psti Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs psti
    SILAC-based affinity capture of Cj1132c with purF <t>DNA</t> bait and effect of cj1132c deletion on spontaneous mutation rate. (A) Screen for DNA-binding proteins captured with purF DNA bait. Differentially labeled (light, [ 13 C 6 ]arginine, or heavy, [ 13 C 6 14 N 4 ]arginine) C. jejuni total protein lysates were incubated with biotinylated purF DNA or prsA DNA, respectively. A 1:1 light/heavy mixture of DNA/protein complexes was captured on streptavidin beads. Proteins were eluted from beads by digestion with <t>PstI</t> restriction enzyme, and trypsinized proteins were analyzed by gel electrophoresis liquid chromatography-mass spectrometry. Each dot represents an identified peptide. SILAC analysis discriminates the specificity of an interaction; peptides with a low heavy/light ratio indicate higher-affinity capture. Data are representative of two independent experiments statistically assessed by the Benjamini-Hochberg false discovery rate (FDR), and FDR Q significance values are indicated: *, Q = 0.024; **, Q = 0.014. (B) Representative mass spectra for SILAC-labeled captured peptides. Top, equal mass/charge ratio of light and heavy forms of PorA peptide indicating nonspecific interaction; bottom, the light form of Cj1132c is present in a ratio > 16.8 times higher than the heavy form, indicating a high probability of interaction with the direct repeat and hypervariable region of purF . (C) Frequency of emergence of spontaneous ciprofloxacin resistance (spontaneous mutation rate) of Δ cj1132c and complemented Δ cj1132c / cj1132c mutants in purF- T91del genetic background. The numbers of spontaneous ciprofloxacin-resistant mutants relative to total CFU per OD 600 equivalent are presented. Mean results with SEM from six independent experiments each with two technical replicates are shown: ****, P ≤ 0.0001.
    Psti, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1468 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/New England Biolabs
    Average 99 stars, based on 1468 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher psti
    Circularization of <t>pBR322</t> (cohesive ends) and pUC19 (blunt ends) plasmids mediated by DdrC visualized by electron microscopy. Panel a: Control pBR322 DNA linearized by <t>PstI.</t> Panels b-e: pBR322 circularization mediated by DdrC. Panel f. Control pUC19 DNA linearized by Ssp11. Panels g-j: pUC19 circularization mediated by DdrC. 1 μM DdrC was mixed with 2 nM molecules of linear pBR322 or pUC19 plasmid, containing cohesive or blunt ends, respectively. The shapes are similar at 0.5 μM, 1 μM or 2 μM of DdrC. Magnification = 85,000. Some loci of plasmid circularization are indicated by arrows.
    Psti, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 385 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/Thermo Fisher
    Average 99 stars, based on 385 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc anti spink3
    Interaction of Htt with <t>Spink3</t> regulates trypsin activity in vitro. ( A ) Measurement of trypsin activity in vitro by adding Spink3, HTT, nHTT, tHTT, or Spink3 and HTT, nHTT, and tHTT containing cell lysates of transfected HEK293 cells. Cell extracts were mixed with porcine trypsin (TRSEQII) and the substrate Boc-Gln-Ala-Arg-AMC, and the rates of fluorescent products generated by trypsin were measured. Results are indicated as means ± SEM ( n = 3; two-way ANOVA test, * P
    Anti Spink3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti spink3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    anti spink3 - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs psti hf
    Proof-of-concept assembly of 16TU construct. (A) A schematic showing the four intermediate Level 2 constructs for the assembly of the 16-TU construct. The carotenoid biosynthesis genes crtE , crtB , crtI , and crtY assembled in the Vector A, the yellow chromoprotein genes scOrange , amilGFP , amajLime , and fwYellow in the Vector B, the pink chromoprotein genes tsPurple , eforRed , spisPink , and mRFP1 in the Vector Γ, and the violacein biosynthesis genes vioA , vioB , vioD and vioE in the Vector Δ. (B) A schematic of the 16TU construct derived from the assembly of the four Level 2 cassettes, each containing 4-TUs, in the Level 1 Acceptor Vector A. (C) Cells transformed with the successfully assembled 16TU construct grew into black colonies due to predominant colouring by protoviolaceinic acid. (D) Gel electrophoresis of six plasmids (isolated from the black colonies) digested with <t>PstI</t> and <t>EcoRI</t> resulting in bands of expected sizes—18.2kb for the insert and 2.2kb for the vector. (E) The same plasmids were digested with PstI and AleI resulting in the bands of expected sizes—7.1kb, 5.1 and 4.9kb (appear merged on the gel), and 3.2kb.
    Psti Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 185 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti hf/product/New England Biolabs
    Average 99 stars, based on 185 article reviews
    Price from $9.99 to $1999.99
    psti hf - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher psti fastdigest
    Proof-of-concept assembly of 16TU construct. (A) A schematic showing the four intermediate Level 2 constructs for the assembly of the 16-TU construct. The carotenoid biosynthesis genes crtE , crtB , crtI , and crtY assembled in the Vector A, the yellow chromoprotein genes scOrange , amilGFP , amajLime , and fwYellow in the Vector B, the pink chromoprotein genes tsPurple , eforRed , spisPink , and mRFP1 in the Vector Γ, and the violacein biosynthesis genes vioA , vioB , vioD and vioE in the Vector Δ. (B) A schematic of the 16TU construct derived from the assembly of the four Level 2 cassettes, each containing 4-TUs, in the Level 1 Acceptor Vector A. (C) Cells transformed with the successfully assembled 16TU construct grew into black colonies due to predominant colouring by protoviolaceinic acid. (D) Gel electrophoresis of six plasmids (isolated from the black colonies) digested with <t>PstI</t> and <t>EcoRI</t> resulting in bands of expected sizes—18.2kb for the insert and 2.2kb for the vector. (E) The same plasmids were digested with PstI and AleI resulting in the bands of expected sizes—7.1kb, 5.1 and 4.9kb (appear merged on the gel), and 3.2kb.
    Psti Fastdigest, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 41 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti fastdigest/product/Thermo Fisher
    Average 99 stars, based on 41 article reviews
    Price from $9.99 to $1999.99
    psti fastdigest - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    78
    Millipore psti enzyme
    Proof-of-concept assembly of 16TU construct. (A) A schematic showing the four intermediate Level 2 constructs for the assembly of the 16-TU construct. The carotenoid biosynthesis genes crtE , crtB , crtI , and crtY assembled in the Vector A, the yellow chromoprotein genes scOrange , amilGFP , amajLime , and fwYellow in the Vector B, the pink chromoprotein genes tsPurple , eforRed , spisPink , and mRFP1 in the Vector Γ, and the violacein biosynthesis genes vioA , vioB , vioD and vioE in the Vector Δ. (B) A schematic of the 16TU construct derived from the assembly of the four Level 2 cassettes, each containing 4-TUs, in the Level 1 Acceptor Vector A. (C) Cells transformed with the successfully assembled 16TU construct grew into black colonies due to predominant colouring by protoviolaceinic acid. (D) Gel electrophoresis of six plasmids (isolated from the black colonies) digested with <t>PstI</t> and <t>EcoRI</t> resulting in bands of expected sizes—18.2kb for the insert and 2.2kb for the vector. (E) The same plasmids were digested with PstI and AleI resulting in the bands of expected sizes—7.1kb, 5.1 and 4.9kb (appear merged on the gel), and 3.2kb.
    Psti Enzyme, supplied by Millipore, used in various techniques. Bioz Stars score: 78/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti enzyme/product/Millipore
    Average 78 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    psti enzyme - by Bioz Stars, 2020-03
    78/100 stars
      Buy from Supplier

    97
    Thermo Fisher xbai psti
    Proof-of-concept assembly of 16TU construct. (A) A schematic showing the four intermediate Level 2 constructs for the assembly of the 16-TU construct. The carotenoid biosynthesis genes crtE , crtB , crtI , and crtY assembled in the Vector A, the yellow chromoprotein genes scOrange , amilGFP , amajLime , and fwYellow in the Vector B, the pink chromoprotein genes tsPurple , eforRed , spisPink , and mRFP1 in the Vector Γ, and the violacein biosynthesis genes vioA , vioB , vioD and vioE in the Vector Δ. (B) A schematic of the 16TU construct derived from the assembly of the four Level 2 cassettes, each containing 4-TUs, in the Level 1 Acceptor Vector A. (C) Cells transformed with the successfully assembled 16TU construct grew into black colonies due to predominant colouring by protoviolaceinic acid. (D) Gel electrophoresis of six plasmids (isolated from the black colonies) digested with <t>PstI</t> and <t>EcoRI</t> resulting in bands of expected sizes—18.2kb for the insert and 2.2kb for the vector. (E) The same plasmids were digested with PstI and AleI resulting in the bands of expected sizes—7.1kb, 5.1 and 4.9kb (appear merged on the gel), and 3.2kb.
    Xbai Psti, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 37 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai psti/product/Thermo Fisher
    Average 97 stars, based on 37 article reviews
    Price from $9.99 to $1999.99
    xbai psti - by Bioz Stars, 2020-03
    97/100 stars
      Buy from Supplier

    80
    Promega psti enzyme
    Proof-of-concept assembly of 16TU construct. (A) A schematic showing the four intermediate Level 2 constructs for the assembly of the 16-TU construct. The carotenoid biosynthesis genes crtE , crtB , crtI , and crtY assembled in the Vector A, the yellow chromoprotein genes scOrange , amilGFP , amajLime , and fwYellow in the Vector B, the pink chromoprotein genes tsPurple , eforRed , spisPink , and mRFP1 in the Vector Γ, and the violacein biosynthesis genes vioA , vioB , vioD and vioE in the Vector Δ. (B) A schematic of the 16TU construct derived from the assembly of the four Level 2 cassettes, each containing 4-TUs, in the Level 1 Acceptor Vector A. (C) Cells transformed with the successfully assembled 16TU construct grew into black colonies due to predominant colouring by protoviolaceinic acid. (D) Gel electrophoresis of six plasmids (isolated from the black colonies) digested with <t>PstI</t> and <t>EcoRI</t> resulting in bands of expected sizes—18.2kb for the insert and 2.2kb for the vector. (E) The same plasmids were digested with PstI and AleI resulting in the bands of expected sizes—7.1kb, 5.1 and 4.9kb (appear merged on the gel), and 3.2kb.
    Psti Enzyme, supplied by Promega, used in various techniques. Bioz Stars score: 80/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti enzyme/product/Promega
    Average 80 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    psti enzyme - by Bioz Stars, 2020-03
    80/100 stars
      Buy from Supplier

