psti Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs psti
    SILAC-based affinity capture of Cj1132c with purF <t>DNA</t> bait and effect of cj1132c deletion on spontaneous mutation rate. (A) Screen for DNA-binding proteins captured with purF DNA bait. Differentially labeled (light, [ 13 C 6 ]arginine, or heavy, [ 13 C 6 14 N 4 ]arginine) C. jejuni total protein lysates were incubated with biotinylated purF DNA or prsA DNA, respectively. A 1:1 light/heavy mixture of DNA/protein complexes was captured on streptavidin beads. Proteins were eluted from beads by digestion with <t>PstI</t> restriction enzyme, and trypsinized proteins were analyzed by gel electrophoresis liquid chromatography-mass spectrometry. Each dot represents an identified peptide. SILAC analysis discriminates the specificity of an interaction; peptides with a low heavy/light ratio indicate higher-affinity capture. Data are representative of two independent experiments statistically assessed by the Benjamini-Hochberg false discovery rate (FDR), and FDR Q significance values are indicated: *, Q = 0.024; **, Q = 0.014. (B) Representative mass spectra for SILAC-labeled captured peptides. Top, equal mass/charge ratio of light and heavy forms of PorA peptide indicating nonspecific interaction; bottom, the light form of Cj1132c is present in a ratio > 16.8 times higher than the heavy form, indicating a high probability of interaction with the direct repeat and hypervariable region of purF . (C) Frequency of emergence of spontaneous ciprofloxacin resistance (spontaneous mutation rate) of Δ cj1132c and complemented Δ cj1132c / cj1132c mutants in purF- T91del genetic background. The numbers of spontaneous ciprofloxacin-resistant mutants relative to total CFU per OD 600 equivalent are presented. Mean results with SEM from six independent experiments each with two technical replicates are shown: ****, P ≤ 0.0001.
    Psti, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1410 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/New England Biolabs
    Average 99 stars, based on 1410 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    98
    Thermo Fisher psti
    Circularization of <t>pBR322</t> (cohesive ends) and pUC19 (blunt ends) plasmids mediated by DdrC visualized by electron microscopy. Panel a: Control pBR322 DNA linearized by <t>PstI.</t> Panels b-e: pBR322 circularization mediated by DdrC. Panel f. Control pUC19 DNA linearized by Ssp11. Panels g-j: pUC19 circularization mediated by DdrC. 1 μM DdrC was mixed with 2 nM molecules of linear pBR322 or pUC19 plasmid, containing cohesive or blunt ends, respectively. The shapes are similar at 0.5 μM, 1 μM or 2 μM of DdrC. Magnification = 85,000. Some loci of plasmid circularization are indicated by arrows.
    Psti, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 717 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/Thermo Fisher
    Average 98 stars, based on 717 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-09
    98/100 stars
      Buy from Supplier

