pgl4.10 Promega Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Promega pgl4 10 promega vectors
    A 3′ ss can mimic a promoter in the pGL4 system by inducing production of spliced readthrough transcripts. ( A ) Expression of luciferase from <t>pGL4.10</t> and pGL4.17 with and without the globin 3′ ss inserted into the MCS. Error bars, SD. ( B ) 5′ RACE products from pGL4.17 containing the globin insert.
    Pgl4 10 Promega Vectors, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 222 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgl4 10 promega vectors/product/Promega
    Average 92 stars, based on 222 article reviews
    Price from $9.99 to $1999.99
    pgl4 10 promega vectors - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    91
    Promega pgl4 10 promega vector
    MUC16 expression and transcriptional activity of MUC16 promoters. (A) MUC16 expression in ovarian cancer cells by immunocytochemistry. 1, HEY; 2, Caov3; 3, SKOV-3; 4, RMUG-L. (B) Transcriptional activity of the MUC16 promoters in ovarian cancer cells per dual-luciferase reporter assays. Cells were transfected with <t>pGL4.10</t> vectors containing different MUC16 promoters (pGL-MUC16.1, pGL-MUC16.2, pGL-MUC16.3 and pGL-MUC16.4). The pGL4.10 vector with the CMV promoter (pGL-CMV) was used as the positive control. pGL4.10 without a promoter (pGL-Basic) was used as the negative control. * P
    Pgl4 10 Promega Vector, supplied by Promega, used in various techniques. Bioz Stars score: 91/100, based on 112 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgl4 10 promega vector/product/Promega
    Average 91 stars, based on 112 article reviews
    Price from $9.99 to $1999.99
    pgl4 10 promega vector - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    84
    Promega pgl4 10 promega luciferase reporter plasmids
    MUC16 expression and transcriptional activity of MUC16 promoters. (A) MUC16 expression in ovarian cancer cells by immunocytochemistry. 1, HEY; 2, Caov3; 3, SKOV-3; 4, RMUG-L. (B) Transcriptional activity of the MUC16 promoters in ovarian cancer cells per dual-luciferase reporter assays. Cells were transfected with <t>pGL4.10</t> vectors containing different MUC16 promoters (pGL-MUC16.1, pGL-MUC16.2, pGL-MUC16.3 and pGL-MUC16.4). The pGL4.10 vector with the CMV promoter (pGL-CMV) was used as the positive control. pGL4.10 without a promoter (pGL-Basic) was used as the negative control. * P
    Pgl4 10 Promega Luciferase Reporter Plasmids, supplied by Promega, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgl4 10 promega luciferase reporter plasmids/product/Promega
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pgl4 10 promega luciferase reporter plasmids - by Bioz Stars, 2020-08
    84/100 stars
      Buy from Supplier