    91
    Thermo Fisher psti xhoi
    Proof-of-concept assembly of 16TU construct. (A) A schematic showing the four intermediate Level 2 constructs for the assembly of the 16-TU construct. The carotenoid biosynthesis genes crtE , crtB , crtI , and crtY assembled in the Vector A, the yellow chromoprotein genes scOrange , amilGFP , amajLime , and fwYellow in the Vector B, the pink chromoprotein genes tsPurple , eforRed , spisPink , and mRFP1 in the Vector Γ, and the violacein biosynthesis genes vioA , vioB , vioD and vioE in the Vector Δ. (B) A schematic of the 16TU construct derived from the assembly of the four Level 2 cassettes, each containing 4-TUs, in the Level 1 Acceptor Vector A. (C) Cells transformed with the successfully assembled 16TU construct grew into black colonies due to predominant colouring by protoviolaceinic acid. (D) Gel electrophoresis of six plasmids (isolated from the black colonies) digested with <t>PstI</t> and <t>EcoRI</t> resulting in bands of expected sizes—18.2kb for the insert and 2.2kb for the vector. (E) The same plasmids were digested with PstI and AleI resulting in the bands of expected sizes—7.1kb, 5.1 and 4.9kb (appear merged on the gel), and 3.2kb.
    Psti Xhoi, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti xhoi/product/Thermo Fisher
    Average 91 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    psti xhoi - by Bioz Stars, 2020-03
    91/100 stars
      Buy from Supplier

    82
    TaKaRa psti enzyme
    Proof-of-concept assembly of 16TU construct. (A) A schematic showing the four intermediate Level 2 constructs for the assembly of the 16-TU construct. The carotenoid biosynthesis genes crtE , crtB , crtI , and crtY assembled in the Vector A, the yellow chromoprotein genes scOrange , amilGFP , amajLime , and fwYellow in the Vector B, the pink chromoprotein genes tsPurple , eforRed , spisPink , and mRFP1 in the Vector Γ, and the violacein biosynthesis genes vioA , vioB , vioD and vioE in the Vector Δ. (B) A schematic of the 16TU construct derived from the assembly of the four Level 2 cassettes, each containing 4-TUs, in the Level 1 Acceptor Vector A. (C) Cells transformed with the successfully assembled 16TU construct grew into black colonies due to predominant colouring by protoviolaceinic acid. (D) Gel electrophoresis of six plasmids (isolated from the black colonies) digested with <t>PstI</t> and <t>EcoRI</t> resulting in bands of expected sizes—18.2kb for the insert and 2.2kb for the vector. (E) The same plasmids were digested with PstI and AleI resulting in the bands of expected sizes—7.1kb, 5.1 and 4.9kb (appear merged on the gel), and 3.2kb.
    Psti Enzyme, supplied by TaKaRa, used in various techniques. Bioz Stars score: 82/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti enzyme/product/TaKaRa
    Average 82 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    psti enzyme - by Bioz Stars, 2020-03
    82/100 stars
      Buy from Supplier

    79
    Promega 1x psti buffer
    Proof-of-concept assembly of 16TU construct. (A) A schematic showing the four intermediate Level 2 constructs for the assembly of the 16-TU construct. The carotenoid biosynthesis genes crtE , crtB , crtI , and crtY assembled in the Vector A, the yellow chromoprotein genes scOrange , amilGFP , amajLime , and fwYellow in the Vector B, the pink chromoprotein genes tsPurple , eforRed , spisPink , and mRFP1 in the Vector Γ, and the violacein biosynthesis genes vioA , vioB , vioD and vioE in the Vector Δ. (B) A schematic of the 16TU construct derived from the assembly of the four Level 2 cassettes, each containing 4-TUs, in the Level 1 Acceptor Vector A. (C) Cells transformed with the successfully assembled 16TU construct grew into black colonies due to predominant colouring by protoviolaceinic acid. (D) Gel electrophoresis of six plasmids (isolated from the black colonies) digested with <t>PstI</t> and <t>EcoRI</t> resulting in bands of expected sizes—18.2kb for the insert and 2.2kb for the vector. (E) The same plasmids were digested with PstI and AleI resulting in the bands of expected sizes—7.1kb, 5.1 and 4.9kb (appear merged on the gel), and 3.2kb.
    1x Psti Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 79/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x psti buffer/product/Promega
    Average 79 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    1x psti buffer - by Bioz Stars, 2020-03
    79/100 stars
      Buy from Supplier

    91
    Promega restriction enzyme psti
    (A) XBP1 transcript splicing in NIH 3T3 cells infected (MOI, 30) with SFV4 or VRPs. RNA from infected cells was reverse transcribed into cDNA, and XBP1 amplicons were generated by <t>PCR.</t> These were digested with <t>PstI,</t> which only cleaves amplicons derived
    Restriction Enzyme Psti, supplied by Promega, used in various techniques. Bioz Stars score: 91/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzyme psti/product/Promega
    Average 91 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme psti - by Bioz Stars, 2020-03
    91/100 stars
      Buy from Supplier

    91
    Millipore psti
    (A) XBP1 transcript splicing in NIH 3T3 cells infected (MOI, 30) with SFV4 or VRPs. RNA from infected cells was reverse transcribed into cDNA, and XBP1 amplicons were generated by <t>PCR.</t> These were digested with <t>PstI,</t> which only cleaves amplicons derived
    Psti, supplied by Millipore, used in various techniques. Bioz Stars score: 91/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/Millipore
    Average 91 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-03
    91/100 stars
      Buy from Supplier

    83
    GenScript psti d360a smai
    (A) XBP1 transcript splicing in NIH 3T3 cells infected (MOI, 30) with SFV4 or VRPs. RNA from infected cells was reverse transcribed into cDNA, and XBP1 amplicons were generated by <t>PCR.</t> These were digested with <t>PstI,</t> which only cleaves amplicons derived
    Psti D360a Smai, supplied by GenScript, used in various techniques. Bioz Stars score: 83/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti d360a smai/product/GenScript
    Average 83 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    psti d360a smai - by Bioz Stars, 2020-03
    83/100 stars
      Buy from Supplier

    79
    TaKaRa restriction enzyme psti
    (A) XBP1 transcript splicing in NIH 3T3 cells infected (MOI, 30) with SFV4 or VRPs. RNA from infected cells was reverse transcribed into cDNA, and XBP1 amplicons were generated by <t>PCR.</t> These were digested with <t>PstI,</t> which only cleaves amplicons derived
    Restriction Enzyme Psti, supplied by TaKaRa, used in various techniques. Bioz Stars score: 79/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzyme psti/product/TaKaRa
    Average 79 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme psti - by Bioz Stars, 2020-03
    79/100 stars
      Buy from Supplier

    99
    Promega psti
    Schematic representation of potential CYP2E1 <t>RsaI/PStI</t> alleles and PCR-RFLP band sizes. ‘2Els’ and ‘2Elas’ are sense and antisense oligonucleotides, respectively, used in PCR amplifications of the CYPE1 5′ regulatory region. P, PstI; , R, RsaI restriction enzyme sites.
    Psti, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 171 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/Promega
    Average 99 stars, based on 171 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    psti  (Roche)
    91
    Roche psti
    Inhibition of restriction of H.pylori 1061 <t>DNA.</t> Lane 1, marker X (Roche); lane 2, H.pylori 1061 DNA and a PCR product ‘SHV’ after digestion with NdeII; lane 3, H.pylori 1061 DNA and a PCR product ‘SHV’ after mock incubation; lane 4, H.pylori 1061 DNA and a PCR product ‘SHV’ after digestion with <t>PstI;</t> lane 5, H.pylori 1061 DNA; lane 6, marker X (Roche); lane 7, PCR product ‘SHV’ after PstI digestion; and lane 8, PCR product ‘SHV’ after NdeII digestion. NdeII cleaves GATC but is inhibited by N 6 -adenosine methylation. PstI cleaves CTGCAG but is inhibited by N 6 -adenosine methylation. Note the presence of several plasmid bands in uncleaved H.pylori 1061 DNA.
    Psti, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 130 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/Roche
    Average 91 stars, based on 130 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-03
    91/100 stars
      Buy from Supplier

    89
    GE Healthcare psti
    (a) Gene order in the SfMNPV variable region, including <t>PstI-F,</t> PstI-L, PstI-K, and <t>EcoRI-N</t> fragments of SfNIC-B. Schematic representation of the gene order of SfNIC genotypic variants, indicating the deletions of each variants and the genes present in
    Psti, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 89/100, based on 51 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/GE Healthcare
    Average 89 stars, based on 51 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-03
    89/100 stars
      Buy from Supplier

    psti  (Toyobo)
    89
    Toyobo psti
    Ma-LMM01 genomic DNA digested with various restriction enzymes. Lanes 1 and 18, 1-kb ladder marker; lane 2, BamHI; lane 3, EcoRI; lane 4, EcoRV; lane 5, HincII; lane 6, HindIII; lane 7, <t>NotI;</t> lane 8, <t>PstI;</t> lane 9, SacI; lane 10, SalI; lane 11, ScaI; lane 12, SmaI; lanes 13 and 14, lambda/HindIII marker; lane 15, SpeI; lane 16, XhoI; lane 17, XbaI.
    Psti, supplied by Toyobo, used in various techniques. Bioz Stars score: 89/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/Toyobo
    Average 89 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-03
    89/100 stars
      Buy from Supplier

