pre-complexing sirna Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher transfection complexes hsa mir 335 5p pre mir mirna precursor
    Relative expression of LAMTOR genes after transfection with <t>miRNA-20a-5p</t> mimic in foetal astrocytes. TaqMan TM PCR of miRNA-20a-5p ( A ) and RT-qPCR of LAMTOR1 ( B ), LAMTOR2 ( C ), LAMTOR3 ( D ), LAMTOR4 ( E ) and LAMTOR5 ( F ) in foetal astrocytes <t>transfected</t> with miRNA-20a-5p mimic (miR20a) for 24h ( n = 3 biological triplets and two technical duplicates). Data are normalized to Lipofectamine® (control). * P
    Transfection Complexes Hsa Mir 335 5p Pre Mir Mirna Precursor, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1420 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transfection complexes hsa mir 335 5p pre mir mirna precursor/product/Thermo Fisher
    Average 99 stars, based on 1420 article reviews
    Price from $9.99 to $1999.99
    transfection complexes hsa mir 335 5p pre mir mirna precursor - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    93
    GenePharma Company pre prepare sirna sirna mate complex
    Relative expression of LAMTOR genes after transfection with <t>miRNA-20a-5p</t> mimic in foetal astrocytes. TaqMan TM PCR of miRNA-20a-5p ( A ) and RT-qPCR of LAMTOR1 ( B ), LAMTOR2 ( C ), LAMTOR3 ( D ), LAMTOR4 ( E ) and LAMTOR5 ( F ) in foetal astrocytes <t>transfected</t> with miRNA-20a-5p mimic (miR20a) for 24h ( n = 3 biological triplets and two technical duplicates). Data are normalized to Lipofectamine® (control). * P
    Pre Prepare Sirna Sirna Mate Complex, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 93/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pre prepare sirna sirna mate complex/product/GenePharma Company
    Average 93 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    pre prepare sirna sirna mate complex - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher sirna
    Super-resolution imaging of centriole amplification in MEFs expressing Multicilin and E2f4VP16. (a) Super-resolution images of MEFs expressing Multicili/E2f4VP16 stained with Cep63 (red), Centrin (green) and Cep152 (blue). The magnified insets show details for centriole assembly on existing centrioles (C1 or C2, marked with Cep63) versus that occurring at the deuterosome (DD). (b) Super-resolution images of MEFs expressing Multicilin/E2f4VP16 stained with Deup1 (red), Centrin (green) and Cep152 (blue). The magnified insets show details for centriole assembly on existing centrioles (C1 or C2, marked with Centrin at the core) versus that occurring at the deuterosome (DD, marked with Deup1). Cells were divided into 4 stages as described in the text. (c) MEFs expressing Multicilin/E2f4VP16 were scored at different days PI in triplicate for > 100 cells, using the staging of MCC differentiation described in the text. (d) Average number of Deup1 and Centrin foci in MEFs expressing Multicilin/E2f4VP16 at different stages of MCC differentiation, based on > 35 cells scored at each stage. (e) Average size of Deup1 foci based on super-resolution images (Fig. S5a,b and lower panel) of Deup1 (red) and Centrin (green) antibody staining, plotted according to engaged centriole number. (f) MEFs were subjected to RNAi knock down ( siCTL , siDeup1 , siCep63 or siCep152 ) 1 day before the infection. MEFs were fixed at day 1 PI (2 days after initial <t>siRNA</t> transfection) then subjected to antibody staining as indicated. Representative super-resolution images of MEFs stained with Cep63 (red), Centrin (green) and Cep152 (blue) followed by cropping to show MCD specific centriole amplification. ( g–i ) Boxplots summarizing the effects of different gene knock downs in MEFs expressing Multicilin/myc-E2f4VP16, on the number of Deup1 foci (g) , of Sas-6 foci associated with Deup1 (h) , or of procentrioles, marked with Centrin, associated with the pre-existing centrioles marked with Cep63 staining (i) . P-values based on a two-tailed, t -test. All other error bars = s.d. Scale bars = 2 μm (a , b) or 0.5 μm (e , f) .
    Sirna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 93491 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna/product/Thermo Fisher
    Average 99 stars, based on 93491 article reviews
    Price from $9.99 to $1999.99
    sirna - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher pre designed silencer select sirna
    Identification of a novel androgen regulated protein isoform encoded by the tumour suppressor gene <t>TSC2</t> in PCa cells (A) A novel internal initiation site from the TSC2 gene was identified in 24-hour androgen stimulated LNCaP cells using 5′ RACE. First strand cDNA synthesis was primed using a gene-specific primer to TSC2 exon 34 and a product was obtained for LNCaP cells treated with the synthetic androgen R1881 (A+), which was absent from steroid-depleted (SD) cells. (B) Visualisation of the sequenced 5′ RACE product on the UCSC genome browser indicated the androgen regulated TSC2 isoform contained a novel 5′ UTR, with a start codon at the beginning of exon 32. (C) Real-time qPCR using primer pairs to specific exons of TSC2 confirmed the location of the androgen-indued TSC2 internal 5' end. (D) Detection of TSC2 isoforms in LNCaP cells using antibodies specific to the N- and C terminus of the protein revealed an androgen inducible band, named isoform A, of approximately 60kDa detectable using the C-terminal antibody (E) which was absent when the same samples were probed with the N-terminal antibody (F). Anti-p70-S6K was used as a control to confirm the response to androgens. Notably, as well as induction of TSC2A, there was also a reduction in full-length TSC2 protein levels following androgen treatment detectable by both TSC2 antibodies. Stable transfection of LNCaP cells with <t>shRNA</t> targeting full-length TSC2 mRNA but not TSC2A (labelled N-term shRNA) showed that although there is loss of the full-length protein, TSC2A is still present, indicating it is not a degradation product of the full-length protein (G). Stable transfection with shRNA targeting both isoforms (labelled C-term shRNA) resulted in the loss of both proteins, demonstrating the specificity of the C-terminal TSC2 antibody (H).
    Pre Designed Silencer Select Sirna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pre designed silencer select sirna/product/Thermo Fisher
    Average 99 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    pre designed silencer select sirna - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    Relative expression of LAMTOR genes after transfection with miRNA-20a-5p mimic in foetal astrocytes. TaqMan TM PCR of miRNA-20a-5p ( A ) and RT-qPCR of LAMTOR1 ( B ), LAMTOR2 ( C ), LAMTOR3 ( D ), LAMTOR4 ( E ) and LAMTOR5 ( F ) in foetal astrocytes transfected with miRNA-20a-5p mimic (miR20a) for 24h ( n = 3 biological triplets and two technical duplicates). Data are normalized to Lipofectamine® (control). * P

    Journal: Brain

    Article Title: The coding and non-coding transcriptional landscape of subependymal giant cell astrocytomas

    doi: 10.1093/brain/awz370

    Figure Lengend Snippet: Relative expression of LAMTOR genes after transfection with miRNA-20a-5p mimic in foetal astrocytes. TaqMan TM PCR of miRNA-20a-5p ( A ) and RT-qPCR of LAMTOR1 ( B ), LAMTOR2 ( C ), LAMTOR3 ( D ), LAMTOR4 ( E ) and LAMTOR5 ( F ) in foetal astrocytes transfected with miRNA-20a-5p mimic (miR20a) for 24h ( n = 3 biological triplets and two technical duplicates). Data are normalized to Lipofectamine® (control). * P

    Article Snippet: Transfection and treatment of cell cultures SEGA cells were plated and stimulated with a final concentration of 5 µM U0126 (Sigma-Aldrich), 0.1 µM rapamycin (LC Laboratories) in dimethyl sulphoxide (DMSO) (0.05% final DMSO concentration) or vehicle (0.05% DMSO) for 24 h. Primary astrocyte cells were transfected with mimic pre-miRNA for miRNA-20a-5p (mirVana miRNA mimics, Applied Biosystems) using Lipofectamine® 2000 transfection reagent (Life Technologies) in a final concentration of 50 nM for 24 h. Cells treated with Lipofectamine® without mimic were used as a control.

