psti Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs psti
    Psti, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2021-05
    99/100 stars
      Buy from Supplier

    98
    Thermo Fisher psti
    Psti, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/Thermo Fisher
    Average 98 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2021-05
    98/100 stars
      Buy from Supplier

    99
    New England Biolabs psti hf
    Psti Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti hf/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    psti hf - by Bioz Stars, 2021-05
    99/100 stars
      Buy from Supplier

    psti  (TaKaRa)
    92
    TaKaRa psti
    Sorafenib induces autophagy through ER stress and MAPK8/9/10 activation. (A) TEM representative micrographs showing dilated ER cavities in sorafenib-treated Ishikawa cells for 24 h. For additional information please see Fig. S4A. (B) Left, representative images showing increased and discontinuous fluorescence intensity in endoplasmic reticulum upon sorafenib treatment. Untreated and sorafenib-treated Ishikawa cells were cultured in the presence of ER-Tracker Blue-White DPX and analyzed at 4 h post-treatment. Scale bar: 50 µm. Right, quantification of ER-Tracker Blue-White DPX intensity according to refs. 94,95 and using ImageJ software. (C) Left, schematic illustration representing 2 characteristic UPR responses, EIF2AK3/PERK-ATF4 and ERN1/IRE1. Right, <t>XBP1</t> splicing analysis by PCR and enzymatic restriction and DDIT3/CHOP protein levels by western blot with densitometry quantification in Ishikawa cells treated with sorafenib. Splicing of XBP1 mRNA results in the excision of a 26-nucleotide intronic region, causing a frame shift in the coding sequence and the removal of a <t>PstI</t> restriction site. Therefore, PstI can digest unspliced XBP1 mRNA ( XBP1u ), generating XBP1 u1 and u2 fragments, but not spliced XBP1 mRNA ( XBP1s ). h represents a hybrid band composed of XBP1u and XBP1s single-stranded DNA produced during PCR. Western blot against tubulin was performed to ensure equal protein loading amounts. (D) Kaplan-Meyer and (E) disease-free survival curves comparing the outcome of EC cases with or without overexpression of MAPK8/JNK1, MAPK9/JNK2 and MAPK10/JNK3. A z-score≥ 3 was used as threshold for increased expression. Data were extracted from TCGA_ucec (RNAseq_V2). (F) Western blot and densitometry quantification (n = 3) showing activation of MAPK8/9/10 and its target JUN after a time course treatment of sorafenib (20 µM) in Ishikawa cells. (G) Activation of MAPK8/9/10 and JUN by western blot in sorafenib-treated primary EC biopsies. CEP-1347 inhibits activation of MAPK8/9/10 and JUN (H) and blocks LC3B-II increase in Ishikawa EC cells (I). Densitometry quantifications from 3 independent experiments are also shown. (J) Representative western blot and densitometry quantification (n = 3) showing impaired LC3B-II accumulation in mapk8/9 −/− cells after sorafenib treatment. (K) Representative immunofluorescence images and quantification of the number of LC3B-II puncta per cell in wild-type and mapk8/9 −/− MEFs treated with sorafenib or sorafenib combined with CQ. Scale bar: 50 µm. (L) Analysis of SQSTM1 protein levels by western blot in wild type and mapk8/9 −/− MEFs showing that CQ and Mapk8/9 -targeted deletion abrogates SQSTM1 proteolysis in response to sorafenib in wild-type and mapk8/9 −/− MEFs. Western blot against tubulin was performed to ensure equal protein loading amounts. SQSTM1 densitometry analysis is also shown. All experiments were performed in triplicate.
    Psti, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psti/product/TaKaRa
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    psti - by Bioz Stars, 2021-05
    92/100 stars
      Buy from Supplier




    N/A
    Target species mouse Gene Silencers generally consist of pools of three to five target specific 19 25 nucleotide sequences in length For independent verification of SPINK3 gene silencing results individual
      Buy from Supplier

    Image Search Results


    Sorafenib induces autophagy through ER stress and MAPK8/9/10 activation. (A) TEM representative micrographs showing dilated ER cavities in sorafenib-treated Ishikawa cells for 24 h. For additional information please see Fig. S4A. (B) Left, representative images showing increased and discontinuous fluorescence intensity in endoplasmic reticulum upon sorafenib treatment. Untreated and sorafenib-treated Ishikawa cells were cultured in the presence of ER-Tracker Blue-White DPX and analyzed at 4 h post-treatment. Scale bar: 50 µm. Right, quantification of ER-Tracker Blue-White DPX intensity according to refs. 94,95 and using ImageJ software. (C) Left, schematic illustration representing 2 characteristic UPR responses, EIF2AK3/PERK-ATF4 and ERN1/IRE1. Right, XBP1 splicing analysis by PCR and enzymatic restriction and DDIT3/CHOP protein levels by western blot with densitometry quantification in Ishikawa cells treated with sorafenib. Splicing of XBP1 mRNA results in the excision of a 26-nucleotide intronic region, causing a frame shift in the coding sequence and the removal of a PstI restriction site. Therefore, PstI can digest unspliced XBP1 mRNA ( XBP1u ), generating XBP1 u1 and u2 fragments, but not spliced XBP1 mRNA ( XBP1s ). h represents a hybrid band composed of XBP1u and XBP1s single-stranded DNA produced during PCR. Western blot against tubulin was performed to ensure equal protein loading amounts. (D) Kaplan-Meyer and (E) disease-free survival curves comparing the outcome of EC cases with or without overexpression of MAPK8/JNK1, MAPK9/JNK2 and MAPK10/JNK3. A z-score≥ 3 was used as threshold for increased expression. Data were extracted from TCGA_ucec (RNAseq_V2). (F) Western blot and densitometry quantification (n = 3) showing activation of MAPK8/9/10 and its target JUN after a time course treatment of sorafenib (20 µM) in Ishikawa cells. (G) Activation of MAPK8/9/10 and JUN by western blot in sorafenib-treated primary EC biopsies. CEP-1347 inhibits activation of MAPK8/9/10 and JUN (H) and blocks LC3B-II increase in Ishikawa EC cells (I). Densitometry quantifications from 3 independent experiments are also shown. (J) Representative western blot and densitometry quantification (n = 3) showing impaired LC3B-II accumulation in mapk8/9 −/− cells after sorafenib treatment. (K) Representative immunofluorescence images and quantification of the number of LC3B-II puncta per cell in wild-type and mapk8/9 −/− MEFs treated with sorafenib or sorafenib combined with CQ. Scale bar: 50 µm. (L) Analysis of SQSTM1 protein levels by western blot in wild type and mapk8/9 −/− MEFs showing that CQ and Mapk8/9 -targeted deletion abrogates SQSTM1 proteolysis in response to sorafenib in wild-type and mapk8/9 −/− MEFs. Western blot against tubulin was performed to ensure equal protein loading amounts. SQSTM1 densitometry analysis is also shown. All experiments were performed in triplicate.