    89
    Microsynth psti
    Ma-LMM01 genomic DNA digested with various restriction enzymes. Lanes 1 and 18, 1-kb ladder marker; lane 2, BamHI; lane 3, EcoRI; lane 4, EcoRV; lane 5, HincII; lane 6, HindIII; lane 7, <t>NotI;</t> lane 8, <t>PstI;</t> lane 9, SacI; lane 10, SalI; lane 11, ScaI; lane 12, SmaI; lanes 13 and 14, lambda/HindIII marker; lane 15, SpeI; lane 16, XhoI; lane 17, XbaI.
    Psti, supplied by Microsynth, used in various techniques. Bioz Stars score: 89/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/Microsynth
    Average 89 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-03
    89/100 stars
      Buy from Supplier

    psti  (TaKaRa)
    99
    TaKaRa psti
    Sorafenib induces autophagy through ER stress and MAPK8/9/10 activation. (A) TEM representative micrographs showing dilated ER cavities in sorafenib-treated Ishikawa cells for 24 h. For additional information please see Fig. S4A. (B) Left, representative images showing increased and discontinuous fluorescence intensity in endoplasmic reticulum upon sorafenib treatment. Untreated and sorafenib-treated Ishikawa cells were cultured in the presence of ER-Tracker Blue-White DPX and analyzed at 4 h post-treatment. Scale bar: 50 µm. Right, quantification of ER-Tracker Blue-White DPX intensity according to refs. 94,95 and using ImageJ software. (C) Left, schematic illustration representing 2 characteristic UPR responses, EIF2AK3/PERK-ATF4 and ERN1/IRE1. Right, <t>XBP1</t> splicing analysis by PCR and enzymatic restriction and DDIT3/CHOP protein levels by western blot with densitometry quantification in Ishikawa cells treated with sorafenib. Splicing of XBP1 mRNA results in the excision of a 26-nucleotide intronic region, causing a frame shift in the coding sequence and the removal of a <t>PstI</t> restriction site. Therefore, PstI can digest unspliced XBP1 mRNA ( XBP1u ), generating XBP1 u1 and u2 fragments, but not spliced XBP1 mRNA ( XBP1s ). h represents a hybrid band composed of XBP1u and XBP1s single-stranded DNA produced during PCR. Western blot against tubulin was performed to ensure equal protein loading amounts. (D) Kaplan-Meyer and (E) disease-free survival curves comparing the outcome of EC cases with or without overexpression of MAPK8/JNK1, MAPK9/JNK2 and MAPK10/JNK3. A z-score≥ 3 was used as threshold for increased expression. Data were extracted from TCGA_ucec (RNAseq_V2). (F) Western blot and densitometry quantification (n = 3) showing activation of MAPK8/9/10 and its target JUN after a time course treatment of sorafenib (20 µM) in Ishikawa cells. (G) Activation of MAPK8/9/10 and JUN by western blot in sorafenib-treated primary EC biopsies. CEP-1347 inhibits activation of MAPK8/9/10 and JUN (H) and blocks LC3B-II increase in Ishikawa EC cells (I). Densitometry quantifications from 3 independent experiments are also shown. (J) Representative western blot and densitometry quantification (n = 3) showing impaired LC3B-II accumulation in mapk8/9 −/− cells after sorafenib treatment. (K) Representative immunofluorescence images and quantification of the number of LC3B-II puncta per cell in wild-type and mapk8/9 −/− MEFs treated with sorafenib or sorafenib combined with CQ. Scale bar: 50 µm. (L) Analysis of SQSTM1 protein levels by western blot in wild type and mapk8/9 −/− MEFs showing that CQ and Mapk8/9 -targeted deletion abrogates SQSTM1 proteolysis in response to sorafenib in wild-type and mapk8/9 −/− MEFs. Western blot against tubulin was performed to ensure equal protein loading amounts. SQSTM1 densitometry analysis is also shown. All experiments were performed in triplicate.
    Psti, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 175 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/TaKaRa
    Average 99 stars, based on 175 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    89
    Becton Dickinson psti
    Sorafenib induces autophagy through ER stress and MAPK8/9/10 activation. (A) TEM representative micrographs showing dilated ER cavities in sorafenib-treated Ishikawa cells for 24 h. For additional information please see Fig. S4A. (B) Left, representative images showing increased and discontinuous fluorescence intensity in endoplasmic reticulum upon sorafenib treatment. Untreated and sorafenib-treated Ishikawa cells were cultured in the presence of ER-Tracker Blue-White DPX and analyzed at 4 h post-treatment. Scale bar: 50 µm. Right, quantification of ER-Tracker Blue-White DPX intensity according to refs. 94,95 and using ImageJ software. (C) Left, schematic illustration representing 2 characteristic UPR responses, EIF2AK3/PERK-ATF4 and ERN1/IRE1. Right, <t>XBP1</t> splicing analysis by PCR and enzymatic restriction and DDIT3/CHOP protein levels by western blot with densitometry quantification in Ishikawa cells treated with sorafenib. Splicing of XBP1 mRNA results in the excision of a 26-nucleotide intronic region, causing a frame shift in the coding sequence and the removal of a <t>PstI</t> restriction site. Therefore, PstI can digest unspliced XBP1 mRNA ( XBP1u ), generating XBP1 u1 and u2 fragments, but not spliced XBP1 mRNA ( XBP1s ). h represents a hybrid band composed of XBP1u and XBP1s single-stranded DNA produced during PCR. Western blot against tubulin was performed to ensure equal protein loading amounts. (D) Kaplan-Meyer and (E) disease-free survival curves comparing the outcome of EC cases with or without overexpression of MAPK8/JNK1, MAPK9/JNK2 and MAPK10/JNK3. A z-score≥ 3 was used as threshold for increased expression. Data were extracted from TCGA_ucec (RNAseq_V2). (F) Western blot and densitometry quantification (n = 3) showing activation of MAPK8/9/10 and its target JUN after a time course treatment of sorafenib (20 µM) in Ishikawa cells. (G) Activation of MAPK8/9/10 and JUN by western blot in sorafenib-treated primary EC biopsies. CEP-1347 inhibits activation of MAPK8/9/10 and JUN (H) and blocks LC3B-II increase in Ishikawa EC cells (I). Densitometry quantifications from 3 independent experiments are also shown. (J) Representative western blot and densitometry quantification (n = 3) showing impaired LC3B-II accumulation in mapk8/9 −/− cells after sorafenib treatment. (K) Representative immunofluorescence images and quantification of the number of LC3B-II puncta per cell in wild-type and mapk8/9 −/− MEFs treated with sorafenib or sorafenib combined with CQ. Scale bar: 50 µm. (L) Analysis of SQSTM1 protein levels by western blot in wild type and mapk8/9 −/− MEFs showing that CQ and Mapk8/9 -targeted deletion abrogates SQSTM1 proteolysis in response to sorafenib in wild-type and mapk8/9 −/− MEFs. Western blot against tubulin was performed to ensure equal protein loading amounts. SQSTM1 densitometry analysis is also shown. All experiments were performed in triplicate.
    Psti, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 89/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/Becton Dickinson
    Average 89 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-03
    89/100 stars
      Buy from Supplier

    89
    Boehringer Mannheim psti
    Sorafenib induces autophagy through ER stress and MAPK8/9/10 activation. (A) TEM representative micrographs showing dilated ER cavities in sorafenib-treated Ishikawa cells for 24 h. For additional information please see Fig. S4A. (B) Left, representative images showing increased and discontinuous fluorescence intensity in endoplasmic reticulum upon sorafenib treatment. Untreated and sorafenib-treated Ishikawa cells were cultured in the presence of ER-Tracker Blue-White DPX and analyzed at 4 h post-treatment. Scale bar: 50 µm. Right, quantification of ER-Tracker Blue-White DPX intensity according to refs. 94,95 and using ImageJ software. (C) Left, schematic illustration representing 2 characteristic UPR responses, EIF2AK3/PERK-ATF4 and ERN1/IRE1. Right, <t>XBP1</t> splicing analysis by PCR and enzymatic restriction and DDIT3/CHOP protein levels by western blot with densitometry quantification in Ishikawa cells treated with sorafenib. Splicing of XBP1 mRNA results in the excision of a 26-nucleotide intronic region, causing a frame shift in the coding sequence and the removal of a <t>PstI</t> restriction site. Therefore, PstI can digest unspliced XBP1 mRNA ( XBP1u ), generating XBP1 u1 and u2 fragments, but not spliced XBP1 mRNA ( XBP1s ). h represents a hybrid band composed of XBP1u and XBP1s single-stranded DNA produced during PCR. Western blot against tubulin was performed to ensure equal protein loading amounts. (D) Kaplan-Meyer and (E) disease-free survival curves comparing the outcome of EC cases with or without overexpression of MAPK8/JNK1, MAPK9/JNK2 and MAPK10/JNK3. A z-score≥ 3 was used as threshold for increased expression. Data were extracted from TCGA_ucec (RNAseq_V2). (F) Western blot and densitometry quantification (n = 3) showing activation of MAPK8/9/10 and its target JUN after a time course treatment of sorafenib (20 µM) in Ishikawa cells. (G) Activation of MAPK8/9/10 and JUN by western blot in sorafenib-treated primary EC biopsies. CEP-1347 inhibits activation of MAPK8/9/10 and JUN (H) and blocks LC3B-II increase in Ishikawa EC cells (I). Densitometry quantifications from 3 independent experiments are also shown. (J) Representative western blot and densitometry quantification (n = 3) showing impaired LC3B-II accumulation in mapk8/9 −/− cells after sorafenib treatment. (K) Representative immunofluorescence images and quantification of the number of LC3B-II puncta per cell in wild-type and mapk8/9 −/− MEFs treated with sorafenib or sorafenib combined with CQ. Scale bar: 50 µm. (L) Analysis of SQSTM1 protein levels by western blot in wild type and mapk8/9 −/− MEFs showing that CQ and Mapk8/9 -targeted deletion abrogates SQSTM1 proteolysis in response to sorafenib in wild-type and mapk8/9 −/− MEFs. Western blot against tubulin was performed to ensure equal protein loading amounts. SQSTM1 densitometry analysis is also shown. All experiments were performed in triplicate.
    Psti, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 89/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/Boehringer Mannheim
    Average 89 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-03
    89/100 stars
      Buy from Supplier

