pegfp-c1 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Becton Dickinson pegfp c1
    BGLF4 rescues p65-mediated inhibition of Zta and Rta transactivation. (A) The indicated expression plasmids were cotransfected with pBHLF1-Luc and <t>pEGFP-C1</t> (as a transfection control) into 293T cells. At 48 h posttransfection, cells were harvested and
    Pegfp C1, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 93/100, based on 1691 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1/product/Becton Dickinson
    Average 93 stars, based on 1691 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    94
    TaKaRa pegfp c1
    Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected <t>pEGFP-C1</t> (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.
    Pegfp C1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 17456 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1/product/TaKaRa
    Average 94 stars, based on 17456 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    93
    Thermo Fisher pegfp c1
    LHX8 enhances the activation of BMP15 promoter. ( A ) RT-PCR analysis of expression of transcription factors in different porcine tissues; ( B ) Overexpression of LHX8 in CHO and NIH3T3 cells. The plasmid <t>pEGFP-C1</t> was used as control. Scale bar, 100 μm; and ( C ) Luciferase assays of BMP15 promoter activity that was enhanced by LHX8 were performed by cotransfection of vectors into CHO and NIH3T3 cells for 36 h. +, indicats a vector was transfected into the recipient cells. Values are represented as mean ± SD. * p
    Pegfp C1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1035 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1/product/Thermo Fisher
    Average 93 stars, based on 1035 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    92
    Promega pegfp c1
    Autoregulation of BIS was not mediated by the alteration of mRNA stability. (A) The sequencing results of genotyping in BIS-KO A549 cells show the deletion in exon 1 of the BIS gene and consequent generation of a premature stop codon. (B) WT and BIS-KO A549 cells were treated with actinomycin D for up to 24 h. At the indicated times, mRNA was extracted, and the remaining BIS mRNA was measured and compared to the initial value with qRT-PCR analysis (mean±SE, n =3). (C) The coding region of the WT BIS and the deletion mutant of the BIS gene, in which 14 bp were deleted (Δ14), were cloned into the <t>pEGFP-C1</t> construct (left). After transfection for 48 h, the GFP mRNA levels representing WT and Δ14-BIS were determined with PCR amplification and agarose electrophoresis by loading different quantities of PCR products (right). (D) The BIS pre-mRNA levels were determined in WT A549 and BIS-KO A549 cells using qRT-PCR analysis with specific primers for intron 2 (solid arrows). The BIS mature mRNA was levels were also determined by the primers covering exon 2 and 3 (dotted arrows). Reverse transcription was performed as described in Method section. * p≤0.05 vs . WT.
    Pegfp C1, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 133 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1/product/Promega
    Average 92 stars, based on 133 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    Stratagene pegfp c1
    In developing neurons, AP2 contributes to endocytosis of transferrin receptor but not GluA2 under basal culture conditions. a Representative confocal images of RAT2 fibroblasts exposed to fluorescently labeled transferrin. Cells were electroporated for 2 days with empty pSuper or pSuper-shAP2b1#2 (shAP2b1) and <t>pEGFP-C1</t> for the identification of transfected cells ( arrows ). After 2 days, the cells were starved overnight prior to 5 or 10 min fluorescently labeled transferrin uptake. Scale bar = 20 μm. b Quantification of integrated density of transferrin fluorescence in the cell body of RAT2 fibroblasts transfected and treated as in a . The data are expressed as a mean value normalized to control. Error bars indicate SEM. *** p
    Pegfp C1, supplied by Stratagene, used in various techniques. Bioz Stars score: 92/100, based on 127 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1/product/Stratagene
    Average 92 stars, based on 127 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    GE Healthcare pegfp c1
    In developing neurons, AP2 contributes to endocytosis of transferrin receptor but not GluA2 under basal culture conditions. a Representative confocal images of RAT2 fibroblasts exposed to fluorescently labeled transferrin. Cells were electroporated for 2 days with empty pSuper or pSuper-shAP2b1#2 (shAP2b1) and <t>pEGFP-C1</t> for the identification of transfected cells ( arrows ). After 2 days, the cells were starved overnight prior to 5 or 10 min fluorescently labeled transferrin uptake. Scale bar = 20 μm. b Quantification of integrated density of transferrin fluorescence in the cell body of RAT2 fibroblasts transfected and treated as in a . The data are expressed as a mean value normalized to control. Error bars indicate SEM. *** p
    Pegfp C1, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1/product/GE Healthcare
    Average 92 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    Addgene inc pegfp c1
    In developing neurons, AP2 contributes to endocytosis of transferrin receptor but not GluA2 under basal culture conditions. a Representative confocal images of RAT2 fibroblasts exposed to fluorescently labeled transferrin. Cells were electroporated for 2 days with empty pSuper or pSuper-shAP2b1#2 (shAP2b1) and <t>pEGFP-C1</t> for the identification of transfected cells ( arrows ). After 2 days, the cells were starved overnight prior to 5 or 10 min fluorescently labeled transferrin uptake. Scale bar = 20 μm. b Quantification of integrated density of transferrin fluorescence in the cell body of RAT2 fibroblasts transfected and treated as in a . The data are expressed as a mean value normalized to control. Error bars indicate SEM. *** p
    Pegfp C1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 209 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1/product/Addgene inc
    Average 92 stars, based on 209 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    90
    Genewiz pegfp c1
    Overexpression of sAnk1 decreased glucose uptake in C2C12 cells. ( A ) The efficiency of <t>pEGFP-c1-sAnk1</t> transferred in C2C12 cells. C2C12 cells were transfected with the pEGFP-c1-sAnk1 plasmid. After differentiation, total RNA and protein isolates were analyzed by qPCR and western blotting, respectively. ( B ) Glucose uptake in C2C12 cells after transfection with the pEGFP-c1-sAnk1 plasmid and subsequent differentiation. The data shown are the mean ± S.D. P values were calculated by Student’s t-test.
    Pegfp C1, supplied by Genewiz, used in various techniques. Bioz Stars score: 90/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1/product/Genewiz
    Average 90 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    92
    Millipore pegfp c1
    Overexpression of sAnk1 decreased glucose uptake in C2C12 cells. ( A ) The efficiency of <t>pEGFP-c1-sAnk1</t> transferred in C2C12 cells. C2C12 cells were transfected with the pEGFP-c1-sAnk1 plasmid. After differentiation, total RNA and protein isolates were analyzed by qPCR and western blotting, respectively. ( B ) Glucose uptake in C2C12 cells after transfection with the pEGFP-c1-sAnk1 plasmid and subsequent differentiation. The data shown are the mean ± S.D. P values were calculated by Student’s t-test.
    Pegfp C1, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 154 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1/product/Millipore
    Average 92 stars, based on 154 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    86
    Addgene inc pegfp c1 ataxin3q28
    Overexpression of sAnk1 decreased glucose uptake in C2C12 cells. ( A ) The efficiency of <t>pEGFP-c1-sAnk1</t> transferred in C2C12 cells. C2C12 cells were transfected with the pEGFP-c1-sAnk1 plasmid. After differentiation, total RNA and protein isolates were analyzed by qPCR and western blotting, respectively. ( B ) Glucose uptake in C2C12 cells after transfection with the pEGFP-c1-sAnk1 plasmid and subsequent differentiation. The data shown are the mean ± S.D. P values were calculated by Student’s t-test.
    Pegfp C1 Ataxin3q28, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1 ataxin3q28/product/Addgene inc
    Average 86 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 ataxin3q28 - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    80
    TaKaRa pgfp pegfp c1
    Overexpression of sAnk1 decreased glucose uptake in C2C12 cells. ( A ) The efficiency of <t>pEGFP-c1-sAnk1</t> transferred in C2C12 cells. C2C12 cells were transfected with the pEGFP-c1-sAnk1 plasmid. After differentiation, total RNA and protein isolates were analyzed by qPCR and western blotting, respectively. ( B ) Glucose uptake in C2C12 cells after transfection with the pEGFP-c1-sAnk1 plasmid and subsequent differentiation. The data shown are the mean ± S.D. P values were calculated by Student’s t-test.
    Pgfp Pegfp C1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 80/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgfp pegfp c1/product/TaKaRa
    Average 80 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    pgfp pegfp c1 - by Bioz Stars, 2020-08
    80/100 stars
      Buy from Supplier