    Techniques: Expressing, Transfection, Polymerase Chain Reaction, Quantitative RT-PCR

    Evaluation of delivery for synthetic microRNA (miRNA) molecules to tumors in bone. A dual-luciferase expressing PC-3M cells that have 3'-UTR of Bcl2 under the renilla luciferase gene, PC-3M-luc/Rluc-Bcl2 3'UTR cells, were generated. These cells were used

    Journal: Molecular Therapy

    Article Title: Systemic Delivery of Synthetic MicroRNA-16 Inhibits the Growth of Metastatic Prostate Tumors via Downregulation of Multiple Cell-cycle Genes

    doi: 10.1038/mt.2009.207

    Figure Lengend Snippet: Evaluation of delivery for synthetic microRNA (miRNA) molecules to tumors in bone. A dual-luciferase expressing PC-3M cells that have 3'-UTR of Bcl2 under the renilla luciferase gene, PC-3M-luc/Rluc-Bcl2 3'UTR cells, were generated. These cells were used

    Article Snippet: For preparation of RNA samples, PC-3M-luc cells were reverse transfected in quadruplicate by complexing miR-16 and NC miRNA and NeoFX transfection reagent (Ambion).

    Techniques: Luciferase, Expressing, Generated

    Inhibition of metastatic tumor growth in bone tissues by the atelocollagen-mediated miRNA treatment. Mice were injected with 2 × 10 6 PC-3M-luc-C6 cells into the left heart ventricle on day zero. The miR-16 and NC miRNA (50 µg)

    Journal: Molecular Therapy

    Article Title: Systemic Delivery of Synthetic MicroRNA-16 Inhibits the Growth of Metastatic Prostate Tumors via Downregulation of Multiple Cell-cycle Genes

    doi: 10.1038/mt.2009.207

    Figure Lengend Snippet: Inhibition of metastatic tumor growth in bone tissues by the atelocollagen-mediated miRNA treatment. Mice were injected with 2 × 10 6 PC-3M-luc-C6 cells into the left heart ventricle on day zero. The miR-16 and NC miRNA (50 µg)

    Article Snippet: For preparation of RNA samples, PC-3M-luc cells were reverse transfected in quadruplicate by complexing miR-16 and NC miRNA and NeoFX transfection reagent (Ambion).

    Techniques: Inhibition, Mouse Assay, Injection

    Genome and transduction efficiency of vectors with heterologous ITR2 and ITR5. ( A ) Alkaline Southern blot analysis of DNA extracted from 3 × 10 10 GC of both 5′- and 3′- ABCA4 -half vectors with either homologous (2:2) or heterologous (5:2 or 2:5) ITR, and of a control AAV preparation with homologous ITR2 (CTRL). The expected size of each genome is depicted below each lane. The molecular weight marker (kb) is depicted on the left 5′: 5′-half vector; 3′: 3′-half vector. ( B – D ) Representative Western blot analysis and quantification of HEK293 cells infected with dual AAV2/2 hybrid ABCA4 vectors with either heterologous ITR2 and ITR5 or homologous ITR2 at m.o.i. based on either the ITR2 (B and C) or the transgene (B and D) titre. The Western blot images (B) are representative of n = 3 independent experiments; the quantifications (C and D) are from n = 3 independent experiments. (B) The upper arrow indicates full-length ABCA4 protein, the lower arrow indicates truncated proteins; the molecular weight ladder is depicted on the left. The micrograms of proteins loaded are depicted below the image. α-3×flag: Western blot with anti-3×flag antibodies; α-Filamin A: Western blot with anti-Filamin A antibodies, used as loading control. (C and D) Quantification of full-length and truncated ABCA4 protein bands from Western blot analysis of cells infected with a dose of vector based on either the ITR2 (C) or the transgene (D) titre. The histograms show either the intensity of the full-length and truncated protein bands divided by that of the Filamin A bands or the intensity of the full-length protein bands divided by that of the truncated protein bands in the corresponding lane. The mean value is depicted above the corresponding bar. Values are represented as: mean ± s.e.m. * p Student's t -test ≤ 0.05. More details on the statistical analysis including specific statistical values can be found in the Statistical analysis paragraph of the Materials and Methods section. 2:2 2:2: cells infected with dual AAV hybrid ABCA4 vectors with homologous ITR from AAV2; 5:2 2:5: cells infected with dual AAV hybrid ABCA4 vectors with heterologous ITR from AAV2 and AAV5; neg: cells infected with EGFP -expressing vectors, as negative controls.

    Journal: Human Molecular Genetics

    Article Title: Improved dual AAV vectors with reduced expression of truncated proteins are safe and effective in the retina of a mouse model of Stargardt disease

    doi: 10.1093/hmg/ddv386

    Figure Lengend Snippet: Genome and transduction efficiency of vectors with heterologous ITR2 and ITR5. ( A ) Alkaline Southern blot analysis of DNA extracted from 3 × 10 10 GC of both 5′- and 3′- ABCA4 -half vectors with either homologous (2:2) or heterologous (5:2 or 2:5) ITR, and of a control AAV preparation with homologous ITR2 (CTRL). The expected size of each genome is depicted below each lane. The molecular weight marker (kb) is depicted on the left 5′: 5′-half vector; 3′: 3′-half vector. ( B – D ) Representative Western blot analysis and quantification of HEK293 cells infected with dual AAV2/2 hybrid ABCA4 vectors with either heterologous ITR2 and ITR5 or homologous ITR2 at m.o.i. based on either the ITR2 (B and C) or the transgene (B and D) titre. The Western blot images (B) are representative of n = 3 independent experiments; the quantifications (C and D) are from n = 3 independent experiments. (B) The upper arrow indicates full-length ABCA4 protein, the lower arrow indicates truncated proteins; the molecular weight ladder is depicted on the left. The micrograms of proteins loaded are depicted below the image. α-3×flag: Western blot with anti-3×flag antibodies; α-Filamin A: Western blot with anti-Filamin A antibodies, used as loading control. (C and D) Quantification of full-length and truncated ABCA4 protein bands from Western blot analysis of cells infected with a dose of vector based on either the ITR2 (C) or the transgene (D) titre. The histograms show either the intensity of the full-length and truncated protein bands divided by that of the Filamin A bands or the intensity of the full-length protein bands divided by that of the truncated protein bands in the corresponding lane. The mean value is depicted above the corresponding bar. Values are represented as: mean ± s.e.m. * p Student's t -test ≤ 0.05. More details on the statistical analysis including specific statistical values can be found in the Statistical analysis paragraph of the Materials and Methods section. 2:2 2:2: cells infected with dual AAV hybrid ABCA4 vectors with homologous ITR from AAV2; 5:2 2:5: cells infected with dual AAV hybrid ABCA4 vectors with heterologous ITR from AAV2 and AAV5; neg: cells infected with EGFP -expressing vectors, as negative controls.

    Article Snippet: Since miR-let7b, miR-26a, miR-204 and miR-124 are poorly expressed or completely absent in HEK293 cells [Ambion miRNA Research Guide and ( )], to test silencing of the constructs which contain their corresponding target sites, we transfected cells with miR mimics [i.e. small, chemically modified double-stranded RNAs that mimic endogenous miR ( )], prior to infection with the AAV2/2 vectors containing the corresponding target sites.