    86
    Promega promoterless pgl4 10
    MUC16 expression and transcriptional activity of MUC16 promoters. (A) MUC16 expression in ovarian cancer cells by immunocytochemistry. 1, HEY; 2, Caov3; 3, SKOV-3; 4, RMUG-L. (B) Transcriptional activity of the MUC16 promoters in ovarian cancer cells per dual-luciferase reporter assays. Cells were transfected with <t>pGL4.10</t> vectors containing different MUC16 promoters (pGL-MUC16.1, pGL-MUC16.2, pGL-MUC16.3 and pGL-MUC16.4). The pGL4.10 vector with the CMV promoter (pGL-CMV) was used as the positive control. pGL4.10 without a promoter (pGL-Basic) was used as the negative control. * P
    Promoterless Pgl4 10, supplied by Promega, used in various techniques. Bioz Stars score: 86/100, based on 54 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/promoterless pgl4 10/product/Promega
    Average 86 stars, based on 54 article reviews
    Price from $9.99 to $1999.99
    promoterless pgl4 10 - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    85
    Promega pgl4 10 nfat
    MUC16 expression and transcriptional activity of MUC16 promoters. (A) MUC16 expression in ovarian cancer cells by immunocytochemistry. 1, HEY; 2, Caov3; 3, SKOV-3; 4, RMUG-L. (B) Transcriptional activity of the MUC16 promoters in ovarian cancer cells per dual-luciferase reporter assays. Cells were transfected with <t>pGL4.10</t> vectors containing different MUC16 promoters (pGL-MUC16.1, pGL-MUC16.2, pGL-MUC16.3 and pGL-MUC16.4). The pGL4.10 vector with the CMV promoter (pGL-CMV) was used as the positive control. pGL4.10 without a promoter (pGL-Basic) was used as the negative control. * P
    Pgl4 10 Nfat, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgl4 10 nfat/product/Promega
    Average 85 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    pgl4 10 nfat - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    90
    Promega pgl4 10 luc2 promega luciferase2 sequence
    MUC16 expression and transcriptional activity of MUC16 promoters. (A) MUC16 expression in ovarian cancer cells by immunocytochemistry. 1, HEY; 2, Caov3; 3, SKOV-3; 4, RMUG-L. (B) Transcriptional activity of the MUC16 promoters in ovarian cancer cells per dual-luciferase reporter assays. Cells were transfected with <t>pGL4.10</t> vectors containing different MUC16 promoters (pGL-MUC16.1, pGL-MUC16.2, pGL-MUC16.3 and pGL-MUC16.4). The pGL4.10 vector with the CMV promoter (pGL-CMV) was used as the positive control. pGL4.10 without a promoter (pGL-Basic) was used as the negative control. * P
    Pgl4 10 Luc2 Promega Luciferase2 Sequence, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgl4 10 luc2 promega luciferase2 sequence/product/Promega
    Average 90 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    pgl4 10 luc2 promega luciferase2 sequence - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    89
    Promega pgl4 10 luc2
    Compound 7 inhibits EJ-1 bladder carcinoma growth in immunodeficient NOG mice. (A) Whole-body bioluminescence imaging of tumor cells. Immunodeficient NOG mice were intraperitoneally (i.p.) inoculated with 1 × 10 6 EJ-1 cells transfected with <t>pGL4.10[luc2]</t> on day 0 and treated with 2 μg/0.1 mL compound 7 (97.1 μg/kg) or 0.1 mL of PBS i.p. on days 3 and 6. On day 7, 0.1 mL of 15 mg/mL VivoGlo™ luciferin (Xenogen, Alameda, CA, USA) was injected i.p. and the mice were placed in the specimen chamber and photon emissions transmitted from the mice were then measured. This treatment regimen was repeated 7 times and the images from day 28 are shown. Luciferase units are photons/second/mouse. (B) Inhibition of tumor growth by compound 7 in vivo. The growth of EJ-1 was monitored for weeks 2 through 7 as described in (A) and the average photon flux/sec for four to five mice is plotted ± SEM. * p
    Pgl4 10 Luc2, supplied by Promega, used in various techniques. Bioz Stars score: 89/100, based on 388 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgl4 10 luc2/product/Promega
    Average 89 stars, based on 388 article reviews
    Price from $9.99 to $1999.99
    pgl4 10 luc2 - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    85
    Promega ecori nhei pgl4 10
    Compound 7 inhibits EJ-1 bladder carcinoma growth in immunodeficient NOG mice. (A) Whole-body bioluminescence imaging of tumor cells. Immunodeficient NOG mice were intraperitoneally (i.p.) inoculated with 1 × 10 6 EJ-1 cells transfected with <t>pGL4.10[luc2]</t> on day 0 and treated with 2 μg/0.1 mL compound 7 (97.1 μg/kg) or 0.1 mL of PBS i.p. on days 3 and 6. On day 7, 0.1 mL of 15 mg/mL VivoGlo™ luciferin (Xenogen, Alameda, CA, USA) was injected i.p. and the mice were placed in the specimen chamber and photon emissions transmitted from the mice were then measured. This treatment regimen was repeated 7 times and the images from day 28 are shown. Luciferase units are photons/second/mouse. (B) Inhibition of tumor growth by compound 7 in vivo. The growth of EJ-1 was monitored for weeks 2 through 7 as described in (A) and the average photon flux/sec for four to five mice is plotted ± SEM. * p
