primers 27f Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore oligos 16s 27f
    Oligos 16s 27f, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos 16s 27f/product/Millipore
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    oligos 16s 27f - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    90
    Macrogen 27f primer
    27f Primer, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/27f primer/product/Macrogen
    Average 90 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    27f primer - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    85
    Thermo Fisher bacterial primer 27f
    Bacterial Primer 27f, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial primer 27f/product/Thermo Fisher
    Average 85 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    bacterial primer 27f - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    91
    MWG-Biotech primers 27f
    Primers 27f, supplied by MWG-Biotech, used in various techniques. Bioz Stars score: 91/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primers 27f/product/MWG-Biotech
    Average 91 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    primers 27f - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    89
    Thermo Fisher 27f primer
    27f Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 136 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/27f primer/product/Thermo Fisher
    Average 89 stars, based on 136 article reviews
    Price from $9.99 to $1999.99
    27f primer - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    90
    Illumina Inc primers 27f
    Primers 27f, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 43 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primers 27f/product/Illumina Inc
    Average 90 stars, based on 43 article reviews
    Price from $9.99 to $1999.99
    primers 27f - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    89
    Roche 27f primer
    Agarose gel electrophoresis of 16S rDNA produced by PCR primed by <t>27f</t> and 1525r primers from lactic acid bacteria. Lane M, molecular weight marker; lane 1, CAU 6728; lane 2, CAU 7856; lane 3, CAU 9567; lane 4, CAU 9967; lane 5, CAU 9896.
    27f Primer, supplied by Roche, used in various techniques. Bioz Stars score: 89/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/27f primer/product/Roche
    Average 89 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    27f primer - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    89
    Beckman Coulter primer 27f
    Agarose gel electrophoresis of 16S rDNA produced by PCR primed by <t>27f</t> and 1525r primers from lactic acid bacteria. Lane M, molecular weight marker; lane 1, CAU 6728; lane 2, CAU 7856; lane 3, CAU 9567; lane 4, CAU 9967; lane 5, CAU 9896.
    Primer 27f, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 89/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer 27f/product/Beckman Coulter
    Average 89 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    primer 27f - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    89
    Primm Biotech primer 27f
    Agarose gel electrophoresis of 16S rDNA produced by PCR primed by <t>27f</t> and 1525r primers from lactic acid bacteria. Lane M, molecular weight marker; lane 1, CAU 6728; lane 2, CAU 7856; lane 3, CAU 9567; lane 4, CAU 9967; lane 5, CAU 9896.
    Primer 27f, supplied by Primm Biotech, used in various techniques. Bioz Stars score: 89/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer 27f/product/Primm Biotech
    Average 89 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    primer 27f - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    90
    LGC Genomics GmbH 27f primer
    Agarose gel electrophoresis of 16S rDNA produced by PCR primed by <t>27f</t> and 1525r primers from lactic acid bacteria. Lane M, molecular weight marker; lane 1, CAU 6728; lane 2, CAU 7856; lane 3, CAU 9567; lane 4, CAU 9967; lane 5, CAU 9896.
    27f Primer, supplied by LGC Genomics GmbH, used in various techniques. Bioz Stars score: 90/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/27f primer/product/LGC Genomics GmbH
    Average 90 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    27f primer - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    85
    GATC Biotech primers b8 f 27f
    Agarose gel electrophoresis of 16S rDNA produced by PCR primed by <t>27f</t> and 1525r primers from lactic acid bacteria. Lane M, molecular weight marker; lane 1, CAU 6728; lane 2, CAU 7856; lane 3, CAU 9567; lane 4, CAU 9967; lane 5, CAU 9896.
    Primers B8 F 27f, supplied by GATC Biotech, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primers b8 f 27f/product/GATC Biotech
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    primers b8 f 27f - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    84
    Illumina Inc primers 27f aatgatacggcgaccaccgagatctacac
    Agarose gel electrophoresis of 16S rDNA produced by PCR primed by <t>27f</t> and 1525r primers from lactic acid bacteria. Lane M, molecular weight marker; lane 1, CAU 6728; lane 2, CAU 7856; lane 3, CAU 9567; lane 4, CAU 9967; lane 5, CAU 9896.
    Primers 27f Aatgatacggcgaccaccgagatctacac, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primers 27f aatgatacggcgaccaccgagatctacac/product/Illumina Inc
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    primers 27f aatgatacggcgaccaccgagatctacac - by Bioz Stars, 2020-08
    84/100 stars
      Buy from Supplier