    Techniques: Transduction, Alkaline Southern Blotting, Molecular Weight, Marker, Plasmid Preparation, Western Blot, Infection, Expressing

    Efficient ABCA4 protein expression using the AK, AP1 and AP2 regions of homology. Representative Western blot analysis of ( A ) HEK293 cells (50 micrograms/lane) infected with dual AAV2/2 hybrid CMV- ABCA4 vectors or ( C ) C57BL/6 retinas (whole retinal lysates) 1-month post-injection with dual AAV2/8 hybrid GRK1- ABCA4 vectors (dose of each vector/eye: 1.9 × 10 9 GC). The upper arrow indicates full-length proteins, the lower arrow indicates truncated proteins from the 3′-half vector. Since no truncated proteins can be detected in the mouse retina ( 10 ), the lower arrow in (C) points to the level of truncated proteins present in a lysate of infected cells which has been loaded on the same gel as positive control. The molecular weight ladder is depicted on the left. ( B ) Quantification of ABCA4 protein bands from Western blot analysis in (A). The intensity of the ABCA4 bands in (A) was divided by the intensity of the Filamin A bands. The histograms show the expression of proteins as a percentage relative to dual AAV hybrid AK vectors, the mean value is depicted above the corresponding bar. Values are represented as: mean ± s.e.m. * p ANOVA ≤ 0.05, the asterisk indicates significant differences with AK. ** p ANOVA

    Journal: Human Molecular Genetics

    Article Title: Improved dual AAV vectors with reduced expression of truncated proteins are safe and effective in the retina of a mouse model of Stargardt disease

    doi: 10.1093/hmg/ddv386

    Figure Lengend Snippet: Efficient ABCA4 protein expression using the AK, AP1 and AP2 regions of homology. Representative Western blot analysis of ( A ) HEK293 cells (50 micrograms/lane) infected with dual AAV2/2 hybrid CMV- ABCA4 vectors or ( C ) C57BL/6 retinas (whole retinal lysates) 1-month post-injection with dual AAV2/8 hybrid GRK1- ABCA4 vectors (dose of each vector/eye: 1.9 × 10 9 GC). The upper arrow indicates full-length proteins, the lower arrow indicates truncated proteins from the 3′-half vector. Since no truncated proteins can be detected in the mouse retina ( 10 ), the lower arrow in (C) points to the level of truncated proteins present in a lysate of infected cells which has been loaded on the same gel as positive control. The molecular weight ladder is depicted on the left. ( B ) Quantification of ABCA4 protein bands from Western blot analysis in (A). The intensity of the ABCA4 bands in (A) was divided by the intensity of the Filamin A bands. The histograms show the expression of proteins as a percentage relative to dual AAV hybrid AK vectors, the mean value is depicted above the corresponding bar. Values are represented as: mean ± s.e.m. * p ANOVA ≤ 0.05, the asterisk indicates significant differences with AK. ** p ANOVA

    Article Snippet: Since miR-let7b, miR-26a, miR-204 and miR-124 are poorly expressed or completely absent in HEK293 cells [Ambion miRNA Research Guide and ( )], to test silencing of the constructs which contain their corresponding target sites, we transfected cells with miR mimics [i.e. small, chemically modified double-stranded RNAs that mimic endogenous miR ( )], prior to infection with the AAV2/2 vectors containing the corresponding target sites.

    Techniques: Expressing, Western Blot, Infection, Injection, Plasmid Preparation, Positive Control, Molecular Weight

    Inclusion of the CL1 degradation signal but not of miR target sites in the 5′-half vectors results in significant reduction of truncated proteins. ( A ) Representative Western blot analysis of HEK293 cells infected with dual AAV2/2 hybrid vectors encoding for ABCA4 , containing miR target sites for either miR-let7b (4×, left panel), miR-204 + 124 (3×, central panel) or miR-26a (4×, right panel). 5′ + 3′: cells co-infected with 5′-half vectors without miR target sites and 3′-half vectors; 5′mir + 3′: cells co-infected with 5′-half vectors containing miR target sites and 3′-half vectors; neg: control cells infected with the 3′-half vectors; +scramble : cells infected in the presence of scramble miR mimics; +mimic let7b : cells infected in the presence of miR-let7b mimics; +mimic 204+124 : cells infected in the presence of miR-204 and -124 mimics; +mimic 26a : cells infected in the presence of miR-26a mimics. ( B and C ) Representative Western blot analysis of either HEK293 cells infected with dual AAV2/2 hybrid vectors (B) or pig eyes (c; RPE+retina) 1-month post-injection of dual AAV2/8 hybrid vectors encoding for ABCA4 and containing or not the CL1 degradation signal. 5′ + 3′: cells co-infected or eyes co-injected with 5′-half vectors without CL1 and 3′-half vectors; 5′-CL1 + 3′: cells co-infected or eyes co-injected with 5′-half vectors containing CL1 and 3′-half vectors; 5′: cells infected with 5′-half vectors without CL1; 5′-CL1: cells infected with 5′-half vectors containing CL1; neg: control cells infected or control eyes injected with either the 3′-half vectors or EGFP -expressing vectors, as negative controls. (A–C) The upper arrows indicate full-length ABCA4 proteins, the lower arrows indicate truncated proteins; the molecular weight ladder is depicted on the left. The micrograms of proteins loaded are depicted below the image. α-3×flag: Western blot with anti-3×flag antibodies; α-Filamin A: Western blot with anti-Filamin A antibodies, used as loading control; α-Dysferlin: Western blot with anti-Dysferlin antibodies, used as loading control. (A and B) The Western blot images are representative of n = 3 independent experiments. (C) The Western blot image is representative of n = 5 eyes injected with 5′ + 3′ vectors, n = 2 eyes injected with 5′-CL1 + 3′ vectors and n = 5 of eyes injected with either the 3′-half vectors or EGFP -expressing vectors as negative controls.

    Journal: Human Molecular Genetics

    Article Title: Improved dual AAV vectors with reduced expression of truncated proteins are safe and effective in the retina of a mouse model of Stargardt disease

    doi: 10.1093/hmg/ddv386

    Figure Lengend Snippet: Inclusion of the CL1 degradation signal but not of miR target sites in the 5′-half vectors results in significant reduction of truncated proteins. ( A ) Representative Western blot analysis of HEK293 cells infected with dual AAV2/2 hybrid vectors encoding for ABCA4 , containing miR target sites for either miR-let7b (4×, left panel), miR-204 + 124 (3×, central panel) or miR-26a (4×, right panel). 5′ + 3′: cells co-infected with 5′-half vectors without miR target sites and 3′-half vectors; 5′mir + 3′: cells co-infected with 5′-half vectors containing miR target sites and 3′-half vectors; neg: control cells infected with the 3′-half vectors; +scramble : cells infected in the presence of scramble miR mimics; +mimic let7b : cells infected in the presence of miR-let7b mimics; +mimic 204+124 : cells infected in the presence of miR-204 and -124 mimics; +mimic 26a : cells infected in the presence of miR-26a mimics. ( B and C ) Representative Western blot analysis of either HEK293 cells infected with dual AAV2/2 hybrid vectors (B) or pig eyes (c; RPE+retina) 1-month post-injection of dual AAV2/8 hybrid vectors encoding for ABCA4 and containing or not the CL1 degradation signal. 5′ + 3′: cells co-infected or eyes co-injected with 5′-half vectors without CL1 and 3′-half vectors; 5′-CL1 + 3′: cells co-infected or eyes co-injected with 5′-half vectors containing CL1 and 3′-half vectors; 5′: cells infected with 5′-half vectors without CL1; 5′-CL1: cells infected with 5′-half vectors containing CL1; neg: control cells infected or control eyes injected with either the 3′-half vectors or EGFP -expressing vectors, as negative controls. (A–C) The upper arrows indicate full-length ABCA4 proteins, the lower arrows indicate truncated proteins; the molecular weight ladder is depicted on the left. The micrograms of proteins loaded are depicted below the image. α-3×flag: Western blot with anti-3×flag antibodies; α-Filamin A: Western blot with anti-Filamin A antibodies, used as loading control; α-Dysferlin: Western blot with anti-Dysferlin antibodies, used as loading control. (A and B) The Western blot images are representative of n = 3 independent experiments. (C) The Western blot image is representative of n = 5 eyes injected with 5′ + 3′ vectors, n = 2 eyes injected with 5′-CL1 + 3′ vectors and n = 5 of eyes injected with either the 3′-half vectors or EGFP -expressing vectors as negative controls.

    Article Snippet: Since miR-let7b, miR-26a, miR-204 and miR-124 are poorly expressed or completely absent in HEK293 cells [Ambion miRNA Research Guide and ( )], to test silencing of the constructs which contain their corresponding target sites, we transfected cells with miR mimics [i.e. small, chemically modified double-stranded RNAs that mimic endogenous miR ( )], prior to infection with the AAV2/2 vectors containing the corresponding target sites.

    Techniques: Western Blot, Infection, Injection, Expressing, Molecular Weight

    Generation of miR-205-NPs formulations ( A ) Preparative approach and hypothetical structure of miR-205 nanoformulations. PEI-PEG: gray line belongs to PEI and dotted greens belong to PEG. miR-205 binds to PEI. ( B – C ) Nanocomplexation assessment with miR-205. Fluorescence-based quenching study of fluorescein amidite (FAM)-labeled miRNA mimic MNP and MNP-MPEI-PEG (MPEI-PEG) nanoparticles. Note: MNP alone is also able to bind smaller amounts of miR-205, due to physical deposition on the nanoparticles but not due to binding. ( D ) Determination of nanocomplexation of miR-205 with MNP and MPEI-PEG through agarose gel electrophoresis. Data represent that 5 µg of nanocarrier is sufficient to hold 1 µg of miR-205 for delivery applications. ( E ) Evaluation of miR-205 binding with MNP and MPEI-PEG nanoparticles by circular dichroism (CD) spectral analysis.

