untranslated regions for B2m, Anxa5 and Cybb in the 24 bone marrow-derived macrophages profiled. ( b – d ) Sequence alignments from targeted <t>RT–PCR</t> amplification and Sanger sequencing of bacterial colonies for ( b ) B2m, ( c ) Anxa5 and ( d ) Cybb transcripts from gDNA and cDNA from a bulk sample (amplified using standard PCR), and cDNA of single cells (amplified using a modified <t>OneStep</t> RT–PCR protocol, per Supplementary Fig. 4 ). Alignments, showing the sequence space surrounding a particular editable site, are clustered by sample. Alignments are colour-coded to indicate whether the sequence aligned contained (red) or lacked (grey) editing in the length of the amplicon. Though a C-to-U change may not be shown in the narrow window illustrated, a red sequence would indicate that the amplicon sequence contained at least one C-to-U edit elsewhere (red). Lack of editing in the gDNA indicates that the C-to-U transitions observed are bona fide APOBEC1-mediated RNA editing events.
    Onestep Rt Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 14902 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onestep rt pcr kit/product/Qiagen
    Average 99 stars, based on 14902 article reviews
    Price from $9.99 to $1999.99
    onestep rt pcr kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen multiplex pcr kit
    H . pylori - specific <t>PCR</t> for <t>DNA</t> extracted from oral cavity. In this figure, one can see the amplification of VacA in the three cases previously identified as oral cavity positives for H. pylori (Hp positive sample #1 to #3), in comparison with other three cases that are oral cavity H. pylori negatives (Hp negative sample #1 to #3). As a positive control (Hp positive control) PCR for DNA extracted from H . pylori (strain 7354) diluted in saliva was used. Blank—PCR negative control.
    Multiplex Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 7207 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplex pcr kit/product/Qiagen
    Average 99 stars, based on 7207 article reviews
    Price from $9.99 to $1999.99
    multiplex pcr kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen hotstartaq dna polymerase
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); <t>HotStarTaq</t> = HotStarTaq <t>DNA</t> Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    Hotstartaq Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 6804 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstartaq dna polymerase/product/Qiagen
    Average 99 stars, based on 6804 article reviews
    Price from $9.99 to $1999.99
    hotstartaq dna polymerase - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen pyromark pcr kit
    Representation of the two sequence targets in the exon III of the OXTR gene. Legend: Representation of OXTR gene with the CpG island in green and the location of exon III in blue . The dashed lines show the amplification of the region analyzed that contains two targets, OXTR1 OXTR2. The target sequences are in the exon III of OXTR gene ( OXTR1 —cat. PM00016821 and OXTR2 —cat. PM00016828, QIAGEN), using the <t>PyroMark</t> <t>PCR</t> Kit (QIAGEN). Both regions are in the CpG island the comprise exons I–III. The OXTR1 target sequence has 34 pb with 4 CpG sites analyzed and the OXTR2 target sequence has 34 bp with 5 CpG sites analyzed
    Pyromark Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 3939 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pyromark pcr kit/product/Qiagen
    Average 99 stars, based on 3939 article reviews
    Price from $9.99 to $1999.99
    pyromark pcr kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen taq pcr core kit
    Representative CAG repeat distributions, and Msh3 variations in B6 and CBy mice. A) The autoradiographs show representative <t>SP-PCR</t> analyses of DNA, extracted from heart, liver, striatum and tail. At weaning the B6.Cg-R6/1 (B6) and CBy.Cg-R6/1 (CBy) congenic mice contained in tail DNA (CAG)98 and (CAG)94, respectively. For comparison the profiles of the Msh2 −/− mouse is shown. About 5–10 DNA amplifiable molecules were amplified in each reaction with primers MS-1F and MS-1R. Animals were 20-weeks old. B) Congenic CBy.Cg-R6/1 mice were crossed to B6 and the resulting F1 progeny were crossed to produce F2 mice with all possible genotypes at the Msh3 locus. Repeat instability was assayed by amplifying 10 ng genomic DNA using fluorescently labelled primers and resolving the fragments by capillary gel electrophoresis ( Figure 1B ). Using this high-resolution approach repeat length distributions present with the typical ‘hedgehog’ pattern ( e.g. [10] , [13] , [15] , [16] . This pattern reflects both somatic mosaicism within the sample and PCR artefacts generated by <t>Taq</t> polymerase slippage [62] , [63] . The PCR artefacts are predominantly repeat contractions, hence these are not considered here. The pattern of CAG repeat instability depended on genotype at the MSH3 locus. B6 homozygosity resulted in the greatest instability, CBy homozygosity resulted in lack of expansion, while heterozygosity resulted in an intermediate instability, indicative of a gene dosage effect of the Msh3 locus. Numbers indicate the CAG repeat size corresponding to major peaks. In addition, on the B6 tracing, a second number indicates the highest CAG repeat number detected. C) Msh3 polymorphisms in Msh3 gene from C57BL/6 (B6) and BALB/cBy (CBy) mice. Promoters were identical. SNPs were identified or confirmed to those in dbSNP by sequencing the Msh3 gene.
    Taq Pcr Core Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1500 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq pcr core kit/product/Qiagen
    Average 99 stars, based on 1500 article reviews
    Price from $9.99 to $1999.99
    taq pcr core kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen hotstartaq plus dna polymerase
    Effects of different concentrations and sizes of UCNPs on PCR amplification specificity. Three commercial real-time PCR master mixes were applied to determine the effects of different concentrations and sizes of UCNPs on the specificity of PCR amplification of a 120 bp 5S rDNA fragment from soybean genomic <t>DNA,</t> at an annealing temperature of 50°C. ( A ) AccuPower PCR PreMix with Top Polymerase (Bioneer). ( B ) AmpliTaq Gold 360 Master Mix with AmpliTaq Gold DNA Polymerase (Applied Biosystems). ( C ) <t>HotStarTaq</t> Plus Master Mix with HotStarTaq DNA Polymerase (Qiagen). Lane M: DNA marker; lane C: template without UCNPs; lanes 1∼5∶5, 7.5, 10, 15, and 30 nM of QDs, respectively; lanes 6∼8∶0.5, 0.75, and 1.0 µg/µL of 40-nm-sized UCNPs, respectively; lanes 9∼14∶1×( = 2.4×10 5 particles/µL), 10×, 15×, 20×, 25×, and 30× of 70-nm-sized UCNPs, respectively; lanes 15∼20∶1×, 10×, 15×, 20×, 25×, and 30× of 250-nm-sized UCNPs, respectively.
    Hotstartaq Plus Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1698 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstartaq plus dna polymerase/product/Qiagen
    Average 99 stars, based on 1698 article reviews
    Price from $9.99 to $1999.99
    hotstartaq plus dna polymerase - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen type it microsatellite pcr kit
    Overview of the ratios of alterations in the 30 tumours detected with the OncoScan assay compared to the <t>microsatellite</t> based multiplex <t>PCR</t> assays.
    Type It Microsatellite Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1285 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/type it microsatellite pcr kit/product/Qiagen
    Average 99 stars, based on 1285 article reviews
    Price from $9.99 to $1999.99
    type it microsatellite pcr kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen multiplex pcr master mix
    Gel image of <t>PCR</t> products amplified with the three customised multiplex PCR assays and visualised with the QIAxcel system. MPI ( left side ) comprises group/family-specific primers for seven taxa: beetles/thrips, spiders, aphids, earthworms, springtails, dipterans, and lacewings. MPII spiders ( upper right side ) covers two spider families, i.e. lycosids and linyphiids, as well as the genus Pachygnatha . MPII beetles/thrips ( lower right side ) addresses six taxa: the carabid genera Poecilus , Bembidion , Pterostichus, and Harpalus , the ladybeetle Coccinella septempunctata as well as thrips ( Frankliniella , Limothrips ). The shortest and longest fragments within each lane represent the two alignment markers (AM; 15 and 3000 bp) as indicated in the left panel . For amplicon lengths see Fig. 1 and Table 3 . Mixes of <t>DNA</t> templates of targets; approximately 1000 ds copies each in PCR