    99
    New England Biolabs psti hf
    Maps of doxycycline (dox)-inducible plasmids and over-expression analyses. A) Map of the pPID2 piggyBac cloning vector showing insulators in magenta; a DNA nuclear targeting sequence (DTS) in orange; multicloning sites (MCS) in purple; bacterial origin of replication (Ori) in cyan; bacterial β-lactamase (Bla) resistance gene (AmpR) in red; and piggyBac ITRs, IRES, and P2A sequences in grey. B) Map of the <t>pPIDNB</t> piggyBac dox-inducible vector showing restriction sites for cloning, coding sequences in yellow, terminator sequences in brown, and promoter sequences in green. pPIDNB constitutively expresses mNeonGreen (GFP) and coding sequences can be cloned into the plasmid under a bidirectional tetracycline (tet) inducible promoter using the AflII and <t>PstI</t> restriction sites. mScarlet-I, a red fluorescent protein (RFP), is expressed on the alternate side of the bidirectional tet promoter. C) Map of the pPIDNB2 vector, which is identical to pPIDNB except that GFP is localized to the nucleus using histone H2B. D) DF-1 cells transfected with pPIDNB constitutively express GFP and differentially express RFP in response to varying concentrations of dox after 24 hours. E) RFP-positive (i.e., dox-induced) cells relative to total number of GFP-positive (i.e., transfected) cells. F) dox induction was measured in DF-1 cells on the mRNA and G) protein levels for Cxcl14 (n = 2 for each group except n = 1 for the 2.5 ng/ml treatment; and mRNA level for H) Gas1 (n = 4 for each group). Levels are relative to 0 ng/ml of dox and normalized to 18S for mRNA and β-Actin for protein. I) Over-expression of Runx2 and J) Mmp13 with pPIDNB. DF-1 cells were transfected with control (cntrl) empty pPIDNB or pPIDNB plus Runx2 or Mmp13 coding sequence and treated with 50 ng/ml of dox for 24 hours. mRNA levels were normalized using 18S and protein using β-Actin. Representative WBs are shown below. N = 4 for each group. Error bars represent SEM. (*p
    Psti Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 208 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti hf/product/New England Biolabs
    Average 99 stars, based on 208 article reviews
    Price from $9.99 to $1999.99
    psti hf - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    psti  (TaKaRa)
    93
    TaKaRa psti
    Sorafenib induces autophagy through ER stress and MAPK8/9/10 activation. (A) TEM representative micrographs showing dilated ER cavities in sorafenib-treated Ishikawa cells for 24 h. For additional information please see Fig. S4A. (B) Left, representative images showing increased and discontinuous fluorescence intensity in endoplasmic reticulum upon sorafenib treatment. Untreated and sorafenib-treated Ishikawa cells were cultured in the presence of ER-Tracker Blue-White DPX and analyzed at 4 h post-treatment. Scale bar: 50 µm. Right, quantification of ER-Tracker Blue-White DPX intensity according to refs. 94,95 and using ImageJ software. (C) Left, schematic illustration representing 2 characteristic UPR responses, EIF2AK3/PERK-ATF4 and ERN1/IRE1. Right, <t>XBP1</t> splicing analysis by PCR and enzymatic restriction and DDIT3/CHOP protein levels by western blot with densitometry quantification in Ishikawa cells treated with sorafenib. Splicing of XBP1 mRNA results in the excision of a 26-nucleotide intronic region, causing a frame shift in the coding sequence and the removal of a <t>PstI</t> restriction site. Therefore, PstI can digest unspliced XBP1 mRNA ( XBP1u ), generating XBP1 u1 and u2 fragments, but not spliced XBP1 mRNA ( XBP1s ). h represents a hybrid band composed of XBP1u and XBP1s single-stranded DNA produced during PCR. Western blot against tubulin was performed to ensure equal protein loading amounts. (D) Kaplan-Meyer and (E) disease-free survival curves comparing the outcome of EC cases with or without overexpression of MAPK8/JNK1, MAPK9/JNK2 and MAPK10/JNK3. A z-score≥ 3 was used as threshold for increased expression. Data were extracted from TCGA_ucec (RNAseq_V2). (F) Western blot and densitometry quantification (n = 3) showing activation of MAPK8/9/10 and its target JUN after a time course treatment of sorafenib (20 µM) in Ishikawa cells. (G) Activation of MAPK8/9/10 and JUN by western blot in sorafenib-treated primary EC biopsies. CEP-1347 inhibits activation of MAPK8/9/10 and JUN (H) and blocks LC3B-II increase in Ishikawa EC cells (I). Densitometry quantifications from 3 independent experiments are also shown. (J) Representative western blot and densitometry quantification (n = 3) showing impaired LC3B-II accumulation in mapk8/9 −/− cells after sorafenib treatment. (K) Representative immunofluorescence images and quantification of the number of LC3B-II puncta per cell in wild-type and mapk8/9 −/− MEFs treated with sorafenib or sorafenib combined with CQ. Scale bar: 50 µm. (L) Analysis of SQSTM1 protein levels by western blot in wild type and mapk8/9 −/− MEFs showing that CQ and Mapk8/9 -targeted deletion abrogates SQSTM1 proteolysis in response to sorafenib in wild-type and mapk8/9 −/− MEFs. Western blot against tubulin was performed to ensure equal protein loading amounts. SQSTM1 densitometry analysis is also shown. All experiments were performed in triplicate.
    Psti, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 207 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/TaKaRa
    Average 93 stars, based on 207 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    93
    Promega psti
    Schematic representation of potential CYP2E1 <t>RsaI/PStI</t> alleles and PCR-RFLP band sizes. ‘2Els’ and ‘2Elas’ are sense and antisense oligonucleotides, respectively, used in PCR amplifications of the CYPE1 5′ regulatory region. P, PstI; , R, RsaI restriction enzyme sites.
    Psti, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 241 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/Promega
    Average 93 stars, based on 241 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    85
    Promega sacii psti digested pgem t easy
    Schematic representation of potential CYP2E1 <t>RsaI/PStI</t> alleles and PCR-RFLP band sizes. ‘2Els’ and ‘2Elas’ are sense and antisense oligonucleotides, respectively, used in PCR amplifications of the CYPE1 5′ regulatory region. P, PstI; , R, RsaI restriction enzyme sites.
    Sacii Psti Digested Pgem T Easy, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sacii psti digested pgem t easy/product/Promega
    Average 85 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    sacii psti digested pgem t easy - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    99
    New England Biolabs psti endonuclease
    PtsI restriction digestion of the chromosomal DNAs of the wild-type (lane 6), Δ <t>pstI</t> (lane 2), and Δ pstI pstM (lane 4) strains. The DNAs were subjected to electrophoresis on the 1% (wt/vol) agarose gel. M, 1-kb <t>DNA</t> markers. Lanes 1, 3,
    Psti Endonuclease, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti endonuclease/product/New England Biolabs
    Average 99 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    psti endonuclease - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    89
    Promega restriction enzyme psti
    (A) XBP1 transcript splicing in NIH 3T3 cells infected (MOI, 30) with SFV4 or VRPs. RNA from infected cells was reverse transcribed into cDNA, and XBP1 amplicons were generated by <t>PCR.</t> These were digested with <t>PstI,</t> which only cleaves amplicons derived
    Restriction Enzyme Psti, supplied by Promega, used in various techniques. Bioz Stars score: 89/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzyme psti/product/Promega
    Average 89 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme psti - by Bioz Stars, 2020-09
    89/100 stars
      Buy from Supplier

    99
    Thermo Fisher bamhi psti
    (A) XBP1 transcript splicing in NIH 3T3 cells infected (MOI, 30) with SFV4 or VRPs. RNA from infected cells was reverse transcribed into cDNA, and XBP1 amplicons were generated by <t>PCR.</t> These were digested with <t>PstI,</t> which only cleaves amplicons derived
    Bamhi Psti, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 40 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi psti/product/Thermo Fisher
    Average 99 stars, based on 40 article reviews
    Price from $9.99 to $1999.99
    bamhi psti - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    95
    Thermo Fisher fastdigest psti
    (A) XBP1 transcript splicing in NIH 3T3 cells infected (MOI, 30) with SFV4 or VRPs. RNA from infected cells was reverse transcribed into cDNA, and XBP1 amplicons were generated by <t>PCR.</t> These were digested with <t>PstI,</t> which only cleaves amplicons derived
    Fastdigest Psti, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 44 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fastdigest psti/product/Thermo Fisher
    Average 95 stars, based on 44 article reviews
    Price from $9.99 to $1999.99
    fastdigest psti - by Bioz Stars, 2020-09
    95/100 stars
      Buy from Supplier