    Journal: Cancers

    Article Title: miRNA-205 Nanoformulation Sensitizes Prostate Cancer Cells to Chemotherapy

    doi: 10.3390/cancers10090289

    Figure Lengend Snippet: Generation of miR-205-NPs formulations ( A ) Preparative approach and hypothetical structure of miR-205 nanoformulations. PEI-PEG: gray line belongs to PEI and dotted greens belong to PEG. miR-205 binds to PEI. ( B – C ) Nanocomplexation assessment with miR-205. Fluorescence-based quenching study of fluorescein amidite (FAM)-labeled miRNA mimic MNP and MNP-MPEI-PEG (MPEI-PEG) nanoparticles. Note: MNP alone is also able to bind smaller amounts of miR-205, due to physical deposition on the nanoparticles but not due to binding. ( D ) Determination of nanocomplexation of miR-205 with MNP and MPEI-PEG through agarose gel electrophoresis. Data represent that 5 µg of nanocarrier is sufficient to hold 1 µg of miR-205 for delivery applications. ( E ) Evaluation of miR-205 binding with MNP and MPEI-PEG nanoparticles by circular dichroism (CD) spectral analysis.

    Article Snippet: The complexation or binding profile of miR-205 mimic (Mature miRNA Sequence: UCCUUCAUUCCACCGGAGUCUG, Thermo Fisher, referred to as miR-205 throughout this work) with developed nanoparticles (MNPs and MPEI-PEG NPs) was evaluated using gel retardation, fluorescence quenching, and circular dichroism assays.

    Techniques: Fluorescence, Labeling, Binding Assay, Agarose Gel Electrophoresis

    Cellular fate of miR-205-NPs formulation. ( A ) Cellular uptake of coumarin 6-labeled MPEI-PEG nanoformulation. Representative cellular internalized nanoparticles images were captured at 40× magnification using confocal microscopy. Green color arise from coumarin 6 in MPEI-PEG. Scale bar: 50 µm. ( B ) Quantitative measurement of FAM-miRNA mimic in cells treated with FAM-labeled miR-MPEI-PEG formulation. ( C ) Restoration of miR-205 through miR-205-NPs in PrCa cells. q-PCR gene expression studies reveals that treatments with miR-205-NPs reconstitutes the gene expression of miR-205. ( D ) miR-205-NPs influence cell growth in PrCa cells. Proliferation assays after miR-205 and miR-205-NPs transfection treatments in C4-2 and PC-3 cell lines using 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assays. The significance level was * p

    Journal: Cancers

    Article Title: miRNA-205 Nanoformulation Sensitizes Prostate Cancer Cells to Chemotherapy

    doi: 10.3390/cancers10090289

    Figure Lengend Snippet: Cellular fate of miR-205-NPs formulation. ( A ) Cellular uptake of coumarin 6-labeled MPEI-PEG nanoformulation. Representative cellular internalized nanoparticles images were captured at 40× magnification using confocal microscopy. Green color arise from coumarin 6 in MPEI-PEG. Scale bar: 50 µm. ( B ) Quantitative measurement of FAM-miRNA mimic in cells treated with FAM-labeled miR-MPEI-PEG formulation. ( C ) Restoration of miR-205 through miR-205-NPs in PrCa cells. q-PCR gene expression studies reveals that treatments with miR-205-NPs reconstitutes the gene expression of miR-205. ( D ) miR-205-NPs influence cell growth in PrCa cells. Proliferation assays after miR-205 and miR-205-NPs transfection treatments in C4-2 and PC-3 cell lines using 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assays. The significance level was * p

    Article Snippet: The complexation or binding profile of miR-205 mimic (Mature miRNA Sequence: UCCUUCAUUCCACCGGAGUCUG, Thermo Fisher, referred to as miR-205 throughout this work) with developed nanoparticles (MNPs and MPEI-PEG NPs) was evaluated using gel retardation, fluorescence quenching, and circular dichroism assays.

    Techniques: Labeling, Confocal Microscopy, Polymerase Chain Reaction, Expressing, Transfection

    miR-205 delivery characteristics of miR-205-NPs. ( A , B ) Hemolytic activity of MNP-PEI-PEG nanocarrier. Brightfield microscopy at 20× magnification was employed for capturing hemolytic characteristic of human red blood cells. Scale bar: 50 µm. Note: NPs are not toxic but lipofectamine is at the tested concentrations. Data indicate that nanocarrier is hemocompatible, unlike lipofectamine. ( C ) Dissociation studies of miR-205 in presence of poly(anion) (heparin). ( D ) miRNA-205 stability in the presence of 0–50% Fetal Bovine Serum (FBS) concentration. Equal amount of each sample was incubated with 10 μL of FBS at 37 °C for 24 h prior to gel electrophoresis. Note: “No NPs” lane did not show any band due to the absence of miRNA. ( E ) FAM-miRNA release profile from the FAM-miR through fluorescence spectral analysis at variable pH solutions (7.4, 6.5 and 3.5). The significance level was * p

    Journal: Cancers

    Article Title: miRNA-205 Nanoformulation Sensitizes Prostate Cancer Cells to Chemotherapy

    doi: 10.3390/cancers10090289

    Figure Lengend Snippet: miR-205 delivery characteristics of miR-205-NPs. ( A , B ) Hemolytic activity of MNP-PEI-PEG nanocarrier. Brightfield microscopy at 20× magnification was employed for capturing hemolytic characteristic of human red blood cells. Scale bar: 50 µm. Note: NPs are not toxic but lipofectamine is at the tested concentrations. Data indicate that nanocarrier is hemocompatible, unlike lipofectamine. ( C ) Dissociation studies of miR-205 in presence of poly(anion) (heparin). ( D ) miRNA-205 stability in the presence of 0–50% Fetal Bovine Serum (FBS) concentration. Equal amount of each sample was incubated with 10 μL of FBS at 37 °C for 24 h prior to gel electrophoresis. Note: “No NPs” lane did not show any band due to the absence of miRNA. ( E ) FAM-miRNA release profile from the FAM-miR through fluorescence spectral analysis at variable pH solutions (7.4, 6.5 and 3.5). The significance level was * p

    Article Snippet: The complexation or binding profile of miR-205 mimic (Mature miRNA Sequence: UCCUUCAUUCCACCGGAGUCUG, Thermo Fisher, referred to as miR-205 throughout this work) with developed nanoparticles (MNPs and MPEI-PEG NPs) was evaluated using gel retardation, fluorescence quenching, and circular dichroism assays.

    Techniques: Activity Assay, Microscopy, Concentration Assay, Incubation, Nucleic Acid Electrophoresis, Fluorescence

    Verification of miR-19a candidate target genes by luciferase assays. (A) Overview of miR-19a target candidate mRNAs. The miR-19a–binding sites identified using PicTar, TargetScan, or MiRanda software are shown in the 3ʹ-untranslated (UTR) region of miR-19a target candidate mRNAs. (B) Construction of luciferase vectors. The miR-19a–binding sites of the candidate genes and negative control sequences (Negative Ctrl) were cloned downstream of the luciferase ORF at the Xba I restriction site of the pTK-hRG vector. Sense ( upper ) and antisense ( lower ) strands of complementary sequences indicate the miRNA target site of the mRNA 3ʹ-UTR and miR-19a sequences, respectively. Underlines indicate miR-19a seed sequences. The negative control plasmid has mismatches in the center of miR-19a seed sequences. (C) The luciferase activity of constructs with miR-19a–binding sites was compared with that of the empty vector, which had no insert at the Xba I site (No-Insert Ctrl), and was statistically analyzed. (D) Luciferase plasmids with the miR-19a–binding site and negative control plasmid were transfected with anti-miR-19a-LNA or control-LNA (Ctrl). The luciferase activity of cells treated with anti-miR-19a-LNA was compared with that of cells treated with the control-LNA. *, p