    Multiplex Pcr Master Mix, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 4530 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplex pcr master mix/product/Qiagen
    Average 99 stars, based on 4530 article reviews
    Price from $9.99 to $1999.99
    multiplex pcr master mix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen longrange pcr kit
    Gel image of <t>PCR</t> products amplified with the three customised multiplex PCR assays and visualised with the QIAxcel system. MPI ( left side ) comprises group/family-specific primers for seven taxa: beetles/thrips, spiders, aphids, earthworms, springtails, dipterans, and lacewings. MPII spiders ( upper right side ) covers two spider families, i.e. lycosids and linyphiids, as well as the genus Pachygnatha . MPII beetles/thrips ( lower right side ) addresses six taxa: the carabid genera Poecilus , Bembidion , Pterostichus, and Harpalus , the ladybeetle Coccinella septempunctata as well as thrips ( Frankliniella , Limothrips ). The shortest and longest fragments within each lane represent the two alignment markers (AM; 15 and 3000 bp) as indicated in the left panel . For amplicon lengths see Fig. 1 and Table 3 . Mixes of <t>DNA</t> templates of targets; approximately 1000 ds copies each in PCR
    Longrange Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 693 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/longrange pcr kit/product/Qiagen
    Average 99 stars, based on 693 article reviews
    Price from $9.99 to $1999.99
    longrange pcr kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen hotstar hifidelity polymerase kit
    Gel image of <t>PCR</t> products amplified with the three customised multiplex PCR assays and visualised with the QIAxcel system. MPI ( left side ) comprises group/family-specific primers for seven taxa: beetles/thrips, spiders, aphids, earthworms, springtails, dipterans, and lacewings. MPII spiders ( upper right side ) covers two spider families, i.e. lycosids and linyphiids, as well as the genus Pachygnatha . MPII beetles/thrips ( lower right side ) addresses six taxa: the carabid genera Poecilus , Bembidion , Pterostichus, and Harpalus , the ladybeetle Coccinella septempunctata as well as thrips ( Frankliniella , Limothrips ). The shortest and longest fragments within each lane represent the two alignment markers (AM; 15 and 3000 bp) as indicated in the left panel . For amplicon lengths see Fig. 1 and Table 3 . Mixes of <t>DNA</t> templates of targets; approximately 1000 ds copies each in PCR
    Hotstar Hifidelity Polymerase Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 430 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstar hifidelity polymerase kit/product/Qiagen
    Average 99 stars, based on 430 article reviews
    Price from $9.99 to $1999.99
    hotstar hifidelity polymerase kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen taq dna polymerase kit
    Gel image of <t>PCR</t> products amplified with the three customised multiplex PCR assays and visualised with the QIAxcel system. MPI ( left side ) comprises group/family-specific primers for seven taxa: beetles/thrips, spiders, aphids, earthworms, springtails, dipterans, and lacewings. MPII spiders ( upper right side ) covers two spider families, i.e. lycosids and linyphiids, as well as the genus Pachygnatha . MPII beetles/thrips ( lower right side ) addresses six taxa: the carabid genera Poecilus , Bembidion , Pterostichus, and Harpalus , the ladybeetle Coccinella septempunctata as well as thrips ( Frankliniella , Limothrips ). The shortest and longest fragments within each lane represent the two alignment markers (AM; 15 and 3000 bp) as indicated in the left panel . For amplicon lengths see Fig. 1 and Table 3 . Mixes of <t>DNA</t> templates of targets; approximately 1000 ds copies each in PCR
    Taq Dna Polymerase Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 449 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase kit/product/Qiagen
    Average 99 stars, based on 449 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen toptaq dna polymerase
    Gel image of <t>PCR</t> products amplified with the three customised multiplex PCR assays and visualised with the QIAxcel system. MPI ( left side ) comprises group/family-specific primers for seven taxa: beetles/thrips, spiders, aphids, earthworms, springtails, dipterans, and lacewings. MPII spiders ( upper right side ) covers two spider families, i.e. lycosids and linyphiids, as well as the genus Pachygnatha . MPII beetles/thrips ( lower right side ) addresses six taxa: the carabid genera Poecilus , Bembidion , Pterostichus, and Harpalus , the ladybeetle Coccinella septempunctata as well as thrips ( Frankliniella , Limothrips ). The shortest and longest fragments within each lane represent the two alignment markers (AM; 15 and 3000 bp) as indicated in the left panel . For amplicon lengths see Fig. 1 and Table 3 . Mixes of <t>DNA</t> templates of targets; approximately 1000 ds copies each in PCR
    Toptaq Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 456 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/toptaq dna polymerase/product/Qiagen
    Average 99 stars, based on 456 article reviews
    Price from $9.99 to $1999.99
    toptaq dna polymerase - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen fast cycling pcr kit
    FIGURE 1: C. <t>pneumoniae</t> is present more frequently in subgingival plaque obtained from periodontally diseased sites vs. healthy sites. Dental plaques were obtained from subgingival locations in ten healthy patients (HPt, four sites for each one) and in ten patients with periodontal disease (PPt). For patients with periodontal disease, subgingival dental plaques were obtained from both areas with periodontitis (P, two sites per subject) and areas without periodontitis (H, two sites per subject). All dental plaque samples were subjected to <t>PCR</t> followed by agarose gel electrophoresis. (A, C, E) Representative gel electrophoretogram of PCR products screening C. pneumoniae (A) , P. gingivalis (C) and A. actinomycetemcomitans (E) . Quantification of C. pneumoniae (B) , P. gingivalis (D) and A. actinomycetemcomitans (F) 16S rRNA, PCR products. (B, D, F) Healthy sites: n = 40 (only from healthy donors) and diseased sites: n = 20. For each dental plaque sample, seven different runs were performed for C. pneumoniae and three different runs for P. gingivalis and A. actinomycetemcomitans. Arrows indicate positive bands in the expected bp size. Error bars represent ± SD; 2-sided, paired Student's t test, * P ≤ 0.05, ***P≤0.001.
    Fast Cycling Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 654 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fast cycling pcr kit/product/Qiagen
    Average 99 stars, based on 654 article reviews
    Price from $9.99 to $1999.99
    fast cycling pcr kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen type it hrm pcr kit
    The distribution of the <t>HRM</t> measurements of the 5' junction of MON810 (5'-MON810) region tested with real-time <t>PCR.</t> For the HRM analysis the confidence values were divided into 10 classes. The values of these classes were plotted on the x -axis and the numbers of the samples for the classes on the y -axis.
    Type It Hrm Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 278 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/type it hrm pcr kit/product/Qiagen
    Average 99 stars, based on 278 article reviews
    Price from $9.99 to $1999.99
    type it hrm pcr kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    HPSE1, HER2 and Syndecan-1 mRNA expression in MCF10A, SKBR3, MCF7 and MCF7-HPSE1. The RNA was extracted using TRIzol reagent, converted into cDNA by RT-PCR and submitted to qRT-PCR using specific primers for HER2, Syn-1 and HPSE1, as described in methods. The values were corrected by RPL13a (ribosomal protein) and GAPDH expressions. Each bar indicates the mean ± SD of triplicate assays. *P