    93
    Illumina Inc psti
    muSeq applied to a genomic representation. We demonstrate the application of muSeq to a genomic representation by tracing two fragments (X and Y) from a single genomic locus through the molecular and informatics processing steps. The full experiment comprises 160,000 genomic loci and about 100 fragments per locus. ( A ) We first generate a representation from genomic DNA using <t>PstI.</t> ( B ) The ends of restriction fragments are polished, T-tailed, and then the fragments are ligated to bisulfite-resistant sequence adapters. ( C ) The templates are then melted and subjected to partial bisulfite conversion (Materials and Methods). The conversion process randomly deaminates unmethylated cytosines (blue C), converting some proportion to uracil (red U). Each double-stranded molecule results in two templates, one from each strand. ( D ) We then sample the converted templates and PCR amplify to generate a sequencing library. During amplification uracil is copied as thymine (red T). ( E ) The library is then paired-end sequenced on an <t>Illumina</t> machine. Because of asymmetries in the sequencing primers, read one shows C to T conversion while read 2 shows G to A conversions. We then fully convert the reads ( F ) and map them to two fully converted genomes ( G ): one where every C in the reference is converted to a T and one where every G is converted to an A. Reads originating from a top strand map to the C to T reference with read 1 reading in the forward direction and read 2 in the reverse, while bottom strand reads map to the G to A reference with read 2 mapping forward and read 1 in reverse. ( H ) The reads are binned by genomic locus and strand. Mutable positions and their conversions are recorded as a bit pattern. We then use those patterns to cluster the reads (see Figure 3 ).
    Psti, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/Illumina Inc
    Average 93 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2020-03
    93/100 stars
      Buy from Supplier

    78
    Promega psti hindiii digested pgem3z
    muSeq applied to a genomic representation. We demonstrate the application of muSeq to a genomic representation by tracing two fragments (X and Y) from a single genomic locus through the molecular and informatics processing steps. The full experiment comprises 160,000 genomic loci and about 100 fragments per locus. ( A ) We first generate a representation from genomic DNA using <t>PstI.</t> ( B ) The ends of restriction fragments are polished, T-tailed, and then the fragments are ligated to bisulfite-resistant sequence adapters. ( C ) The templates are then melted and subjected to partial bisulfite conversion (Materials and Methods). The conversion process randomly deaminates unmethylated cytosines (blue C), converting some proportion to uracil (red U). Each double-stranded molecule results in two templates, one from each strand. ( D ) We then sample the converted templates and PCR amplify to generate a sequencing library. During amplification uracil is copied as thymine (red T). ( E ) The library is then paired-end sequenced on an <t>Illumina</t> machine. Because of asymmetries in the sequencing primers, read one shows C to T conversion while read 2 shows G to A conversions. We then fully convert the reads ( F ) and map them to two fully converted genomes ( G ): one where every C in the reference is converted to a T and one where every G is converted to an A. Reads originating from a top strand map to the C to T reference with read 1 reading in the forward direction and read 2 in the reverse, while bottom strand reads map to the G to A reference with read 2 mapping forward and read 1 in reverse. ( H ) The reads are binned by genomic locus and strand. Mutable positions and their conversions are recorded as a bit pattern. We then use those patterns to cluster the reads (see Figure 3 ).
    Psti Hindiii Digested Pgem3z, supplied by Promega, used in various techniques. Bioz Stars score: 78/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti hindiii digested pgem3z/product/Promega
    Average 78 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    psti hindiii digested pgem3z - by Bioz Stars, 2020-03
    78/100 stars
      Buy from Supplier

    78
    Promega psti restriction enzymes
    muSeq applied to a genomic representation. We demonstrate the application of muSeq to a genomic representation by tracing two fragments (X and Y) from a single genomic locus through the molecular and informatics processing steps. The full experiment comprises 160,000 genomic loci and about 100 fragments per locus. ( A ) We first generate a representation from genomic DNA using <t>PstI.</t> ( B ) The ends of restriction fragments are polished, T-tailed, and then the fragments are ligated to bisulfite-resistant sequence adapters. ( C ) The templates are then melted and subjected to partial bisulfite conversion (Materials and Methods). The conversion process randomly deaminates unmethylated cytosines (blue C), converting some proportion to uracil (red U). Each double-stranded molecule results in two templates, one from each strand. ( D ) We then sample the converted templates and PCR amplify to generate a sequencing library. During amplification uracil is copied as thymine (red T). ( E ) The library is then paired-end sequenced on an <t>Illumina</t> machine. Because of asymmetries in the sequencing primers, read one shows C to T conversion while read 2 shows G to A conversions. We then fully convert the reads ( F ) and map them to two fully converted genomes ( G ): one where every C in the reference is converted to a T and one where every G is converted to an A. Reads originating from a top strand map to the C to T reference with read 1 reading in the forward direction and read 2 in the reverse, while bottom strand reads map to the G to A reference with read 2 mapping forward and read 1 in reverse. ( H ) The reads are binned by genomic locus and strand. Mutable positions and their conversions are recorded as a bit pattern. We then use those patterns to cluster the reads (see Figure 3 ).
    Psti Restriction Enzymes, supplied by Promega, used in various techniques. Bioz Stars score: 78/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti restriction enzymes/product/Promega
    Average 78 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    psti restriction enzymes - by Bioz Stars, 2020-03
    78/100 stars
      Buy from Supplier

    79
    TaKaRa psti kpni restricted pegfp
    muSeq applied to a genomic representation. We demonstrate the application of muSeq to a genomic representation by tracing two fragments (X and Y) from a single genomic locus through the molecular and informatics processing steps. The full experiment comprises 160,000 genomic loci and about 100 fragments per locus. ( A ) We first generate a representation from genomic DNA using <t>PstI.</t> ( B ) The ends of restriction fragments are polished, T-tailed, and then the fragments are ligated to bisulfite-resistant sequence adapters. ( C ) The templates are then melted and subjected to partial bisulfite conversion (Materials and Methods). The conversion process randomly deaminates unmethylated cytosines (blue C), converting some proportion to uracil (red U). Each double-stranded molecule results in two templates, one from each strand. ( D ) We then sample the converted templates and PCR amplify to generate a sequencing library. During amplification uracil is copied as thymine (red T). ( E ) The library is then paired-end sequenced on an <t>Illumina</t> machine. Because of asymmetries in the sequencing primers, read one shows C to T conversion while read 2 shows G to A conversions. We then fully convert the reads ( F ) and map them to two fully converted genomes ( G ): one where every C in the reference is converted to a T and one where every G is converted to an A. Reads originating from a top strand map to the C to T reference with read 1 reading in the forward direction and read 2 in the reverse, while bottom strand reads map to the G to A reference with read 2 mapping forward and read 1 in reverse. ( H ) The reads are binned by genomic locus and strand. Mutable positions and their conversions are recorded as a bit pattern. We then use those patterns to cluster the reads (see Figure 3 ).
    Psti Kpni Restricted Pegfp, supplied by TaKaRa, used in various techniques. Bioz Stars score: 79/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti kpni restricted pegfp/product/TaKaRa
    Average 79 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    psti kpni restricted pegfp - by Bioz Stars, 2020-03
    79/100 stars
      Buy from Supplier

    79
    Thermo Fisher bamhi psti digested puc19
    muSeq applied to a genomic representation. We demonstrate the application of muSeq to a genomic representation by tracing two fragments (X and Y) from a single genomic locus through the molecular and informatics processing steps. The full experiment comprises 160,000 genomic loci and about 100 fragments per locus. ( A ) We first generate a representation from genomic DNA using <t>PstI.</t> ( B ) The ends of restriction fragments are polished, T-tailed, and then the fragments are ligated to bisulfite-resistant sequence adapters. ( C ) The templates are then melted and subjected to partial bisulfite conversion (Materials and Methods). The conversion process randomly deaminates unmethylated cytosines (blue C), converting some proportion to uracil (red U). Each double-stranded molecule results in two templates, one from each strand. ( D ) We then sample the converted templates and PCR amplify to generate a sequencing library. During amplification uracil is copied as thymine (red T). ( E ) The library is then paired-end sequenced on an <t>Illumina</t> machine. Because of asymmetries in the sequencing primers, read one shows C to T conversion while read 2 shows G to A conversions. We then fully convert the reads ( F ) and map them to two fully converted genomes ( G ): one where every C in the reference is converted to a T and one where every G is converted to an A. Reads originating from a top strand map to the C to T reference with read 1 reading in the forward direction and read 2 in the reverse, while bottom strand reads map to the G to A reference with read 2 mapping forward and read 1 in reverse. ( H ) The reads are binned by genomic locus and strand. Mutable positions and their conversions are recorded as a bit pattern. We then use those patterns to cluster the reads (see Figure 3 ).
    Bamhi Psti Digested Puc19, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi psti digested puc19/product/Thermo Fisher
    Average 79 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    bamhi psti digested puc19 - by Bioz Stars, 2020-03
    79/100 stars
      Buy from Supplier

    79
    Thermo Fisher psti xhoi digested pbacpak8
    muSeq applied to a genomic representation. We demonstrate the application of muSeq to a genomic representation by tracing two fragments (X and Y) from a single genomic locus through the molecular and informatics processing steps. The full experiment comprises 160,000 genomic loci and about 100 fragments per locus. ( A ) We first generate a representation from genomic DNA using <t>PstI.</t> ( B ) The ends of restriction fragments are polished, T-tailed, and then the fragments are ligated to bisulfite-resistant sequence adapters. ( C ) The templates are then melted and subjected to partial bisulfite conversion (Materials and Methods). The conversion process randomly deaminates unmethylated cytosines (blue C), converting some proportion to uracil (red U). Each double-stranded molecule results in two templates, one from each strand. ( D ) We then sample the converted templates and PCR amplify to generate a sequencing library. During amplification uracil is copied as thymine (red T). ( E ) The library is then paired-end sequenced on an <t>Illumina</t> machine. Because of asymmetries in the sequencing primers, read one shows C to T conversion while read 2 shows G to A conversions. We then fully convert the reads ( F ) and map them to two fully converted genomes ( G ): one where every C in the reference is converted to a T and one where every G is converted to an A. Reads originating from a top strand map to the C to T reference with read 1 reading in the forward direction and read 2 in the reverse, while bottom strand reads map to the G to A reference with read 2 mapping forward and read 1 in reverse. ( H ) The reads are binned by genomic locus and strand. Mutable positions and their conversions are recorded as a bit pattern. We then use those patterns to cluster the reads (see Figure 3 ).
    Psti Xhoi Digested Pbacpak8, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti xhoi digested pbacpak8/product/Thermo Fisher
    Average 79 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    psti xhoi digested pbacpak8 - by Bioz Stars, 2020-03
    79/100 stars
      Buy from Supplier