    85
    Promega psti endonuclease
    <t>PstI-digested</t> PCR products of <t>bla</t> CTX-M genes of representative cefotaxime-resistant isolates. Lanes 1 to 10, Belarussian isolates MI-16, VOL-19, RET-27, VTB-6570, VTB-3078, VTB-13526, VTB-14533, VTB-1358, USH-1845, and ORS-13935, respectively; lanes 11 to 15, Russian isolates MOS-20, SP-891, SP-893, JAR-637, and JAR-81, respectively; lane 16, Salmonella serovar Typhimurium CAS-5 (CTX-M-2); lane 17, undigested PCR product from strain CAS-5; lanes M, molecular size markers (pUC18-HaeIII restriction fragments).
    Psti Endonuclease, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti endonuclease/product/Promega
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    psti endonuclease - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    Image Search Results


    SILAC-based affinity capture of Cj1132c with purF DNA bait and effect of cj1132c deletion on spontaneous mutation rate. (A) Screen for DNA-binding proteins captured with purF DNA bait. Differentially labeled (light, [ 13 C 6 ]arginine, or heavy, [ 13 C 6 14 N 4 ]arginine) C. jejuni total protein lysates were incubated with biotinylated purF DNA or prsA DNA, respectively. A 1:1 light/heavy mixture of DNA/protein complexes was captured on streptavidin beads. Proteins were eluted from beads by digestion with PstI restriction enzyme, and trypsinized proteins were analyzed by gel electrophoresis liquid chromatography-mass spectrometry. Each dot represents an identified peptide. SILAC analysis discriminates the specificity of an interaction; peptides with a low heavy/light ratio indicate higher-affinity capture. Data are representative of two independent experiments statistically assessed by the Benjamini-Hochberg false discovery rate (FDR), and FDR Q significance values are indicated: *, Q = 0.024; **, Q = 0.014. (B) Representative mass spectra for SILAC-labeled captured peptides. Top, equal mass/charge ratio of light and heavy forms of PorA peptide indicating nonspecific interaction; bottom, the light form of Cj1132c is present in a ratio > 16.8 times higher than the heavy form, indicating a high probability of interaction with the direct repeat and hypervariable region of purF . (C) Frequency of emergence of spontaneous ciprofloxacin resistance (spontaneous mutation rate) of Δ cj1132c and complemented Δ cj1132c / cj1132c mutants in purF- T91del genetic background. The numbers of spontaneous ciprofloxacin-resistant mutants relative to total CFU per OD 600 equivalent are presented. Mean results with SEM from six independent experiments each with two technical replicates are shown: ****, P ≤ 0.0001.

    Journal: mBio

    Article Title: High-Frequency Variation of Purine Biosynthesis Genes Is a Mechanism of Success in Campylobacter jejuni

    doi: 10.1128/mBio.00612-15

    Figure Lengend Snippet: SILAC-based affinity capture of Cj1132c with purF DNA bait and effect of cj1132c deletion on spontaneous mutation rate. (A) Screen for DNA-binding proteins captured with purF DNA bait. Differentially labeled (light, [ 13 C 6 ]arginine, or heavy, [ 13 C 6 14 N 4 ]arginine) C. jejuni total protein lysates were incubated with biotinylated purF DNA or prsA DNA, respectively. A 1:1 light/heavy mixture of DNA/protein complexes was captured on streptavidin beads. Proteins were eluted from beads by digestion with PstI restriction enzyme, and trypsinized proteins were analyzed by gel electrophoresis liquid chromatography-mass spectrometry. Each dot represents an identified peptide. SILAC analysis discriminates the specificity of an interaction; peptides with a low heavy/light ratio indicate higher-affinity capture. Data are representative of two independent experiments statistically assessed by the Benjamini-Hochberg false discovery rate (FDR), and FDR Q significance values are indicated: *, Q = 0.024; **, Q = 0.014. (B) Representative mass spectra for SILAC-labeled captured peptides. Top, equal mass/charge ratio of light and heavy forms of PorA peptide indicating nonspecific interaction; bottom, the light form of Cj1132c is present in a ratio > 16.8 times higher than the heavy form, indicating a high probability of interaction with the direct repeat and hypervariable region of purF . (C) Frequency of emergence of spontaneous ciprofloxacin resistance (spontaneous mutation rate) of Δ cj1132c and complemented Δ cj1132c / cj1132c mutants in purF- T91del genetic background. The numbers of spontaneous ciprofloxacin-resistant mutants relative to total CFU per OD 600 equivalent are presented. Mean results with SEM from six independent experiments each with two technical replicates are shown: ****, P ≤ 0.0001.

    Article Snippet: Protein-DNA complexes were pooled, eluted by PstI (NEB) restriction enzyme cleavage, and digested with ArgC, and purified peptides were analyzed by reverse-phase liquid chromatography-mass spectrometry.

    Techniques: Mutagenesis, DNA Binding Assay, Labeling, Incubation, Nucleic Acid Electrophoresis, Liquid Chromatography, Mass Spectrometry

    Changes in conformational states of the terminase and prohead portal during packaging of linear and Y-DNA substrates. Packaging was carried out using GFP-gp20 proheads, CT-ReAsH terminase, and unlabeled linear (5-kb PstI-digested pL16 DNA) or unlabeled 3.7-kb Y-DNA. Different FRET values were observed between CT-ReAsH terminase and GFP-gp20 fusion with the linear ( A ) and Y-DNAs ( B ). FRET was measured with the 3.7-kb Y-DNA after resolvase treatment for 30 min ( C ).

    Journal: The Journal of Biological Chemistry

    Article Title: Dynamics of the T4 Bacteriophage DNA Packasome Motor

    doi: 10.1074/jbc.M111.222828

    Figure Lengend Snippet: Changes in conformational states of the terminase and prohead portal during packaging of linear and Y-DNA substrates. Packaging was carried out using GFP-gp20 proheads, CT-ReAsH terminase, and unlabeled linear (5-kb PstI-digested pL16 DNA) or unlabeled 3.7-kb Y-DNA. Different FRET values were observed between CT-ReAsH terminase and GFP-gp20 fusion with the linear ( A ) and Y-DNAs ( B ). FRET was measured with the 3.7-kb Y-DNA after resolvase treatment for 30 min ( C ).

