pcr-positive transformants Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher pcr buffer
    Molecular analysis in transgenic soybean plants. <t>PCR</t> products of hpt II and SnOLP genes amplified from <t>DNA</t> extracted from transgenic plants and controls. Detection of the Sn OLP protein (~27 kDa) in soybean plants by Western blot hybridization. +: vector pCL1390-UBQ3- Sn OLP (PCR positive control). B1, B2 and B3 lines: plants recovered from three putative transformation events. B1 line was represented by 10 clone plants. B2 and B3 lines were represented by one plant each. Two Bragg wild-type (WT) plants were used as negative controls.
    Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 28828 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr buffer/product/Thermo Fisher
    Average 99 stars, based on 28828 article reviews
    Price from $9.99 to $1999.99
    pcr buffer - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    Millipore smarca4
    BRD4-SWI/SNF interaction maintains NRG1 expression and is necessary for BRD4-mediated transformation. (A) Summary of IOSE proteomics experiment. (B) Gene-ontology analysis of BRD4 short-isoform proteomics hits. (C) Immunoprecipitations were carried out using FLAG (left) or BRD4 (right) antibodies in IOSE cells expressing BRD4 long and short isoforms. Western blot analysis of the resulting immuno-complexes was carried out to determine the association between BRD4 isoforms and members of the SWI/SNF complex. CDK9, a component of the pTEFb complex that interacts with the long isoform of BRD4, is used as a positive control. (D) shRNA-mediated <t>SMARCA4</t> knockdown in BRD4-short expressing IOSE cells. (E) Soft-agar colony formation of shSMARCA4 expressing BRD4 short isoform-expressing IOSE cells. (F) Proliferation of shSMARCA4 expressing BRD4 short isoform-expressing IOSE cells. (G) qPCR analysis of NRG1 levels in IOSE cells overexpressing BRD4 isoforms after 4 days of siRNA-mediated SMARCA4 knockdown.
    Smarca4, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/smarca4/product/Millipore
    Average 99 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    smarca4 - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    91
    GATC Biotech positive transformants
    BRD4-SWI/SNF interaction maintains NRG1 expression and is necessary for BRD4-mediated transformation. (A) Summary of IOSE proteomics experiment. (B) Gene-ontology analysis of BRD4 short-isoform proteomics hits. (C) Immunoprecipitations were carried out using FLAG (left) or BRD4 (right) antibodies in IOSE cells expressing BRD4 long and short isoforms. Western blot analysis of the resulting immuno-complexes was carried out to determine the association between BRD4 isoforms and members of the SWI/SNF complex. CDK9, a component of the pTEFb complex that interacts with the long isoform of BRD4, is used as a positive control. (D) shRNA-mediated <t>SMARCA4</t> knockdown in BRD4-short expressing IOSE cells. (E) Soft-agar colony formation of shSMARCA4 expressing BRD4 short isoform-expressing IOSE cells. (F) Proliferation of shSMARCA4 expressing BRD4 short isoform-expressing IOSE cells. (G) qPCR analysis of NRG1 levels in IOSE cells overexpressing BRD4 isoforms after 4 days of siRNA-mediated SMARCA4 knockdown.
    Positive Transformants, supplied by GATC Biotech, used in various techniques. Bioz Stars score: 91/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/positive transformants/product/GATC Biotech
    Average 91 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    positive transformants - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    99
    Qiagen pcr purification kit
    Genetic alternations of BAF180 in breast cancer A , Genetic alteration of BAF180 in Bx41. Sequence analysis indicates Bx41 has duplication of exon 5, 6 and 7, producing stop codon at codon 222. The stop codon is underlined. B , Genetic alteration of BAF180 in breast cancer and its derived cell line SUM1315. On left, the <t>RT-PCR</t> product of SUM1315 showed an aberrant transcript. The set 2 primers were used. On right, Southern blot of tumor genomic <t>DNA</t> shows duplication of exons in tumor biopsy taken from lymph node ( lane 3 ) and in the cell line from the same patient SUM1315 ( lane 4 ). Rearranged fragment was detected in lane 3 and 4, but was not in lane 1 (unrelated normal blood DNA) and lane 2 (normal blood DNA from the same patient). DNAs were digested with Bgl II. The RT-PCR product of exon 15 through 17 was used for a probe. C , Genetic alteration of BAF180 in case 337. Exon sequencing revealed a nonsense mutation on exon 18 in a primary tumor sample (case 337). A corresponding normal sequence (case 336) is shown for comparison. D , Domains and mutations of BAF180. The BAF180 cDNA encodes a protein 1635 amino acids. Mutations are indicated with arrows. Homozygous deletion indicated with black bar.
    Pcr Purification Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 42554 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr purification kit/product/Qiagen
    Average 99 stars, based on 42554 article reviews
    Price from $9.99 to $1999.99
    pcr purification kit - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    93
    Millipore high fidelity pcr
    Transformation and virulence of restriction mutants of S. aureus USA300 strain NRS384. (A) <t>PCR</t> profiles (primers IM110/IM111) of the sauUSI region amplified from NRS384 (lanes 1), NRS384 hsdR INT sauUSI INT (lanes 2), and NRS384 hsdR INT sauUSI ECORV (lanes 3) without or with EcoRV digestion. (B) Concentrated pRMC2 <t>DNA</t> (5 µg) isolated from E . coli DH10B ( dam + dcm + ) (light grey bars) or DC10B ( dam + ) (dark grey bars) was electroporated into the strains described above, and transformants were enumerated. (C) Intravenous injection of 2 × 10 6 CFU into 6- to 7-week-old female A/J mice. On day 7 of infection, the mice were euthanized, both kidneys were aseptically removed, and the bacterial CFU were enumerated as described in Materials and Methods. Each symbol represents the value for an individual mouse, and the short black line represents the mean for the group of mice. The broken line denotes the limit of detection at 333 CFU for the two kidneys.
    High Fidelity Pcr, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 107 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity pcr/product/Millipore
    Average 93 stars, based on 107 article reviews
    Price from $9.99 to $1999.99
    high fidelity pcr - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    93
    Agilent technologies pcr reaction
    Determination of proper <t>transposon</t> insertion. Confirmation of transposon insertions was performed by <t>PCR</t> for presence of transposon ( ermG ) ( A ). “Mwt” = molecular weight marker, “+” = positive control (gDNA from E. coli /pSAM_Bt); “-“= a negative control ( P. gingivalis ATCC 33277). All other lanes contain amplicons from PCR of individual colonies of transformed P. gingivalis . Panels ( B ) and ( C ) show PCR of the same samples using primers for the bla and himar1c19a genes respectively that are present in the plasmid, but which should be lost with proper insertion of the transposon. These three panels are a combination of separate gels; all which were run using identical PCR gDNA template for each of the separate reactions. ( D ) Nested semi-random PCR for individual mutant sequencing preparation. PCR from individual colonies was performed using primers to Mariner transposon and random primers ARB1 and ARB2 (Additional file 6 : Table S6). Two rounds of nested PCR were performed. Negative controls of wild-type P. gingivalis strain ATCC 33277 ( Pg ), template only (T) and primer only (P) lanes precede thirteen individual mutants.