    86
    Addgene inc pegfp c1 ataxin3q84
    Overexpression of sAnk1 decreased glucose uptake in C2C12 cells. ( A ) The efficiency of <t>pEGFP-c1-sAnk1</t> transferred in C2C12 cells. C2C12 cells were transfected with the pEGFP-c1-sAnk1 plasmid. After differentiation, total RNA and protein isolates were analyzed by qPCR and western blotting, respectively. ( B ) Glucose uptake in C2C12 cells after transfection with the pEGFP-c1-sAnk1 plasmid and subsequent differentiation. The data shown are the mean ± S.D. P values were calculated by Student’s t-test.
    Pegfp C1 Ataxin3q84, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1 ataxin3q84/product/Addgene inc
    Average 86 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 ataxin3q84 - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    85
    TaKaRa pegfp c1 n1
    Overexpression of sAnk1 decreased glucose uptake in C2C12 cells. ( A ) The efficiency of <t>pEGFP-c1-sAnk1</t> transferred in C2C12 cells. C2C12 cells were transfected with the pEGFP-c1-sAnk1 plasmid. After differentiation, total RNA and protein isolates were analyzed by qPCR and western blotting, respectively. ( B ) Glucose uptake in C2C12 cells after transfection with the pEGFP-c1-sAnk1 plasmid and subsequent differentiation. The data shown are the mean ± S.D. P values were calculated by Student’s t-test.
    Pegfp C1 N1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1 n1/product/TaKaRa
    Average 85 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 n1 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    TaKaRa pegfp c1 s
    Overexpression of sAnk1 decreased glucose uptake in C2C12 cells. ( A ) The efficiency of <t>pEGFP-c1-sAnk1</t> transferred in C2C12 cells. C2C12 cells were transfected with the pEGFP-c1-sAnk1 plasmid. After differentiation, total RNA and protein isolates were analyzed by qPCR and western blotting, respectively. ( B ) Glucose uptake in C2C12 cells after transfection with the pEGFP-c1-sAnk1 plasmid and subsequent differentiation. The data shown are the mean ± S.D. P values were calculated by Student’s t-test.
    Pegfp C1 S, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1 s/product/TaKaRa
    Average 85 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 s - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    80
    TaKaRa circular pegfp c1
    Overexpression of sAnk1 decreased glucose uptake in C2C12 cells. ( A ) The efficiency of <t>pEGFP-c1-sAnk1</t> transferred in C2C12 cells. C2C12 cells were transfected with the pEGFP-c1-sAnk1 plasmid. After differentiation, total RNA and protein isolates were analyzed by qPCR and western blotting, respectively. ( B ) Glucose uptake in C2C12 cells after transfection with the pEGFP-c1-sAnk1 plasmid and subsequent differentiation. The data shown are the mean ± S.D. P values were calculated by Student’s t-test.
    Circular Pegfp C1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 80/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/circular pegfp c1/product/TaKaRa
    Average 80 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    circular pegfp c1 - by Bioz Stars, 2020-08
    80/100 stars
      Buy from Supplier

    91
    Addgene inc pegfp c1 erβ
    Overexpression of sAnk1 decreased glucose uptake in C2C12 cells. ( A ) The efficiency of <t>pEGFP-c1-sAnk1</t> transferred in C2C12 cells. C2C12 cells were transfected with the pEGFP-c1-sAnk1 plasmid. After differentiation, total RNA and protein isolates were analyzed by qPCR and western blotting, respectively. ( B ) Glucose uptake in C2C12 cells after transfection with the pEGFP-c1-sAnk1 plasmid and subsequent differentiation. The data shown are the mean ± S.D. P values were calculated by Student’s t-test.
    Pegfp C1 Erβ, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1 erβ/product/Addgene inc
    Average 91 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 erβ - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    85
    TaKaRa monomeric pegfp c1
    Overexpression of sAnk1 decreased glucose uptake in C2C12 cells. ( A ) The efficiency of <t>pEGFP-c1-sAnk1</t> transferred in C2C12 cells. C2C12 cells were transfected with the pEGFP-c1-sAnk1 plasmid. After differentiation, total RNA and protein isolates were analyzed by qPCR and western blotting, respectively. ( B ) Glucose uptake in C2C12 cells after transfection with the pEGFP-c1-sAnk1 plasmid and subsequent differentiation. The data shown are the mean ± S.D. P values were calculated by Student’s t-test.
    Monomeric Pegfp C1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/monomeric pegfp c1/product/TaKaRa
    Average 85 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    monomeric pegfp c1 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    88
    Addgene inc pegfp c1 tnfaip3
    Overexpression of sAnk1 decreased glucose uptake in C2C12 cells. ( A ) The efficiency of <t>pEGFP-c1-sAnk1</t> transferred in C2C12 cells. C2C12 cells were transfected with the pEGFP-c1-sAnk1 plasmid. After differentiation, total RNA and protein isolates were analyzed by qPCR and western blotting, respectively. ( B ) Glucose uptake in C2C12 cells after transfection with the pEGFP-c1-sAnk1 plasmid and subsequent differentiation. The data shown are the mean ± S.D. P values were calculated by Student’s t-test.
    Pegfp C1 Tnfaip3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1 tnfaip3/product/Addgene inc
    Average 88 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 tnfaip3 - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    85
    TaKaRa pegfp c1 c2
    Overexpression of sAnk1 decreased glucose uptake in C2C12 cells. ( A ) The efficiency of <t>pEGFP-c1-sAnk1</t> transferred in C2C12 cells. C2C12 cells were transfected with the pEGFP-c1-sAnk1 plasmid. After differentiation, total RNA and protein isolates were analyzed by qPCR and western blotting, respectively. ( B ) Glucose uptake in C2C12 cells after transfection with the pEGFP-c1-sAnk1 plasmid and subsequent differentiation. The data shown are the mean ± S.D. P values were calculated by Student’s t-test.
    Pegfp C1 C2, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp c1 c2/product/TaKaRa
    Average 85 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    pegfp c1 c2 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Image Search Results


    BGLF4 rescues p65-mediated inhibition of Zta and Rta transactivation. (A) The indicated expression plasmids were cotransfected with pBHLF1-Luc and pEGFP-C1 (as a transfection control) into 293T cells. At 48 h posttransfection, cells were harvested and

    Journal: Journal of Virology

    Article Title: Epstein-Barr Virus BGLF4 Kinase Downregulates NF-?B Transactivation through Phosphorylation of Coactivator UXT

    doi: 10.1128/JVI.01918-12

    Figure Lengend Snippet: BGLF4 rescues p65-mediated inhibition of Zta and Rta transactivation. (A) The indicated expression plasmids were cotransfected with pBHLF1-Luc and pEGFP-C1 (as a transfection control) into 293T cells. At 48 h posttransfection, cells were harvested and

    Article Snippet: A Renilla luciferase (Rluc) reporter plasmid (pCMV-Rluc) or pEGFP-C1 (BD Bioscience) expression plasmid was cotransfected as a control for transfection efficiency.

    Techniques: Inhibition, Expressing, Transfection

    Knockdown of BGLF4 during EBV lytic replication increases NF-κB transactivation. (A) BGLF4-targeted siRNA or control siRNA was cotransfected with Rta expression plasmid, pEGFP-C1, and pNF-κB-Luc into NA cells. At 18, 24, and 48 h posttransfection,

    Journal: Journal of Virology

    Article Title: Epstein-Barr Virus BGLF4 Kinase Downregulates NF-?B Transactivation through Phosphorylation of Coactivator UXT

    doi: 10.1128/JVI.01918-12

    Figure Lengend Snippet: Knockdown of BGLF4 during EBV lytic replication increases NF-κB transactivation. (A) BGLF4-targeted siRNA or control siRNA was cotransfected with Rta expression plasmid, pEGFP-C1, and pNF-κB-Luc into NA cells. At 18, 24, and 48 h posttransfection,

    Article Snippet: A Renilla luciferase (Rluc) reporter plasmid (pCMV-Rluc) or pEGFP-C1 (BD Bioscience) expression plasmid was cotransfected as a control for transfection efficiency.

    Techniques: Expressing, Plasmid Preparation

    Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.

    Journal: PLoS ONE

    Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids

    doi: 10.1371/journal.pone.0043283

    Figure Lengend Snippet: Effects of co-transfected plasmids on expression of luciferase reporters. (A) Different plasmids have different effects on luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 150 ng of a tested plasmid. Renilla luciferase (RL) and firefly luciferase (FL) activities in pBS co-transfection were set to one. Data represent results of four transfection experiments performed in triplicates. Error bars = SEM. (B) Dose-dependent suppression of luciferase activities by co-transfected pEGFP-C1 (upper panel) and pRFP-T (lower panel). HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng/well of pEGFP-C1 or pRFP-T. The amount of transfected DNA was kept constant by adding pBS. Error bars = SEM. Data represent results of four transfection experiments performed in triplicates. (C) pEGFP-C1 negatively affects RFP reporter expression. HEK-293 cells were co-transfected with 150 ng/well of pCI-RFPT plasmid and 350 ng/well of pBS or pEGFP-C1 plasmid. RFP expression was analyzed 36 hours post-transfection by flow cytometry. X axis = RFP fluorescence intensity. Y axis = cell count. Colored curves show distribution of RFP signal as follows: black curve = untransfected cells; blue curve = pCI-RFPT + pBS co-transfection, and red curve = pCI-RFPT + pEGFP-C1 co-transfection. Total counts of transfected (RFP-positive) cells were identical in both samples (Fig. S1C). The shape of the red curve suggests that pEGFP-C1 reduces RFP fluorescence in transfected cells. The experiment has been performed three times, results from a representative experiment are shown.

    Article Snippet: To get further insights into possible causes of inhibitory effects of pEGFP-C1, we re-examined deep sequencing data searching for any transcriptome features unique to pEGFP-C1.

    Techniques: Transfection, Expressing, Luciferase, Plasmid Preparation, Cotransfection, Flow Cytometry, Cytometry, Fluorescence, Cell Counting

    Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.

    Journal: PLoS ONE

    Article Title: Deep Sequencing Reveals Complex Spurious Transcription from Transiently Transfected Plasmids

    doi: 10.1371/journal.pone.0043283

    Figure Lengend Snippet: Kan/Neo cassette has a unique small RNA signature and contributes to downregulated expression of luciferase reporters. (A) Analysis of putative adenosine-deaminated small RNAs derived from Kan/Neo cassette (left panel) and pBS (right panel). The distribution of 20–24 nt reads with A/G conversions along pEGFP-C1 and pBS sequences is shown. (B) Size distribution of RNAs originating from EGFP CDS and Kan/Neo CDS sequences in HEK-293 cells. Small RNAs are sorted along the X-axis according to their length (18–26 nt long reads are shown). The Y-axis in both graphs shows the absolute number of reads carrying EGFP- (left) or Kan/Neo-derived sequences (right). The gray portion of each column indicates the fraction of reads carrying up to five A/G sequence changes. Note the absence of edited reads from EGFP CDS region. (C) Replacement of the Kan/Neo cassette by Amp r (denoted by _Amp) relieves repression of luciferase reporters. HEK-293 cells were co-transfected with 100 ng/well of each luciferase reporter and 0–250 ng of one of the four plasmids shown above the graph. The total amount of transfected DNA was kept constant by adding pBS. Renilla luciferase activity relative to the sample co-transfected with pBS (dashed line) is shown. Error bars = SEM. Data represent two independent experiments done in quadruplicates.

    Article Snippet: To get further insights into possible causes of inhibitory effects of pEGFP-C1, we re-examined deep sequencing data searching for any transcriptome features unique to pEGFP-C1.

    Techniques: Expressing, Luciferase, Derivative Assay, Sequencing, Transfection, Activity Assay

    LHX8 enhances the activation of BMP15 promoter. ( A ) RT-PCR analysis of expression of transcription factors in different porcine tissues; ( B ) Overexpression of LHX8 in CHO and NIH3T3 cells. The plasmid pEGFP-C1 was used as control. Scale bar, 100 μm; and ( C ) Luciferase assays of BMP15 promoter activity that was enhanced by LHX8 were performed by cotransfection of vectors into CHO and NIH3T3 cells for 36 h. +, indicats a vector was transfected into the recipient cells. Values are represented as mean ± SD. * p

    Journal: International Journal of Molecular Sciences

    Article Title: Identification and Analysis of Regulatory Elements in Porcine Bone Morphogenetic Protein 15 Gene Promoter

    doi: 10.3390/ijms161025759

    Figure Lengend Snippet: LHX8 enhances the activation of BMP15 promoter. ( A ) RT-PCR analysis of expression of transcription factors in different porcine tissues; ( B ) Overexpression of LHX8 in CHO and NIH3T3 cells. The plasmid pEGFP-C1 was used as control. Scale bar, 100 μm; and ( C ) Luciferase assays of BMP15 promoter activity that was enhanced by LHX8 were performed by cotransfection of vectors into CHO and NIH3T3 cells for 36 h. +, indicats a vector was transfected into the recipient cells. Values are represented as mean ± SD. * p

    Article Snippet: LHX8 CDS was then subcloned into XhoI /BamHI sites of pEGFP-C1 (Invitrogen, Camarillo, CA, USA) to generate pEC1-LHX8 that could express GFP-LHX8 fusion protein.

    Techniques: Activation Assay, Reverse Transcription Polymerase Chain Reaction, Expressing, Over Expression, Plasmid Preparation, Luciferase, Activity Assay, Cotransfection, Transfection

    Autoregulation of BIS was not mediated by the alteration of mRNA stability. (A) The sequencing results of genotyping in BIS-KO A549 cells show the deletion in exon 1 of the BIS gene and consequent generation of a premature stop codon. (B) WT and BIS-KO A549 cells were treated with actinomycin D for up to 24 h. At the indicated times, mRNA was extracted, and the remaining BIS mRNA was measured and compared to the initial value with qRT-PCR analysis (mean±SE, n =3). (C) The coding region of the WT BIS and the deletion mutant of the BIS gene, in which 14 bp were deleted (Δ14), were cloned into the pEGFP-C1 construct (left). After transfection for 48 h, the GFP mRNA levels representing WT and Δ14-BIS were determined with PCR amplification and agarose electrophoresis by loading different quantities of PCR products (right). (D) The BIS pre-mRNA levels were determined in WT A549 and BIS-KO A549 cells using qRT-PCR analysis with specific primers for intron 2 (solid arrows). The BIS mature mRNA was levels were also determined by the primers covering exon 2 and 3 (dotted arrows). Reverse transcription was performed as described in Method section. * p≤0.05 vs . WT.

    Journal: The Korean Journal of Physiology & Pharmacology : Official Journal of the Korean Physiological Society and the Korean Society of Pharmacology

    Article Title: Effect of BIS depletion on HSF1-dependent transcriptional activation in A549 non-small cell lung cancer cells

    doi: 10.4196/kjpp.2018.22.4.457

    Figure Lengend Snippet: Autoregulation of BIS was not mediated by the alteration of mRNA stability. (A) The sequencing results of genotyping in BIS-KO A549 cells show the deletion in exon 1 of the BIS gene and consequent generation of a premature stop codon. (B) WT and BIS-KO A549 cells were treated with actinomycin D for up to 24 h. At the indicated times, mRNA was extracted, and the remaining BIS mRNA was measured and compared to the initial value with qRT-PCR analysis (mean±SE, n =3). (C) The coding region of the WT BIS and the deletion mutant of the BIS gene, in which 14 bp were deleted (Δ14), were cloned into the pEGFP-C1 construct (left). After transfection for 48 h, the GFP mRNA levels representing WT and Δ14-BIS were determined with PCR amplification and agarose electrophoresis by loading different quantities of PCR products (right). (D) The BIS pre-mRNA levels were determined in WT A549 and BIS-KO A549 cells using qRT-PCR analysis with specific primers for intron 2 (solid arrows). The BIS mature mRNA was levels were also determined by the primers covering exon 2 and 3 (dotted arrows). Reverse transcription was performed as described in Method section. * p≤0.05 vs . WT.

    Article Snippet: After verification of the correct sequences, the PCR product was then digested and cloned into XhoI and EcoRI sites of pEGFP-C1 (Promega).

    Techniques: Sequencing, Quantitative RT-PCR, Mutagenesis, Clone Assay, Construct, Transfection, Polymerase Chain Reaction, Amplification, Electrophoresis

    In developing neurons, AP2 contributes to endocytosis of transferrin receptor but not GluA2 under basal culture conditions. a Representative confocal images of RAT2 fibroblasts exposed to fluorescently labeled transferrin. Cells were electroporated for 2 days with empty pSuper or pSuper-shAP2b1#2 (shAP2b1) and pEGFP-C1 for the identification of transfected cells ( arrows ). After 2 days, the cells were starved overnight prior to 5 or 10 min fluorescently labeled transferrin uptake. Scale bar = 20 μm. b Quantification of integrated density of transferrin fluorescence in the cell body of RAT2 fibroblasts transfected and treated as in a . The data are expressed as a mean value normalized to control. Error bars indicate SEM. *** p

    Journal: Molecular Neurobiology

    Article Title: Adaptor Complex 2 Controls Dendrite Morphology via mTOR-Dependent Expression of GluA2

    doi: 10.1007/s12035-017-0436-3

    Figure Lengend Snippet: In developing neurons, AP2 contributes to endocytosis of transferrin receptor but not GluA2 under basal culture conditions. a Representative confocal images of RAT2 fibroblasts exposed to fluorescently labeled transferrin. Cells were electroporated for 2 days with empty pSuper or pSuper-shAP2b1#2 (shAP2b1) and pEGFP-C1 for the identification of transfected cells ( arrows ). After 2 days, the cells were starved overnight prior to 5 or 10 min fluorescently labeled transferrin uptake. Scale bar = 20 μm. b Quantification of integrated density of transferrin fluorescence in the cell body of RAT2 fibroblasts transfected and treated as in a . The data are expressed as a mean value normalized to control. Error bars indicate SEM. *** p

    Article Snippet: The following sequences were used: 5′-GTCTCACAACAAGATATGT-3′ (scrAP2b1#1), 5′-GATCATTACCCGTACTATA-3′ (scrAP2b1#2), and 5′-GGGTGAGATCATGAGAGAA-3′ (scrAP2b1#3). shAP2b1#2 was additionally subcloned to pUltra-Chili to obtain pUltra-Chili-shAP2b1. pEGFP-AP2b1 was obtained by subcloning rat AP2b1 cDNA into EcoRI/SalI sites of pEGFP-C1. pEGFP-AP2b1*, a plasmid that encodes the shRNA#2-resistant mutant of AP2b1, was generated from pEGFP-AP2b1 by introducing silent mutations in the shRNA target region using the QuikChange Site-Directed Mutagenesis System (Stratagene, Santa Clara, CA) with the following primers: 5′-GATCAGTGAGTCTCACCCAAACAGTAACCTGCTCGACTTGAACCCTCAGAATATC -3′ and 5′-GATATTCTGAGGGTTCAAGTCGAGCAGGTTACTGTTTGGGTGAGACTCACTGATC -3′. pGW1-GluA2ΔSP was obtained by deleting the N-terminal signal peptide (MQKIMHISVLLSPVLWGLIFGV) from the wild-type GluA2 construct according to the protocol of the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA) using the following primers: 5′-CATTTCCAAGAA-AAGTAGAGCATAAG-3′ and 5′-TACCCATACGACGTCCCAGACTAC-3′.

    Techniques: Labeling, Transfection, Fluorescence

    Overexpression of sAnk1 decreased glucose uptake in C2C12 cells. ( A ) The efficiency of pEGFP-c1-sAnk1 transferred in C2C12 cells. C2C12 cells were transfected with the pEGFP-c1-sAnk1 plasmid. After differentiation, total RNA and protein isolates were analyzed by qPCR and western blotting, respectively. ( B ) Glucose uptake in C2C12 cells after transfection with the pEGFP-c1-sAnk1 plasmid and subsequent differentiation. The data shown are the mean ± S.D. P values were calculated by Student’s t-test.

    Journal: Scientific Reports

    Article Title: A novel type 2 diabetes risk allele increases the promoter activity of the muscle-specific small ankyrin 1 gene

    doi: 10.1038/srep25105

    Figure Lengend Snippet: Overexpression of sAnk1 decreased glucose uptake in C2C12 cells. ( A ) The efficiency of pEGFP-c1-sAnk1 transferred in C2C12 cells. C2C12 cells were transfected with the pEGFP-c1-sAnk1 plasmid. After differentiation, total RNA and protein isolates were analyzed by qPCR and western blotting, respectively. ( B ) Glucose uptake in C2C12 cells after transfection with the pEGFP-c1-sAnk1 plasmid and subsequent differentiation. The data shown are the mean ± S.D. P values were calculated by Student’s t-test.

    Article Snippet: Plasmid construction The coding sequence of sAnk1 (GenBank: Accession No. U73972) was generated and cloned into pEGFP-C1 (GENEWIZ Biological Technology Co., Ltd., South Plainfield, NJ, USA).

    Techniques: Over Expression, Transfection, Plasmid Preparation, Real-time Polymerase Chain Reaction, Western Blot