    Article Snippet: The double dye AxC3Y-DNAs, single dye AxY-DNAs, and unlabeled Y-DNAs (90 bases each) were phosphorylated by T4 polynucleotide kinase (New England Biolabs), and the blunt ends were ligated to pBR322 DNA linearized with EcoRV, followed by PstI digestion and gel extraction to yield the Y-DNAs with the 3.7-kb purified pBR322 (New England Biolabs) derived leaders ( C ).

    Techniques:

    ReAsH-EDT2 labeled N- and C-terminal tetra cysteine-tagged gp17 proteins are active in DNA packaging. A and B , both the NT and CT tetra cysteine-tagged gp17 proteins were labeled with ReAsH EDT2 dye, and fluorescence was measured in a Picoquant MicroTime 200 confocal microscope ( A ) and Typhoon imager ( B ). C , the labeled and unlabeled CT and NT terminases were run on native-PAGE followed by Coomassie staining as a loading control, and unstained gel was analyzed in Typhoon imager. D and E , nuclease assays were carried out to check the activities of the unlabeled ( D ) and the labeled CT and NT terminases ( E ) using 5-kb PstI linearized pL16 DNA as a substrate and wild type proheads in the reaction mixtures. Wild type terminase was used as a positive control in the assays.

    Journal: The Journal of Biological Chemistry

    Article Title: Dynamics of the T4 Bacteriophage DNA Packasome Motor

    doi: 10.1074/jbc.M111.222828

    Figure Lengend Snippet: ReAsH-EDT2 labeled N- and C-terminal tetra cysteine-tagged gp17 proteins are active in DNA packaging. A and B , both the NT and CT tetra cysteine-tagged gp17 proteins were labeled with ReAsH EDT2 dye, and fluorescence was measured in a Picoquant MicroTime 200 confocal microscope ( A ) and Typhoon imager ( B ). C , the labeled and unlabeled CT and NT terminases were run on native-PAGE followed by Coomassie staining as a loading control, and unstained gel was analyzed in Typhoon imager. D and E , nuclease assays were carried out to check the activities of the unlabeled ( D ) and the labeled CT and NT terminases ( E ) using 5-kb PstI linearized pL16 DNA as a substrate and wild type proheads in the reaction mixtures. Wild type terminase was used as a positive control in the assays.

    Article Snippet: The double dye AxC3Y-DNAs, single dye AxY-DNAs, and unlabeled Y-DNAs (90 bases each) were phosphorylated by T4 polynucleotide kinase (New England Biolabs), and the blunt ends were ligated to pBR322 DNA linearized with EcoRV, followed by PstI digestion and gel extraction to yield the Y-DNAs with the 3.7-kb purified pBR322 (New England Biolabs) derived leaders ( C ).

    Techniques: Labeling, Fluorescence, Microscopy, Clear Native PAGE, Staining, Positive Control

    Circularization of pBR322 (cohesive ends) and pUC19 (blunt ends) plasmids mediated by DdrC visualized by electron microscopy. Panel a: Control pBR322 DNA linearized by PstI. Panels b-e: pBR322 circularization mediated by DdrC. Panel f. Control pUC19 DNA linearized by Ssp11. Panels g-j: pUC19 circularization mediated by DdrC. 1 μM DdrC was mixed with 2 nM molecules of linear pBR322 or pUC19 plasmid, containing cohesive or blunt ends, respectively. The shapes are similar at 0.5 μM, 1 μM or 2 μM of DdrC. Magnification = 85,000. Some loci of plasmid circularization are indicated by arrows.

    Journal: PLoS ONE

    Article Title: In vivo and in vitro characterization of DdrC, a DNA damage response protein in Deinococcus radiodurans bacterium

    doi: 10.1371/journal.pone.0177751

    Figure Lengend Snippet: Circularization of pBR322 (cohesive ends) and pUC19 (blunt ends) plasmids mediated by DdrC visualized by electron microscopy. Panel a: Control pBR322 DNA linearized by PstI. Panels b-e: pBR322 circularization mediated by DdrC. Panel f. Control pUC19 DNA linearized by Ssp11. Panels g-j: pUC19 circularization mediated by DdrC. 1 μM DdrC was mixed with 2 nM molecules of linear pBR322 or pUC19 plasmid, containing cohesive or blunt ends, respectively. The shapes are similar at 0.5 μM, 1 μM or 2 μM of DdrC. Magnification = 85,000. Some loci of plasmid circularization are indicated by arrows.

    Article Snippet: Electrophoretic Mobility Shift Assay (EMSA) 200 ng of supercoiled pBR322 or pBR322 linearized by PstI (Thermo-Scientific) (4361 bp), as well as 200 ng of RFI (5386 bp) or single-stranded DNA of phiX174 virion were incubated in 20 μl of buffer A (40 mM Tris-HCl pH 7.8, 5 mM MgCl2 , 1.5 mM DTT, 50 mM NaCl, 12% glycerol) with increasing concentrations of DdrC (0.86 μM, 1.7 μM, 3.5 μM, 7 μM and 8.6 μM).

    Techniques: Electron Microscopy, Plasmid Preparation

    Agarose gel electrophoresis of the polymerase chain reaction based restriction fragment length polymorphism (PCR-RFLP) analysis of XPD and XRCC1 . (Lanes 1–5) PstI digested fragments of exon 23 c.2298A > C XPD SNP. (Lane 1) AA genotype consisting of two fragments; 290 and 146 bp. (Lanes 2, 3, and 5) AC genotype consisting of four fragments; 290, 227, 146 and 63 bp. (Lane 4) CC genotype consisting of three fragments; 227, 146, and 63 bp. (Lanes 6–9) MspI digested fragments of exon 10 c.1316G > A XRCC1 SNP. (Lane 7) GG genotype consisting of two fragments; 148 and 94 bp. (Lanes 6 and 8) AG genotype consisting of three fragments; 242, 148, and 94 bp. (Lane 9) AA genotype consisting of an undigested fragment of 242 bp.