    Pcr Reaction, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 93/100, based on 899 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr reaction/product/Agilent technologies
    Average 93 stars, based on 899 article reviews
    Price from $9.99 to $1999.99
    pcr reaction - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    90
    GATC Biotech colony pcr
    Determination of proper <t>transposon</t> insertion. Confirmation of transposon insertions was performed by <t>PCR</t> for presence of transposon ( ermG ) ( A ). “Mwt” = molecular weight marker, “+” = positive control (gDNA from E. coli /pSAM_Bt); “-“= a negative control ( P. gingivalis ATCC 33277). All other lanes contain amplicons from PCR of individual colonies of transformed P. gingivalis . Panels ( B ) and ( C ) show PCR of the same samples using primers for the bla and himar1c19a genes respectively that are present in the plasmid, but which should be lost with proper insertion of the transposon. These three panels are a combination of separate gels; all which were run using identical PCR gDNA template for each of the separate reactions. ( D ) Nested semi-random PCR for individual mutant sequencing preparation. PCR from individual colonies was performed using primers to Mariner transposon and random primers ARB1 and ARB2 (Additional file 6 : Table S6). Two rounds of nested PCR were performed. Negative controls of wild-type P. gingivalis strain ATCC 33277 ( Pg ), template only (T) and primer only (P) lanes precede thirteen individual mutants.
    Colony Pcr, supplied by GATC Biotech, used in various techniques. Bioz Stars score: 90/100, based on 95 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/colony pcr/product/GATC Biotech
    Average 90 stars, based on 95 article reviews
    Price from $9.99 to $1999.99
    colony pcr - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    91
    Genechem pcr authentication
    Determination of proper <t>transposon</t> insertion. Confirmation of transposon insertions was performed by <t>PCR</t> for presence of transposon ( ermG ) ( A ). “Mwt” = molecular weight marker, “+” = positive control (gDNA from E. coli /pSAM_Bt); “-“= a negative control ( P. gingivalis ATCC 33277). All other lanes contain amplicons from PCR of individual colonies of transformed P. gingivalis . Panels ( B ) and ( C ) show PCR of the same samples using primers for the bla and himar1c19a genes respectively that are present in the plasmid, but which should be lost with proper insertion of the transposon. These three panels are a combination of separate gels; all which were run using identical PCR gDNA template for each of the separate reactions. ( D ) Nested semi-random PCR for individual mutant sequencing preparation. PCR from individual colonies was performed using primers to Mariner transposon and random primers ARB1 and ARB2 (Additional file 6 : Table S6). Two rounds of nested PCR were performed. Negative controls of wild-type P. gingivalis strain ATCC 33277 ( Pg ), template only (T) and primer only (P) lanes precede thirteen individual mutants.
    Pcr Authentication, supplied by Genechem, used in various techniques. Bioz Stars score: 91/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr authentication/product/Genechem
    Average 91 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    pcr authentication - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    91
    QIAGEN pcr array
    <t>PCR</t> array identifies metastasis and invasion downstream genes of <t>miR-335.</t> a , b Expression profiles of genes involved in metastasis and tumor invasion in AGS cells transfected with miR-335 mimic or with miR-335 inhibitor. Expression levels were normalized to three endogenous genes. Results indicate the mean values of three independent experiments ± SD. c ΔCq of PLAUR in 19 gastric tumor tissues compared to their matched non-tumor adjacent tissues (NAT) and normalized to reference genes. Data were transformed to logarithmic values (−log). d Relative expression of PLAUR in 19 samples of gastric tumor tissues, normalized to reference genes. e ΔCq of CDH11 in 19 gastric tumor tissues compared to NAT and normalized to reference genes. Data were transformed to logarithmic values (−log). f Relative expression of CHD11 in 19 samples of gastric tumor tissues, normalized to reference genes. Data were transformed to logarithmic values (log 2). g Direct interaction between miR-335 and CDH11 was detected by dual-luciferase reporter assay. Over-expression of miR-335 in AGS cells reduced the luciferase signal of CDH11 compared with NC mimic, while mutation of the miR-335-binding site diminished this suppressive effect. * р
    Pcr Array, supplied by QIAGEN, used in various techniques. Bioz Stars score: 91/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr array/product/QIAGEN
    Average 91 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    pcr array - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    94
    Bio-Rad pcr assays
    DDX5 gene is co-amplified with <t>MIR21</t> and DDX5 facilitates maturation of pri-miR-21. a Immunoprecipitation (IP) and western blotting analyses were performed using indicated antibodies. Normal immunoglobulin G (IgG) was used as a negative control for IP. The RNA-binding protein DDX1 was used as a positive control for the Drosha-binding proteins. b The DDX5-bound pri-miRNAs were immunoprecipitated with DDX5 and analyzed by <t>qRT-PCR.</t> Control IgG was used as a negative control. c Levels of primary or mature forms of miR-21 were analyzed in control and DDX5-knockdown breast cancer cells harboring 17q23 amplicon. d Levels of mature miR-21 and DDX5 were analyzed in breast tumor samples using in situ hybridization and immunohistochemistry. Representative staining images of tissue samples are shown. Scale bar, 100 μm. e Soft agar colony formation assays with MMTV-ErbB2 mouse mammary epithelial cells transduced with control vector or lentiviral vector expressing the indicated genes. Representative images are shown in the middle panel and relative expression levels of mature miR-16 or miR-21 are shown in the right panel. * p
    Pcr Assays, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1094 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr assays/product/Bio-Rad
    Average 94 stars, based on 1094 article reviews
    Price from $9.99 to $1999.99
    pcr assays - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    93
    Bioneer Corporation pcr premix
    Development of transgenic alfalfa expressing IbOr under the control of the SWPA2 promoter (SOR plants). (A) Diagram of the oxidative stress-inducible SWPA2 promoter: IbOr construct used for alfalfa transformation. Vertical bar shows the primer set ( A2pro :: IbOr ) used for genomic <t>PCR</t> analysis. (B) Genomic <t>DNA</t> PCR analysis using the A2pro :: IbOr primer set. Numbers (1–11) represent independent transgenic lines. M, size markers; NT, non-transgenic plant; PC, positive control. (C) RT-PCR analysis of 11 lines expressing stable IbOr gene integration in transgenic plants following 2 h of 5 μM MV treatment.
    Pcr Premix, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 93/100, based on 1109 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr premix/product/Bioneer Corporation
    Average 93 stars, based on 1109 article reviews
    Price from $9.99 to $1999.99
    pcr premix - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    94
    Millipore pcr dig probe synthesis kit