    Image Search Results


    SILAC-based affinity capture of Cj1132c with purF DNA bait and effect of cj1132c deletion on spontaneous mutation rate. (A) Screen for DNA-binding proteins captured with purF DNA bait. Differentially labeled (light, [ 13 C 6 ]arginine, or heavy, [ 13 C 6 14 N 4 ]arginine) C. jejuni total protein lysates were incubated with biotinylated purF DNA or prsA DNA, respectively. A 1:1 light/heavy mixture of DNA/protein complexes was captured on streptavidin beads. Proteins were eluted from beads by digestion with PstI restriction enzyme, and trypsinized proteins were analyzed by gel electrophoresis liquid chromatography-mass spectrometry. Each dot represents an identified peptide. SILAC analysis discriminates the specificity of an interaction; peptides with a low heavy/light ratio indicate higher-affinity capture. Data are representative of two independent experiments statistically assessed by the Benjamini-Hochberg false discovery rate (FDR), and FDR Q significance values are indicated: *, Q = 0.024; **, Q = 0.014. (B) Representative mass spectra for SILAC-labeled captured peptides. Top, equal mass/charge ratio of light and heavy forms of PorA peptide indicating nonspecific interaction; bottom, the light form of Cj1132c is present in a ratio > 16.8 times higher than the heavy form, indicating a high probability of interaction with the direct repeat and hypervariable region of purF . (C) Frequency of emergence of spontaneous ciprofloxacin resistance (spontaneous mutation rate) of Δ cj1132c and complemented Δ cj1132c / cj1132c mutants in purF- T91del genetic background. The numbers of spontaneous ciprofloxacin-resistant mutants relative to total CFU per OD 600 equivalent are presented. Mean results with SEM from six independent experiments each with two technical replicates are shown: ****, P ≤ 0.0001.

    Journal: mBio

    Article Title: High-Frequency Variation of Purine Biosynthesis Genes Is a Mechanism of Success in Campylobacter jejuni

    doi: 10.1128/mBio.00612-15

    Figure Lengend Snippet: SILAC-based affinity capture of Cj1132c with purF DNA bait and effect of cj1132c deletion on spontaneous mutation rate. (A) Screen for DNA-binding proteins captured with purF DNA bait. Differentially labeled (light, [ 13 C 6 ]arginine, or heavy, [ 13 C 6 14 N 4 ]arginine) C. jejuni total protein lysates were incubated with biotinylated purF DNA or prsA DNA, respectively. A 1:1 light/heavy mixture of DNA/protein complexes was captured on streptavidin beads. Proteins were eluted from beads by digestion with PstI restriction enzyme, and trypsinized proteins were analyzed by gel electrophoresis liquid chromatography-mass spectrometry. Each dot represents an identified peptide. SILAC analysis discriminates the specificity of an interaction; peptides with a low heavy/light ratio indicate higher-affinity capture. Data are representative of two independent experiments statistically assessed by the Benjamini-Hochberg false discovery rate (FDR), and FDR Q significance values are indicated: *, Q = 0.024; **, Q = 0.014. (B) Representative mass spectra for SILAC-labeled captured peptides. Top, equal mass/charge ratio of light and heavy forms of PorA peptide indicating nonspecific interaction; bottom, the light form of Cj1132c is present in a ratio > 16.8 times higher than the heavy form, indicating a high probability of interaction with the direct repeat and hypervariable region of purF . (C) Frequency of emergence of spontaneous ciprofloxacin resistance (spontaneous mutation rate) of Δ cj1132c and complemented Δ cj1132c / cj1132c mutants in purF- T91del genetic background. The numbers of spontaneous ciprofloxacin-resistant mutants relative to total CFU per OD 600 equivalent are presented. Mean results with SEM from six independent experiments each with two technical replicates are shown: ****, P ≤ 0.0001.

    Article Snippet: Protein-DNA complexes were pooled, eluted by PstI (NEB) restriction enzyme cleavage, and digested with ArgC, and purified peptides were analyzed by reverse-phase liquid chromatography-mass spectrometry.

    Techniques: Mutagenesis, DNA Binding Assay, Labeling, Incubation, Nucleic Acid Electrophoresis, Liquid Chromatography, Mass Spectrometry

    Changes in conformational states of the terminase and prohead portal during packaging of linear and Y-DNA substrates. Packaging was carried out using GFP-gp20 proheads, CT-ReAsH terminase, and unlabeled linear (5-kb PstI-digested pL16 DNA) or unlabeled 3.7-kb Y-DNA. Different FRET values were observed between CT-ReAsH terminase and GFP-gp20 fusion with the linear ( A ) and Y-DNAs ( B ). FRET was measured with the 3.7-kb Y-DNA after resolvase treatment for 30 min ( C ).

    Journal: The Journal of Biological Chemistry

    Article Title: Dynamics of the T4 Bacteriophage DNA Packasome Motor

    doi: 10.1074/jbc.M111.222828

    Figure Lengend Snippet: Changes in conformational states of the terminase and prohead portal during packaging of linear and Y-DNA substrates. Packaging was carried out using GFP-gp20 proheads, CT-ReAsH terminase, and unlabeled linear (5-kb PstI-digested pL16 DNA) or unlabeled 3.7-kb Y-DNA. Different FRET values were observed between CT-ReAsH terminase and GFP-gp20 fusion with the linear ( A ) and Y-DNAs ( B ). FRET was measured with the 3.7-kb Y-DNA after resolvase treatment for 30 min ( C ).

    Article Snippet: The double dye AxC3Y-DNAs, single dye AxY-DNAs, and unlabeled Y-DNAs (90 bases each) were phosphorylated by T4 polynucleotide kinase (New England Biolabs), and the blunt ends were ligated to pBR322 DNA linearized with EcoRV, followed by PstI digestion and gel extraction to yield the Y-DNAs with the 3.7-kb purified pBR322 (New England Biolabs) derived leaders ( C ).

    Techniques:

    ReAsH-EDT2 labeled N- and C-terminal tetra cysteine-tagged gp17 proteins are active in DNA packaging. A and B , both the NT and CT tetra cysteine-tagged gp17 proteins were labeled with ReAsH EDT2 dye, and fluorescence was measured in a Picoquant MicroTime 200 confocal microscope ( A ) and Typhoon imager ( B ). C , the labeled and unlabeled CT and NT terminases were run on native-PAGE followed by Coomassie staining as a loading control, and unstained gel was analyzed in Typhoon imager. D and E , nuclease assays were carried out to check the activities of the unlabeled ( D ) and the labeled CT and NT terminases ( E ) using 5-kb PstI linearized pL16 DNA as a substrate and wild type proheads in the reaction mixtures. Wild type terminase was used as a positive control in the assays.

    Journal: The Journal of Biological Chemistry

    Article Title: Dynamics of the T4 Bacteriophage DNA Packasome Motor

    doi: 10.1074/jbc.M111.222828

    Figure Lengend Snippet: ReAsH-EDT2 labeled N- and C-terminal tetra cysteine-tagged gp17 proteins are active in DNA packaging. A and B , both the NT and CT tetra cysteine-tagged gp17 proteins were labeled with ReAsH EDT2 dye, and fluorescence was measured in a Picoquant MicroTime 200 confocal microscope ( A ) and Typhoon imager ( B ). C , the labeled and unlabeled CT and NT terminases were run on native-PAGE followed by Coomassie staining as a loading control, and unstained gel was analyzed in Typhoon imager. D and E , nuclease assays were carried out to check the activities of the unlabeled ( D ) and the labeled CT and NT terminases ( E ) using 5-kb PstI linearized pL16 DNA as a substrate and wild type proheads in the reaction mixtures. Wild type terminase was used as a positive control in the assays.

    Article Snippet: The double dye AxC3Y-DNAs, single dye AxY-DNAs, and unlabeled Y-DNAs (90 bases each) were phosphorylated by T4 polynucleotide kinase (New England Biolabs), and the blunt ends were ligated to pBR322 DNA linearized with EcoRV, followed by PstI digestion and gel extraction to yield the Y-DNAs with the 3.7-kb purified pBR322 (New England Biolabs) derived leaders ( C ).

    Techniques: Labeling, Fluorescence, Microscopy, Clear Native PAGE, Staining, Positive Control

    Circularization of pBR322 (cohesive ends) and pUC19 (blunt ends) plasmids mediated by DdrC visualized by electron microscopy. Panel a: Control pBR322 DNA linearized by PstI. Panels b-e: pBR322 circularization mediated by DdrC. Panel f. Control pUC19 DNA linearized by Ssp11. Panels g-j: pUC19 circularization mediated by DdrC. 1 μM DdrC was mixed with 2 nM molecules of linear pBR322 or pUC19 plasmid, containing cohesive or blunt ends, respectively. The shapes are similar at 0.5 μM, 1 μM or 2 μM of DdrC. Magnification = 85,000. Some loci of plasmid circularization are indicated by arrows.

    Journal: PLoS ONE

    Article Title: In vivo and in vitro characterization of DdrC, a DNA damage response protein in Deinococcus radiodurans bacterium

    doi: 10.1371/journal.pone.0177751

    Figure Lengend Snippet: Circularization of pBR322 (cohesive ends) and pUC19 (blunt ends) plasmids mediated by DdrC visualized by electron microscopy. Panel a: Control pBR322 DNA linearized by PstI. Panels b-e: pBR322 circularization mediated by DdrC. Panel f. Control pUC19 DNA linearized by Ssp11. Panels g-j: pUC19 circularization mediated by DdrC. 1 μM DdrC was mixed with 2 nM molecules of linear pBR322 or pUC19 plasmid, containing cohesive or blunt ends, respectively. The shapes are similar at 0.5 μM, 1 μM or 2 μM of DdrC. Magnification = 85,000. Some loci of plasmid circularization are indicated by arrows.

    Article Snippet: Electrophoretic Mobility Shift Assay (EMSA) 200 ng of supercoiled pBR322 or pBR322 linearized by PstI (Thermo-Scientific) (4361 bp), as well as 200 ng of RFI (5386 bp) or single-stranded DNA of phiX174 virion were incubated in 20 μl of buffer A (40 mM Tris-HCl pH 7.8, 5 mM MgCl2 , 1.5 mM DTT, 50 mM NaCl, 12% glycerol) with increasing concentrations of DdrC (0.86 μM, 1.7 μM, 3.5 μM, 7 μM and 8.6 μM).