    Ecori Nhei Pgl4 10, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecori nhei pgl4 10/product/Promega
    Average 85 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    ecori nhei pgl4 10 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    92
    Promega luciferase reporter pgl4 10
    Compound 7 inhibits EJ-1 bladder carcinoma growth in immunodeficient NOG mice. (A) Whole-body bioluminescence imaging of tumor cells. Immunodeficient NOG mice were intraperitoneally (i.p.) inoculated with 1 × 10 6 EJ-1 cells transfected with <t>pGL4.10[luc2]</t> on day 0 and treated with 2 μg/0.1 mL compound 7 (97.1 μg/kg) or 0.1 mL of PBS i.p. on days 3 and 6. On day 7, 0.1 mL of 15 mg/mL VivoGlo™ luciferin (Xenogen, Alameda, CA, USA) was injected i.p. and the mice were placed in the specimen chamber and photon emissions transmitted from the mice were then measured. This treatment regimen was repeated 7 times and the images from day 28 are shown. Luciferase units are photons/second/mouse. (B) Inhibition of tumor growth by compound 7 in vivo. The growth of EJ-1 was monitored for weeks 2 through 7 as described in (A) and the average photon flux/sec for four to five mice is plotted ± SEM. * p
    Luciferase Reporter Pgl4 10, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 35 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/luciferase reporter pgl4 10/product/Promega
    Average 92 stars, based on 35 article reviews
    Price from $9.99 to $1999.99
    luciferase reporter pgl4 10 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    90
    Promega kpni xhoi pgl4 10
    Compound 7 inhibits EJ-1 bladder carcinoma growth in immunodeficient NOG mice. (A) Whole-body bioluminescence imaging of tumor cells. Immunodeficient NOG mice were intraperitoneally (i.p.) inoculated with 1 × 10 6 EJ-1 cells transfected with <t>pGL4.10[luc2]</t> on day 0 and treated with 2 μg/0.1 mL compound 7 (97.1 μg/kg) or 0.1 mL of PBS i.p. on days 3 and 6. On day 7, 0.1 mL of 15 mg/mL VivoGlo™ luciferin (Xenogen, Alameda, CA, USA) was injected i.p. and the mice were placed in the specimen chamber and photon emissions transmitted from the mice were then measured. This treatment regimen was repeated 7 times and the images from day 28 are shown. Luciferase units are photons/second/mouse. (B) Inhibition of tumor growth by compound 7 in vivo. The growth of EJ-1 was monitored for weeks 2 through 7 as described in (A) and the average photon flux/sec for four to five mice is plotted ± SEM. * p
    Kpni Xhoi Pgl4 10, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kpni xhoi pgl4 10/product/Promega
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    kpni xhoi pgl4 10 - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    85
    Promega pgl4 10 luc2 pluc2
    Compound 7 inhibits EJ-1 bladder carcinoma growth in immunodeficient NOG mice. (A) Whole-body bioluminescence imaging of tumor cells. Immunodeficient NOG mice were intraperitoneally (i.p.) inoculated with 1 × 10 6 EJ-1 cells transfected with <t>pGL4.10[luc2]</t> on day 0 and treated with 2 μg/0.1 mL compound 7 (97.1 μg/kg) or 0.1 mL of PBS i.p. on days 3 and 6. On day 7, 0.1 mL of 15 mg/mL VivoGlo™ luciferin (Xenogen, Alameda, CA, USA) was injected i.p. and the mice were placed in the specimen chamber and photon emissions transmitted from the mice were then measured. This treatment regimen was repeated 7 times and the images from day 28 are shown. Luciferase units are photons/second/mouse. (B) Inhibition of tumor growth by compound 7 in vivo. The growth of EJ-1 was monitored for weeks 2 through 7 as described in (A) and the average photon flux/sec for four to five mice is plotted ± SEM. * p
    Pgl4 10 Luc2 Pluc2, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgl4 10 luc2 pluc2/product/Promega
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    pgl4 10 luc2 pluc2 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    Promega xhoi hindiii digested pgl4 10
    Compound 7 inhibits EJ-1 bladder carcinoma growth in immunodeficient NOG mice. (A) Whole-body bioluminescence imaging of tumor cells. Immunodeficient NOG mice were intraperitoneally (i.p.) inoculated with 1 × 10 6 EJ-1 cells transfected with <t>pGL4.10[luc2]</t> on day 0 and treated with 2 μg/0.1 mL compound 7 (97.1 μg/kg) or 0.1 mL of PBS i.p. on days 3 and 6. On day 7, 0.1 mL of 15 mg/mL VivoGlo™ luciferin (Xenogen, Alameda, CA, USA) was injected i.p. and the mice were placed in the specimen chamber and photon emissions transmitted from the mice were then measured. This treatment regimen was repeated 7 times and the images from day 28 are shown. Luciferase units are photons/second/mouse. (B) Inhibition of tumor growth by compound 7 in vivo. The growth of EJ-1 was monitored for weeks 2 through 7 as described in (A) and the average photon flux/sec for four to five mice is plotted ± SEM. * p
    Xhoi Hindiii Digested Pgl4 10, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xhoi hindiii digested pgl4 10/product/Promega
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    xhoi hindiii digested pgl4 10 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Image Search Results