    Characterization of transplastomic tobacco plants. (A) Southern blot confirming homoplastomy of the transformed tobacco lines. Tobacco DNA was cut with restriction enzymes and separated on an agarose gel for blotting. A probe hybridizing to homologous recombination regions in tobacco plastids was used to confirm insertion/integration of dsRNA expression cassettes into plastid DNA. A single band of the expected size was observed in each DNA sample; 1, <t>DIG-labeled</t> marker; 2 DNA from WT tobacco; 3, DNA from tobacco with v-ATPaseA dsRNA expression cassette; 4, DNA from tobacco with GFP dsRNA expression cassette. All DNA samples display single bands which confirm homoplastomy of transformed plants. (B) <t>RT-PCR</t> confirming expression of v-ATPaseA dsRNA and GFP dsRNA in transplastomic plants. Primers annealing to dsRNA sequences were used to confirm production of dsRNA in transplastomic tobacco plants. Tobacco EF1-α gene was used as a positive control and NRT reactions confirmed absence of DNA contamination in cDNA preparations.
    Pcr Dig Probe Synthesis Kit, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 61 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr dig probe synthesis kit/product/Millipore
    Average 94 stars, based on 61 article reviews
    Price from $9.99 to $1999.99
    pcr dig probe synthesis kit - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    94
    Roche qrt pcr analysis
    Real-time quantitative reverse transcription polymerase chain reaction <t>(qRT-PCR)</t> analysis of the expression of the transformed gene Gh_A07G0747 ( GhTOM ) . ( A ) Total RNA isolated from two-week-old cotton plant under normal conditions; ( B ) Total RNA extracted from salt-stressed cotton seedlings; ( C ) Polymerase chain reaction (PCR) analysis performed to check 978 bp coding sequence (CDS) integration in transformed T0 generation, number 1–13 transgenic lines, 14 positive control ( pWM101-Gh_A07G0747 ( GhTOM )), and 15 is the negative control (wild-type, WT). Expression of the transformed genes in transgenic; ( D ) the transcripts levels of the Gh_A07G0747 (GhTOM) of T2 transgenic lines analysed through qRT-PCR.
    Qrt Pcr Analysis, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 1820 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr analysis/product/Roche
    Average 94 stars, based on 1820 article reviews
    Price from $9.99 to $1999.99
    qrt pcr analysis - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    85
    Roche pcr dig labelling mix
    Genetic analysis of LCF1. ( a ) Southern blot on Nco I digested genomic DNA (gDNA) of empty vector control plants (Col-0 transformed with pRF-VP16-Kana not containing a 3F fragment; lane 2) and LCF1 (lane 3). Lane 1 contains <t>DIG-labelled</t> DNA ladder. The DIG-labelled probe was expected to hybridize with fragments of the promoter of the endogenous RPS5a gene (10695 bp fragment), the RPS5a promoter (p RPS5a ) from the T-DNA construct (2590 bp fragment with intensity depending on the copy number of the insert), and the (3F)-VP16 fusion encoding part of each T-DNA insert in the genome (fragments of ≥~1500 bp for LCF1 and ≥~800 bp for the empty vector control without 3F). ( b ) Map of the 3F-VP16 encoding T-DNA construct in MORC2 (At4g36280) of LCF1. MORC2 is presented to scale. Exons are presented as grey boxes. 5′ and 3′ untranslated regions (UTRs) are presented as white boxes. The T-DNA insert is not presented to scale. ( c ) <t>RT-PCR</t> analysis of MORC2 expression in Col-0 and LCF1 plants. The genes ATG6 (At3g61710) and SCAMP5 (At1g32050) serve as a controls for gene expression. Expression of the 3F-VP16 construct in LCF1 was verified as a positive control. ( d ) False color φPSII images of Col-0 and LCF1 plants (T1 generation; obtained through selection with PPT) harboring T-DNA constructs with either the GUS gene under control of the CaMV 35S promoter ( p35S::GUS ), the full length genomic sequence of MORC2 under control of its own promoter and terminator sequences (p MORC::MORC2 ) to assay for complementation, or the cDNA encoding MORC2 under control of the NOS promoter and terminator sequences ( pNOS::MORC2 ) to assay for complementation. The variation in size among the transformants was due to herbicide selection and subsequent transfer from selection medium to soil. ( e ) RT-qPCR analysis of the expression of the 5′ end of MORC2 ( MORC2Δ3 ′) and of the two neighboring genes At4g36270 and At4g36290 ( MORC1 ). Expression of the 3F-VP16 construct in LCF1 was quantified as a positive control. Relative expression values were obtained by normalizing to the expression values of the genes ATG6 and SCAMP5 . Error bars represent SEM values (n = 4). The presented data are the average of two technical replicates.
    Pcr Dig Labelling Mix, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 56 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr dig labelling mix/product/Roche
    Average 85 stars, based on 56 article reviews
    Price from $9.99 to $1999.99
    pcr dig labelling mix - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    91
    Roche transcriptase pcr rt pcr
    Correlation of IL-13 upregulation with HTLV-1 Tax synthesis. The impact of Tax on endogenous IL-13 expression in Jurkat T cells and in Tax-immortalized primary human T cells (Tesi) was investigated. (A) Jurkat cells were transfected with a Tax expression plasmid; <t>RNA</t> was reverse transcribed and analyzed by <t>PCR.</t> As an internal standard, β-actin PCRs were performed with the same cDNA. (B) Human T cells transformed with a repressible Tax gene (Tesi) were kept under conditions of induced (Tesi) and repressed (Tesi+Tet) Tax expression. Total RNA was analyzed by Northern blotting with an IL-13-specific probe. C91-PL and StEd, HTLV-1-infected lymphocytes; PBMC + PHA and Jurkat, uninfected T lymphocytes. (C) Tissue culture supernatants of Jurkat, Tesi, and Tesi+Tet cells were subjected to IL-13 ELISA. The results represent the means from three experiments. Error bars show standard deviations.
    Transcriptase Pcr Rt Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 68 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transcriptase pcr rt pcr/product/Roche
    Average 91 stars, based on 68 article reviews
    Price from $9.99 to $1999.99
    transcriptase pcr rt pcr - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    90
    MACHEREY NAGEL dna purification kit nucleospin pcr clean up
    <t>PCR</t> analysis of some progeny of transgenic plants. The presence of the gus gene was proven by electrophoresis of amplified product (300 bp) on gDNA from plants of T 1 families ( A ) and on cDNA from plants of T 2 progeny ( B ). <t>DNA</t> from non-transformed (control) plants was used as a negative control, while the plasmid (pWBVec10a) carried by the A. tumefaciens strain, was used as a positive control. The 1-kb DNA Molecular Weight Ladder is represented in the last lane.
    Dna Purification Kit Nucleospin Pcr Clean Up, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 90/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna purification kit nucleospin pcr clean up/product/MACHEREY NAGEL
    Average 90 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    dna purification kit nucleospin pcr clean up - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    99
    Millipore pcr genomic dna