    Techniques: Electron Microscopy, Plasmid Preparation

    Restriction profiles of plasmid DNA determined with enzymes Bst1107I and PstI (A); hybridization of the Southern blot with a repA probe derived from Mandevilla isolate Ph4 (B). 1 kb, DNA molecular weight marker Generuler Plus DNA Ladder (Fermentas, St.

    Journal: Applied and Environmental Microbiology

    Article Title: A New Bacterial Disease on Mandevilla sanderi, Caused by Pseudomonas savastanoi: Lessons Learned for Bacterial Diversity Studies

    doi: 10.1128/AEM.02049-12

    Figure Lengend Snippet: Restriction profiles of plasmid DNA determined with enzymes Bst1107I and PstI (A); hybridization of the Southern blot with a repA probe derived from Mandevilla isolate Ph4 (B). 1 kb, DNA molecular weight marker Generuler Plus DNA Ladder (Fermentas, St.

    Article Snippet: Plasmid DNA left undigested or digested with Bst1107I and PstI enzymes (Fermentas) was analyzed in 0.8% or 1% agarose gels, respectively.

    Techniques: Plasmid Preparation, Hybridization, Southern Blot, Derivative Assay, Molecular Weight, Marker

    PERK and IRE1 pathways was activated under ER stress and was involved in DEV-induced autophagy. (A) DEF cells were infected with DEV at a MOI of 1 or treated with 300 nM Tg for 24 hours, and whole-cell protein extracts were collected at 36, 48, and 60 hours post-infection and then subjected to immunoblotting analysis of GRP78, p-PERK, p-eIF2α, LC3, ATF4, p-IRE1 and β-actin using the indicated antibodies. Tg is an inducer of ER stress. (B) Ratios of GRP78 to β-actin, p-PERK to PERK, p-eIF2α to eIF2α, ATF4 to actin, and p-IRE1 to IRE1, and LC3-II to LC3-I. (C) Activation of the IRE1-XBP1 signaling pathway. Total RNA was isolated from DEF cells, and RT-PCR was performed using XBP1-specific primers. PCR products were digested with PstI. Spliced XBP1 (s) products, 549 bp; Unspliced XBP1 (u) products, 276 bp; GAPDH was used as the loading control. (D) Inactivation of the ATF6 signaling pathway. DEF cells were infected with DEV at a MOI of 1 or treated with 300 nM Tg for 24 hours, and whole-cell protein extracts were collected at 36, 48, and 60 hours post-infection and then subjected to immunoblotting analysis of ATF6 and β-actin using the indicated antibodies.

    Journal: PLoS ONE

    Article Title: DEV induce autophagy via the endoplasmic reticulum stress related unfolded protein response

    doi: 10.1371/journal.pone.0189704

    Figure Lengend Snippet: PERK and IRE1 pathways was activated under ER stress and was involved in DEV-induced autophagy. (A) DEF cells were infected with DEV at a MOI of 1 or treated with 300 nM Tg for 24 hours, and whole-cell protein extracts were collected at 36, 48, and 60 hours post-infection and then subjected to immunoblotting analysis of GRP78, p-PERK, p-eIF2α, LC3, ATF4, p-IRE1 and β-actin using the indicated antibodies. Tg is an inducer of ER stress. (B) Ratios of GRP78 to β-actin, p-PERK to PERK, p-eIF2α to eIF2α, ATF4 to actin, and p-IRE1 to IRE1, and LC3-II to LC3-I. (C) Activation of the IRE1-XBP1 signaling pathway. Total RNA was isolated from DEF cells, and RT-PCR was performed using XBP1-specific primers. PCR products were digested with PstI. Spliced XBP1 (s) products, 549 bp; Unspliced XBP1 (u) products, 276 bp; GAPDH was used as the loading control. (D) Inactivation of the ATF6 signaling pathway. DEF cells were infected with DEV at a MOI of 1 or treated with 300 nM Tg for 24 hours, and whole-cell protein extracts were collected at 36, 48, and 60 hours post-infection and then subjected to immunoblotting analysis of ATF6 and β-actin using the indicated antibodies.

    Article Snippet: The PCR products were further digested with the restriction enzyme PstI (Thermo Fisher Scientific, Waltham, MA, USA) and then separated on a 1% agarose gel.

    Techniques: Infection, Activation Assay, Isolation, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

    Interaction of Htt with Spink3 regulates trypsin activity in vitro. ( A ) Measurement of trypsin activity in vitro by adding Spink3, HTT, nHTT, tHTT, or Spink3 and HTT, nHTT, and tHTT containing cell lysates of transfected HEK293 cells. Cell extracts were mixed with porcine trypsin (TRSEQII) and the substrate Boc-Gln-Ala-Arg-AMC, and the rates of fluorescent products generated by trypsin were measured. Results are indicated as means ± SEM ( n = 3; two-way ANOVA test, * P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Ablation of huntingtin in adult neurons is nondeleterious but its depletion in young mice causes acute pancreatitis

    doi: 10.1073/pnas.1524575113

    Figure Lengend Snippet: Interaction of Htt with Spink3 regulates trypsin activity in vitro. ( A ) Measurement of trypsin activity in vitro by adding Spink3, HTT, nHTT, tHTT, or Spink3 and HTT, nHTT, and tHTT containing cell lysates of transfected HEK293 cells. Cell extracts were mixed with porcine trypsin (TRSEQII) and the substrate Boc-Gln-Ala-Arg-AMC, and the rates of fluorescent products generated by trypsin were measured. Results are indicated as means ± SEM ( n = 3; two-way ANOVA test, * P

    Article Snippet: Rabbit antibodies used in this study were obtained from commercial sources as follows: HTT [EPR5526] (Abcam), beta-tubulin III [EP1569Y] (Novus Biologicals), NF-κB [D14E12] (Cell Signaling), LC3I/II [NB100-2220] (Novus Biologicals), ELA3B [GTX105123] (GeneTex), FAT10 [EPR4370] (GeneTex), SPINK3 [2744S] (Cell Signaling), HA [C29F4] (Cell Signaling), p-NF-κB [93H1] (Cell Signaling), RIP3 [GTX107574] (GeneTex), Caspase3 [9662] (Cell Signaling), and cleaved Caspase3 [5A1E] (Cell Signaling).

    Techniques: Activity Assay, In Vitro, Transfection, Generated

    Interaction of Htt with Spink3 inhibits trypsin activity. ( A ) Western blotting ( Upper ) and quantification ( Lower ) of Spink3 in 2-, 4-, and 8-mo-old ubiquitous KO and control mice. ( n = 3 independent experiments, two-way ANOVA test; n.s. represents no significant difference, *** P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Ablation of huntingtin in adult neurons is nondeleterious but its depletion in young mice causes acute pancreatitis

    doi: 10.1073/pnas.1524575113

    Figure Lengend Snippet: Interaction of Htt with Spink3 inhibits trypsin activity. ( A ) Western blotting ( Upper ) and quantification ( Lower ) of Spink3 in 2-, 4-, and 8-mo-old ubiquitous KO and control mice. ( n = 3 independent experiments, two-way ANOVA test; n.s. represents no significant difference, *** P

    Article Snippet: Rabbit antibodies used in this study were obtained from commercial sources as follows: HTT [EPR5526] (Abcam), beta-tubulin III [EP1569Y] (Novus Biologicals), NF-κB [D14E12] (Cell Signaling), LC3I/II [NB100-2220] (Novus Biologicals), ELA3B [GTX105123] (GeneTex), FAT10 [EPR4370] (GeneTex), SPINK3 [2744S] (Cell Signaling), HA [C29F4] (Cell Signaling), p-NF-κB [93H1] (Cell Signaling), RIP3 [GTX107574] (GeneTex), Caspase3 [9662] (Cell Signaling), and cleaved Caspase3 [5A1E] (Cell Signaling).

    Techniques: Activity Assay, Western Blot, Mouse Assay

    Proof-of-concept assembly of 16TU construct. (A) A schematic showing the four intermediate Level 2 constructs for the assembly of the 16-TU construct. The carotenoid biosynthesis genes crtE , crtB , crtI , and crtY assembled in the Vector A, the yellow chromoprotein genes scOrange , amilGFP , amajLime , and fwYellow in the Vector B, the pink chromoprotein genes tsPurple , eforRed , spisPink , and mRFP1 in the Vector Γ, and the violacein biosynthesis genes vioA , vioB , vioD and vioE in the Vector Δ. (B) A schematic of the 16TU construct derived from the assembly of the four Level 2 cassettes, each containing 4-TUs, in the Level 1 Acceptor Vector A. (C) Cells transformed with the successfully assembled 16TU construct grew into black colonies due to predominant colouring by protoviolaceinic acid. (D) Gel electrophoresis of six plasmids (isolated from the black colonies) digested with PstI and EcoRI resulting in bands of expected sizes—18.2kb for the insert and 2.2kb for the vector. (E) The same plasmids were digested with PstI and AleI resulting in the bands of expected sizes—7.1kb, 5.1 and 4.9kb (appear merged on the gel), and 3.2kb.

    Journal: PLoS ONE

    Article Title: Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly

    doi: 10.1371/journal.pone.0189892

    Figure Lengend Snippet: Proof-of-concept assembly of 16TU construct. (A) A schematic showing the four intermediate Level 2 constructs for the assembly of the 16-TU construct. The carotenoid biosynthesis genes crtE , crtB , crtI , and crtY assembled in the Vector A, the yellow chromoprotein genes scOrange , amilGFP , amajLime , and fwYellow in the Vector B, the pink chromoprotein genes tsPurple , eforRed , spisPink , and mRFP1 in the Vector Γ, and the violacein biosynthesis genes vioA , vioB , vioD and vioE in the Vector Δ. (B) A schematic of the 16TU construct derived from the assembly of the four Level 2 cassettes, each containing 4-TUs, in the Level 1 Acceptor Vector A. (C) Cells transformed with the successfully assembled 16TU construct grew into black colonies due to predominant colouring by protoviolaceinic acid. (D) Gel electrophoresis of six plasmids (isolated from the black colonies) digested with PstI and EcoRI resulting in bands of expected sizes—18.2kb for the insert and 2.2kb for the vector. (E) The same plasmids were digested with PstI and AleI resulting in the bands of expected sizes—7.1kb, 5.1 and 4.9kb (appear merged on the gel), and 3.2kb.

