puregene kits Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen puregene blood kit a
    Puregene Blood Kit A, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 314 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/puregene blood kit a/product/Qiagen
    Average 99 stars, based on 314 article reviews
    Price from $9.99 to $1999.99
    puregene blood kit a - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    Qiagen puregene kit a
    Sanger sequence chromatograms of exons 17 and 13 of ABCC2 and ABCB11 genes, respectively, for the child and mother. The genomic DNA was from peripheral blood using <t>Puregene</t> Kit (QIAGEN), and primers’ sequences for polymerase chain reaction were designed as follows: ABCC2_17F 5′TGGGGCTTTTAATGGTGAAG3′. ABCC2_17R 5′GTGTAGTTCTTCACCACCATC3′. ABCB11_13F 5′ACTTCTTGGTCATGGCTCTCAG3. ABCB11_13R 5′AGCGTGTCCCATCAATTCAG3′
    Puregene Kit A, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 191 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/puregene kit a/product/Qiagen
    Average 99 stars, based on 191 article reviews
    Price from $9.99 to $1999.99
    puregene kit a - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    93
    Gentra Systems puregene kit
    DNA electrophoresis on 0.5% agarose gel at 45 volts for 2 hrs. GeneRuler™1 kb Plus DNA markers (M, in bp) and typical DNA samples isolated by SDS (1), CTAB (2), DNAzol® (3), <t>Puregene®</t> (4) and DNeasy® (5).
    Puregene Kit, supplied by Gentra Systems, used in various techniques. Bioz Stars score: 93/100, based on 1795 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/puregene kit/product/Gentra Systems
    Average 93 stars, based on 1795 article reviews
    Price from $9.99 to $1999.99
    puregene kit - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    92
    Qiagen puregene cell kit
    DNA electrophoresis on 0.5% agarose gel at 45 volts for 2 hrs. GeneRuler™1 kb Plus DNA markers (M, in bp) and typical DNA samples isolated by SDS (1), CTAB (2), DNAzol® (3), <t>Puregene®</t> (4) and DNeasy® (5).
    Puregene Cell Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 92/100, based on 1062 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/puregene cell kit/product/Qiagen
    Average 92 stars, based on 1062 article reviews
    Price from $9.99 to $1999.99
    puregene cell kit - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    Qiagen puregene tissue kit
    DNA electrophoresis on 0.5% agarose gel at 45 volts for 2 hrs. GeneRuler™1 kb Plus DNA markers (M, in bp) and typical DNA samples isolated by SDS (1), CTAB (2), DNAzol® (3), <t>Puregene®</t> (4) and DNeasy® (5).
    Puregene Tissue Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 92/100, based on 1322 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/puregene tissue kit/product/Qiagen
    Average 92 stars, based on 1322 article reviews
    Price from $9.99 to $1999.99
    puregene tissue kit - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    Image Search Results


    Sanger sequence chromatograms of exons 17 and 13 of ABCC2 and ABCB11 genes, respectively, for the child and mother. The genomic DNA was from peripheral blood using Puregene Kit (QIAGEN), and primers’ sequences for polymerase chain reaction were designed as follows: ABCC2_17F 5′TGGGGCTTTTAATGGTGAAG3′. ABCC2_17R 5′GTGTAGTTCTTCACCACCATC3′. ABCB11_13F 5′ACTTCTTGGTCATGGCTCTCAG3. ABCB11_13R 5′AGCGTGTCCCATCAATTCAG3′

    Journal: BMC Research Notes

    Article Title: Dubin–Johnson syndrome and intrahepatic cholestasis of pregnancy in a Sri Lankan family: a case report

    doi: 10.1186/s13104-017-2811-6

    Figure Lengend Snippet: Sanger sequence chromatograms of exons 17 and 13 of ABCC2 and ABCB11 genes, respectively, for the child and mother. The genomic DNA was from peripheral blood using Puregene Kit (QIAGEN), and primers’ sequences for polymerase chain reaction were designed as follows: ABCC2_17F 5′TGGGGCTTTTAATGGTGAAG3′. ABCC2_17R 5′GTGTAGTTCTTCACCACCATC3′. ABCB11_13F 5′ACTTCTTGGTCATGGCTCTCAG3. ABCB11_13R 5′AGCGTGTCCCATCAATTCAG3′

    Article Snippet: The genomic DNA was prepared from peripheral blood using standard methods (Puregene Kit, QIAGEN France SAS, 3 avenue du Canada, LP 809, 91974 COURTABOEUF CEDEX).

    Techniques: Sequencing, Polymerase Chain Reaction

    DNA electrophoresis on 0.5% agarose gel at 45 volts for 2 hrs. GeneRuler™1 kb Plus DNA markers (M, in bp) and typical DNA samples isolated by SDS (1), CTAB (2), DNAzol® (3), Puregene® (4) and DNeasy® (5).

    Journal: PLoS ONE

    Article Title: Evaluation of Five Methods for Total DNA Extraction from Western Corn Rootworm Beetles

    doi: 10.1371/journal.pone.0011963

    Figure Lengend Snippet: DNA electrophoresis on 0.5% agarose gel at 45 volts for 2 hrs. GeneRuler™1 kb Plus DNA markers (M, in bp) and typical DNA samples isolated by SDS (1), CTAB (2), DNAzol® (3), Puregene® (4) and DNeasy® (5).

    Article Snippet: The Puregene® kit contains two main reagents: cell lysis and protein precipitation solutions (Gentra Systems, Minneapolis, MN, USA).

    Techniques: Nucleic Acid Electrophoresis, Agarose Gel Electrophoresis, Isolation