    A 3′ ss can mimic a promoter in the pGL4 system by inducing production of spliced readthrough transcripts. ( A ) Expression of luciferase from pGL4.10 and pGL4.17 with and without the globin 3′ ss inserted into the MCS. Error bars, SD. ( B ) 5′ RACE products from pGL4.17 containing the globin insert.

    Journal: Nucleic Acids Research

    Article Title: Cryptic transcripts from a ubiquitous plasmid origin of replication confound tests for cis-regulatory function

    doi: 10.1093/nar/gks451

    Figure Lengend Snippet: A 3′ ss can mimic a promoter in the pGL4 system by inducing production of spliced readthrough transcripts. ( A ) Expression of luciferase from pGL4.10 and pGL4.17 with and without the globin 3′ ss inserted into the MCS. Error bars, SD. ( B ) 5′ RACE products from pGL4.17 containing the globin insert.

    Article Snippet: The SacI–NcoI fragment of pGL3-Enhancer containing the 3′ ss was transferred to pGL4.17 and pGL4.10 to generate the β-globin 3′ ss-containing variants of these plasmids.

    Techniques: Expressing, Luciferase

    Effect of Gata1, SP1, SMAD3 and E2F4 on transcriptional activity of LTBP4L and LTBP4S promoter. HEK293 cells were transiently transfected with pGL4.10-LTBP4L or pGL4.10-LTBP4S and a Renilla luciferase expression vector for normalization. Cells were also co-transfected with different concentrations of A) a Gata1 expression vector, B) a SP1 expression vector, C) a SMAD3 expression vector or D) an E2F4 expression vector. After 24 h cells were lysed and luciferase activities were determined. Experiments were repeated at least 3 times and the mean value was calculated. Data are presented ± standard deviation.

    Journal: PLoS ONE

    Article Title: Latent Transforming Growth Factor ?-Binding Protein 4 Is Downregulated in Esophageal Cancer via Promoter Methylation

    doi: 10.1371/journal.pone.0065614

    Figure Lengend Snippet: Effect of Gata1, SP1, SMAD3 and E2F4 on transcriptional activity of LTBP4L and LTBP4S promoter. HEK293 cells were transiently transfected with pGL4.10-LTBP4L or pGL4.10-LTBP4S and a Renilla luciferase expression vector for normalization. Cells were also co-transfected with different concentrations of A) a Gata1 expression vector, B) a SP1 expression vector, C) a SMAD3 expression vector or D) an E2F4 expression vector. After 24 h cells were lysed and luciferase activities were determined. Experiments were repeated at least 3 times and the mean value was calculated. Data are presented ± standard deviation.