    Screening of T 0 and T 1 Tr cry1Ac transgenic tomato plants. A–C <t>PCR</t> amplification of 995 bp of cry1Ac gene. D–F 678 bp of npt II gene using gene specific primers in thirty T 0 transgenics. G , H RT-PCR analysis of ten randomly selected T 0 transgenic tomato plants of cry1Ac showing 995 bp cry1Ac gene and 678 bp npt II gene transcripts. M – 100 bp <t>DNA</t> ladder (NEB, USA). -C – non-transgenic control plant, +C – plasmid DNA positive control. I Real-time analysis for Bt- cry1Ac transcript levels in six T 0 transgenic tomato plants. TC – Transgenic plant with low expression of Bt-toxin used as control. J–O PCR amplification of 995 bp of cry1Ac gene and 678 bp of npt II gene using gene specific primers inT 1 progeny of promising T 0 parents. M −100 bp DNA ladder (NEB, USA). –C : non-transgenic control plant, +C : plasmid DNA positive control.
    Pcr Genomic Dna, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 96 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr genomic dna/product/Millipore
    Average 99 stars, based on 96 article reviews
    Price from $9.99 to $1999.99
    pcr genomic dna - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    94
    TaKaRa pcr master mix
    <t>PCR</t> confirming the natural transformation in E. anophelis endophthalmitis. Lane 1: 1 kb <t>DNA</t> ladder. Lane 2: Positive control (pCMV-6 BDNF plasmid used as template). Expected band size of BDNF gene is 750 bp. Lane 3–5: PCR products from plasmid isolated from E. anophelis endophthalmitis after natural transformation. Lane 6–7: Negative controls.
    Pcr Master Mix, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 799 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr master mix/product/TaKaRa
    Average 94 stars, based on 799 article reviews
    Price from $9.99 to $1999.99
    pcr master mix - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript iii rt pcr system
    Expression of CmSPL genes ( a , b , c ) and cmo-MIR156 ( d , e ) in CmNF-YB8 -RNAi chrysanthemum plants. <t>qRT-PCR</t> was performed to evaluate the expression of each gene. UBIQUITIN was used as the control gene for CmSPL3 , CmSPL5 , CmSPL9 , and primary cmo-MIR156 expression. U6 was used as the control gene for cmo-miR156. <t>Three</t> independent experiments were performed and error bars indicate standard deviation. Asterisks indicate significant differences according to a Student’s t test (* P
    Superscript Iii Rt Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 312 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii rt pcr system/product/Thermo Fisher
    Average 99 stars, based on 312 article reviews
    Price from $9.99 to $1999.99
    superscript iii rt pcr system - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    92
    tiangen biotech co quantitative real time pcr detection
    Antiviral activity of shrimp fed mja-miR-35-expressing bacteria in vivo . (A) Expression of mature mja-miR-35 in bacteria. LITMUS 38i vector (vector alone) or LITMUS 38i-miR-35 expressing mja-miR-35 (recombinant plasmid) was transformed into Escherichia coli HT115 cells. After IPTG induction, Northern blotting was conducted to detect mja-miR-35. (B) Detection of mature mja-miR-35 in shrimp fed with bacteria expressing mja-miR-35. The bacteria expressing mja-miR-35 were mixed with shrimp feed and then the shrimp were fed with the mixed feed daily. At 48 h after feeding, the expression level of mja-miR-35 was detected by Northern blotting. U6 served as a loading control. (C) Influence of mja-miR-35 in shrimp fed with bacteria-mja-miR-35 on WSSV replication. The WSSV-infected shrimp were fed shrimp feed containing bacteria-mja-miR-35 or bacteria-mja-miR-35-scrambled daily. At different post-infection times, WSSV copy number was quantified by real-time <t>PCR.</t> WSSV alone was used as a positive control. (D) Effects of mja-miR-35 in shrimp fed with bacteria-mja-miR-35 on shrimp cumulative mortality. The shrimp were treated with WSSV and fed shrimp feed containing bacteria- mja-miR-35 or bacteria- mja-miR-35-scrambled. The shrimp cumulative mortality was examined every day. The treatments were shown at the top. (E) Impact of mja-miR-35 in shrimp fed with bacteria-mja-miR-35 on the expression of mja-miR-35 target viral genes. Shrimp were fed shrimp feed+bacteria-miR-34/bacteria-miR-34-scrambled daily. The shrimp were then infected with WSSV. WSSV alone was used as a control. At 48 h post-infection, the <t>mRNA</t> levels of viral genes were evaluated using quantitative real-time PCR. Statistically significant differences between treatments were indicated with asterisks (* p
    Quantitative Real Time Pcr Detection, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 92/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr detection/product/tiangen biotech co
    Average 92 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr detection - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    90
    Thermo Fisher step real time rt pcr
    RIN-mediated transcriptional regulation of β-Hex. (A) EMSA demonstrates the formation of DNA–protein complex between RIN and tomato β-Hex promoter fragments. EMSA was performed using double-stranded radiolabelled probes containing either 26-bp or 200-bp promoter fragments with normal (CArG and HP-200) or mutated (mCArG and mHP-200) CArG box elements with their flanking sequences. Cytosine (C) and guanine (G) were replaced with thymine (T) and adenine (A), respectively, to create mutated CArG probes. Specificity of the DNA–protein complex was analysed by using competitor DNAs. Arrows indicate DNA–protein complex. (B) EMSA shows binding of RIN protein to six different CArG boxes identified within the tomato β-Hex promoter. (C) Activation of the β-Hex promoter in the wild type (cv. Ailsa Craig) and rin mutant was determined by transient expression of GUS reporter in fruits. Mature green tomato fruits were agroinjected with HP::GUS construct. Agroinjected fruits were harvested at R stage and histochemical and fluorometric GUS assays were performed. Control fruits were agroinjected with 35S::GUS construct for constitutive expression of GUS reporter driven by CaMV 35S promoter. (D) Relative expression of β-Hex in wild type (cv. Ailsa Craig) and rin mutant fruits was determined by <t>qRT-PCR</t> using actin as an endogenous control. Data are presented as the mean (±SE) of two biological replicates.
    Step Real Time Rt Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 138 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/step real time rt pcr/product/Thermo Fisher
    Average 90 stars, based on 138 article reviews
    Price from $9.99 to $1999.99
    step real time rt pcr - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    89
    TaKaRa reverse transcription rt pcr analysis
    HRVVP7-CTB molecular detection was performed using polymerase chain reaction and western blotting. Agarose gel electrophoresis was used to screen for positive transgenic lines following amplification. (A) HRVVP7-CTB fusion transgenic Arabidopsis <t>thaliana</t> lines. pUC19-HRVVP7-linker-CTB plasmid was used as the positive control (+). (B) HRVVP7 transgenic A. thaliana lines. pPHAP1301-HRVVP7 plasmid was used as the positive control (+). Proteins expressed by transgenic A. thaliana were assessed using western blotting. (C) HRVVP7-linker-CTB and (D) HRVVP7 expressed in seeds of T3 transgenic A. thaliana lines. HRVVP7, human rotavirus VP7; CTB, cholera toxin B subunit; WT, wild type A. thaliana; +, positive control; M, marker.
    Reverse Transcription Rt Pcr Analysis, supplied by TaKaRa, used in various techniques. Bioz Stars score: 89/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse transcription rt pcr analysis/product/TaKaRa
    Average 89 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    reverse transcription rt pcr analysis - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    Image Search Results