    Journal: BMC Cancer

    Article Title: Heparan sulfate mediates trastuzumab effect in breast cancer cells

    doi: 10.1186/1471-2407-13-444

    Figure Lengend Snippet: HPSE1, HER2 and Syndecan-1 mRNA expression in MCF10A, SKBR3, MCF7 and MCF7-HPSE1. The RNA was extracted using TRIzol reagent, converted into cDNA by RT-PCR and submitted to qRT-PCR using specific primers for HER2, Syn-1 and HPSE1, as described in methods. The values were corrected by RPL13a (ribosomal protein) and GAPDH expressions. Each bar indicates the mean ± SD of triplicate assays. *P

    Article Snippet: Cells were harvested and total-RNA was extracted using TRIzol reagent (Invitrogen) following the manufacturer's protocol. cDNA was synthesized using ImProm-II™ Reverse Transcription System (Promega, Madison, Wisconsin) and oligo (dT)12–18 (Invitrogen), following the manufacturer's protocol.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR

    Ratio of HER2, HPSE1 and Syn-1 mRNA expression of trastuzumab treated per non-treated breast cancer cells MCF7, MCF7-HPSE1 and SKBR3. These cells were treated for three days with 25 μg/mL of trastuzumab. The RNA was extracted using TRIzol reagent, converted into cDNA by RT-PCR and submitted to qRT-PCR using specific primers for HER2, Syn-1 and HPSE1. The mRNA expression of constitutive genes GAPDH and RPL13A was used to correct the mRNA expression of HER2, Syn-1 and HPSE1, as described in methods. Each bar indicates the mean ± SD of triplicate assays. *P

    Journal: BMC Cancer

    Article Title: Heparan sulfate mediates trastuzumab effect in breast cancer cells

    doi: 10.1186/1471-2407-13-444

    Figure Lengend Snippet: Ratio of HER2, HPSE1 and Syn-1 mRNA expression of trastuzumab treated per non-treated breast cancer cells MCF7, MCF7-HPSE1 and SKBR3. These cells were treated for three days with 25 μg/mL of trastuzumab. The RNA was extracted using TRIzol reagent, converted into cDNA by RT-PCR and submitted to qRT-PCR using specific primers for HER2, Syn-1 and HPSE1. The mRNA expression of constitutive genes GAPDH and RPL13A was used to correct the mRNA expression of HER2, Syn-1 and HPSE1, as described in methods. Each bar indicates the mean ± SD of triplicate assays. *P

    Article Snippet: Cells were harvested and total-RNA was extracted using TRIzol reagent (Invitrogen) following the manufacturer's protocol. cDNA was synthesized using ImProm-II™ Reverse Transcription System (Promega, Madison, Wisconsin) and oligo (dT)12–18 (Invitrogen), following the manufacturer's protocol.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR

    Slowly migrating DNAs are converted into ocDNA by Taq (A) or T4 (B) DNA polymerase treatment. The blots were hybridized with a C1-sense RNA probe. The positions of ocDNA, linear DNA (linDNA), scDNA, and cssDNA forms of viral DNA are indicated. Slowly migrating viral DNAs are indicated with an asterisk (∗). (A) TNAs were extracted from wt protoplasts at 72 h posttransfection with pTOM6 alone (the two lanes on the right) or together with pTOM100C4(−) or pTOM100NT and analyzed directly (−) or following incubation with Taq DNA polymerase for the time indicated below. (B) TNAs were extracted from wt or transgenic (102.22) protoplasts at 72 h posttransfection with pSP97 (TYLCSV-ES[1]) and analyzed following a 1-h incubation with (+) or without (−) T4 DNA polymerase. Lane C, TNAs from a TYLCSV-infected tomato plant digested with Bgl II to show migration of linear DNA.

    Journal: Journal of Virology

    Article Title: Transgenically Expressed T-Rep of Tomato Yellow Leaf Curl Sardinia Virus Acts as a trans-Dominant-Negative Mutant, Inhibiting Viral Transcription and Replication

    doi: 10.1128/JVI.75.22.10573-10581.2001

    Figure Lengend Snippet: Slowly migrating DNAs are converted into ocDNA by Taq (A) or T4 (B) DNA polymerase treatment. The blots were hybridized with a C1-sense RNA probe. The positions of ocDNA, linear DNA (linDNA), scDNA, and cssDNA forms of viral DNA are indicated. Slowly migrating viral DNAs are indicated with an asterisk (∗). (A) TNAs were extracted from wt protoplasts at 72 h posttransfection with pTOM6 alone (the two lanes on the right) or together with pTOM100C4(−) or pTOM100NT and analyzed directly (−) or following incubation with Taq DNA polymerase for the time indicated below. (B) TNAs were extracted from wt or transgenic (102.22) protoplasts at 72 h posttransfection with pSP97 (TYLCSV-ES[1]) and analyzed following a 1-h incubation with (+) or without (−) T4 DNA polymerase. Lane C, TNAs from a TYLCSV-infected tomato plant digested with Bgl II to show migration of linear DNA.

    Article Snippet: To verify the nature of these slowly migrating molecules, TNAs extracted from the samples at 24 and 72 h were incubated with Taq DNA polymerase and analyzed by Southern blot (Fig. B).

    Techniques: Incubation, Transgenic Assay, Infection, Migration

    Slowly migrating DNAs also accumulate at early stages after transfection of wt protoplasts with TYLCSV. TNAs were extracted from protoplasts transfected with pTOM6. The blots were hybridized with a C1-sense RNA probe. The positions of ocDNA, linear DNA (linDNA), scDNA, and cssDNA forms of viral DNA are indicated. Slow-migrating viral DNAs are indicated with an asterisk (∗). HPT, hours posttransfection. (A) Time course analysis of viral DNA forms. Sample at 72 h was diluted 20-fold to give signals of satisfactory intensity on the autoradiographic film. (B) Taq DNA polymerase treatment of TNAs at 24 and 72 h after transfection. Samples were incubated for 10 min at 37°C with (+) or without (−) the polymerase. Lane C, sample at 72 h digested with Bgl II to show the linear DNA.

    Journal: Journal of Virology

    Article Title: Transgenically Expressed T-Rep of Tomato Yellow Leaf Curl Sardinia Virus Acts as a trans-Dominant-Negative Mutant, Inhibiting Viral Transcription and Replication

    doi: 10.1128/JVI.75.22.10573-10581.2001

    Figure Lengend Snippet: Slowly migrating DNAs also accumulate at early stages after transfection of wt protoplasts with TYLCSV. TNAs were extracted from protoplasts transfected with pTOM6. The blots were hybridized with a C1-sense RNA probe. The positions of ocDNA, linear DNA (linDNA), scDNA, and cssDNA forms of viral DNA are indicated. Slow-migrating viral DNAs are indicated with an asterisk (∗). HPT, hours posttransfection. (A) Time course analysis of viral DNA forms. Sample at 72 h was diluted 20-fold to give signals of satisfactory intensity on the autoradiographic film. (B) Taq DNA polymerase treatment of TNAs at 24 and 72 h after transfection. Samples were incubated for 10 min at 37°C with (+) or without (−) the polymerase. Lane C, sample at 72 h digested with Bgl II to show the linear DNA.

    Article Snippet: To verify the nature of these slowly migrating molecules, TNAs extracted from the samples at 24 and 72 h were incubated with Taq DNA polymerase and analyzed by Southern blot (Fig. B).