    Journal: PLoS ONE

    Article Title: Uncovering Direct Targets of MiR-19a Involved in Lung Cancer Progression

    doi: 10.1371/journal.pone.0137887

    Figure Lengend Snippet: Verification of miR-19a candidate target genes by luciferase assays. (A) Overview of miR-19a target candidate mRNAs. The miR-19a–binding sites identified using PicTar, TargetScan, or MiRanda software are shown in the 3ʹ-untranslated (UTR) region of miR-19a target candidate mRNAs. (B) Construction of luciferase vectors. The miR-19a–binding sites of the candidate genes and negative control sequences (Negative Ctrl) were cloned downstream of the luciferase ORF at the Xba I restriction site of the pTK-hRG vector. Sense ( upper ) and antisense ( lower ) strands of complementary sequences indicate the miRNA target site of the mRNA 3ʹ-UTR and miR-19a sequences, respectively. Underlines indicate miR-19a seed sequences. The negative control plasmid has mismatches in the center of miR-19a seed sequences. (C) The luciferase activity of constructs with miR-19a–binding sites was compared with that of the empty vector, which had no insert at the Xba I site (No-Insert Ctrl), and was statistically analyzed. (D) Luciferase plasmids with the miR-19a–binding site and negative control plasmid were transfected with anti-miR-19a-LNA or control-LNA (Ctrl). The luciferase activity of cells treated with anti-miR-19a-LNA was compared with that of cells treated with the control-LNA. *, p

    Article Snippet: The cDNA of the biotin–miRNA/mRNA complex was amplified by PCR in a 20-μL volume containing 0.2 μL of each reverse transcription reaction and 10 μL of the TaqMan 2× Universal PCR Master Mix (Life Technologies) in a 7300 Fast Real-Time PCR System (40 cycles of 95°C for 15 s and 58°C for 5 min).

    Techniques: Luciferase, Binding Assay, Software, Negative Control, Clone Assay, Plasmid Preparation, Activity Assay, Construct, Transfection

    Pull-down assay using biotinylated miRNA. (A) Overview of the in vitro pull-down assay. The biotinylated double-stranded miR-19a or control random RNA was incubated in cell extract (step 1) to yield a complex of the biotinylated miRNA single strand with target mRNA and RISC (step 2). The biotinylated miRNA/target mRNA complex was incubated with streptavidin beads and pulled down (step 3). The complex was treated by DNase I and reverse-transcribed (step 4). (B) The expression of miR-19a target candidate mRNAs in HEK293 cells. PTEN , known as one of miR-19a target genes, was used as a positive control. The gene, whose sequence did not match with miR-19a seed sequences, was used as the negative control. (C) Confirmation of AGO2 protein in biotinylated miRNA/target mRNA complex by western blotting with the AGO2 antibody. Biotinylated miR-19a (lane 1), biotinylated control random RNA (lane 2), and biotin (lane 3) were used for the pull-down assay and subjected to SDS-polyacrylamide gel electrophoresis and western blotting. Total cell extract was used as the positive control (lane 4). (D) Detection of target mRNAs in biotinylated miRNA/target mRNA complex by real-time RT-PCR. The relative level of each target mRNA in the complex pulled down by using biotinylated miR-19a was compared to that of the complex pulled down by using the biotinylated control random RNA. **, p

    Journal: PLoS ONE

    Article Title: Uncovering Direct Targets of MiR-19a Involved in Lung Cancer Progression

    doi: 10.1371/journal.pone.0137887

    Figure Lengend Snippet: Pull-down assay using biotinylated miRNA. (A) Overview of the in vitro pull-down assay. The biotinylated double-stranded miR-19a or control random RNA was incubated in cell extract (step 1) to yield a complex of the biotinylated miRNA single strand with target mRNA and RISC (step 2). The biotinylated miRNA/target mRNA complex was incubated with streptavidin beads and pulled down (step 3). The complex was treated by DNase I and reverse-transcribed (step 4). (B) The expression of miR-19a target candidate mRNAs in HEK293 cells. PTEN , known as one of miR-19a target genes, was used as a positive control. The gene, whose sequence did not match with miR-19a seed sequences, was used as the negative control. (C) Confirmation of AGO2 protein in biotinylated miRNA/target mRNA complex by western blotting with the AGO2 antibody. Biotinylated miR-19a (lane 1), biotinylated control random RNA (lane 2), and biotin (lane 3) were used for the pull-down assay and subjected to SDS-polyacrylamide gel electrophoresis and western blotting. Total cell extract was used as the positive control (lane 4). (D) Detection of target mRNAs in biotinylated miRNA/target mRNA complex by real-time RT-PCR. The relative level of each target mRNA in the complex pulled down by using biotinylated miR-19a was compared to that of the complex pulled down by using the biotinylated control random RNA. **, p

    Article Snippet: The cDNA of the biotin–miRNA/mRNA complex was amplified by PCR in a 20-μL volume containing 0.2 μL of each reverse transcription reaction and 10 μL of the TaqMan 2× Universal PCR Master Mix (Life Technologies) in a 7300 Fast Real-Time PCR System (40 cycles of 95°C for 15 s and 58°C for 5 min).

    Techniques: Pull Down Assay, In Vitro, Incubation, Expressing, Positive Control, Sequencing, Negative Control, Western Blot, Polyacrylamide Gel Electrophoresis, Quantitative RT-PCR

    Exiqon miRNA microarray confirms 8 Rapamycin-dependent miRNA. 621-101 cells were treated with Rapamycin 20 nM or DMSO for 24 hours. Total RNA was isolated and applied to the Exiqon platform, which assays 946 human miRNA. A ) Heat map of miRNA dysregulated by Rapamycin > 1.5-fold, log 2 scale. RNA from three biologic replicates per condition was pooled; each miRNA was assayed in quadruplet on the array. B ) miRNA dysregulated by Rapamycin > 1.5-fold (normalized to RNU44). Highlighted miRNA (except miR-31 and 210) are common to both the Exiqon and Signosis platforms. miR-21 is circled.

    Journal: PLoS ONE

    Article Title: MicroRNA-21 is Induced by Rapamycin in a Model of Tuberous Sclerosis (TSC) and Lymphangioleiomyomatosis (LAM)

    doi: 10.1371/journal.pone.0060014

    Figure Lengend Snippet: Exiqon miRNA microarray confirms 8 Rapamycin-dependent miRNA. 621-101 cells were treated with Rapamycin 20 nM or DMSO for 24 hours. Total RNA was isolated and applied to the Exiqon platform, which assays 946 human miRNA. A ) Heat map of miRNA dysregulated by Rapamycin > 1.5-fold, log 2 scale. RNA from three biologic replicates per condition was pooled; each miRNA was assayed in quadruplet on the array. B ) miRNA dysregulated by Rapamycin > 1.5-fold (normalized to RNU44). Highlighted miRNA (except miR-31 and 210) are common to both the Exiqon and Signosis platforms. miR-21 is circled.

    Article Snippet: For miRNA quantification RNA was reverse-transcribed using a Taq- ManTM microRNA reverse transcription kit, and subjected to real-time PCR using TaqManTM microRNA assay kits (Applied Biosystems).

    Techniques: Microarray, Isolation

    The effects of pre-miR-19b and pre-miR-218 overexpression on ( A ) AAT mRNA and ( B ) AAT protein expression in THP-1, 16HBE14o− and HepG2. Cells (1 × 10 5 in triplicate) were transfected with 30 nM negative control pre-miR (control pre-miR) or synthetic pre-miRs as indicated. Twenty-four hours post-transfection RNA was isolated and used in qRT-PCR reactions with AAT and GAPDH primers. Relative AAT mRNA expression for each cell type was quantified using the 2 −ΔΔCt method. Thereafter, 24 and 48 h culture supernatants were assayed by ELISA to quantify AAT protein expression. Data presented in y -logarithmic axis for B. Assays were performed in triplicate ( n = 3). Data were compared by t -test for negative control pre-miR versus pre-miRs.