    Molecular analysis in transgenic soybean plants. PCR products of hpt II and SnOLP genes amplified from DNA extracted from transgenic plants and controls. Detection of the Sn OLP protein (~27 kDa) in soybean plants by Western blot hybridization. +: vector pCL1390-UBQ3- Sn OLP (PCR positive control). B1, B2 and B3 lines: plants recovered from three putative transformation events. B1 line was represented by 10 clone plants. B2 and B3 lines were represented by one plant each. Two Bragg wild-type (WT) plants were used as negative controls.

    Journal: BMC Plant Biology

    Article Title: Expression of an osmotin-like protein from Solanum nigrum confers drought tolerance in transgenic soybean

    doi: 10.1186/s12870-014-0343-y

    Figure Lengend Snippet: Molecular analysis in transgenic soybean plants. PCR products of hpt II and SnOLP genes amplified from DNA extracted from transgenic plants and controls. Detection of the Sn OLP protein (~27 kDa) in soybean plants by Western blot hybridization. +: vector pCL1390-UBQ3- Sn OLP (PCR positive control). B1, B2 and B3 lines: plants recovered from three putative transformation events. B1 line was represented by 10 clone plants. B2 and B3 lines were represented by one plant each. Two Bragg wild-type (WT) plants were used as negative controls.

    Article Snippet: A melting curve analysis was performed at the end of the PCR run, over the range 55-99°C, increasing the temperature stepwise by 0.1°C every 1 s. Each 25-μL reaction contained 12.5 μL diluted DNA template, 1x PCR buffer (Invitrogen, São Paulo, Brazil), 2.4 mM MgCl2 , 0.024 mM dNTP, 0.1 μM each primer, 2.5 μL SYBR-Green (1:100.000, Molecular Probes Inc., Eugene, USA) and 0.3 U Platinum Taq DNA Polymerase (Invitrogen, São Paulo, Brazil).

    Techniques: Transgenic Assay, Polymerase Chain Reaction, Amplification, Western Blot, Hybridization, Plasmid Preparation, Positive Control, Transformation Assay

    BRD4-SWI/SNF interaction maintains NRG1 expression and is necessary for BRD4-mediated transformation. (A) Summary of IOSE proteomics experiment. (B) Gene-ontology analysis of BRD4 short-isoform proteomics hits. (C) Immunoprecipitations were carried out using FLAG (left) or BRD4 (right) antibodies in IOSE cells expressing BRD4 long and short isoforms. Western blot analysis of the resulting immuno-complexes was carried out to determine the association between BRD4 isoforms and members of the SWI/SNF complex. CDK9, a component of the pTEFb complex that interacts with the long isoform of BRD4, is used as a positive control. (D) shRNA-mediated SMARCA4 knockdown in BRD4-short expressing IOSE cells. (E) Soft-agar colony formation of shSMARCA4 expressing BRD4 short isoform-expressing IOSE cells. (F) Proliferation of shSMARCA4 expressing BRD4 short isoform-expressing IOSE cells. (G) qPCR analysis of NRG1 levels in IOSE cells overexpressing BRD4 isoforms after 4 days of siRNA-mediated SMARCA4 knockdown.

    Journal: PLoS ONE

    Article Title: BRD4 amplification facilitates an oncogenic gene expression program in high-grade serous ovarian cancer and confers sensitivity to BET inhibitors

    doi: 10.1371/journal.pone.0200826

    Figure Lengend Snippet: BRD4-SWI/SNF interaction maintains NRG1 expression and is necessary for BRD4-mediated transformation. (A) Summary of IOSE proteomics experiment. (B) Gene-ontology analysis of BRD4 short-isoform proteomics hits. (C) Immunoprecipitations were carried out using FLAG (left) or BRD4 (right) antibodies in IOSE cells expressing BRD4 long and short isoforms. Western blot analysis of the resulting immuno-complexes was carried out to determine the association between BRD4 isoforms and members of the SWI/SNF complex. CDK9, a component of the pTEFb complex that interacts with the long isoform of BRD4, is used as a positive control. (D) shRNA-mediated SMARCA4 knockdown in BRD4-short expressing IOSE cells. (E) Soft-agar colony formation of shSMARCA4 expressing BRD4 short isoform-expressing IOSE cells. (F) Proliferation of shSMARCA4 expressing BRD4 short isoform-expressing IOSE cells. (G) qPCR analysis of NRG1 levels in IOSE cells overexpressing BRD4 isoforms after 4 days of siRNA-mediated SMARCA4 knockdown.

    Article Snippet: shRNA lentiviral viral particles targeting NRG1 (#SHCLND- ) and SMARCA4 (#SHCLNV- ) were obtained from Sigma-Aldrich.

    Techniques: Expressing, Transformation Assay, Western Blot, Positive Control, shRNA, Real-time Polymerase Chain Reaction

    Genetic alternations of BAF180 in breast cancer A , Genetic alteration of BAF180 in Bx41. Sequence analysis indicates Bx41 has duplication of exon 5, 6 and 7, producing stop codon at codon 222. The stop codon is underlined. B , Genetic alteration of BAF180 in breast cancer and its derived cell line SUM1315. On left, the RT-PCR product of SUM1315 showed an aberrant transcript. The set 2 primers were used. On right, Southern blot of tumor genomic DNA shows duplication of exons in tumor biopsy taken from lymph node ( lane 3 ) and in the cell line from the same patient SUM1315 ( lane 4 ). Rearranged fragment was detected in lane 3 and 4, but was not in lane 1 (unrelated normal blood DNA) and lane 2 (normal blood DNA from the same patient). DNAs were digested with Bgl II. The RT-PCR product of exon 15 through 17 was used for a probe. C , Genetic alteration of BAF180 in case 337. Exon sequencing revealed a nonsense mutation on exon 18 in a primary tumor sample (case 337). A corresponding normal sequence (case 336) is shown for comparison. D , Domains and mutations of BAF180. The BAF180 cDNA encodes a protein 1635 amino acids. Mutations are indicated with arrows. Homozygous deletion indicated with black bar.