    Journal: Molecular Vision

    Article Title: XRCC1 and XPD DNA repair gene polymorphisms: A potential risk factor for glaucoma in the Pakistani population

    doi:

    Figure Lengend Snippet: Agarose gel electrophoresis of the polymerase chain reaction based restriction fragment length polymorphism (PCR-RFLP) analysis of XPD and XRCC1 . (Lanes 1–5) PstI digested fragments of exon 23 c.2298A > C XPD SNP. (Lane 1) AA genotype consisting of two fragments; 290 and 146 bp. (Lanes 2, 3, and 5) AC genotype consisting of four fragments; 290, 227, 146 and 63 bp. (Lane 4) CC genotype consisting of three fragments; 227, 146, and 63 bp. (Lanes 6–9) MspI digested fragments of exon 10 c.1316G > A XRCC1 SNP. (Lane 7) GG genotype consisting of two fragments; 148 and 94 bp. (Lanes 6 and 8) AG genotype consisting of three fragments; 242, 148, and 94 bp. (Lane 9) AA genotype consisting of an undigested fragment of 242 bp.

    Article Snippet: RFLP analysis of XPD The PCR amplified products were digested with PstI restriction enzyme (Fermentas) overnight at 37 °C and the fragments were resolved on 4% agarose gel.

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction

    PERK and IRE1 pathways was activated under ER stress and was involved in DEV-induced autophagy. (A) DEF cells were infected with DEV at a MOI of 1 or treated with 300 nM Tg for 24 hours, and whole-cell protein extracts were collected at 36, 48, and 60 hours post-infection and then subjected to immunoblotting analysis of GRP78, p-PERK, p-eIF2α, LC3, ATF4, p-IRE1 and β-actin using the indicated antibodies. Tg is an inducer of ER stress. (B) Ratios of GRP78 to β-actin, p-PERK to PERK, p-eIF2α to eIF2α, ATF4 to actin, and p-IRE1 to IRE1, and LC3-II to LC3-I. (C) Activation of the IRE1-XBP1 signaling pathway. Total RNA was isolated from DEF cells, and RT-PCR was performed using XBP1-specific primers. PCR products were digested with PstI. Spliced XBP1 (s) products, 549 bp; Unspliced XBP1 (u) products, 276 bp; GAPDH was used as the loading control. (D) Inactivation of the ATF6 signaling pathway. DEF cells were infected with DEV at a MOI of 1 or treated with 300 nM Tg for 24 hours, and whole-cell protein extracts were collected at 36, 48, and 60 hours post-infection and then subjected to immunoblotting analysis of ATF6 and β-actin using the indicated antibodies.

    Journal: PLoS ONE

    Article Title: DEV induce autophagy via the endoplasmic reticulum stress related unfolded protein response

    doi: 10.1371/journal.pone.0189704

    Figure Lengend Snippet: PERK and IRE1 pathways was activated under ER stress and was involved in DEV-induced autophagy. (A) DEF cells were infected with DEV at a MOI of 1 or treated with 300 nM Tg for 24 hours, and whole-cell protein extracts were collected at 36, 48, and 60 hours post-infection and then subjected to immunoblotting analysis of GRP78, p-PERK, p-eIF2α, LC3, ATF4, p-IRE1 and β-actin using the indicated antibodies. Tg is an inducer of ER stress. (B) Ratios of GRP78 to β-actin, p-PERK to PERK, p-eIF2α to eIF2α, ATF4 to actin, and p-IRE1 to IRE1, and LC3-II to LC3-I. (C) Activation of the IRE1-XBP1 signaling pathway. Total RNA was isolated from DEF cells, and RT-PCR was performed using XBP1-specific primers. PCR products were digested with PstI. Spliced XBP1 (s) products, 549 bp; Unspliced XBP1 (u) products, 276 bp; GAPDH was used as the loading control. (D) Inactivation of the ATF6 signaling pathway. DEF cells were infected with DEV at a MOI of 1 or treated with 300 nM Tg for 24 hours, and whole-cell protein extracts were collected at 36, 48, and 60 hours post-infection and then subjected to immunoblotting analysis of ATF6 and β-actin using the indicated antibodies.

    Article Snippet: The PCR products were further digested with the restriction enzyme PstI (Thermo Fisher Scientific, Waltham, MA, USA) and then separated on a 1% agarose gel.

    Techniques: Infection, Activation Assay, Isolation, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

    Maps of doxycycline (dox)-inducible plasmids and over-expression analyses. A) Map of the pPID2 piggyBac cloning vector showing insulators in magenta; a DNA nuclear targeting sequence (DTS) in orange; multicloning sites (MCS) in purple; bacterial origin of replication (Ori) in cyan; bacterial β-lactamase (Bla) resistance gene (AmpR) in red; and piggyBac ITRs, IRES, and P2A sequences in grey. B) Map of the pPIDNB piggyBac dox-inducible vector showing restriction sites for cloning, coding sequences in yellow, terminator sequences in brown, and promoter sequences in green. pPIDNB constitutively expresses mNeonGreen (GFP) and coding sequences can be cloned into the plasmid under a bidirectional tetracycline (tet) inducible promoter using the AflII and PstI restriction sites. mScarlet-I, a red fluorescent protein (RFP), is expressed on the alternate side of the bidirectional tet promoter. C) Map of the pPIDNB2 vector, which is identical to pPIDNB except that GFP is localized to the nucleus using histone H2B. D) DF-1 cells transfected with pPIDNB constitutively express GFP and differentially express RFP in response to varying concentrations of dox after 24 hours. E) RFP-positive (i.e., dox-induced) cells relative to total number of GFP-positive (i.e., transfected) cells. F) dox induction was measured in DF-1 cells on the mRNA and G) protein levels for Cxcl14 (n = 2 for each group except n = 1 for the 2.5 ng/ml treatment; and mRNA level for H) Gas1 (n = 4 for each group). Levels are relative to 0 ng/ml of dox and normalized to 18S for mRNA and β-Actin for protein. I) Over-expression of Runx2 and J) Mmp13 with pPIDNB. DF-1 cells were transfected with control (cntrl) empty pPIDNB or pPIDNB plus Runx2 or Mmp13 coding sequence and treated with 50 ng/ml of dox for 24 hours. mRNA levels were normalized using 18S and protein using β-Actin. Representative WBs are shown below. N = 4 for each group. Error bars represent SEM. (*p