    Article Snippet: These fragments were cloned into pGL4.23 and pGL4.10 vectors (Promega, USA), which results in pGL4.23-LTBP4L, pGL4.23-LTBP4S, pGL4.10-LTBP4L and pGL4.10-LTBP4S.

    Techniques: Activity Assay, Transfection, Luciferase, Expressing, Plasmid Preparation, Standard Deviation

    MUC16 expression and transcriptional activity of MUC16 promoters. (A) MUC16 expression in ovarian cancer cells by immunocytochemistry. 1, HEY; 2, Caov3; 3, SKOV-3; 4, RMUG-L. (B) Transcriptional activity of the MUC16 promoters in ovarian cancer cells per dual-luciferase reporter assays. Cells were transfected with pGL4.10 vectors containing different MUC16 promoters (pGL-MUC16.1, pGL-MUC16.2, pGL-MUC16.3 and pGL-MUC16.4). The pGL4.10 vector with the CMV promoter (pGL-CMV) was used as the positive control. pGL4.10 without a promoter (pGL-Basic) was used as the negative control. * P

    Journal: Drug Delivery

    Article Title: Transcriptional control of the MUC16 promoter facilitates follicle-stimulating hormone peptide-conjugated shRNA nanoparticle-mediated inhibition of ovarian carcinoma in vivo

    doi: 10.1080/10717544.2018.1451934

    Figure Lengend Snippet: MUC16 expression and transcriptional activity of MUC16 promoters. (A) MUC16 expression in ovarian cancer cells by immunocytochemistry. 1, HEY; 2, Caov3; 3, SKOV-3; 4, RMUG-L. (B) Transcriptional activity of the MUC16 promoters in ovarian cancer cells per dual-luciferase reporter assays. Cells were transfected with pGL4.10 vectors containing different MUC16 promoters (pGL-MUC16.1, pGL-MUC16.2, pGL-MUC16.3 and pGL-MUC16.4). The pGL4.10 vector with the CMV promoter (pGL-CMV) was used as the positive control. pGL4.10 without a promoter (pGL-Basic) was used as the negative control. * P

    Article Snippet: Then, the TA cloning vector was digested and ligated with the basic vector pGL4.10[ luc2 ] (Promega Corporation, USA) at the Xho I and Bgl II restriction sites.

    Techniques: Expressing, Activity Assay, Immunocytochemistry, Luciferase, Transfection, Plasmid Preparation, Positive Control, Negative Control

    Haplotype-specific transcriptional activity. Luciferase reporter assays. Firefly luciferase activity was normalized to the Renilla luciferase signal and the data are shown as proportions of control vector pGL4.10-TK. a HepG2 cells with 638-bp constructs. Right panel : FOXA2 induced a haplotype-specific transcriptional activity (CGG > TAC) compared to the control pGL4.10-TK. Error bars represent the standard deviation of five experiments ( n = 5) with three, three, eight, four, and four technical replicates (*** p ≤ 0.005; two-tailed t -test). b HepG2 cells with 3-kb constructs. Right panel : FOXA2 induced the transcriptional activity of the inserts in a haplotype-specific way (CGG > TAC) compared to the control pGL4.10-TK. Error bars represent the standard deviation of six experiments ( n = 6) with four, four, eight, eight, four, and four technical replicates (*** p ≤ 0.005; two-tailed t -test). c MPHs with 3-kb constructs. Right panel : insulin reduced FOXA2-induced transcriptional activity in MPHs. Error bars represent standard deviation of four biological replicates corresponding to four livers ( n = 4) with two technical replicates each (* p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.005; t -test for comparison between haplotypes within treatment; one-way ANOVA for comparisons between the treatments). a – c Left panels : in co-transfection with the pCMV6-XL5 vector without a TF insert, none of the haplotypes show transcriptional activity with respect to the control plasmid pGL4.10-TK. d HepG2 cells with 3-kb constructs. Left panel : in co-transfection with MAFK and pCMV6-XL5, none of the haplotypes show transcriptional activity. Right panel : co-transfection of FOXA2 and MAFK induced transcriptional activity from both 3-kb regions but inverted the haplotype bias compared to FOXA2 alone (TAC > CGG). Error bars represent standard deviation of six experiments ( n = 6) with six, six, six, six, four, and four technical replicates (*** p ≤ 0.005; two-tailed t -test)