    Journal: Nucleic Acids Research

    Article Title: Isolation and identification of cell-specific microRNAs targeting a messenger RNA using a biotinylated anti-sense oligonucleotide capture affinity technique

    doi: 10.1093/nar/gks1466

    Figure Lengend Snippet: The effects of pre-miR-19b and pre-miR-218 overexpression on ( A ) AAT mRNA and ( B ) AAT protein expression in THP-1, 16HBE14o− and HepG2. Cells (1 × 10 5 in triplicate) were transfected with 30 nM negative control pre-miR (control pre-miR) or synthetic pre-miRs as indicated. Twenty-four hours post-transfection RNA was isolated and used in qRT-PCR reactions with AAT and GAPDH primers. Relative AAT mRNA expression for each cell type was quantified using the 2 −ΔΔCt method. Thereafter, 24 and 48 h culture supernatants were assayed by ELISA to quantify AAT protein expression. Data presented in y -logarithmic axis for B. Assays were performed in triplicate ( n = 3). Data were compared by t -test for negative control pre-miR versus pre-miRs.

    Article Snippet: The beads were washed twice using washing buffer [10 mM Tris–HCl (pH 7.5), 1 mM EDTA, 0.15 mM LiCl] and AAT mRNA:miRNA complexes were captured using a Dynal magnet.

    Techniques: Over Expression, Expressing, Transfection, Negative Control, Isolation, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

    Effects of pre-miR-455-3p, pre-miR-328, pre-miR-769-5p and pre-miR-296-5p overexpression on AAT mRNA ( top ) and protein ( below ) expression in ( A ) THP-1, ( B ) 16HBE14o− and ( C ) HepG2. Cells (1 × 10 5 in triplicate) were left untreated (no pre-miR) or transfected with 30 nM negative control pre-miR (control pre-miR) or synthetic pre-miRs as indicated. 24 h post-transfection RNA was isolated and used in qRT-PCR reactions with AAT and GAPDH primers. Relative AAT mRNA expression was quantified using the 2 −ΔΔCt method. Thereafter, 24 and 48 h culture supernatants were pooled and assayed by ELISA to quantify AAT protein expression. Assays were performed in triplicate ( n = 3). Data were compared by t -test for negative control pre-miR versus pre-miRs. Note, miR-455-3p was detected in all AAT mRNA-specific miRNAs assays, whereas miR-328, miR-769-5p and miR-296-5p were detected in THP-1, 16HBE14o− and HepG2 cells, respectively.

    Journal: Nucleic Acids Research

    Article Title: Isolation and identification of cell-specific microRNAs targeting a messenger RNA using a biotinylated anti-sense oligonucleotide capture affinity technique

    doi: 10.1093/nar/gks1466

    Figure Lengend Snippet: Effects of pre-miR-455-3p, pre-miR-328, pre-miR-769-5p and pre-miR-296-5p overexpression on AAT mRNA ( top ) and protein ( below ) expression in ( A ) THP-1, ( B ) 16HBE14o− and ( C ) HepG2. Cells (1 × 10 5 in triplicate) were left untreated (no pre-miR) or transfected with 30 nM negative control pre-miR (control pre-miR) or synthetic pre-miRs as indicated. 24 h post-transfection RNA was isolated and used in qRT-PCR reactions with AAT and GAPDH primers. Relative AAT mRNA expression was quantified using the 2 −ΔΔCt method. Thereafter, 24 and 48 h culture supernatants were pooled and assayed by ELISA to quantify AAT protein expression. Assays were performed in triplicate ( n = 3). Data were compared by t -test for negative control pre-miR versus pre-miRs. Note, miR-455-3p was detected in all AAT mRNA-specific miRNAs assays, whereas miR-328, miR-769-5p and miR-296-5p were detected in THP-1, 16HBE14o− and HepG2 cells, respectively.

    Article Snippet: The beads were washed twice using washing buffer [10 mM Tris–HCl (pH 7.5), 1 mM EDTA, 0.15 mM LiCl] and AAT mRNA:miRNA complexes were captured using a Dynal magnet.

    Techniques: Over Expression, Expressing, Transfection, Negative Control, Isolation, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

    miRNA expression profiling and testing of AAT mRNA- and cell-specific miRNAs. ( A ) Relative miRNA expression in AAT mRNA captured samples was quantified using the 2 −ΔΔCt method. Assays were performed in triplicate ( n = 3). ( B ) Numbers of miRNAs interacting with AAT mRNA in THP-1, 16HBE14o− and HepG2 cells using NanoString Technologies miRNA Expression Kit. ( C ) Relative luciferase activity was measured in HEK293 cells (1 × 10 5 in triplicate) transiently transfected with pMIR-AAT-3′UTR and pRLSV40 and co-transfected with synthetic pre-miRs as indicated. Firefly luciferase activity was normalized to the Renilla luciferase activity. Data are represented as mean ± SEM and were compared by t -test for negative control pre-miR versus pre-miR; data are representative of three experiments.

    Journal: Nucleic Acids Research

    Article Title: Isolation and identification of cell-specific microRNAs targeting a messenger RNA using a biotinylated anti-sense oligonucleotide capture affinity technique

    doi: 10.1093/nar/gks1466

    Figure Lengend Snippet: miRNA expression profiling and testing of AAT mRNA- and cell-specific miRNAs. ( A ) Relative miRNA expression in AAT mRNA captured samples was quantified using the 2 −ΔΔCt method. Assays were performed in triplicate ( n = 3). ( B ) Numbers of miRNAs interacting with AAT mRNA in THP-1, 16HBE14o− and HepG2 cells using NanoString Technologies miRNA Expression Kit. ( C ) Relative luciferase activity was measured in HEK293 cells (1 × 10 5 in triplicate) transiently transfected with pMIR-AAT-3′UTR and pRLSV40 and co-transfected with synthetic pre-miRs as indicated. Firefly luciferase activity was normalized to the Renilla luciferase activity. Data are represented as mean ± SEM and were compared by t -test for negative control pre-miR versus pre-miR; data are representative of three experiments.

    Article Snippet: The beads were washed twice using washing buffer [10 mM Tris–HCl (pH 7.5), 1 mM EDTA, 0.15 mM LiCl] and AAT mRNA:miRNA complexes were captured using a Dynal magnet.

    Techniques: Expressing, Luciferase, Activity Assay, Transfection, Negative Control

    mRNA:miRNA isolation technique for ( A ) SLPI mRNA and ( B ) IL-8 mRNA from THP-1 cells. In all, 30-mer probes were designed to capture (i) a predicted single-stranded loop present in the SLPI mRNA and a predicted double-stranded sequence in the IL-8 mRNA (capture performed in three independent samples). qRT-PCR showed enrichment of (ii) SLPI and IL-8 mRNAs where expression of each transcript was normalized to the respective baseline expression in cell lysates using the 2 −ΔΔCt method. Taqman assays showed enrichment of (iii), miR-19a/miR-19b and let-7b/miR-23b, but not of miR-16 in samples captured with transcript-specific capture or mismatch oligonucleotides. mRNA and miRNA expression were quantified using the 2 −ΔΔCt method.

    Journal: Nucleic Acids Research

    Article Title: Isolation and identification of cell-specific microRNAs targeting a messenger RNA using a biotinylated anti-sense oligonucleotide capture affinity technique

    doi: 10.1093/nar/gks1466

    Figure Lengend Snippet: mRNA:miRNA isolation technique for ( A ) SLPI mRNA and ( B ) IL-8 mRNA from THP-1 cells. In all, 30-mer probes were designed to capture (i) a predicted single-stranded loop present in the SLPI mRNA and a predicted double-stranded sequence in the IL-8 mRNA (capture performed in three independent samples). qRT-PCR showed enrichment of (ii) SLPI and IL-8 mRNAs where expression of each transcript was normalized to the respective baseline expression in cell lysates using the 2 −ΔΔCt method. Taqman assays showed enrichment of (iii), miR-19a/miR-19b and let-7b/miR-23b, but not of miR-16 in samples captured with transcript-specific capture or mismatch oligonucleotides. mRNA and miRNA expression were quantified using the 2 −ΔΔCt method.

    Article Snippet: The beads were washed twice using washing buffer [10 mM Tris–HCl (pH 7.5), 1 mM EDTA, 0.15 mM LiCl] and AAT mRNA:miRNA complexes were captured using a Dynal magnet.