    Journal: bioRxiv

    Article Title: Stable integration of an optimized inducible promoter system enables spatiotemporal control of gene expression throughout avian development

    doi: 10.1101/2020.06.22.165704

    Figure Lengend Snippet: Maps of doxycycline (dox)-inducible plasmids and over-expression analyses. A) Map of the pPID2 piggyBac cloning vector showing insulators in magenta; a DNA nuclear targeting sequence (DTS) in orange; multicloning sites (MCS) in purple; bacterial origin of replication (Ori) in cyan; bacterial β-lactamase (Bla) resistance gene (AmpR) in red; and piggyBac ITRs, IRES, and P2A sequences in grey. B) Map of the pPIDNB piggyBac dox-inducible vector showing restriction sites for cloning, coding sequences in yellow, terminator sequences in brown, and promoter sequences in green. pPIDNB constitutively expresses mNeonGreen (GFP) and coding sequences can be cloned into the plasmid under a bidirectional tetracycline (tet) inducible promoter using the AflII and PstI restriction sites. mScarlet-I, a red fluorescent protein (RFP), is expressed on the alternate side of the bidirectional tet promoter. C) Map of the pPIDNB2 vector, which is identical to pPIDNB except that GFP is localized to the nucleus using histone H2B. D) DF-1 cells transfected with pPIDNB constitutively express GFP and differentially express RFP in response to varying concentrations of dox after 24 hours. E) RFP-positive (i.e., dox-induced) cells relative to total number of GFP-positive (i.e., transfected) cells. F) dox induction was measured in DF-1 cells on the mRNA and G) protein levels for Cxcl14 (n = 2 for each group except n = 1 for the 2.5 ng/ml treatment; and mRNA level for H) Gas1 (n = 4 for each group). Levels are relative to 0 ng/ml of dox and normalized to 18S for mRNA and β-Actin for protein. I) Over-expression of Runx2 and J) Mmp13 with pPIDNB. DF-1 cells were transfected with control (cntrl) empty pPIDNB or pPIDNB plus Runx2 or Mmp13 coding sequence and treated with 50 ng/ml of dox for 24 hours. mRNA levels were normalized using 18S and protein using β-Actin. Representative WBs are shown below. N = 4 for each group. Error bars represent SEM. (*p

    Article Snippet: Following confirmation of cloning of full length coding sequences by Sanger sequencing, Runx2 , Mmp13 , Cxcl14 , and Gas1 were cloned into pEPIC1.1 digested with AflII (NEB, R0520S) and EcoRI (NEB, R3101S) or pPIDNB digested with AflII (NEB, R0520S) and PstI (NEB, R3140S) using NEBuilder HiFi DNA Assembly Master Mix.

    Techniques: Over Expression, Clone Assay, Plasmid Preparation, Sequencing, Transfection

    Sorafenib induces autophagy through ER stress and MAPK8/9/10 activation. (A) TEM representative micrographs showing dilated ER cavities in sorafenib-treated Ishikawa cells for 24 h. For additional information please see Fig. S4A. (B) Left, representative images showing increased and discontinuous fluorescence intensity in endoplasmic reticulum upon sorafenib treatment. Untreated and sorafenib-treated Ishikawa cells were cultured in the presence of ER-Tracker Blue-White DPX and analyzed at 4 h post-treatment. Scale bar: 50 µm. Right, quantification of ER-Tracker Blue-White DPX intensity according to refs. 94,95 and using ImageJ software. (C) Left, schematic illustration representing 2 characteristic UPR responses, EIF2AK3/PERK-ATF4 and ERN1/IRE1. Right, XBP1 splicing analysis by PCR and enzymatic restriction and DDIT3/CHOP protein levels by western blot with densitometry quantification in Ishikawa cells treated with sorafenib. Splicing of XBP1 mRNA results in the excision of a 26-nucleotide intronic region, causing a frame shift in the coding sequence and the removal of a PstI restriction site. Therefore, PstI can digest unspliced XBP1 mRNA ( XBP1u ), generating XBP1 u1 and u2 fragments, but not spliced XBP1 mRNA ( XBP1s ). h represents a hybrid band composed of XBP1u and XBP1s single-stranded DNA produced during PCR. Western blot against tubulin was performed to ensure equal protein loading amounts. (D) Kaplan-Meyer and (E) disease-free survival curves comparing the outcome of EC cases with or without overexpression of MAPK8/JNK1, MAPK9/JNK2 and MAPK10/JNK3. A z-score≥ 3 was used as threshold for increased expression. Data were extracted from TCGA_ucec (RNAseq_V2). (F) Western blot and densitometry quantification (n = 3) showing activation of MAPK8/9/10 and its target JUN after a time course treatment of sorafenib (20 µM) in Ishikawa cells. (G) Activation of MAPK8/9/10 and JUN by western blot in sorafenib-treated primary EC biopsies. CEP-1347 inhibits activation of MAPK8/9/10 and JUN (H) and blocks LC3B-II increase in Ishikawa EC cells (I). Densitometry quantifications from 3 independent experiments are also shown. (J) Representative western blot and densitometry quantification (n = 3) showing impaired LC3B-II accumulation in mapk8/9 −/− cells after sorafenib treatment. (K) Representative immunofluorescence images and quantification of the number of LC3B-II puncta per cell in wild-type and mapk8/9 −/− MEFs treated with sorafenib or sorafenib combined with CQ. Scale bar: 50 µm. (L) Analysis of SQSTM1 protein levels by western blot in wild type and mapk8/9 −/− MEFs showing that CQ and Mapk8/9 -targeted deletion abrogates SQSTM1 proteolysis in response to sorafenib in wild-type and mapk8/9 −/− MEFs. Western blot against tubulin was performed to ensure equal protein loading amounts. SQSTM1 densitometry analysis is also shown. All experiments were performed in triplicate.