    Article Snippet: Subsequently the pSB1C3/pSB1K3 backbones and the Golden Gate cassettes were digested with EcoRI-HF and PstI-HF (NEB) for 20 min at 37°C followed by purification with PCR Clean-up kit (Macherey Nagel).

    Techniques: Construct, Plasmid Preparation, Derivative Assay, Transformation Assay, Nucleic Acid Electrophoresis, Isolation

    (A) XBP1 transcript splicing in NIH 3T3 cells infected (MOI, 30) with SFV4 or VRPs. RNA from infected cells was reverse transcribed into cDNA, and XBP1 amplicons were generated by PCR. These were digested with PstI, which only cleaves amplicons derived

    Journal: Journal of Virology

    Article Title: Semliki Forest Virus-Induced Endoplasmic Reticulum Stress Accelerates Apoptotic Death of Mammalian Cells ▿Semliki Forest Virus-Induced Endoplasmic Reticulum Stress Accelerates Apoptotic Death of Mammalian Cells ▿ †

    doi: 10.1128/JVI.02310-09

    Figure Lengend Snippet: (A) XBP1 transcript splicing in NIH 3T3 cells infected (MOI, 30) with SFV4 or VRPs. RNA from infected cells was reverse transcribed into cDNA, and XBP1 amplicons were generated by PCR. These were digested with PstI, which only cleaves amplicons derived

    Article Snippet: The PCR product then was treated with the restriction enzyme PstI (Promega) and run on an agarose gel.

    Techniques: Infection, Generated, Polymerase Chain Reaction, Derivative Assay

    Schematic representation of potential CYP2E1 RsaI/PStI alleles and PCR-RFLP band sizes. ‘2Els’ and ‘2Elas’ are sense and antisense oligonucleotides, respectively, used in PCR amplifications of the CYPE1 5′ regulatory region. P, PstI; , R, RsaI restriction enzyme sites.

    Journal: Oral oncology

    Article Title: Elucidation of CYP2E1 5? regulatory RsaI/Pstl allelic variants and their role in risk for oral cancer

    doi:

    Figure Lengend Snippet: Schematic representation of potential CYP2E1 RsaI/PStI alleles and PCR-RFLP band sizes. ‘2Els’ and ‘2Elas’ are sense and antisense oligonucleotides, respectively, used in PCR amplifications of the CYPE1 5′ regulatory region. P, PstI; , R, RsaI restriction enzyme sites.

    Article Snippet: Differences in RFLP patterns were detected after combined or single restriction enzyme digestion with RsaI and/or PstI (Promega Corp., Madison, WI) as indicated in the text.

    Techniques: Polymerase Chain Reaction

    Inhibition of restriction of H.pylori 1061 DNA. Lane 1, marker X (Roche); lane 2, H.pylori 1061 DNA and a PCR product ‘SHV’ after digestion with NdeII; lane 3, H.pylori 1061 DNA and a PCR product ‘SHV’ after mock incubation; lane 4, H.pylori 1061 DNA and a PCR product ‘SHV’ after digestion with PstI; lane 5, H.pylori 1061 DNA; lane 6, marker X (Roche); lane 7, PCR product ‘SHV’ after PstI digestion; and lane 8, PCR product ‘SHV’ after NdeII digestion. NdeII cleaves GATC but is inhibited by N 6 -adenosine methylation. PstI cleaves CTGCAG but is inhibited by N 6 -adenosine methylation. Note the presence of several plasmid bands in uncleaved H.pylori 1061 DNA.

    Journal: Nucleic Acids Research

    Article Title: Direct detection of methylation in genomic DNA

    doi: 10.1093/nar/gni121

    Figure Lengend Snippet: Inhibition of restriction of H.pylori 1061 DNA. Lane 1, marker X (Roche); lane 2, H.pylori 1061 DNA and a PCR product ‘SHV’ after digestion with NdeII; lane 3, H.pylori 1061 DNA and a PCR product ‘SHV’ after mock incubation; lane 4, H.pylori 1061 DNA and a PCR product ‘SHV’ after digestion with PstI; lane 5, H.pylori 1061 DNA; lane 6, marker X (Roche); lane 7, PCR product ‘SHV’ after PstI digestion; and lane 8, PCR product ‘SHV’ after NdeII digestion. NdeII cleaves GATC but is inhibited by N 6 -adenosine methylation. PstI cleaves CTGCAG but is inhibited by N 6 -adenosine methylation. Note the presence of several plasmid bands in uncleaved H.pylori 1061 DNA.

    Article Snippet: Digestion of chromosomal DNA with restriction enzymes Sau3AI, NdeI and PstI (Roche) was performed according to the manufacturer's instructions, but incubation was extended to 16 h. A mock incubation of chromosomal DNA with ultrapure water instead of restriction enzyme served as a control.

    Techniques: Inhibition, Marker, Polymerase Chain Reaction, Incubation, Methylation, Plasmid Preparation

    (a) Gene order in the SfMNPV variable region, including PstI-F, PstI-L, PstI-K, and EcoRI-N fragments of SfNIC-B. Schematic representation of the gene order of SfNIC genotypic variants, indicating the deletions of each variants and the genes present in

    Journal:

    Article Title: Functional Importance of Deletion Mutant Genotypes in an Insect Nucleopolyhedrovirus Population

    doi: 10.1128/AEM.71.8.4254-4262.2005

    Figure Lengend Snippet: (a) Gene order in the SfMNPV variable region, including PstI-F, PstI-L, PstI-K, and EcoRI-N fragments of SfNIC-B. Schematic representation of the gene order of SfNIC genotypic variants, indicating the deletions of each variants and the genes present in

    Article Snippet: For restriction endonuclease analysis, 2 μg of viral genomic DNA was treated with EcoRI or PstI (Amersham) following the manufacturer's recommendations.

    Techniques:

    Location and gene organization present on the PstI-F, PstI-L, PstI-K, and EcoRI-N fragments in the genome of the Nicaraguan SfMNPV isolate, genotype B (SfNIC-B). (a) EcoRI and PstI physical map of the SfMNPV genome. The position and orientation of the

    Journal:

    Article Title: Functional Importance of Deletion Mutant Genotypes in an Insect Nucleopolyhedrovirus Population

    doi: 10.1128/AEM.71.8.4254-4262.2005

    Figure Lengend Snippet: Location and gene organization present on the PstI-F, PstI-L, PstI-K, and EcoRI-N fragments in the genome of the Nicaraguan SfMNPV isolate, genotype B (SfNIC-B). (a) EcoRI and PstI physical map of the SfMNPV genome. The position and orientation of the

    Article Snippet: For restriction endonuclease analysis, 2 μg of viral genomic DNA was treated with EcoRI or PstI (Amersham) following the manufacturer's recommendations.

    Techniques:

    Ma-LMM01 genomic DNA digested with various restriction enzymes. Lanes 1 and 18, 1-kb ladder marker; lane 2, BamHI; lane 3, EcoRI; lane 4, EcoRV; lane 5, HincII; lane 6, HindIII; lane 7, NotI; lane 8, PstI; lane 9, SacI; lane 10, SalI; lane 11, ScaI; lane 12, SmaI; lanes 13 and 14, lambda/HindIII marker; lane 15, SpeI; lane 16, XhoI; lane 17, XbaI.

    Journal: Applied and Environmental Microbiology

    Article Title: Isolation and Characterization of a Cyanophage Infecting the Toxic Cyanobacterium Microcystis aeruginosa

    doi: 10.1128/AEM.72.2.1239-1247.2006

    Figure Lengend Snippet: Ma-LMM01 genomic DNA digested with various restriction enzymes. Lanes 1 and 18, 1-kb ladder marker; lane 2, BamHI; lane 3, EcoRI; lane 4, EcoRV; lane 5, HincII; lane 6, HindIII; lane 7, NotI; lane 8, PstI; lane 9, SacI; lane 10, SalI; lane 11, ScaI; lane 12, SmaI; lanes 13 and 14, lambda/HindIII marker; lane 15, SpeI; lane 16, XhoI; lane 17, XbaI.

    Article Snippet: Using the manufacturers' recommendations, we tested the sensitivity of the phage nucleic acid to RNase A (0.01 ng μl−1 ; 37°C for 1 h; Nippon Gene Co., Ltd.), DNase I (0.02 ng μl−1 ; 37°C for 1 h; Promega Co., Ltd.), and the following 14 restriction enzymes, which were incubated for 16 h: SpeI (0.5 U μl−1 ; 37°C; TOYOBO Co., Ltd.), XhoI (0.45 U μl−1 ; 37°C; TOYOBO Co., Ltd.), XbaI (0.5 U μl−1 ; 37°C; Roche Molecular Biochemicals), BamHI (0.6 U μl−1 ; 37°C; TOYOBO Co., Ltd.), EcoRI (0.5 U μl−1 ; 37°C; TOYOBO Co., Ltd.), EcoRV (0.6 U μl−1 ; 37°C; TOYOBO Co., Ltd.), HincII (0.5 U μl−1 ; 37°C; TOYOBO Co., Ltd.), HindIII (0.5 U μl−1 ; 37°C; Nippon Gene Co., Ltd.), NotI (0.5 U μl−1 ; 37°C; New England Biolabs Inc.), PstI (0.5 U μl−1 ; 37°C; TOYOBO Co., Ltd.), SacI (0.5 U μl−1 ; 37°C; TOYOBO Co., Ltd.), SalI (0.5 U μl−1 ; 37°C; TOYOBO Co., Ltd.), ScaI (0.5 U μl−1 ; 37°C; TOYOBO Co., Ltd.), and SmaI (0.6 U μl−1 ; 30°C; TOYOBO Co., Ltd.).