    Techniques: Isolation, Sequencing, Quantitative RT-PCR, Expressing

    Design of AAT mRNA capture oligonucleotide. (1) Proposed secondary structure of AAT transcript variant 1 using M-fold, (2) an exposed single-stranded region (ss) located between bases 2283 and 2304 of transcript variant 1 is present in all variants, (3) sequence of DNA capture oligonucleotide.

    Journal: Nucleic Acids Research

    Article Title: Isolation and identification of cell-specific microRNAs targeting a messenger RNA using a biotinylated anti-sense oligonucleotide capture affinity technique

    doi: 10.1093/nar/gks1466

    Figure Lengend Snippet: Design of AAT mRNA capture oligonucleotide. (1) Proposed secondary structure of AAT transcript variant 1 using M-fold, (2) an exposed single-stranded region (ss) located between bases 2283 and 2304 of transcript variant 1 is present in all variants, (3) sequence of DNA capture oligonucleotide.

    Article Snippet: The beads were washed twice using washing buffer [10 mM Tris–HCl (pH 7.5), 1 mM EDTA, 0.15 mM LiCl] and AAT mRNA:miRNA complexes were captured using a Dynal magnet.

    Techniques: Variant Assay, Sequencing

    Validation of AAT mRNA-specific isolation technique. ( A ) qRT-PCR showing the enrichment of AAT mRNA compared with other mRNAs. Expression of captured mRNA was normalized to baseline expression of these transcripts in HepG2 cell lysates to demonstrate enrichment of the AAT mRNA compared with other highly abundant mRNAs. ( B ) qRT-PCR comparing the level of AAT mRNA and other mRNAs in captured samples compared with levels in the remaining cell lysates after capture. ( C ) AAT mRNA and miR-940 levels detectable on dynabeads pre-80°C heat treatment (sample 1), in eluates post-80°C heat treatment (sample 2) and in samples after reversal of formaldehyde cross-linking (sample 3). ( D ) Additional targets to capture AAT mRNA including a second predicted loop (2nd loop) from position 2454–2572 and a double-stranded sequence (non-loop) from position 2533–2554. Relative expression of AAT mRNA following capture with the capture oligonucleotides as indicated. Relative mRNA and miRNA expression were quantified using the 2 −ΔΔCt method. Assays were performed in triplicate ( n = 3).

    Journal: Nucleic Acids Research

    Article Title: Isolation and identification of cell-specific microRNAs targeting a messenger RNA using a biotinylated anti-sense oligonucleotide capture affinity technique

    doi: 10.1093/nar/gks1466

    Figure Lengend Snippet: Validation of AAT mRNA-specific isolation technique. ( A ) qRT-PCR showing the enrichment of AAT mRNA compared with other mRNAs. Expression of captured mRNA was normalized to baseline expression of these transcripts in HepG2 cell lysates to demonstrate enrichment of the AAT mRNA compared with other highly abundant mRNAs. ( B ) qRT-PCR comparing the level of AAT mRNA and other mRNAs in captured samples compared with levels in the remaining cell lysates after capture. ( C ) AAT mRNA and miR-940 levels detectable on dynabeads pre-80°C heat treatment (sample 1), in eluates post-80°C heat treatment (sample 2) and in samples after reversal of formaldehyde cross-linking (sample 3). ( D ) Additional targets to capture AAT mRNA including a second predicted loop (2nd loop) from position 2454–2572 and a double-stranded sequence (non-loop) from position 2533–2554. Relative expression of AAT mRNA following capture with the capture oligonucleotides as indicated. Relative mRNA and miRNA expression were quantified using the 2 −ΔΔCt method. Assays were performed in triplicate ( n = 3).

    Article Snippet: The beads were washed twice using washing buffer [10 mM Tris–HCl (pH 7.5), 1 mM EDTA, 0.15 mM LiCl] and AAT mRNA:miRNA complexes were captured using a Dynal magnet.

    Techniques: Isolation, Quantitative RT-PCR, Expressing, Capture-C, Sequencing

    Strategy for single (AAT) mRNA:miRNA affinity purification. (1) Cells are treated with formaldehyde to cross-link miR-Ago-RISC complexes with mRNA. (2) Cells are lysed, treated with RNase-free DNase and the biotinylated DNA oligonucleotide is used to capture only AAT mRNA:miRNA complexes with streptavidin-coated magnetic beads. (3) Samples are eluted from the magnetic beads, the DNase is inactivated and the formaldehyde cross-linking is reversed. Samples can be used for qRT-PCR and miRNA expression profiling.

    Journal: Nucleic Acids Research

    Article Title: Isolation and identification of cell-specific microRNAs targeting a messenger RNA using a biotinylated anti-sense oligonucleotide capture affinity technique

    doi: 10.1093/nar/gks1466

    Figure Lengend Snippet: Strategy for single (AAT) mRNA:miRNA affinity purification. (1) Cells are treated with formaldehyde to cross-link miR-Ago-RISC complexes with mRNA. (2) Cells are lysed, treated with RNase-free DNase and the biotinylated DNA oligonucleotide is used to capture only AAT mRNA:miRNA complexes with streptavidin-coated magnetic beads. (3) Samples are eluted from the magnetic beads, the DNase is inactivated and the formaldehyde cross-linking is reversed. Samples can be used for qRT-PCR and miRNA expression profiling.

    Article Snippet: The beads were washed twice using washing buffer [10 mM Tris–HCl (pH 7.5), 1 mM EDTA, 0.15 mM LiCl] and AAT mRNA:miRNA complexes were captured using a Dynal magnet.

    Techniques: Affinity Purification, Magnetic Beads, Quantitative RT-PCR, Expressing

    Super-resolution imaging of centriole amplification in MEFs expressing Multicilin and E2f4VP16. (a) Super-resolution images of MEFs expressing Multicili/E2f4VP16 stained with Cep63 (red), Centrin (green) and Cep152 (blue). The magnified insets show details for centriole assembly on existing centrioles (C1 or C2, marked with Cep63) versus that occurring at the deuterosome (DD). (b) Super-resolution images of MEFs expressing Multicilin/E2f4VP16 stained with Deup1 (red), Centrin (green) and Cep152 (blue). The magnified insets show details for centriole assembly on existing centrioles (C1 or C2, marked with Centrin at the core) versus that occurring at the deuterosome (DD, marked with Deup1). Cells were divided into 4 stages as described in the text. (c) MEFs expressing Multicilin/E2f4VP16 were scored at different days PI in triplicate for > 100 cells, using the staging of MCC differentiation described in the text. (d) Average number of Deup1 and Centrin foci in MEFs expressing Multicilin/E2f4VP16 at different stages of MCC differentiation, based on > 35 cells scored at each stage. (e) Average size of Deup1 foci based on super-resolution images (Fig. S5a,b and lower panel) of Deup1 (red) and Centrin (green) antibody staining, plotted according to engaged centriole number. (f) MEFs were subjected to RNAi knock down ( siCTL , siDeup1 , siCep63 or siCep152 ) 1 day before the infection. MEFs were fixed at day 1 PI (2 days after initial siRNA transfection) then subjected to antibody staining as indicated. Representative super-resolution images of MEFs stained with Cep63 (red), Centrin (green) and Cep152 (blue) followed by cropping to show MCD specific centriole amplification. ( g–i ) Boxplots summarizing the effects of different gene knock downs in MEFs expressing Multicilin/myc-E2f4VP16, on the number of Deup1 foci (g) , of Sas-6 foci associated with Deup1 (h) , or of procentrioles, marked with Centrin, associated with the pre-existing centrioles marked with Cep63 staining (i) . P-values based on a two-tailed, t -test. All other error bars = s.d. Scale bars = 2 μm (a , b) or 0.5 μm (e , f) .