    Journal: Autophagy

    Article Title: Autophagy orchestrates adaptive responses to targeted therapy in endometrial cancer

    doi: 10.1080/15548627.2016.1271512

    Figure Lengend Snippet: Sorafenib induces autophagy through ER stress and MAPK8/9/10 activation. (A) TEM representative micrographs showing dilated ER cavities in sorafenib-treated Ishikawa cells for 24 h. For additional information please see Fig. S4A. (B) Left, representative images showing increased and discontinuous fluorescence intensity in endoplasmic reticulum upon sorafenib treatment. Untreated and sorafenib-treated Ishikawa cells were cultured in the presence of ER-Tracker Blue-White DPX and analyzed at 4 h post-treatment. Scale bar: 50 µm. Right, quantification of ER-Tracker Blue-White DPX intensity according to refs. 94,95 and using ImageJ software. (C) Left, schematic illustration representing 2 characteristic UPR responses, EIF2AK3/PERK-ATF4 and ERN1/IRE1. Right, XBP1 splicing analysis by PCR and enzymatic restriction and DDIT3/CHOP protein levels by western blot with densitometry quantification in Ishikawa cells treated with sorafenib. Splicing of XBP1 mRNA results in the excision of a 26-nucleotide intronic region, causing a frame shift in the coding sequence and the removal of a PstI restriction site. Therefore, PstI can digest unspliced XBP1 mRNA ( XBP1u ), generating XBP1 u1 and u2 fragments, but not spliced XBP1 mRNA ( XBP1s ). h represents a hybrid band composed of XBP1u and XBP1s single-stranded DNA produced during PCR. Western blot against tubulin was performed to ensure equal protein loading amounts. (D) Kaplan-Meyer and (E) disease-free survival curves comparing the outcome of EC cases with or without overexpression of MAPK8/JNK1, MAPK9/JNK2 and MAPK10/JNK3. A z-score≥ 3 was used as threshold for increased expression. Data were extracted from TCGA_ucec (RNAseq_V2). (F) Western blot and densitometry quantification (n = 3) showing activation of MAPK8/9/10 and its target JUN after a time course treatment of sorafenib (20 µM) in Ishikawa cells. (G) Activation of MAPK8/9/10 and JUN by western blot in sorafenib-treated primary EC biopsies. CEP-1347 inhibits activation of MAPK8/9/10 and JUN (H) and blocks LC3B-II increase in Ishikawa EC cells (I). Densitometry quantifications from 3 independent experiments are also shown. (J) Representative western blot and densitometry quantification (n = 3) showing impaired LC3B-II accumulation in mapk8/9 −/− cells after sorafenib treatment. (K) Representative immunofluorescence images and quantification of the number of LC3B-II puncta per cell in wild-type and mapk8/9 −/− MEFs treated with sorafenib or sorafenib combined with CQ. Scale bar: 50 µm. (L) Analysis of SQSTM1 protein levels by western blot in wild type and mapk8/9 −/− MEFs showing that CQ and Mapk8/9 -targeted deletion abrogates SQSTM1 proteolysis in response to sorafenib in wild-type and mapk8/9 −/− MEFs. Western blot against tubulin was performed to ensure equal protein loading amounts. SQSTM1 densitometry analysis is also shown. All experiments were performed in triplicate.

    Article Snippet: Briefly the RT-PCR product of XBP1 mRNA was synthesized primers using primers 5′ GGCCTTGTGGTTGAGAACCAGGAG 3′ (sense) 5′ GAATGCCCAA AA GGATATCAGACTC 3′ (antisense) with the following PCR protocol: 30 cycles of PCR amplification including initialization at 94°C for 4 min, denaturation at 94°C for 10 sec, annealing at 63°C for 30 sec, elongation at 72°C for 30 sec, and final elongation at 72°C for 10 min. Because a 26-bp fragment contains a PstI site that is spliced upon the activation of XBP1 mRNA, the RT-PCR products were digested with PstI (Takara Bio Inc., 1073A).

    Techniques: Activation Assay, Transmission Electron Microscopy, Fluorescence, Cell Culture, Software, Polymerase Chain Reaction, Western Blot, Sequencing, Produced, Over Expression, Expressing, Immunofluorescence