    Techniques: Marker

    Sorafenib induces autophagy through ER stress and MAPK8/9/10 activation. (A) TEM representative micrographs showing dilated ER cavities in sorafenib-treated Ishikawa cells for 24 h. For additional information please see Fig. S4A. (B) Left, representative images showing increased and discontinuous fluorescence intensity in endoplasmic reticulum upon sorafenib treatment. Untreated and sorafenib-treated Ishikawa cells were cultured in the presence of ER-Tracker Blue-White DPX and analyzed at 4 h post-treatment. Scale bar: 50 µm. Right, quantification of ER-Tracker Blue-White DPX intensity according to refs. 94,95 and using ImageJ software. (C) Left, schematic illustration representing 2 characteristic UPR responses, EIF2AK3/PERK-ATF4 and ERN1/IRE1. Right, XBP1 splicing analysis by PCR and enzymatic restriction and DDIT3/CHOP protein levels by western blot with densitometry quantification in Ishikawa cells treated with sorafenib. Splicing of XBP1 mRNA results in the excision of a 26-nucleotide intronic region, causing a frame shift in the coding sequence and the removal of a PstI restriction site. Therefore, PstI can digest unspliced XBP1 mRNA ( XBP1u ), generating XBP1 u1 and u2 fragments, but not spliced XBP1 mRNA ( XBP1s ). h represents a hybrid band composed of XBP1u and XBP1s single-stranded DNA produced during PCR. Western blot against tubulin was performed to ensure equal protein loading amounts. (D) Kaplan-Meyer and (E) disease-free survival curves comparing the outcome of EC cases with or without overexpression of MAPK8/JNK1, MAPK9/JNK2 and MAPK10/JNK3. A z-score≥ 3 was used as threshold for increased expression. Data were extracted from TCGA_ucec (RNAseq_V2). (F) Western blot and densitometry quantification (n = 3) showing activation of MAPK8/9/10 and its target JUN after a time course treatment of sorafenib (20 µM) in Ishikawa cells. (G) Activation of MAPK8/9/10 and JUN by western blot in sorafenib-treated primary EC biopsies. CEP-1347 inhibits activation of MAPK8/9/10 and JUN (H) and blocks LC3B-II increase in Ishikawa EC cells (I). Densitometry quantifications from 3 independent experiments are also shown. (J) Representative western blot and densitometry quantification (n = 3) showing impaired LC3B-II accumulation in mapk8/9 −/− cells after sorafenib treatment. (K) Representative immunofluorescence images and quantification of the number of LC3B-II puncta per cell in wild-type and mapk8/9 −/− MEFs treated with sorafenib or sorafenib combined with CQ. Scale bar: 50 µm. (L) Analysis of SQSTM1 protein levels by western blot in wild type and mapk8/9 −/− MEFs showing that CQ and Mapk8/9 -targeted deletion abrogates SQSTM1 proteolysis in response to sorafenib in wild-type and mapk8/9 −/− MEFs. Western blot against tubulin was performed to ensure equal protein loading amounts. SQSTM1 densitometry analysis is also shown. All experiments were performed in triplicate.

    Journal: Autophagy

    Article Title: Autophagy orchestrates adaptive responses to targeted therapy in endometrial cancer

    doi: 10.1080/15548627.2016.1271512

    Figure Lengend Snippet: Sorafenib induces autophagy through ER stress and MAPK8/9/10 activation. (A) TEM representative micrographs showing dilated ER cavities in sorafenib-treated Ishikawa cells for 24 h. For additional information please see Fig. S4A. (B) Left, representative images showing increased and discontinuous fluorescence intensity in endoplasmic reticulum upon sorafenib treatment. Untreated and sorafenib-treated Ishikawa cells were cultured in the presence of ER-Tracker Blue-White DPX and analyzed at 4 h post-treatment. Scale bar: 50 µm. Right, quantification of ER-Tracker Blue-White DPX intensity according to refs. 94,95 and using ImageJ software. (C) Left, schematic illustration representing 2 characteristic UPR responses, EIF2AK3/PERK-ATF4 and ERN1/IRE1. Right, XBP1 splicing analysis by PCR and enzymatic restriction and DDIT3/CHOP protein levels by western blot with densitometry quantification in Ishikawa cells treated with sorafenib. Splicing of XBP1 mRNA results in the excision of a 26-nucleotide intronic region, causing a frame shift in the coding sequence and the removal of a PstI restriction site. Therefore, PstI can digest unspliced XBP1 mRNA ( XBP1u ), generating XBP1 u1 and u2 fragments, but not spliced XBP1 mRNA ( XBP1s ). h represents a hybrid band composed of XBP1u and XBP1s single-stranded DNA produced during PCR. Western blot against tubulin was performed to ensure equal protein loading amounts. (D) Kaplan-Meyer and (E) disease-free survival curves comparing the outcome of EC cases with or without overexpression of MAPK8/JNK1, MAPK9/JNK2 and MAPK10/JNK3. A z-score≥ 3 was used as threshold for increased expression. Data were extracted from TCGA_ucec (RNAseq_V2). (F) Western blot and densitometry quantification (n = 3) showing activation of MAPK8/9/10 and its target JUN after a time course treatment of sorafenib (20 µM) in Ishikawa cells. (G) Activation of MAPK8/9/10 and JUN by western blot in sorafenib-treated primary EC biopsies. CEP-1347 inhibits activation of MAPK8/9/10 and JUN (H) and blocks LC3B-II increase in Ishikawa EC cells (I). Densitometry quantifications from 3 independent experiments are also shown. (J) Representative western blot and densitometry quantification (n = 3) showing impaired LC3B-II accumulation in mapk8/9 −/− cells after sorafenib treatment. (K) Representative immunofluorescence images and quantification of the number of LC3B-II puncta per cell in wild-type and mapk8/9 −/− MEFs treated with sorafenib or sorafenib combined with CQ. Scale bar: 50 µm. (L) Analysis of SQSTM1 protein levels by western blot in wild type and mapk8/9 −/− MEFs showing that CQ and Mapk8/9 -targeted deletion abrogates SQSTM1 proteolysis in response to sorafenib in wild-type and mapk8/9 −/− MEFs. Western blot against tubulin was performed to ensure equal protein loading amounts. SQSTM1 densitometry analysis is also shown. All experiments were performed in triplicate.

    Article Snippet: Briefly the RT-PCR product of XBP1 mRNA was synthesized primers using primers 5′ GGCCTTGTGGTTGAGAACCAGGAG 3′ (sense) 5′ GAATGCCCAA AA GGATATCAGACTC 3′ (antisense) with the following PCR protocol: 30 cycles of PCR amplification including initialization at 94°C for 4 min, denaturation at 94°C for 10 sec, annealing at 63°C for 30 sec, elongation at 72°C for 30 sec, and final elongation at 72°C for 10 min. Because a 26-bp fragment contains a PstI site that is spliced upon the activation of XBP1 mRNA, the RT-PCR products were digested with PstI (Takara Bio Inc., 1073A).

    Techniques: Activation Assay, Transmission Electron Microscopy, Fluorescence, Cell Culture, Software, Polymerase Chain Reaction, Western Blot, Sequencing, Produced, Over Expression, Expressing, Immunofluorescence

    muSeq applied to a genomic representation. We demonstrate the application of muSeq to a genomic representation by tracing two fragments (X and Y) from a single genomic locus through the molecular and informatics processing steps. The full experiment comprises 160,000 genomic loci and about 100 fragments per locus. ( A ) We first generate a representation from genomic DNA using PstI. ( B ) The ends of restriction fragments are polished, T-tailed, and then the fragments are ligated to bisulfite-resistant sequence adapters. ( C ) The templates are then melted and subjected to partial bisulfite conversion (Materials and Methods). The conversion process randomly deaminates unmethylated cytosines (blue C), converting some proportion to uracil (red U). Each double-stranded molecule results in two templates, one from each strand. ( D ) We then sample the converted templates and PCR amplify to generate a sequencing library. During amplification uracil is copied as thymine (red T). ( E ) The library is then paired-end sequenced on an Illumina machine. Because of asymmetries in the sequencing primers, read one shows C to T conversion while read 2 shows G to A conversions. We then fully convert the reads ( F ) and map them to two fully converted genomes ( G ): one where every C in the reference is converted to a T and one where every G is converted to an A. Reads originating from a top strand map to the C to T reference with read 1 reading in the forward direction and read 2 in the reverse, while bottom strand reads map to the G to A reference with read 2 mapping forward and read 1 in reverse. ( H ) The reads are binned by genomic locus and strand. Mutable positions and their conversions are recorded as a bit pattern. We then use those patterns to cluster the reads (see Figure 3 ).

    Journal: Nucleic Acids Research

    Article Title: Partial bisulfite conversion for unique template sequencing

    doi: 10.1093/nar/gkx1054

    Figure Lengend Snippet: muSeq applied to a genomic representation. We demonstrate the application of muSeq to a genomic representation by tracing two fragments (X and Y) from a single genomic locus through the molecular and informatics processing steps. The full experiment comprises 160,000 genomic loci and about 100 fragments per locus. ( A ) We first generate a representation from genomic DNA using PstI. ( B ) The ends of restriction fragments are polished, T-tailed, and then the fragments are ligated to bisulfite-resistant sequence adapters. ( C ) The templates are then melted and subjected to partial bisulfite conversion (Materials and Methods). The conversion process randomly deaminates unmethylated cytosines (blue C), converting some proportion to uracil (red U). Each double-stranded molecule results in two templates, one from each strand. ( D ) We then sample the converted templates and PCR amplify to generate a sequencing library. During amplification uracil is copied as thymine (red T). ( E ) The library is then paired-end sequenced on an Illumina machine. Because of asymmetries in the sequencing primers, read one shows C to T conversion while read 2 shows G to A conversions. We then fully convert the reads ( F ) and map them to two fully converted genomes ( G ): one where every C in the reference is converted to a T and one where every G is converted to an A. Reads originating from a top strand map to the C to T reference with read 1 reading in the forward direction and read 2 in the reverse, while bottom strand reads map to the G to A reference with read 2 mapping forward and read 1 in reverse. ( H ) The reads are binned by genomic locus and strand. Mutable positions and their conversions are recorded as a bit pattern. We then use those patterns to cluster the reads (see Figure 3 ).

    Article Snippet: Representations Genomic DNAs were extracted from whole blood, cleaved with PstI, end-repaired and ligated to custom Illumina sequencing primers (Figure and ).

    Techniques: Sequencing, Polymerase Chain Reaction, Amplification