    Journal: Genome Medicine

    Article Title: Identification and characterization of a FOXA2-regulated transcriptional enhancer at a type 2 diabetes intronic locus that controls GCKR expression in liver cells

    doi: 10.1186/s13073-017-0453-x

    Figure Lengend Snippet: Haplotype-specific transcriptional activity. Luciferase reporter assays. Firefly luciferase activity was normalized to the Renilla luciferase signal and the data are shown as proportions of control vector pGL4.10-TK. a HepG2 cells with 638-bp constructs. Right panel : FOXA2 induced a haplotype-specific transcriptional activity (CGG > TAC) compared to the control pGL4.10-TK. Error bars represent the standard deviation of five experiments ( n = 5) with three, three, eight, four, and four technical replicates (*** p ≤ 0.005; two-tailed t -test). b HepG2 cells with 3-kb constructs. Right panel : FOXA2 induced the transcriptional activity of the inserts in a haplotype-specific way (CGG > TAC) compared to the control pGL4.10-TK. Error bars represent the standard deviation of six experiments ( n = 6) with four, four, eight, eight, four, and four technical replicates (*** p ≤ 0.005; two-tailed t -test). c MPHs with 3-kb constructs. Right panel : insulin reduced FOXA2-induced transcriptional activity in MPHs. Error bars represent standard deviation of four biological replicates corresponding to four livers ( n = 4) with two technical replicates each (* p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.005; t -test for comparison between haplotypes within treatment; one-way ANOVA for comparisons between the treatments). a – c Left panels : in co-transfection with the pCMV6-XL5 vector without a TF insert, none of the haplotypes show transcriptional activity with respect to the control plasmid pGL4.10-TK. d HepG2 cells with 3-kb constructs. Left panel : in co-transfection with MAFK and pCMV6-XL5, none of the haplotypes show transcriptional activity. Right panel : co-transfection of FOXA2 and MAFK induced transcriptional activity from both 3-kb regions but inverted the haplotype bias compared to FOXA2 alone (TAC > CGG). Error bars represent standard deviation of six experiments ( n = 6) with six, six, six, six, four, and four technical replicates (*** p ≤ 0.005; two-tailed t -test)

    Article Snippet: Amplified DNA was subcloned into BamHI and SalI restriction enzyme sites downstream of the firefly luciferase gene in a pGL4.10 vector (Promega) modified with a minimal TK (thymidine kinase) promoter as previously described (pGL4.10-TK) [ ].

    Techniques: Activity Assay, Luciferase, Plasmid Preparation, Construct, Standard Deviation, Two Tailed Test, Cotransfection

    Effect of TKI treatment on the expression of miR-21 and PDCD4 in AML cells lines (A) MV4.11 and MOLM13 cells were treated with sunitinib (0.1μM, 24h). Then, PDCD4 mRNA and miR-21 were quantified by RT-qPCR (A), and miR-21 promoter activity was assessed by luciferase measurements in cells transduced with the miR-21 promoter-Luciferase lentivirus. (B) For each cell line, histograms represent the base 2 logarithm of the ratio (treated/not treated cells). (C) phospho-STAT5 levels were assessed in control (-) or TKI-treated (+) MV4.11 (left) and MOLM13 (right) cells. (D) Luciferase activity was measured in MOLM13 cells 24 hours after transfection with pGL4.10 plasmids having no promoter, WT or mutated miR-21 promoters.