    Techniques: Transfection, Incubation

    Optimisation of the PPLMD method . The y-axis represents the average background-subtracted pixel density (0–64,000). A. Introduction of SpikeTarget DNA reduced background in negative control (purple vs. yellow). Blue: genomic DNA (containing RRS and MON810) + SpikeTarget, purple: MQ, yellow: MQ with SpikeTarget. All 4 padlock probes were present in the mix. HotStar Taq DNA polymerase was used to amplify in 40 LATE cycles. B. 80 LATE cycles increased signal compared to 40 cycles. Purple: 40 LATE cycles, blue: 80 LATE cycles. All 4 padlock probes were present in the mix (containing RRS and MON810). Vent ® exo - DNA polymerase was used.

    Journal: BMC Genomics

    Article Title: Optimised padlock probe ligation and microarray detection of multiple (non-authorised) GMOs in a single reaction

    doi: 10.1186/1471-2164-9-584

    Figure Lengend Snippet: Optimisation of the PPLMD method . The y-axis represents the average background-subtracted pixel density (0–64,000). A. Introduction of SpikeTarget DNA reduced background in negative control (purple vs. yellow). Blue: genomic DNA (containing RRS and MON810) + SpikeTarget, purple: MQ, yellow: MQ with SpikeTarget. All 4 padlock probes were present in the mix. HotStar Taq DNA polymerase was used to amplify in 40 LATE cycles. B. 80 LATE cycles increased signal compared to 40 cycles. Purple: 40 LATE cycles, blue: 80 LATE cycles. All 4 padlock probes were present in the mix (containing RRS and MON810). Vent ® exo - DNA polymerase was used.

    Article Snippet: The results showed a tendency that positive signals were improved and background signals were decreased compared to the use of HotStar Taq DNA polymerase, although statistical evidence is lacking (results not shown).

    Techniques: Negative Control

    Effect of individual constituents of the PCR on background fluorescence in the presence or absence of CABS. Each column represents the result of three PCRs performed: 1, in the absence of Taq Gold polymerase, but in the presence of oligonucleotides and template; 2, in the absence of Taq Gold polymerase and template, but in the presence of oligonucleotides; 3, in the absence of Taq Gold polymerase, template, and one oligonucleotide but in the presence of one oligonucleotide; 4, in the absence of primers and template, but in the presence of Taq Gold polymerase; 5, in the absence of template, but in the presence of both primers and polymerase; 6, as in case 3, except in the presence of the alternative primer of the primer combination; 7, in which specific amplicon is produced; and 8, in which no amplicon is expected. Conditions 1, 2, and 6 show the effect of CABS in reducing the background fluorescence caused by the single-strand oligonucleotides. The reaction with CABS in conditions 5 and 8 shows the residual effect caused by primer/dimers, in the case of 8 with additional template DNA.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Alkaline-mediated differential interaction (AMDI): A simple automatable single-nucleotide polymorphism assay

    doi: 10.1073/pnas.041619998

    Figure Lengend Snippet: Effect of individual constituents of the PCR on background fluorescence in the presence or absence of CABS. Each column represents the result of three PCRs performed: 1, in the absence of Taq Gold polymerase, but in the presence of oligonucleotides and template; 2, in the absence of Taq Gold polymerase and template, but in the presence of oligonucleotides; 3, in the absence of Taq Gold polymerase, template, and one oligonucleotide but in the presence of one oligonucleotide; 4, in the absence of primers and template, but in the presence of Taq Gold polymerase; 5, in the absence of template, but in the presence of both primers and polymerase; 6, as in case 3, except in the presence of the alternative primer of the primer combination; 7, in which specific amplicon is produced; and 8, in which no amplicon is expected. Conditions 1, 2, and 6 show the effect of CABS in reducing the background fluorescence caused by the single-strand oligonucleotides. The reaction with CABS in conditions 5 and 8 shows the residual effect caused by primer/dimers, in the case of 8 with additional template DNA.

    Article Snippet: The reaction mixture consisted of 67 mM Tris⋅HCl (pH 8.4) at 25°C, 16.6 mM ammonium sulfate, 2 mM magnesium chloride, 0.01% (vol/vol) Tween 20, 200 μM of each dNTP, 1 μM of each primer, and 0.5 units Hotstart Taq DNA polymerase (Qiagen) or AmpliTaq Gold (Perkin–Elmer).

    Techniques: Polymerase Chain Reaction, Fluorescence, Amplification, Produced

    Validation of model predictions using targeted amplification of editable sites from single cells. ( a ) Wiggle plots showing coverage in 3′-untranslated regions for B2m, Anxa5 and Cybb in the 24 bone marrow-derived macrophages profiled. ( b – d ) Sequence alignments from targeted RT–PCR amplification and Sanger sequencing of bacterial colonies for ( b ) B2m, ( c ) Anxa5 and ( d ) Cybb transcripts from gDNA and cDNA from a bulk sample (amplified using standard PCR), and cDNA of single cells (amplified using a modified OneStep RT–PCR protocol, per Supplementary Fig. 4 ). Alignments, showing the sequence space surrounding a particular editable site, are clustered by sample. Alignments are colour-coded to indicate whether the sequence aligned contained (red) or lacked (grey) editing in the length of the amplicon. Though a C-to-U change may not be shown in the narrow window illustrated, a red sequence would indicate that the amplicon sequence contained at least one C-to-U edit elsewhere (red). Lack of editing in the gDNA indicates that the C-to-U transitions observed are bona fide APOBEC1-mediated RNA editing events.

    Journal: Nature Communications

    Article Title: RNA editing generates cellular subsets with diverse sequence within populations

    doi: 10.1038/ncomms12145

    Figure Lengend Snippet: Validation of model predictions using targeted amplification of editable sites from single cells. ( a ) Wiggle plots showing coverage in 3′-untranslated regions for B2m, Anxa5 and Cybb in the 24 bone marrow-derived macrophages profiled. ( b – d ) Sequence alignments from targeted RT–PCR amplification and Sanger sequencing of bacterial colonies for ( b ) B2m, ( c ) Anxa5 and ( d ) Cybb transcripts from gDNA and cDNA from a bulk sample (amplified using standard PCR), and cDNA of single cells (amplified using a modified OneStep RT–PCR protocol, per Supplementary Fig. 4 ). Alignments, showing the sequence space surrounding a particular editable site, are clustered by sample. Alignments are colour-coded to indicate whether the sequence aligned contained (red) or lacked (grey) editing in the length of the amplicon. Though a C-to-U change may not be shown in the narrow window illustrated, a red sequence would indicate that the amplicon sequence contained at least one C-to-U edit elsewhere (red). Lack of editing in the gDNA indicates that the C-to-U transitions observed are bona fide APOBEC1-mediated RNA editing events.

    Article Snippet: RT–PCR amplification was done with gene specific primers and the OneStep RT–PCR kit (Qiagen), using a modified protocol.

    Techniques: Amplification, Derivative Assay, Sequencing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Modification

    Nested PCR for WT1 expression.

    Journal: Biomarker Insights

    Article Title: Studies of Wilms' Tumor (WT1) Gene Expression in Adult Acute Leukemias in Singapore

    doi:

    Figure Lengend Snippet: Nested PCR for WT1 expression.

    Article Snippet: Nested RT-PCR (reverse-transcription PCR) One step nested reverse transcription polymerase chain reaction (Nested RT-PCR) was performed by using a one-step RT-PCR kit. (Qiagen, Valencia, CA, USA) WT1 exon 1–4 was amplified using forward (5′-CCTACCTGCCC AG CTGCCTC-3′) and reverse (5′-CTCCTAAGTTCATCTGATTCC-3′) primers for 20 cycles (annealing temperature 56 °C), followed by nested PCR (forward: 5′-AGAGCCAGCCCGCTATTCG-3′; and reverse: GGTCATGCATTCAAGCTGG-3′ primers) for 30 cycles (annealing temperature 58 °C).