    Journal: Autophagy

    Article Title: Autophagy orchestrates adaptive responses to targeted therapy in endometrial cancer

    doi: 10.1080/15548627.2016.1271512

    Figure Lengend Snippet: Sorafenib induces autophagy through ER stress and MAPK8/9/10 activation. (A) TEM representative micrographs showing dilated ER cavities in sorafenib-treated Ishikawa cells for 24 h. For additional information please see Fig. S4A. (B) Left, representative images showing increased and discontinuous fluorescence intensity in endoplasmic reticulum upon sorafenib treatment. Untreated and sorafenib-treated Ishikawa cells were cultured in the presence of ER-Tracker Blue-White DPX and analyzed at 4 h post-treatment. Scale bar: 50 µm. Right, quantification of ER-Tracker Blue-White DPX intensity according to refs. 94,95 and using ImageJ software. (C) Left, schematic illustration representing 2 characteristic UPR responses, EIF2AK3/PERK-ATF4 and ERN1/IRE1. Right, XBP1 splicing analysis by PCR and enzymatic restriction and DDIT3/CHOP protein levels by western blot with densitometry quantification in Ishikawa cells treated with sorafenib. Splicing of XBP1 mRNA results in the excision of a 26-nucleotide intronic region, causing a frame shift in the coding sequence and the removal of a PstI restriction site. Therefore, PstI can digest unspliced XBP1 mRNA ( XBP1u ), generating XBP1 u1 and u2 fragments, but not spliced XBP1 mRNA ( XBP1s ). h represents a hybrid band composed of XBP1u and XBP1s single-stranded DNA produced during PCR. Western blot against tubulin was performed to ensure equal protein loading amounts. (D) Kaplan-Meyer and (E) disease-free survival curves comparing the outcome of EC cases with or without overexpression of MAPK8/JNK1, MAPK9/JNK2 and MAPK10/JNK3. A z-score≥ 3 was used as threshold for increased expression. Data were extracted from TCGA_ucec (RNAseq_V2). (F) Western blot and densitometry quantification (n = 3) showing activation of MAPK8/9/10 and its target JUN after a time course treatment of sorafenib (20 µM) in Ishikawa cells. (G) Activation of MAPK8/9/10 and JUN by western blot in sorafenib-treated primary EC biopsies. CEP-1347 inhibits activation of MAPK8/9/10 and JUN (H) and blocks LC3B-II increase in Ishikawa EC cells (I). Densitometry quantifications from 3 independent experiments are also shown. (J) Representative western blot and densitometry quantification (n = 3) showing impaired LC3B-II accumulation in mapk8/9 −/− cells after sorafenib treatment. (K) Representative immunofluorescence images and quantification of the number of LC3B-II puncta per cell in wild-type and mapk8/9 −/− MEFs treated with sorafenib or sorafenib combined with CQ. Scale bar: 50 µm. (L) Analysis of SQSTM1 protein levels by western blot in wild type and mapk8/9 −/− MEFs showing that CQ and Mapk8/9 -targeted deletion abrogates SQSTM1 proteolysis in response to sorafenib in wild-type and mapk8/9 −/− MEFs. Western blot against tubulin was performed to ensure equal protein loading amounts. SQSTM1 densitometry analysis is also shown. All experiments were performed in triplicate.

    Article Snippet: Briefly the RT-PCR product of XBP1 mRNA was synthesized primers using primers 5′ GGCCTTGTGGTTGAGAACCAGGAG 3′ (sense) 5′ GAATGCCCAA AA GGATATCAGACTC 3′ (antisense) with the following PCR protocol: 30 cycles of PCR amplification including initialization at 94°C for 4 min, denaturation at 94°C for 10 sec, annealing at 63°C for 30 sec, elongation at 72°C for 30 sec, and final elongation at 72°C for 10 min. Because a 26-bp fragment contains a PstI site that is spliced upon the activation of XBP1 mRNA, the RT-PCR products were digested with PstI (Takara Bio Inc., 1073A).

    Techniques: Activation Assay, Transmission Electron Microscopy, Fluorescence, Cell Culture, Software, Polymerase Chain Reaction, Western Blot, Sequencing, Produced, Over Expression, Expressing, Immunofluorescence

    Schematic representation of potential CYP2E1 RsaI/PStI alleles and PCR-RFLP band sizes. ‘2Els’ and ‘2Elas’ are sense and antisense oligonucleotides, respectively, used in PCR amplifications of the CYPE1 5′ regulatory region. P, PstI; , R, RsaI restriction enzyme sites.

    Journal: Oral oncology

    Article Title: Elucidation of CYP2E1 5? regulatory RsaI/Pstl allelic variants and their role in risk for oral cancer

    doi:

    Figure Lengend Snippet: Schematic representation of potential CYP2E1 RsaI/PStI alleles and PCR-RFLP band sizes. ‘2Els’ and ‘2Elas’ are sense and antisense oligonucleotides, respectively, used in PCR amplifications of the CYPE1 5′ regulatory region. P, PstI; , R, RsaI restriction enzyme sites.

    Article Snippet: Differences in RFLP patterns were detected after combined or single restriction enzyme digestion with RsaI and/or PstI (Promega Corp., Madison, WI) as indicated in the text.

    Techniques: Polymerase Chain Reaction

    PtsI restriction digestion of the chromosomal DNAs of the wild-type (lane 6), Δ pstI (lane 2), and Δ pstI pstM (lane 4) strains. The DNAs were subjected to electrophoresis on the 1% (wt/vol) agarose gel. M, 1-kb DNA markers. Lanes 1, 3,

    Journal: Applied and Environmental Microbiology

    Article Title: Combined Genomics and Experimental Analyses of Respiratory Characteristics of Shewanella putrefaciens W3-18-1

    doi: 10.1128/AEM.00619-13

    Figure Lengend Snippet: PtsI restriction digestion of the chromosomal DNAs of the wild-type (lane 6), Δ pstI (lane 2), and Δ pstI pstM (lane 4) strains. The DNAs were subjected to electrophoresis on the 1% (wt/vol) agarose gel. M, 1-kb DNA markers. Lanes 1, 3,

    Article Snippet: Consistently, its chromosomal DNA could not be digested by commercial PstI endonuclease (New England BioLabs), probably due to the methylation of recognition sites ( ).