    Journal: Scientific Reports

    Article Title: Multicilin and activated E2f4 induce multiciliated cell differentiation in primary fibroblasts

    doi: 10.1038/s41598-018-30791-1

    Figure Lengend Snippet: Super-resolution imaging of centriole amplification in MEFs expressing Multicilin and E2f4VP16. (a) Super-resolution images of MEFs expressing Multicili/E2f4VP16 stained with Cep63 (red), Centrin (green) and Cep152 (blue). The magnified insets show details for centriole assembly on existing centrioles (C1 or C2, marked with Cep63) versus that occurring at the deuterosome (DD). (b) Super-resolution images of MEFs expressing Multicilin/E2f4VP16 stained with Deup1 (red), Centrin (green) and Cep152 (blue). The magnified insets show details for centriole assembly on existing centrioles (C1 or C2, marked with Centrin at the core) versus that occurring at the deuterosome (DD, marked with Deup1). Cells were divided into 4 stages as described in the text. (c) MEFs expressing Multicilin/E2f4VP16 were scored at different days PI in triplicate for > 100 cells, using the staging of MCC differentiation described in the text. (d) Average number of Deup1 and Centrin foci in MEFs expressing Multicilin/E2f4VP16 at different stages of MCC differentiation, based on > 35 cells scored at each stage. (e) Average size of Deup1 foci based on super-resolution images (Fig. S5a,b and lower panel) of Deup1 (red) and Centrin (green) antibody staining, plotted according to engaged centriole number. (f) MEFs were subjected to RNAi knock down ( siCTL , siDeup1 , siCep63 or siCep152 ) 1 day before the infection. MEFs were fixed at day 1 PI (2 days after initial siRNA transfection) then subjected to antibody staining as indicated. Representative super-resolution images of MEFs stained with Cep63 (red), Centrin (green) and Cep152 (blue) followed by cropping to show MCD specific centriole amplification. ( g–i ) Boxplots summarizing the effects of different gene knock downs in MEFs expressing Multicilin/myc-E2f4VP16, on the number of Deup1 foci (g) , of Sas-6 foci associated with Deup1 (h) , or of procentrioles, marked with Centrin, associated with the pre-existing centrioles marked with Cep63 staining (i) . P-values based on a two-tailed, t -test. All other error bars = s.d. Scale bars = 2 μm (a , b) or 0.5 μm (e , f) .

    Article Snippet: The transfection is performed by adding the pre-incubated complex of siRNA with reagent in reduced serum media (Opti-MEM; invitrogen) to cells without media change.

    Techniques: Imaging, Amplification, Expressing, Staining, Infection, Transfection, Two Tailed Test

    Identification of a novel androgen regulated protein isoform encoded by the tumour suppressor gene TSC2 in PCa cells (A) A novel internal initiation site from the TSC2 gene was identified in 24-hour androgen stimulated LNCaP cells using 5′ RACE. First strand cDNA synthesis was primed using a gene-specific primer to TSC2 exon 34 and a product was obtained for LNCaP cells treated with the synthetic androgen R1881 (A+), which was absent from steroid-depleted (SD) cells. (B) Visualisation of the sequenced 5′ RACE product on the UCSC genome browser indicated the androgen regulated TSC2 isoform contained a novel 5′ UTR, with a start codon at the beginning of exon 32. (C) Real-time qPCR using primer pairs to specific exons of TSC2 confirmed the location of the androgen-indued TSC2 internal 5' end. (D) Detection of TSC2 isoforms in LNCaP cells using antibodies specific to the N- and C terminus of the protein revealed an androgen inducible band, named isoform A, of approximately 60kDa detectable using the C-terminal antibody (E) which was absent when the same samples were probed with the N-terminal antibody (F). Anti-p70-S6K was used as a control to confirm the response to androgens. Notably, as well as induction of TSC2A, there was also a reduction in full-length TSC2 protein levels following androgen treatment detectable by both TSC2 antibodies. Stable transfection of LNCaP cells with shRNA targeting full-length TSC2 mRNA but not TSC2A (labelled N-term shRNA) showed that although there is loss of the full-length protein, TSC2A is still present, indicating it is not a degradation product of the full-length protein (G). Stable transfection with shRNA targeting both isoforms (labelled C-term shRNA) resulted in the loss of both proteins, demonstrating the specificity of the C-terminal TSC2 antibody (H).

    Journal: Oncotarget

    Article Title: A novel androgen-regulated isoform of the TSC2 tumour suppressor gene increases cell proliferation

    doi:

    Figure Lengend Snippet: Identification of a novel androgen regulated protein isoform encoded by the tumour suppressor gene TSC2 in PCa cells (A) A novel internal initiation site from the TSC2 gene was identified in 24-hour androgen stimulated LNCaP cells using 5′ RACE. First strand cDNA synthesis was primed using a gene-specific primer to TSC2 exon 34 and a product was obtained for LNCaP cells treated with the synthetic androgen R1881 (A+), which was absent from steroid-depleted (SD) cells. (B) Visualisation of the sequenced 5′ RACE product on the UCSC genome browser indicated the androgen regulated TSC2 isoform contained a novel 5′ UTR, with a start codon at the beginning of exon 32. (C) Real-time qPCR using primer pairs to specific exons of TSC2 confirmed the location of the androgen-indued TSC2 internal 5' end. (D) Detection of TSC2 isoforms in LNCaP cells using antibodies specific to the N- and C terminus of the protein revealed an androgen inducible band, named isoform A, of approximately 60kDa detectable using the C-terminal antibody (E) which was absent when the same samples were probed with the N-terminal antibody (F). Anti-p70-S6K was used as a control to confirm the response to androgens. Notably, as well as induction of TSC2A, there was also a reduction in full-length TSC2 protein levels following androgen treatment detectable by both TSC2 antibodies. Stable transfection of LNCaP cells with shRNA targeting full-length TSC2 mRNA but not TSC2A (labelled N-term shRNA) showed that although there is loss of the full-length protein, TSC2A is still present, indicating it is not a degradation product of the full-length protein (G). Stable transfection with shRNA targeting both isoforms (labelled C-term shRNA) resulted in the loss of both proteins, demonstrating the specificity of the C-terminal TSC2 antibody (H).

    Article Snippet: siRNA Knockdown of TSC2 was carried out using a pre-designed silencer select siRNA (Ambion S14437) and siPORT NeoFX transfection reagent (AM4510, Invitrogen).

    Techniques: Real-time Polymerase Chain Reaction, Stable Transfection, shRNA

    TSC2 isoform A does not inhibit mTOR signalling and increases cell proliferation (A) Knock-down of TSC2 protein by siRNA depletion targeting the C-terminal of the protein causes an increase in mTOR signalling, as measured by changes in phosphorylation of S6K. (B) Conversely, over-expression of full-length TSC2 in HEK293 cells caused a reduction in S6K phosphorylation (lane 2), however unlike full-length TSC2 the TSC2A isoform does not inhibit mTOR activation (lane 3). (C) Over-expression of TSC2A in LNCaP cells did not inhibit mTOR signalling under both steroid-deplete and androgen treated conditions. Analysis of cell proliferation by (D) MTT assay and (E) incorporation of EdU over 6 hours indicated that expression of the TSC2A isoform increases LNCaP cell growth. (F) Similarly, cell cycle analysis of DAPI stained cells by flow cytometry shows that TSC2A decreases the percentage of cells in G1/G0 and increases the percentage of cells in S phase.

    Journal: Oncotarget

    Article Title: A novel androgen-regulated isoform of the TSC2 tumour suppressor gene increases cell proliferation

    doi:

    Figure Lengend Snippet: TSC2 isoform A does not inhibit mTOR signalling and increases cell proliferation (A) Knock-down of TSC2 protein by siRNA depletion targeting the C-terminal of the protein causes an increase in mTOR signalling, as measured by changes in phosphorylation of S6K. (B) Conversely, over-expression of full-length TSC2 in HEK293 cells caused a reduction in S6K phosphorylation (lane 2), however unlike full-length TSC2 the TSC2A isoform does not inhibit mTOR activation (lane 3). (C) Over-expression of TSC2A in LNCaP cells did not inhibit mTOR signalling under both steroid-deplete and androgen treated conditions. Analysis of cell proliferation by (D) MTT assay and (E) incorporation of EdU over 6 hours indicated that expression of the TSC2A isoform increases LNCaP cell growth. (F) Similarly, cell cycle analysis of DAPI stained cells by flow cytometry shows that TSC2A decreases the percentage of cells in G1/G0 and increases the percentage of cells in S phase.

    Article Snippet: siRNA Knockdown of TSC2 was carried out using a pre-designed silencer select siRNA (Ambion S14437) and siPORT NeoFX transfection reagent (AM4510, Invitrogen).

    Techniques: Over Expression, Activation Assay, MTT Assay, Expressing, Cell Cycle Assay, Staining, Flow Cytometry, Cytometry