    85
    Macrogen bacterial primer 27f
    Agarose gel electrophoresis of 16S rDNA produced by PCR primed by <t>27f</t> and 1525r primers from lactic acid bacteria. Lane M, molecular weight marker; lane 1, CAU 6728; lane 2, CAU 7856; lane 3, CAU 9567; lane 4, CAU 9967; lane 5, CAU 9896.
    Bacterial Primer 27f, supplied by Macrogen, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial primer 27f/product/Macrogen
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    bacterial primer 27f - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    88
    Roche fusion primer a 27f
    Agarose gel electrophoresis of 16S rDNA produced by PCR primed by <t>27f</t> and 1525r primers from lactic acid bacteria. Lane M, molecular weight marker; lane 1, CAU 6728; lane 2, CAU 7856; lane 3, CAU 9567; lane 4, CAU 9967; lane 5, CAU 9896.
    Fusion Primer A 27f, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fusion primer a 27f/product/Roche
    Average 88 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    fusion primer a 27f - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    90
    Thermo Fisher 27f primer sequence
    Agarose gel electrophoresis of 16S rDNA produced by PCR primed by <t>27f</t> and 1525r primers from lactic acid bacteria. Lane M, molecular weight marker; lane 1, CAU 6728; lane 2, CAU 7856; lane 3, CAU 9567; lane 4, CAU 9967; lane 5, CAU 9896.
    27f Primer Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/27f primer sequence/product/Thermo Fisher
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    27f primer sequence - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    90
    Millipore 27f 1492r
    Agarose gel electrophoresis of 16S rDNA produced by PCR primed by <t>27f</t> and 1525r primers from lactic acid bacteria. Lane M, molecular weight marker; lane 1, CAU 6728; lane 2, CAU 7856; lane 3, CAU 9567; lane 4, CAU 9967; lane 5, CAU 9896.
    27f 1492r, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/27f 1492r/product/Millipore
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    27f 1492r - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    91
    Illumina Inc 27f
    Agarose gel electrophoresis of 16S rDNA produced by PCR primed by <t>27f</t> and 1525r primers from lactic acid bacteria. Lane M, molecular weight marker; lane 1, CAU 6728; lane 2, CAU 7856; lane 3, CAU 9567; lane 4, CAU 9967; lane 5, CAU 9896.
    27f, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 91/100, based on 74 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/27f/product/Illumina Inc
    Average 91 stars, based on 74 article reviews
    Price from $9.99 to $1999.99
    27f - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    27f  (Roche)
    91
    Roche 27f
    Agarose gel electrophoresis of 16S rDNA produced by PCR primed by <t>27f</t> and 1525r primers from lactic acid bacteria. Lane M, molecular weight marker; lane 1, CAU 6728; lane 2, CAU 7856; lane 3, CAU 9567; lane 4, CAU 9967; lane 5, CAU 9896.
    27f, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 175 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/27f/product/Roche
    Average 91 stars, based on 175 article reviews
    Price from $9.99 to $1999.99
    27f - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    85
    Eurofins 6 carboxyfluorescein 6 fam labeled primer 27f
    Agarose gel electrophoresis of 16S rDNA produced by PCR primed by <t>27f</t> and 1525r primers from lactic acid bacteria. Lane M, molecular weight marker; lane 1, CAU 6728; lane 2, CAU 7856; lane 3, CAU 9567; lane 4, CAU 9967; lane 5, CAU 9896.
    6 Carboxyfluorescein 6 Fam Labeled Primer 27f, supplied by Eurofins, used in various techniques. Bioz Stars score: 85/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 carboxyfluorescein 6 fam labeled primer 27f/product/Eurofins
    Average 85 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    6 carboxyfluorescein 6 fam labeled primer 27f - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Image Search Results


    Agarose gel electrophoresis of 16S rDNA produced by PCR primed by 27f and 1525r primers from lactic acid bacteria. Lane M, molecular weight marker; lane 1, CAU 6728; lane 2, CAU 7856; lane 3, CAU 9567; lane 4, CAU 9967; lane 5, CAU 9896.

    Journal: Journal of Korean Medical Science

    Article Title: The Effect of Lactic Acid Bacteria Isolates on the Urinary Tract Pathogens to Infants In Vitro

    doi: 10.3346/jkms.2009.24.S1.S57

    Figure Lengend Snippet: Agarose gel electrophoresis of 16S rDNA produced by PCR primed by 27f and 1525r primers from lactic acid bacteria. Lane M, molecular weight marker; lane 1, CAU 6728; lane 2, CAU 7856; lane 3, CAU 9567; lane 4, CAU 9967; lane 5, CAU 9896.

    Article Snippet: 16S rDNA was amplified by adding 10× Taq buffer 10 µL, 2.5 mM dNTPs 8 µL, 1.25 mM MgCl2 10 µL, distilled water 59 µL, 10 µM 27f primer (5'-AGAGTTTGATCMTGGCTCAAG-3') 1 µL, 10 µM 1525r primer (5'-AAGGAGGTGWTCCARCC-3') 1 µL, and Taq polymerase (Roche, Basel, Switzerland) 0.5 µL to the extracted genomic DNA, 30 cycles of reactions at 94℃ for two minutes, at 55℃ for 1 min, and at 72℃ for 2 min in GeneAmp 2700 (Applied Biosystems, Foster City, CA, U.S.A.).

    Techniques: Agarose Gel Electrophoresis, Produced, Polymerase Chain Reaction, Molecular Weight, Marker