    Techniques: Electrophoresis, Agarose Gel Electrophoresis

    (A) XBP1 transcript splicing in NIH 3T3 cells infected (MOI, 30) with SFV4 or VRPs. RNA from infected cells was reverse transcribed into cDNA, and XBP1 amplicons were generated by PCR. These were digested with PstI, which only cleaves amplicons derived

    Journal: Journal of Virology

    Article Title: Semliki Forest Virus-Induced Endoplasmic Reticulum Stress Accelerates Apoptotic Death of Mammalian Cells ▿Semliki Forest Virus-Induced Endoplasmic Reticulum Stress Accelerates Apoptotic Death of Mammalian Cells ▿ †

    doi: 10.1128/JVI.02310-09

    Figure Lengend Snippet: (A) XBP1 transcript splicing in NIH 3T3 cells infected (MOI, 30) with SFV4 or VRPs. RNA from infected cells was reverse transcribed into cDNA, and XBP1 amplicons were generated by PCR. These were digested with PstI, which only cleaves amplicons derived

    Article Snippet: The PCR product then was treated with the restriction enzyme PstI (Promega) and run on an agarose gel.

    Techniques: Infection, Generated, Polymerase Chain Reaction, Derivative Assay

    PstI-digested PCR products of bla CTX-M genes of representative cefotaxime-resistant isolates. Lanes 1 to 10, Belarussian isolates MI-16, VOL-19, RET-27, VTB-6570, VTB-3078, VTB-13526, VTB-14533, VTB-1358, USH-1845, and ORS-13935, respectively; lanes 11 to 15, Russian isolates MOS-20, SP-891, SP-893, JAR-637, and JAR-81, respectively; lane 16, Salmonella serovar Typhimurium CAS-5 (CTX-M-2); lane 17, undigested PCR product from strain CAS-5; lanes M, molecular size markers (pUC18-HaeIII restriction fragments).

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Multiple Outbreaks of Nosocomial Salmonellosis in Russia and Belarus Caused by a Single Clone of Salmonella enterica Serovar Typhimurium Producing an Extended-Spectrum ?-Lactamase

    doi: 10.1128/AAC.48.8.2808-2815.2004

    Figure Lengend Snippet: PstI-digested PCR products of bla CTX-M genes of representative cefotaxime-resistant isolates. Lanes 1 to 10, Belarussian isolates MI-16, VOL-19, RET-27, VTB-6570, VTB-3078, VTB-13526, VTB-14533, VTB-1358, USH-1845, and ORS-13935, respectively; lanes 11 to 15, Russian isolates MOS-20, SP-891, SP-893, JAR-637, and JAR-81, respectively; lane 16, Salmonella serovar Typhimurium CAS-5 (CTX-M-2); lane 17, undigested PCR product from strain CAS-5; lanes M, molecular size markers (pUC18-HaeIII restriction fragments).

    Article Snippet: Amplification reactions were carried out in a PTC-200 thermocycler (MJ Research) under the following conditions: initial denaturation at 94°C for 2 min, followed by 35 cycles of denaturation at 95°C for 20 s, annealing at 51°C for 30 s, and elongation at 72°C for 30 s. The final elongation step was extended to 3 min. To verify that the PCR products corresponded to the bla CTX-M-2 -related genes, we compared their restriction profiles after digestion with PstI endonuclease (Promega) with that of the amplicon of the bla CTX-M-2 gene.

    Techniques: Polymerase Chain Reaction

    Restriction profiles of CTX-M-coding plasmids digested with endonucleases PstI (A) and Pvu II (B). Lanes 1 to 12, Belarussian isolates RET-27, VTB-6570, VTB-3078, VTB-13526, VTB-1358, VTB-1603, VTB-14533, VTB-700, VTB-16753, USH-1845, USH-13205, and ORS-13935, respectively; lanes 13 to 18, Russian isolates MOS-20, SP-891, SP-893, JAR-637, JAR-727, and JAR-81, respectively; lanes M, molecular size markers (bacteriophage λ-BstEII restriction fragments).

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Multiple Outbreaks of Nosocomial Salmonellosis in Russia and Belarus Caused by a Single Clone of Salmonella enterica Serovar Typhimurium Producing an Extended-Spectrum ?-Lactamase

    doi: 10.1128/AAC.48.8.2808-2815.2004

    Figure Lengend Snippet: Restriction profiles of CTX-M-coding plasmids digested with endonucleases PstI (A) and Pvu II (B). Lanes 1 to 12, Belarussian isolates RET-27, VTB-6570, VTB-3078, VTB-13526, VTB-1358, VTB-1603, VTB-14533, VTB-700, VTB-16753, USH-1845, USH-13205, and ORS-13935, respectively; lanes 13 to 18, Russian isolates MOS-20, SP-891, SP-893, JAR-637, JAR-727, and JAR-81, respectively; lanes M, molecular size markers (bacteriophage λ-BstEII restriction fragments).

    Article Snippet: Amplification reactions were carried out in a PTC-200 thermocycler (MJ Research) under the following conditions: initial denaturation at 94°C for 2 min, followed by 35 cycles of denaturation at 95°C for 20 s, annealing at 51°C for 30 s, and elongation at 72°C for 30 s. The final elongation step was extended to 3 min. To verify that the PCR products corresponded to the bla CTX-M-2 -related genes, we compared their restriction profiles after digestion with PstI endonuclease (Promega) with that of the amplicon of the bla CTX-M-2 gene.

    Techniques: