pe1.0 primer Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    Illumina Inc pe1 0 primer
    The IMPLICON method A. Schematic view of the murine karyotype depicting the location of the regions detected by IMPLICON; black arrowheads – control regions; red arrowheads – imprinted regions. B. Schematic representation of the mouse Dlk1-Dio3 imprinted cluster; Mat – Maternal inherited chromosome; Pat – Paternal inherited chromosome; ICR – imprinting control region; red arrows – primers to amplify Dlk1-Dio3 ICR; genomic region is not drawn to scale. C. Brief scheme of the IMPLICON method and its approximate timeline; bisulfite conversion of genomic DNA converts unmethylated cytosines to uracils (letters in yellow), whilst methylated cytosines are retained as cytosines (in white); two rounds of PCR are then performed: the 1 st PCR amplifies each region for each sample separately and adds 8 random nucleotides (N 8 ) for data deduplication and adapter sequences; after pooling amplicons for each biological sample, a 2 nd PCR completes a sequence-ready library with sample-barcodes for multiplexing; white lollipops – unmethylated CpGs; black lollipops – methylated CpGs; black DNA strand – targeted strand for amplification; light grey DNA strand – strand not targeted for amplification; Dark grey and green boxes - primers annealing the targeted strand (dark grey), containing adapter sequences (green); green and yellow - primers annealing the adapters (green), containing barcoded <t>Illumina</t> adapters and Illumina PE1.0 primer sequence (yellow).
    Pe1 0 Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 91/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pe1 0 primer/product/Illumina Inc
    Average 91 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    pe1 0 primer - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    90
    Illumina Inc pe 1 0 primer aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct
    The IMPLICON method A. Schematic view of the murine karyotype depicting the location of the regions detected by IMPLICON; black arrowheads – control regions; red arrowheads – imprinted regions. B. Schematic representation of the mouse Dlk1-Dio3 imprinted cluster; Mat – Maternal inherited chromosome; Pat – Paternal inherited chromosome; ICR – imprinting control region; red arrows – primers to amplify Dlk1-Dio3 ICR; genomic region is not drawn to scale. C. Brief scheme of the IMPLICON method and its approximate timeline; bisulfite conversion of genomic DNA converts unmethylated cytosines to uracils (letters in yellow), whilst methylated cytosines are retained as cytosines (in white); two rounds of PCR are then performed: the 1 st PCR amplifies each region for each sample separately and adds 8 random nucleotides (N 8 ) for data deduplication and adapter sequences; after pooling amplicons for each biological sample, a 2 nd PCR completes a sequence-ready library with sample-barcodes for multiplexing; white lollipops – unmethylated CpGs; black lollipops – methylated CpGs; black DNA strand – targeted strand for amplification; light grey DNA strand – strand not targeted for amplification; Dark grey and green boxes - primers annealing the targeted strand (dark grey), containing adapter sequences (green); green and yellow - primers annealing the adapters (green), containing barcoded <t>Illumina</t> adapters and Illumina PE1.0 primer sequence (yellow).
    Pe 1 0 Primer Aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pe 1 0 primer aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct/product/Illumina Inc
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    pe 1 0 primer aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    91
    Illumina Inc primer m1
    The IMPLICON method A. Schematic view of the murine karyotype depicting the location of the regions detected by IMPLICON; black arrowheads – control regions; red arrowheads – imprinted regions. B. Schematic representation of the mouse Dlk1-Dio3 imprinted cluster; Mat – Maternal inherited chromosome; Pat – Paternal inherited chromosome; ICR – imprinting control region; red arrows – primers to amplify Dlk1-Dio3 ICR; genomic region is not drawn to scale. C. Brief scheme of the IMPLICON method and its approximate timeline; bisulfite conversion of genomic DNA converts unmethylated cytosines to uracils (letters in yellow), whilst methylated cytosines are retained as cytosines (in white); two rounds of PCR are then performed: the 1 st PCR amplifies each region for each sample separately and adds 8 random nucleotides (N 8 ) for data deduplication and adapter sequences; after pooling amplicons for each biological sample, a 2 nd PCR completes a sequence-ready library with sample-barcodes for multiplexing; white lollipops – unmethylated CpGs; black lollipops – methylated CpGs; black DNA strand – targeted strand for amplification; light grey DNA strand – strand not targeted for amplification; Dark grey and green boxes - primers annealing the targeted strand (dark grey), containing adapter sequences (green); green and yellow - primers annealing the adapters (green), containing barcoded <t>Illumina</t> adapters and Illumina PE1.0 primer sequence (yellow).
    Primer M1, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer m1/product/Illumina Inc
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    primer m1 - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    84
    Illumina Inc primer u2
    The IMPLICON method A. Schematic view of the murine karyotype depicting the location of the regions detected by IMPLICON; black arrowheads – control regions; red arrowheads – imprinted regions. B. Schematic representation of the mouse Dlk1-Dio3 imprinted cluster; Mat – Maternal inherited chromosome; Pat – Paternal inherited chromosome; ICR – imprinting control region; red arrows – primers to amplify Dlk1-Dio3 ICR; genomic region is not drawn to scale. C. Brief scheme of the IMPLICON method and its approximate timeline; bisulfite conversion of genomic DNA converts unmethylated cytosines to uracils (letters in yellow), whilst methylated cytosines are retained as cytosines (in white); two rounds of PCR are then performed: the 1 st PCR amplifies each region for each sample separately and adds 8 random nucleotides (N 8 ) for data deduplication and adapter sequences; after pooling amplicons for each biological sample, a 2 nd PCR completes a sequence-ready library with sample-barcodes for multiplexing; white lollipops – unmethylated CpGs; black lollipops – methylated CpGs; black DNA strand – targeted strand for amplification; light grey DNA strand – strand not targeted for amplification; Dark grey and green boxes - primers annealing the targeted strand (dark grey), containing adapter sequences (green); green and yellow - primers annealing the adapters (green), containing barcoded <t>Illumina</t> adapters and Illumina PE1.0 primer sequence (yellow).
    Primer U2, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer u2/product/Illumina Inc
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    primer u2 - by Bioz Stars, 2020-08
    84/100 stars
      Buy from Supplier

    Image Search Results


    The IMPLICON method A. Schematic view of the murine karyotype depicting the location of the regions detected by IMPLICON; black arrowheads – control regions; red arrowheads – imprinted regions. B. Schematic representation of the mouse Dlk1-Dio3 imprinted cluster; Mat – Maternal inherited chromosome; Pat – Paternal inherited chromosome; ICR – imprinting control region; red arrows – primers to amplify Dlk1-Dio3 ICR; genomic region is not drawn to scale. C. Brief scheme of the IMPLICON method and its approximate timeline; bisulfite conversion of genomic DNA converts unmethylated cytosines to uracils (letters in yellow), whilst methylated cytosines are retained as cytosines (in white); two rounds of PCR are then performed: the 1 st PCR amplifies each region for each sample separately and adds 8 random nucleotides (N 8 ) for data deduplication and adapter sequences; after pooling amplicons for each biological sample, a 2 nd PCR completes a sequence-ready library with sample-barcodes for multiplexing; white lollipops – unmethylated CpGs; black lollipops – methylated CpGs; black DNA strand – targeted strand for amplification; light grey DNA strand – strand not targeted for amplification; Dark grey and green boxes - primers annealing the targeted strand (dark grey), containing adapter sequences (green); green and yellow - primers annealing the adapters (green), containing barcoded Illumina adapters and Illumina PE1.0 primer sequence (yellow).

    Journal: bioRxiv

    Article Title: IMPLICON: an ultra-deep sequencing method to uncover DNA methylation at imprinted regions

    doi: 10.1101/2020.03.21.000042

    Figure Lengend Snippet: The IMPLICON method A. Schematic view of the murine karyotype depicting the location of the regions detected by IMPLICON; black arrowheads – control regions; red arrowheads – imprinted regions. B. Schematic representation of the mouse Dlk1-Dio3 imprinted cluster; Mat – Maternal inherited chromosome; Pat – Paternal inherited chromosome; ICR – imprinting control region; red arrows – primers to amplify Dlk1-Dio3 ICR; genomic region is not drawn to scale. C. Brief scheme of the IMPLICON method and its approximate timeline; bisulfite conversion of genomic DNA converts unmethylated cytosines to uracils (letters in yellow), whilst methylated cytosines are retained as cytosines (in white); two rounds of PCR are then performed: the 1 st PCR amplifies each region for each sample separately and adds 8 random nucleotides (N 8 ) for data deduplication and adapter sequences; after pooling amplicons for each biological sample, a 2 nd PCR completes a sequence-ready library with sample-barcodes for multiplexing; white lollipops – unmethylated CpGs; black lollipops – methylated CpGs; black DNA strand – targeted strand for amplification; light grey DNA strand – strand not targeted for amplification; Dark grey and green boxes - primers annealing the targeted strand (dark grey), containing adapter sequences (green); green and yellow - primers annealing the adapters (green), containing barcoded Illumina adapters and Illumina PE1.0 primer sequence (yellow).

    Article Snippet: The 20μl PCR pool was amplified using 1μl of 10μM Illumina PE1.0 primer (same for all samples), 1μl of 10μM Illumina iTAG primer (distinct for each sample) and 25μl 2x KAPA HiFi Uracil+ ReadyMix in a 50μl reaction using the following conditions: initial denaturation at 98°C for 45 seconds, 5 cycles of 98°C denaturation for 15 seconds, 65°C annealing for 30 seconds and extension at 72°C for 30 seconds; followed by a final extension at 72°C for 5 minutes.

    Techniques: Methylation, Polymerase Chain Reaction, Sequencing, Multiplexing, Amplification