    Journal: Cancer research

    Article Title: BAF180 is a critical regulator of p21 induction and a tumor suppressor mutated in breast cancer

    doi: 10.1158/0008-5472.CAN-07-5276

    Figure Lengend Snippet: Genetic alternations of BAF180 in breast cancer A , Genetic alteration of BAF180 in Bx41. Sequence analysis indicates Bx41 has duplication of exon 5, 6 and 7, producing stop codon at codon 222. The stop codon is underlined. B , Genetic alteration of BAF180 in breast cancer and its derived cell line SUM1315. On left, the RT-PCR product of SUM1315 showed an aberrant transcript. The set 2 primers were used. On right, Southern blot of tumor genomic DNA shows duplication of exons in tumor biopsy taken from lymph node ( lane 3 ) and in the cell line from the same patient SUM1315 ( lane 4 ). Rearranged fragment was detected in lane 3 and 4, but was not in lane 1 (unrelated normal blood DNA) and lane 2 (normal blood DNA from the same patient). DNAs were digested with Bgl II. The RT-PCR product of exon 15 through 17 was used for a probe. C , Genetic alteration of BAF180 in case 337. Exon sequencing revealed a nonsense mutation on exon 18 in a primary tumor sample (case 337). A corresponding normal sequence (case 336) is shown for comparison. D , Domains and mutations of BAF180. The BAF180 cDNA encodes a protein 1635 amino acids. Mutations are indicated with arrows. Homozygous deletion indicated with black bar.

    Article Snippet: The DNA was purified with Qiagen PCR purification kit and subjected to PCR.

    Techniques: Sequencing, Derivative Assay, Reverse Transcription Polymerase Chain Reaction, Southern Blot, Mutagenesis

    Intragenic homozygous deletion within PB1 encoding BAF180 in the breast cancer cell line HCC1143 A , Southern blot of human breast cancer cell line HCC1143 DNA demonstrating homozygous deletion of RDA clone 1143-75. RDA fragment, 1143-75, is used as a probe. N and T indicate the DNA of Epstein Barr virus transformed lymphoblastoid cell line, HCC1143BL and breast cancer cell line, HCC1143, respectively. DNAs were digested by Bgl II, Hind III, EcoR I and Pst I. Lower panel shows loading control using another RDA fragment as a probe. B , HCC1143 has an intragenic homozygous deletion of PB1/BAF180 . A schema of normal 3p21 region is shown with genes (not to scale) represented by top horizontal line. Blow up of exon structure is shown below with exons indicated with vertical bars. PCR analysis of exons using DNA of HCC1143 and HCC1143BL as templates is shown below. Exon 12, 17 and 22 were absent from tumor DNA and showed homozygous deletion ( minus ). Tumor DNA was amplified in exon 4, 11 and 23 ( plus ). C , Western blot confirming the absence of BAF180 full-length protein in HCC1143 and SUM1315 cells with MDC10A used for positive control.

    Journal: Cancer research

    Article Title: BAF180 is a critical regulator of p21 induction and a tumor suppressor mutated in breast cancer

    doi: 10.1158/0008-5472.CAN-07-5276

    Figure Lengend Snippet: Intragenic homozygous deletion within PB1 encoding BAF180 in the breast cancer cell line HCC1143 A , Southern blot of human breast cancer cell line HCC1143 DNA demonstrating homozygous deletion of RDA clone 1143-75. RDA fragment, 1143-75, is used as a probe. N and T indicate the DNA of Epstein Barr virus transformed lymphoblastoid cell line, HCC1143BL and breast cancer cell line, HCC1143, respectively. DNAs were digested by Bgl II, Hind III, EcoR I and Pst I. Lower panel shows loading control using another RDA fragment as a probe. B , HCC1143 has an intragenic homozygous deletion of PB1/BAF180 . A schema of normal 3p21 region is shown with genes (not to scale) represented by top horizontal line. Blow up of exon structure is shown below with exons indicated with vertical bars. PCR analysis of exons using DNA of HCC1143 and HCC1143BL as templates is shown below. Exon 12, 17 and 22 were absent from tumor DNA and showed homozygous deletion ( minus ). Tumor DNA was amplified in exon 4, 11 and 23 ( plus ). C , Western blot confirming the absence of BAF180 full-length protein in HCC1143 and SUM1315 cells with MDC10A used for positive control.

    Article Snippet: The DNA was purified with Qiagen PCR purification kit and subjected to PCR.

    Techniques: Southern Blot, Transformation Assay, Polymerase Chain Reaction, Amplification, Western Blot, Positive Control

    Transformation and virulence of restriction mutants of S. aureus USA300 strain NRS384. (A) PCR profiles (primers IM110/IM111) of the sauUSI region amplified from NRS384 (lanes 1), NRS384 hsdR INT sauUSI INT (lanes 2), and NRS384 hsdR INT sauUSI ECORV (lanes 3) without or with EcoRV digestion. (B) Concentrated pRMC2 DNA (5 µg) isolated from E . coli DH10B ( dam + dcm + ) (light grey bars) or DC10B ( dam + ) (dark grey bars) was electroporated into the strains described above, and transformants were enumerated. (C) Intravenous injection of 2 × 10 6 CFU into 6- to 7-week-old female A/J mice. On day 7 of infection, the mice were euthanized, both kidneys were aseptically removed, and the bacterial CFU were enumerated as described in Materials and Methods. Each symbol represents the value for an individual mouse, and the short black line represents the mean for the group of mice. The broken line denotes the limit of detection at 333 CFU for the two kidneys.

    Journal: mBio

    Article Title: Transforming the Untransformable: Application of Direct Transformation To Manipulate Genetically Staphylococcus aureus and Staphylococcus epidermidis

    doi: 10.1128/mBio.00277-11

    Figure Lengend Snippet: Transformation and virulence of restriction mutants of S. aureus USA300 strain NRS384. (A) PCR profiles (primers IM110/IM111) of the sauUSI region amplified from NRS384 (lanes 1), NRS384 hsdR INT sauUSI INT (lanes 2), and NRS384 hsdR INT sauUSI ECORV (lanes 3) without or with EcoRV digestion. (B) Concentrated pRMC2 DNA (5 µg) isolated from E . coli DH10B ( dam + dcm + ) (light grey bars) or DC10B ( dam + ) (dark grey bars) was electroporated into the strains described above, and transformants were enumerated. (C) Intravenous injection of 2 × 10 6 CFU into 6- to 7-week-old female A/J mice. On day 7 of infection, the mice were euthanized, both kidneys were aseptically removed, and the bacterial CFU were enumerated as described in Materials and Methods. Each symbol represents the value for an individual mouse, and the short black line represents the mean for the group of mice. The broken line denotes the limit of detection at 333 CFU for the two kidneys.

    Article Snippet: High-fidelity PCR was performed with KOD Hotstart DNA polymerase (Novagen) or Phusion DNA polymerase (Finnzymes) on genomic DNA isolated with the Genelute bacterial genomic DNA kit (Sigma).