    Techniques: Nested PCR, Expressing

    One-step RT-PCR for identification of contaminants in Kit I and Platinum Taq . (A-C) One-step RT-PCR for identification of a contaminated component in Kit I. The experiments were conducted in two independent laboratories, IVR and JRC. In IVR, nucleic acids were extracted from 50 μl of the enzyme mix of the RT-PCR Kit I using an RNA purification column (QIAamp viral RNA mini kit [Cat. no. 52904] [QIAGEN]) and the presence of polytropic endogenous MLV was examined by using the RT-PCR Kit T (A) and Kit P (B). In JRC, nucleic acids were extracted from 75 μl of the enzyme mix of RT-PCR Kit I using an RNA/DNA purification column (PureLink™ Viral RNA/DNA Kit [Cat. no. 12280-050] [Invitrogen]), and the presence of polytropic endogenous MLV was examined using Kit Q (C). Five μl of test samples were examined with primers indicated below the corresponding lanes. The RT-PCR conditions for Kit T and Kit P were the same as in Figure 1B. The RT-PCR conditions for Kit Q were as follows: reverse transcription at 50°C for 30 minutes; activation at 95°C for 15 minutes; 45 cycles of the following steps: 94°C for 30 s, 57°C for 30 s, and 72°C for 1 minute; and a final extension at 72°C for 10 minutes. Lanes 1 and 5, DW; lanes 2 and 6, column-purified carrier RNA (carrier); lanes 3 and 7, column-purified nucleic acids from enzyme mix (enzyme) of the Kit I; lanes 4 and 8, 1 μl buffer of the Kit I plus 4 μl DW (buffer). (D) One-step RT-PCR for the detection of MLV RNA in Platinum Taq. Nucleic acids were extracted from 50 μl of the Platinum Taq using an RNA purification column (QIAamp viral RNA mini kit [QIAGEN]) and the presence of MLV RNA was examined by using the RT-PCR Kit P. Five μl of test samples were examined with primers indicated below the corresponding lanes. The RT-PCR condition was the same as in Figure 1B with the exception of the PCR cycles (60 cycles instead of 45 cycles). Abbreviation; DW: distilled water. M: DNA size marker.

    Journal: Retrovirology

    Article Title: An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV

    doi: 10.1186/1742-4690-7-110

    Figure Lengend Snippet: One-step RT-PCR for identification of contaminants in Kit I and Platinum Taq . (A-C) One-step RT-PCR for identification of a contaminated component in Kit I. The experiments were conducted in two independent laboratories, IVR and JRC. In IVR, nucleic acids were extracted from 50 μl of the enzyme mix of the RT-PCR Kit I using an RNA purification column (QIAamp viral RNA mini kit [Cat. no. 52904] [QIAGEN]) and the presence of polytropic endogenous MLV was examined by using the RT-PCR Kit T (A) and Kit P (B). In JRC, nucleic acids were extracted from 75 μl of the enzyme mix of RT-PCR Kit I using an RNA/DNA purification column (PureLink™ Viral RNA/DNA Kit [Cat. no. 12280-050] [Invitrogen]), and the presence of polytropic endogenous MLV was examined using Kit Q (C). Five μl of test samples were examined with primers indicated below the corresponding lanes. The RT-PCR conditions for Kit T and Kit P were the same as in Figure 1B. The RT-PCR conditions for Kit Q were as follows: reverse transcription at 50°C for 30 minutes; activation at 95°C for 15 minutes; 45 cycles of the following steps: 94°C for 30 s, 57°C for 30 s, and 72°C for 1 minute; and a final extension at 72°C for 10 minutes. Lanes 1 and 5, DW; lanes 2 and 6, column-purified carrier RNA (carrier); lanes 3 and 7, column-purified nucleic acids from enzyme mix (enzyme) of the Kit I; lanes 4 and 8, 1 μl buffer of the Kit I plus 4 μl DW (buffer). (D) One-step RT-PCR for the detection of MLV RNA in Platinum Taq. Nucleic acids were extracted from 50 μl of the Platinum Taq using an RNA purification column (QIAamp viral RNA mini kit [QIAGEN]) and the presence of MLV RNA was examined by using the RT-PCR Kit P. Five μl of test samples were examined with primers indicated below the corresponding lanes. The RT-PCR condition was the same as in Figure 1B with the exception of the PCR cycles (60 cycles instead of 45 cycles). Abbreviation; DW: distilled water. M: DNA size marker.

    Article Snippet: We used the following RT-PCR kits which were purchased in Japan: SuperScript® III One-Step RT-PCR System with the Platinum® Taq High Fidelity Kit (Cat. no. 12574-030) (Invitrogen, Carlsbad, CA, USA) (abbreviated as Kit I); AccessQuick™RT-PCR Sysytem (Cat. no. A1701) (Promega, Madison, WI, USA) (abbreviated as Kit P); One Step RT-PCR Kit (Cat. no. PRO24A) (TaKaRa, Ohtsu, Shiga, Japan) (Abbreviated as Kit T); One Step RT-PCR Kit (Cat. no. 210210) (QIAGEN GmbH, Hilden, Germany) (Abbreviated as Kit Q).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Purification, DNA Purification, Activation Assay, Polymerase Chain Reaction, Marker

    H . pylori - specific PCR for DNA extracted from oral cavity. In this figure, one can see the amplification of VacA in the three cases previously identified as oral cavity positives for H. pylori (Hp positive sample #1 to #3), in comparison with other three cases that are oral cavity H. pylori negatives (Hp negative sample #1 to #3). As a positive control (Hp positive control) PCR for DNA extracted from H . pylori (strain 7354) diluted in saliva was used. Blank—PCR negative control.

    Journal: PLoS ONE

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations

    doi: 10.1371/journal.pone.0126923

    Figure Lengend Snippet: H . pylori - specific PCR for DNA extracted from oral cavity. In this figure, one can see the amplification of VacA in the three cases previously identified as oral cavity positives for H. pylori (Hp positive sample #1 to #3), in comparison with other three cases that are oral cavity H. pylori negatives (Hp negative sample #1 to #3). As a positive control (Hp positive control) PCR for DNA extracted from H . pylori (strain 7354) diluted in saliva was used. Blank—PCR negative control.

    Article Snippet: Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21).

    Techniques: Polymerase Chain Reaction, Amplification, Positive Control, Negative Control

    Highly sensitive PCR for detection of H . pylori . In order to evaluate the sensitivity of VacA -specific PCR, 50ng of DNA from H . pylori was successively diluted (1 to 1:100000) in saliva from two random cases (#3 and #10) that were shown previously to be negative for the presence of H . pylori . The PCR allowed the amplification of the expected product for all different dilutions.

    Journal: PLoS ONE

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations

    doi: 10.1371/journal.pone.0126923

    Figure Lengend Snippet: Highly sensitive PCR for detection of H . pylori . In order to evaluate the sensitivity of VacA -specific PCR, 50ng of DNA from H . pylori was successively diluted (1 to 1:100000) in saliva from two random cases (#3 and #10) that were shown previously to be negative for the presence of H . pylori . The PCR allowed the amplification of the expected product for all different dilutions.

    Article Snippet: Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21).

    Techniques: Polymerase Chain Reaction, Amplification

    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.

    Journal: Scientific Reports

    Article Title: A novel perspective on MOL-PCR optimization and MAGPIX analysis of in-house multiplex foodborne pathogens detection assay

    doi: 10.1038/s41598-019-40035-5

    Figure Lengend Snippet: Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.

    Article Snippet: In order to find a balance, the performance of six different master mixes was tested (Fig. ), including the previously utilized HotStarTaq DNA Polymerase – and the upgraded AmpliTaq Gold 360 Master Mix , .