    Journal: Oncotarget

    Article Title: A tyrosine kinase-STAT5-miR21-PDCD4 regulatory axis in chronic and acute myeloid leukemia cells

    doi: 10.18632/oncotarget.19192

    Figure Lengend Snippet: Effect of TKI treatment on the expression of miR-21 and PDCD4 in AML cells lines (A) MV4.11 and MOLM13 cells were treated with sunitinib (0.1μM, 24h). Then, PDCD4 mRNA and miR-21 were quantified by RT-qPCR (A), and miR-21 promoter activity was assessed by luciferase measurements in cells transduced with the miR-21 promoter-Luciferase lentivirus. (B) For each cell line, histograms represent the base 2 logarithm of the ratio (treated/not treated cells). (C) phospho-STAT5 levels were assessed in control (-) or TKI-treated (+) MV4.11 (left) and MOLM13 (right) cells. (D) Luciferase activity was measured in MOLM13 cells 24 hours after transfection with pGL4.10 plasmids having no promoter, WT or mutated miR-21 promoters.

    Article Snippet: The miR-21 promoter (517bp fragment corresponding to the miR-21 studied by Fujita et al. [ ]) was PCR amplified from human genomic DNA (Promega) using the primers CGGTTTAACAGCACTGCCTCCA and GTCCTCAGAGTAAGGTCAGCTC, and inserted by ligation in the pGL4.10 plasmid (Promega) downstream of the Firefly luciferase cds.

    Techniques: Expressing, Quantitative RT-PCR, Activity Assay, Luciferase, Transduction, Transfection

    Compound 7 inhibits EJ-1 bladder carcinoma growth in immunodeficient NOG mice. (A) Whole-body bioluminescence imaging of tumor cells. Immunodeficient NOG mice were intraperitoneally (i.p.) inoculated with 1 × 10 6 EJ-1 cells transfected with pGL4.10[luc2] on day 0 and treated with 2 μg/0.1 mL compound 7 (97.1 μg/kg) or 0.1 mL of PBS i.p. on days 3 and 6. On day 7, 0.1 mL of 15 mg/mL VivoGlo™ luciferin (Xenogen, Alameda, CA, USA) was injected i.p. and the mice were placed in the specimen chamber and photon emissions transmitted from the mice were then measured. This treatment regimen was repeated 7 times and the images from day 28 are shown. Luciferase units are photons/second/mouse. (B) Inhibition of tumor growth by compound 7 in vivo. The growth of EJ-1 was monitored for weeks 2 through 7 as described in (A) and the average photon flux/sec for four to five mice is plotted ± SEM. * p

    Journal: ChemMedChem

    Article Title: Targeting Cancer Cells with a Bisphosphonate Prodrug

    doi: 10.1002/cmdc.201600465

    Figure Lengend Snippet: Compound 7 inhibits EJ-1 bladder carcinoma growth in immunodeficient NOG mice. (A) Whole-body bioluminescence imaging of tumor cells. Immunodeficient NOG mice were intraperitoneally (i.p.) inoculated with 1 × 10 6 EJ-1 cells transfected with pGL4.10[luc2] on day 0 and treated with 2 μg/0.1 mL compound 7 (97.1 μg/kg) or 0.1 mL of PBS i.p. on days 3 and 6. On day 7, 0.1 mL of 15 mg/mL VivoGlo™ luciferin (Xenogen, Alameda, CA, USA) was injected i.p. and the mice were placed in the specimen chamber and photon emissions transmitted from the mice were then measured. This treatment regimen was repeated 7 times and the images from day 28 are shown. Luciferase units are photons/second/mouse. (B) Inhibition of tumor growth by compound 7 in vivo. The growth of EJ-1 was monitored for weeks 2 through 7 as described in (A) and the average photon flux/sec for four to five mice is plotted ± SEM. * p

    Article Snippet: EJ-1 tumor cells (1 × 106 ) stably transfected with pGL4.10[luc2] (Promega, Madison, WI, USA) were intraperitoneally (i.p.) inoculated into immunodeficient NOG mice (obtained from the Central Institute for Experimental Animals, Kawasaki, Kanagawa, Japan).

    Techniques: Mouse Assay, Imaging, Transfection, Injection, Luciferase, Inhibition, In Vivo, Size-exclusion Chromatography