    Techniques: Transformation Assay, Polymerase Chain Reaction, Amplification, Isolation, Injection, Mouse Assay, Infection

    Schematic of allelic exchange with pIMAY. ( A ) A plasmid isolated from E . coli DC10B is transformed into staphylococci at 28°C, and single-crossover (SCO) integration was stimulated by growth at 37°C in the presence of chloramphenicol. The loss of replicating plasmid is assayed by colony PCR with MCS primers (IM151/IM152). Clones negative for replicating plasmid are then screened for the side of integration with a combination of chromosomal and cloning primers (e.g., OUT FWD/D REV [AB integration {AB INT}] or OUT REV/A FWD [CD integration {CD INT}]). The diagram details an integration event through the AB side (equivalent to clone h in panels B and C). A clone from either AB or CD integration event is grown at 28°C in broth without antibiotic selection to stimulate rolling circle replication and then plated on TSA with 1 µg/ml ATc. Expression of the secY antisense RNA ( a - secY ) inhibits growth of cells maintaining the plasmid. Plasmid excision through the AB side recreates the wild-type locus, while CD excision yields a mutated gene. (B) Colony PCR from 10 randomly chosen clones (clones a to j) after growth at 37°C for the presence of replicating plasmid. The absence of product indicates that the plasmid has integrated. Colony PCR from cells grown at 28°C is included as a positive control (+ve). (C) Two clones without replicating plasmid (clones c and h) were shown by colony PCR to have integrated either on the AB (upstream [clone h]) or CD (downstream [clone c]) side of the gene to be deleted. Wild-type (WT) genomic DNA was included as a control.

    Journal: mBio

    Article Title: Transforming the Untransformable: Application of Direct Transformation To Manipulate Genetically Staphylococcus aureus and Staphylococcus epidermidis

    doi: 10.1128/mBio.00277-11

    Figure Lengend Snippet: Schematic of allelic exchange with pIMAY. ( A ) A plasmid isolated from E . coli DC10B is transformed into staphylococci at 28°C, and single-crossover (SCO) integration was stimulated by growth at 37°C in the presence of chloramphenicol. The loss of replicating plasmid is assayed by colony PCR with MCS primers (IM151/IM152). Clones negative for replicating plasmid are then screened for the side of integration with a combination of chromosomal and cloning primers (e.g., OUT FWD/D REV [AB integration {AB INT}] or OUT REV/A FWD [CD integration {CD INT}]). The diagram details an integration event through the AB side (equivalent to clone h in panels B and C). A clone from either AB or CD integration event is grown at 28°C in broth without antibiotic selection to stimulate rolling circle replication and then plated on TSA with 1 µg/ml ATc. Expression of the secY antisense RNA ( a - secY ) inhibits growth of cells maintaining the plasmid. Plasmid excision through the AB side recreates the wild-type locus, while CD excision yields a mutated gene. (B) Colony PCR from 10 randomly chosen clones (clones a to j) after growth at 37°C for the presence of replicating plasmid. The absence of product indicates that the plasmid has integrated. Colony PCR from cells grown at 28°C is included as a positive control (+ve). (C) Two clones without replicating plasmid (clones c and h) were shown by colony PCR to have integrated either on the AB (upstream [clone h]) or CD (downstream [clone c]) side of the gene to be deleted. Wild-type (WT) genomic DNA was included as a control.

    Article Snippet: High-fidelity PCR was performed with KOD Hotstart DNA polymerase (Novagen) or Phusion DNA polymerase (Finnzymes) on genomic DNA isolated with the Genelute bacterial genomic DNA kit (Sigma).

    Techniques: Plasmid Preparation, Isolation, Transformation Assay, Polymerase Chain Reaction, Clone Assay, Selection, Expressing, Positive Control

    Determination of proper transposon insertion. Confirmation of transposon insertions was performed by PCR for presence of transposon ( ermG ) ( A ). “Mwt” = molecular weight marker, “+” = positive control (gDNA from E. coli /pSAM_Bt); “-“= a negative control ( P. gingivalis ATCC 33277). All other lanes contain amplicons from PCR of individual colonies of transformed P. gingivalis . Panels ( B ) and ( C ) show PCR of the same samples using primers for the bla and himar1c19a genes respectively that are present in the plasmid, but which should be lost with proper insertion of the transposon. These three panels are a combination of separate gels; all which were run using identical PCR gDNA template for each of the separate reactions. ( D ) Nested semi-random PCR for individual mutant sequencing preparation. PCR from individual colonies was performed using primers to Mariner transposon and random primers ARB1 and ARB2 (Additional file 6 : Table S6). Two rounds of nested PCR were performed. Negative controls of wild-type P. gingivalis strain ATCC 33277 ( Pg ), template only (T) and primer only (P) lanes precede thirteen individual mutants.

    Journal: BMC Genomics

    Article Title: Identification of essential genes of the periodontal pathogen Porphyromonas gingivalis

    doi: 10.1186/1471-2164-13-578

    Figure Lengend Snippet: Determination of proper transposon insertion. Confirmation of transposon insertions was performed by PCR for presence of transposon ( ermG ) ( A ). “Mwt” = molecular weight marker, “+” = positive control (gDNA from E. coli /pSAM_Bt); “-“= a negative control ( P. gingivalis ATCC 33277). All other lanes contain amplicons from PCR of individual colonies of transformed P. gingivalis . Panels ( B ) and ( C ) show PCR of the same samples using primers for the bla and himar1c19a genes respectively that are present in the plasmid, but which should be lost with proper insertion of the transposon. These three panels are a combination of separate gels; all which were run using identical PCR gDNA template for each of the separate reactions. ( D ) Nested semi-random PCR for individual mutant sequencing preparation. PCR from individual colonies was performed using primers to Mariner transposon and random primers ARB1 and ARB2 (Additional file 6 : Table S6). Two rounds of nested PCR were performed. Negative controls of wild-type P. gingivalis strain ATCC 33277 ( Pg ), template only (T) and primer only (P) lanes precede thirteen individual mutants.

    Article Snippet: Transposon containing fragments were then amplified in a 50 μL PCR reaction that contained 5 μL C-tailed template, 600 nM C tail-specific primer (olj376 5′ GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGGGGGGGGGGGGGGG 3′ ), 600 nM transposon-specificprimer (pSAM1 5′ CCTGACGGATGGCCTTTTTGCGTTTCTACC 3′ ), 400 μM dNTPs, 5 μL 10x buffer, and 1 μL Easy-A DNA polymerase mix (Agilent).