    Techniques: Polymerase Chain Reaction, Hot Start PCR

    Representation of the two sequence targets in the exon III of the OXTR gene. Legend: Representation of OXTR gene with the CpG island in green and the location of exon III in blue . The dashed lines show the amplification of the region analyzed that contains two targets, OXTR1 OXTR2. The target sequences are in the exon III of OXTR gene ( OXTR1 —cat. PM00016821 and OXTR2 —cat. PM00016828, QIAGEN), using the PyroMark PCR Kit (QIAGEN). Both regions are in the CpG island the comprise exons I–III. The OXTR1 target sequence has 34 pb with 4 CpG sites analyzed and the OXTR2 target sequence has 34 bp with 5 CpG sites analyzed

    Journal: BMC Neuroscience

    Article Title: Epigenetic evidence for involvement of the oxytocin receptor gene in obsessive–compulsive disorder

    doi: 10.1186/s12868-016-0313-4

    Figure Lengend Snippet: Representation of the two sequence targets in the exon III of the OXTR gene. Legend: Representation of OXTR gene with the CpG island in green and the location of exon III in blue . The dashed lines show the amplification of the region analyzed that contains two targets, OXTR1 OXTR2. The target sequences are in the exon III of OXTR gene ( OXTR1 —cat. PM00016821 and OXTR2 —cat. PM00016828, QIAGEN), using the PyroMark PCR Kit (QIAGEN). Both regions are in the CpG island the comprise exons I–III. The OXTR1 target sequence has 34 pb with 4 CpG sites analyzed and the OXTR2 target sequence has 34 bp with 5 CpG sites analyzed

    Article Snippet: PM00016828, QIAGEN), using the PyroMark PCR Kit (QIAGEN).

    Techniques: Sequencing, Amplification, Polymerase Chain Reaction

    Representative CAG repeat distributions, and Msh3 variations in B6 and CBy mice. A) The autoradiographs show representative SP-PCR analyses of DNA, extracted from heart, liver, striatum and tail. At weaning the B6.Cg-R6/1 (B6) and CBy.Cg-R6/1 (CBy) congenic mice contained in tail DNA (CAG)98 and (CAG)94, respectively. For comparison the profiles of the Msh2 −/− mouse is shown. About 5–10 DNA amplifiable molecules were amplified in each reaction with primers MS-1F and MS-1R. Animals were 20-weeks old. B) Congenic CBy.Cg-R6/1 mice were crossed to B6 and the resulting F1 progeny were crossed to produce F2 mice with all possible genotypes at the Msh3 locus. Repeat instability was assayed by amplifying 10 ng genomic DNA using fluorescently labelled primers and resolving the fragments by capillary gel electrophoresis ( Figure 1B ). Using this high-resolution approach repeat length distributions present with the typical ‘hedgehog’ pattern ( e.g. [10] , [13] , [15] , [16] . This pattern reflects both somatic mosaicism within the sample and PCR artefacts generated by Taq polymerase slippage [62] , [63] . The PCR artefacts are predominantly repeat contractions, hence these are not considered here. The pattern of CAG repeat instability depended on genotype at the MSH3 locus. B6 homozygosity resulted in the greatest instability, CBy homozygosity resulted in lack of expansion, while heterozygosity resulted in an intermediate instability, indicative of a gene dosage effect of the Msh3 locus. Numbers indicate the CAG repeat size corresponding to major peaks. In addition, on the B6 tracing, a second number indicates the highest CAG repeat number detected. C) Msh3 polymorphisms in Msh3 gene from C57BL/6 (B6) and BALB/cBy (CBy) mice. Promoters were identical. SNPs were identified or confirmed to those in dbSNP by sequencing the Msh3 gene.

    Journal: PLoS Genetics

    Article Title: MSH3 Polymorphisms and Protein Levels Affect CAG Repeat Instability in Huntington's Disease Mice

    doi: 10.1371/journal.pgen.1003280

    Figure Lengend Snippet: Representative CAG repeat distributions, and Msh3 variations in B6 and CBy mice. A) The autoradiographs show representative SP-PCR analyses of DNA, extracted from heart, liver, striatum and tail. At weaning the B6.Cg-R6/1 (B6) and CBy.Cg-R6/1 (CBy) congenic mice contained in tail DNA (CAG)98 and (CAG)94, respectively. For comparison the profiles of the Msh2 −/− mouse is shown. About 5–10 DNA amplifiable molecules were amplified in each reaction with primers MS-1F and MS-1R. Animals were 20-weeks old. B) Congenic CBy.Cg-R6/1 mice were crossed to B6 and the resulting F1 progeny were crossed to produce F2 mice with all possible genotypes at the Msh3 locus. Repeat instability was assayed by amplifying 10 ng genomic DNA using fluorescently labelled primers and resolving the fragments by capillary gel electrophoresis ( Figure 1B ). Using this high-resolution approach repeat length distributions present with the typical ‘hedgehog’ pattern ( e.g. [10] , [13] , [15] , [16] . This pattern reflects both somatic mosaicism within the sample and PCR artefacts generated by Taq polymerase slippage [62] , [63] . The PCR artefacts are predominantly repeat contractions, hence these are not considered here. The pattern of CAG repeat instability depended on genotype at the MSH3 locus. B6 homozygosity resulted in the greatest instability, CBy homozygosity resulted in lack of expansion, while heterozygosity resulted in an intermediate instability, indicative of a gene dosage effect of the Msh3 locus. Numbers indicate the CAG repeat size corresponding to major peaks. In addition, on the B6 tracing, a second number indicates the highest CAG repeat number detected. C) Msh3 polymorphisms in Msh3 gene from C57BL/6 (B6) and BALB/cBy (CBy) mice. Promoters were identical. SNPs were identified or confirmed to those in dbSNP by sequencing the Msh3 gene.

    Article Snippet: Qiagen Taq polymerase (cat #201225) was used as recommended by the manufacturer.

    Techniques: Mouse Assay, Polymerase Chain Reaction, Amplification, Mass Spectrometry, Nucleic Acid Electrophoresis, Generated, Sequencing

    Effects of different concentrations and sizes of UCNPs on PCR amplification specificity. Three commercial real-time PCR master mixes were applied to determine the effects of different concentrations and sizes of UCNPs on the specificity of PCR amplification of a 120 bp 5S rDNA fragment from soybean genomic DNA, at an annealing temperature of 50°C. ( A ) AccuPower PCR PreMix with Top Polymerase (Bioneer). ( B ) AmpliTaq Gold 360 Master Mix with AmpliTaq Gold DNA Polymerase (Applied Biosystems). ( C ) HotStarTaq Plus Master Mix with HotStarTaq DNA Polymerase (Qiagen). Lane M: DNA marker; lane C: template without UCNPs; lanes 1∼5∶5, 7.5, 10, 15, and 30 nM of QDs, respectively; lanes 6∼8∶0.5, 0.75, and 1.0 µg/µL of 40-nm-sized UCNPs, respectively; lanes 9∼14∶1×( = 2.4×10 5 particles/µL), 10×, 15×, 20×, 25×, and 30× of 70-nm-sized UCNPs, respectively; lanes 15∼20∶1×, 10×, 15×, 20×, 25×, and 30× of 250-nm-sized UCNPs, respectively.

    Journal: PLoS ONE

    Article Title: Effects of Upconversion Nanoparticles on Polymerase Chain Reaction

    doi: 10.1371/journal.pone.0073408

    Figure Lengend Snippet: Effects of different concentrations and sizes of UCNPs on PCR amplification specificity. Three commercial real-time PCR master mixes were applied to determine the effects of different concentrations and sizes of UCNPs on the specificity of PCR amplification of a 120 bp 5S rDNA fragment from soybean genomic DNA, at an annealing temperature of 50°C. ( A ) AccuPower PCR PreMix with Top Polymerase (Bioneer). ( B ) AmpliTaq Gold 360 Master Mix with AmpliTaq Gold DNA Polymerase (Applied Biosystems). ( C ) HotStarTaq Plus Master Mix with HotStarTaq DNA Polymerase (Qiagen). Lane M: DNA marker; lane C: template without UCNPs; lanes 1∼5∶5, 7.5, 10, 15, and 30 nM of QDs, respectively; lanes 6∼8∶0.5, 0.75, and 1.0 µg/µL of 40-nm-sized UCNPs, respectively; lanes 9∼14∶1×( = 2.4×10 5 particles/µL), 10×, 15×, 20×, 25×, and 30× of 70-nm-sized UCNPs, respectively; lanes 15∼20∶1×, 10×, 15×, 20×, 25×, and 30× of 250-nm-sized UCNPs, respectively.

    Article Snippet: The AmpliTaq Gold DNA Polymerase in the AmpliTaq Gold 360 Master Mix, and the HotStarTaq Plus DNA Polymerase in the HotStarTaq Plus Master Mix (Qiagen) were recombinant forms modified from the Thermus aquaticus (Taq ) DNA polymerase.

    Techniques: Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction, Marker

    Overview of the ratios of alterations in the 30 tumours detected with the OncoScan assay compared to the microsatellite based multiplex PCR assays.

    Journal: Scientific Reports

    Article Title: A microsatellite based multiplex PCR method for the detection of chromosomal instability in gastric cancer

    doi: 10.1038/s41598-018-30971-z

    Figure Lengend Snippet: Overview of the ratios of alterations in the 30 tumours detected with the OncoScan assay compared to the microsatellite based multiplex PCR assays.

    Article Snippet: Amplification of 30 markers was performed in 5 multiplex PCRs using the Type-it Microsatellite PCR kit (Qiagen, Hilden, Germany) and the respective forward primers were labelled with the dyes FAM, HEX or ATTO550 (Eurofins Genomics, Ebersberg, Germany).

    Techniques: Multiplex Assay, Polymerase Chain Reaction

    Examples of tumours, which are negative (a,c) and positive for AI (b,d) in the OncoScan (a,b) and the microsatellite based multiplex PCR assays (c,d) . The Nexus Express software displays logR and BAF graphs for every chromosomal arm. In the log2R plot each dot represents copy number values which are calculated from signal intensities of a tumour sample compared to a normal reference and the B-allele frequency generates allelic information at each SNP position. At the region of the microsatellite marker D8S1720 (a) the tumour has zero values in the log2R and a normal three-band pattern in the BAF plot, which indicates no AI. At the region of the microsatellite marker D7S486 (b) the BAF plots show a clear four band pattern, which indicates AI. The relation of the allele intensity of the first and second allele of the respective microsatellite locus is not shifted at the microsatellite marker D8S1720, indicating no AI (c) . At the marker D7S486 (d) a clear shift is shown in the allele intensities in the tumour (arrow) in comparison to the non-tumorous tissue (N), which indicates AI. AI, allelic imbalance; BAF, B-allele frequency; log2R, log intensity ratio.

    Journal: Scientific Reports

    Article Title: A microsatellite based multiplex PCR method for the detection of chromosomal instability in gastric cancer

    doi: 10.1038/s41598-018-30971-z

    Figure Lengend Snippet: Examples of tumours, which are negative (a,c) and positive for AI (b,d) in the OncoScan (a,b) and the microsatellite based multiplex PCR assays (c,d) . The Nexus Express software displays logR and BAF graphs for every chromosomal arm. In the log2R plot each dot represents copy number values which are calculated from signal intensities of a tumour sample compared to a normal reference and the B-allele frequency generates allelic information at each SNP position. At the region of the microsatellite marker D8S1720 (a) the tumour has zero values in the log2R and a normal three-band pattern in the BAF plot, which indicates no AI. At the region of the microsatellite marker D7S486 (b) the BAF plots show a clear four band pattern, which indicates AI. The relation of the allele intensity of the first and second allele of the respective microsatellite locus is not shifted at the microsatellite marker D8S1720, indicating no AI (c) . At the marker D7S486 (d) a clear shift is shown in the allele intensities in the tumour (arrow) in comparison to the non-tumorous tissue (N), which indicates AI. AI, allelic imbalance; BAF, B-allele frequency; log2R, log intensity ratio.

    Article Snippet: Amplification of 30 markers was performed in 5 multiplex PCRs using the Type-it Microsatellite PCR kit (Qiagen, Hilden, Germany) and the respective forward primers were labelled with the dyes FAM, HEX or ATTO550 (Eurofins Genomics, Ebersberg, Germany).

    Techniques: Multiplex Assay, Polymerase Chain Reaction, Software, Marker

    Correlation of the ratios of chromosomal alterations detected with the OncoScan assay compared to the AI ratios determined with the microsatellite based multiplex PCR assays. AI, allelic imbalance.

    Journal: Scientific Reports

    Article Title: A microsatellite based multiplex PCR method for the detection of chromosomal instability in gastric cancer

    doi: 10.1038/s41598-018-30971-z

    Figure Lengend Snippet: Correlation of the ratios of chromosomal alterations detected with the OncoScan assay compared to the AI ratios determined with the microsatellite based multiplex PCR assays. AI, allelic imbalance.

    Article Snippet: Amplification of 30 markers was performed in 5 multiplex PCRs using the Type-it Microsatellite PCR kit (Qiagen, Hilden, Germany) and the respective forward primers were labelled with the dyes FAM, HEX or ATTO550 (Eurofins Genomics, Ebersberg, Germany).

    Techniques: Multiplex Assay, Polymerase Chain Reaction

    Gel image of PCR products amplified with the three customised multiplex PCR assays and visualised with the QIAxcel system. MPI ( left side ) comprises group/family-specific primers for seven taxa: beetles/thrips, spiders, aphids, earthworms, springtails, dipterans, and lacewings. MPII spiders ( upper right side ) covers two spider families, i.e. lycosids and linyphiids, as well as the genus Pachygnatha . MPII beetles/thrips ( lower right side ) addresses six taxa: the carabid genera Poecilus , Bembidion , Pterostichus, and Harpalus , the ladybeetle Coccinella septempunctata as well as thrips ( Frankliniella , Limothrips ). The shortest and longest fragments within each lane represent the two alignment markers (AM; 15 and 3000 bp) as indicated in the left panel . For amplicon lengths see Fig. 1 and Table 3 . Mixes of DNA templates of targets; approximately 1000 ds copies each in PCR

    Journal: Journal of Pest Science

    Article Title: Diagnostic PCR assays to unravel food web interactions in cereal crops with focus on biological control of aphids

    doi: 10.1007/s10340-015-0685-8

    Figure Lengend Snippet: Gel image of PCR products amplified with the three customised multiplex PCR assays and visualised with the QIAxcel system. MPI ( left side ) comprises group/family-specific primers for seven taxa: beetles/thrips, spiders, aphids, earthworms, springtails, dipterans, and lacewings. MPII spiders ( upper right side ) covers two spider families, i.e. lycosids and linyphiids, as well as the genus Pachygnatha . MPII beetles/thrips ( lower right side ) addresses six taxa: the carabid genera Poecilus , Bembidion , Pterostichus, and Harpalus , the ladybeetle Coccinella septempunctata as well as thrips ( Frankliniella , Limothrips ). The shortest and longest fragments within each lane represent the two alignment markers (AM; 15 and 3000 bp) as indicated in the left panel . For amplicon lengths see Fig. 1 and Table 3 . Mixes of DNA templates of targets; approximately 1000 ds copies each in PCR

    Article Snippet: The MPI assay was performed in a total volume of 10 µl containing 1.5 µl of DNA extract, 1× QIAGEN Multiplex PCR Master Mix (Qiagen), each primer at its corresponding concentration (Table ), 0.5× Q-solution (Qiagen), 5 µg BSA, 30 mM TMAC (Sigma-Aldrich), and PCR-grade water to adjust the volume.

    Techniques: Polymerase Chain Reaction, Amplification, Multiplex Assay

    Gel image of PCR products amplified with the newly developed primers and visualised with the QIAxcel system. Different taxonomic levels of primers (group-/family-/genus- and species-specific) are indicated above boxes. For several taxa (i.e. springtails, dipterans, aphids, Harpalus spp., Pachygnatha spp., and Coccinella septempunctata ), two versions of primer pairs amplifying different amplicon lengths are shown. An alignment marker (15 and 3000 bp) was running with each sample and a base pair scale indicates amplicon length on the right side. All targets amplified from 125/250 ds copies µl −1 DNA templates, except for Pachygnatha spp. 1000 ds copies µl −1 DNA template

    Journal: Journal of Pest Science

    Article Title: Diagnostic PCR assays to unravel food web interactions in cereal crops with focus on biological control of aphids

    doi: 10.1007/s10340-015-0685-8

    Figure Lengend Snippet: Gel image of PCR products amplified with the newly developed primers and visualised with the QIAxcel system. Different taxonomic levels of primers (group-/family-/genus- and species-specific) are indicated above boxes. For several taxa (i.e. springtails, dipterans, aphids, Harpalus spp., Pachygnatha spp., and Coccinella septempunctata ), two versions of primer pairs amplifying different amplicon lengths are shown. An alignment marker (15 and 3000 bp) was running with each sample and a base pair scale indicates amplicon length on the right side. All targets amplified from 125/250 ds copies µl −1 DNA templates, except for Pachygnatha spp. 1000 ds copies µl −1 DNA template

    Article Snippet: The MPI assay was performed in a total volume of 10 µl containing 1.5 µl of DNA extract, 1× QIAGEN Multiplex PCR Master Mix (Qiagen), each primer at its corresponding concentration (Table ), 0.5× Q-solution (Qiagen), 5 µg BSA, 30 mM TMAC (Sigma-Aldrich), and PCR-grade water to adjust the volume.

    Techniques: Polymerase Chain Reaction, Amplification, Marker

    FIGURE 1: C. pneumoniae is present more frequently in subgingival plaque obtained from periodontally diseased sites vs. healthy sites. Dental plaques were obtained from subgingival locations in ten healthy patients (HPt, four sites for each one) and in ten patients with periodontal disease (PPt). For patients with periodontal disease, subgingival dental plaques were obtained from both areas with periodontitis (P, two sites per subject) and areas without periodontitis (H, two sites per subject). All dental plaque samples were subjected to PCR followed by agarose gel electrophoresis. (A, C, E) Representative gel electrophoretogram of PCR products screening C. pneumoniae (A) , P. gingivalis (C) and A. actinomycetemcomitans (E) . Quantification of C. pneumoniae (B) , P. gingivalis (D) and A. actinomycetemcomitans (F) 16S rRNA, PCR products. (B, D, F) Healthy sites: n = 40 (only from healthy donors) and diseased sites: n = 20. For each dental plaque sample, seven different runs were performed for C. pneumoniae and three different runs for P. gingivalis and A. actinomycetemcomitans. Arrows indicate positive bands in the expected bp size. Error bars represent ± SD; 2-sided, paired Student's t test, * P ≤ 0.05, ***P≤0.001.

    Journal: Microbial Cell

    Article Title: Chlamydia pneumoniae is present in the dental plaque of periodontitis patients and stimulates an inflammatory response in gingival epithelial cells

    doi: 10.15698/mic2019.04.674

    Figure Lengend Snippet: FIGURE 1: C. pneumoniae is present more frequently in subgingival plaque obtained from periodontally diseased sites vs. healthy sites. Dental plaques were obtained from subgingival locations in ten healthy patients (HPt, four sites for each one) and in ten patients with periodontal disease (PPt). For patients with periodontal disease, subgingival dental plaques were obtained from both areas with periodontitis (P, two sites per subject) and areas without periodontitis (H, two sites per subject). All dental plaque samples were subjected to PCR followed by agarose gel electrophoresis. (A, C, E) Representative gel electrophoretogram of PCR products screening C. pneumoniae (A) , P. gingivalis (C) and A. actinomycetemcomitans (E) . Quantification of C. pneumoniae (B) , P. gingivalis (D) and A. actinomycetemcomitans (F) 16S rRNA, PCR products. (B, D, F) Healthy sites: n = 40 (only from healthy donors) and diseased sites: n = 20. For each dental plaque sample, seven different runs were performed for C. pneumoniae and three different runs for P. gingivalis and A. actinomycetemcomitans. Arrows indicate positive bands in the expected bp size. Error bars represent ± SD; 2-sided, paired Student's t test, * P ≤ 0.05, ***P≤0.001.

    Article Snippet: PCR was performed to amplify the 16S rRNA gene of C. pneumoniae, C. trachomatis, P. gingivalis and A. actinomycetemcomitans using the Fast Cycling PCR Kit (Qiagen, Valencia, CA, USA).

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    The distribution of the HRM measurements of the 5' junction of MON810 (5'-MON810) region tested with real-time PCR. For the HRM analysis the confidence values were divided into 10 classes. The values of these classes were plotted on the x -axis and the numbers of the samples for the classes on the y -axis.

    Journal: International Journal of Molecular Sciences

    Article Title: Mutation Scanning in a Single and a Stacked Genetically Modified (GM) Event by Real-Time PCR and High Resolution Melting (HRM) Analysis

    doi: 10.3390/ijms151119898

    Figure Lengend Snippet: The distribution of the HRM measurements of the 5' junction of MON810 (5'-MON810) region tested with real-time PCR. For the HRM analysis the confidence values were divided into 10 classes. The values of these classes were plotted on the x -axis and the numbers of the samples for the classes on the y -axis.

    Article Snippet: The Type-it HRM PCR Kit (Qiagen), 700 nM primers (Scorpion primer 125 nM), and 1.6 µL of undiluted DNA (70–100 ng/µL) template were used for each reaction.

    Techniques: Real-time Polymerase Chain Reaction

    The distribution of the HRM measurements of the 3' junction of MON810 (3'-MON810) region tested with real-time PCR. For the HRM analysis the confidence values were divided into 10 classes. The values of these classes were plotted against the number of samples.

    Journal: International Journal of Molecular Sciences

    Article Title: Mutation Scanning in a Single and a Stacked Genetically Modified (GM) Event by Real-Time PCR and High Resolution Melting (HRM) Analysis

    doi: 10.3390/ijms151119898

    Figure Lengend Snippet: The distribution of the HRM measurements of the 3' junction of MON810 (3'-MON810) region tested with real-time PCR. For the HRM analysis the confidence values were divided into 10 classes. The values of these classes were plotted against the number of samples.

    Article Snippet: The Type-it HRM PCR Kit (Qiagen), 700 nM primers (Scorpion primer 125 nM), and 1.6 µL of undiluted DNA (70–100 ng/µL) template were used for each reaction.

    Techniques: Real-time Polymerase Chain Reaction