    Techniques: Polymerase Chain Reaction, Molecular Weight, Marker, Positive Control, Negative Control, Transformation Assay, Plasmid Preparation, Mutagenesis, Sequencing, Nested PCR

    PCR array identifies metastasis and invasion downstream genes of miR-335. a , b Expression profiles of genes involved in metastasis and tumor invasion in AGS cells transfected with miR-335 mimic or with miR-335 inhibitor. Expression levels were normalized to three endogenous genes. Results indicate the mean values of three independent experiments ± SD. c ΔCq of PLAUR in 19 gastric tumor tissues compared to their matched non-tumor adjacent tissues (NAT) and normalized to reference genes. Data were transformed to logarithmic values (−log). d Relative expression of PLAUR in 19 samples of gastric tumor tissues, normalized to reference genes. e ΔCq of CDH11 in 19 gastric tumor tissues compared to NAT and normalized to reference genes. Data were transformed to logarithmic values (−log). f Relative expression of CHD11 in 19 samples of gastric tumor tissues, normalized to reference genes. Data were transformed to logarithmic values (log 2). g Direct interaction between miR-335 and CDH11 was detected by dual-luciferase reporter assay. Over-expression of miR-335 in AGS cells reduced the luciferase signal of CDH11 compared with NC mimic, while mutation of the miR-335-binding site diminished this suppressive effect. * р

    Journal: Clinical Epigenetics

    Article Title: MicroRNA-335-5p is a potential suppressor of metastasis and invasion in gastric cancer

    doi: 10.1186/s13148-017-0413-8

    Figure Lengend Snippet: PCR array identifies metastasis and invasion downstream genes of miR-335. a , b Expression profiles of genes involved in metastasis and tumor invasion in AGS cells transfected with miR-335 mimic or with miR-335 inhibitor. Expression levels were normalized to three endogenous genes. Results indicate the mean values of three independent experiments ± SD. c ΔCq of PLAUR in 19 gastric tumor tissues compared to their matched non-tumor adjacent tissues (NAT) and normalized to reference genes. Data were transformed to logarithmic values (−log). d Relative expression of PLAUR in 19 samples of gastric tumor tissues, normalized to reference genes. e ΔCq of CDH11 in 19 gastric tumor tissues compared to NAT and normalized to reference genes. Data were transformed to logarithmic values (−log). f Relative expression of CHD11 in 19 samples of gastric tumor tissues, normalized to reference genes. Data were transformed to logarithmic values (log 2). g Direct interaction between miR-335 and CDH11 was detected by dual-luciferase reporter assay. Over-expression of miR-335 in AGS cells reduced the luciferase signal of CDH11 compared with NC mimic, while mutation of the miR-335-binding site diminished this suppressive effect. * р

    Article Snippet: Network analysis of tumor invasion/metastasis genes Log ratios of significantly overexpressed genes from our PCR array by inhibition of miR-335 were loaded into IPA (Ingenuity Systems®, QIAGEN, USA).

    Techniques: Polymerase Chain Reaction, Expressing, Transfection, Transformation Assay, Luciferase, Reporter Assay, Over Expression, Mutagenesis, Binding Assay

    Expression of miR-335 and DNA methylation of the promoter region of MEST gene in plasma from gastric cancer patients and healthy donors. a Cq of miR-335 expression among four gastric cancer plasma samples and seven plasma samples from healthy donors. Data were transformed to logarithmic values (−log). Results indicate the mean ± SD. b Illustrative results of MSP in gastric cancer and healthy donor’s plasma samples. MyoD was used as a control of DNA conversion. MW, weight marker; M, PCR product with primers specific for methylated promotor region of miR-335 host gene (MEST); PC, positive control of methylation (methylated gastric cancer cell line); NC, negative control of methylation (peripheral blood lymphocytes)

    Journal: Clinical Epigenetics

    Article Title: MicroRNA-335-5p is a potential suppressor of metastasis and invasion in gastric cancer

    doi: 10.1186/s13148-017-0413-8

    Figure Lengend Snippet: Expression of miR-335 and DNA methylation of the promoter region of MEST gene in plasma from gastric cancer patients and healthy donors. a Cq of miR-335 expression among four gastric cancer plasma samples and seven plasma samples from healthy donors. Data were transformed to logarithmic values (−log). Results indicate the mean ± SD. b Illustrative results of MSP in gastric cancer and healthy donor’s plasma samples. MyoD was used as a control of DNA conversion. MW, weight marker; M, PCR product with primers specific for methylated promotor region of miR-335 host gene (MEST); PC, positive control of methylation (methylated gastric cancer cell line); NC, negative control of methylation (peripheral blood lymphocytes)

    Article Snippet: Network analysis of tumor invasion/metastasis genes Log ratios of significantly overexpressed genes from our PCR array by inhibition of miR-335 were loaded into IPA (Ingenuity Systems®, QIAGEN, USA).

    Techniques: Expressing, DNA Methylation Assay, Transformation Assay, Marker, Polymerase Chain Reaction, Methylation, Positive Control, Negative Control

    DDX5 gene is co-amplified with MIR21 and DDX5 facilitates maturation of pri-miR-21. a Immunoprecipitation (IP) and western blotting analyses were performed using indicated antibodies. Normal immunoglobulin G (IgG) was used as a negative control for IP. The RNA-binding protein DDX1 was used as a positive control for the Drosha-binding proteins. b The DDX5-bound pri-miRNAs were immunoprecipitated with DDX5 and analyzed by qRT-PCR. Control IgG was used as a negative control. c Levels of primary or mature forms of miR-21 were analyzed in control and DDX5-knockdown breast cancer cells harboring 17q23 amplicon. d Levels of mature miR-21 and DDX5 were analyzed in breast tumor samples using in situ hybridization and immunohistochemistry. Representative staining images of tissue samples are shown. Scale bar, 100 μm. e Soft agar colony formation assays with MMTV-ErbB2 mouse mammary epithelial cells transduced with control vector or lentiviral vector expressing the indicated genes. Representative images are shown in the middle panel and relative expression levels of mature miR-16 or miR-21 are shown in the right panel. * p

    Journal: Nature Communications

    Article Title: Targeting 17q23 amplicon to overcome the resistance to anti-HER2 therapy in HER2+ breast cancer

    doi: 10.1038/s41467-018-07264-0

    Figure Lengend Snippet: DDX5 gene is co-amplified with MIR21 and DDX5 facilitates maturation of pri-miR-21. a Immunoprecipitation (IP) and western blotting analyses were performed using indicated antibodies. Normal immunoglobulin G (IgG) was used as a negative control for IP. The RNA-binding protein DDX1 was used as a positive control for the Drosha-binding proteins. b The DDX5-bound pri-miRNAs were immunoprecipitated with DDX5 and analyzed by qRT-PCR. Control IgG was used as a negative control. c Levels of primary or mature forms of miR-21 were analyzed in control and DDX5-knockdown breast cancer cells harboring 17q23 amplicon. d Levels of mature miR-21 and DDX5 were analyzed in breast tumor samples using in situ hybridization and immunohistochemistry. Representative staining images of tissue samples are shown. Scale bar, 100 μm. e Soft agar colony formation assays with MMTV-ErbB2 mouse mammary epithelial cells transduced with control vector or lentiviral vector expressing the indicated genes. Representative images are shown in the middle panel and relative expression levels of mature miR-16 or miR-21 are shown in the right panel. * p

    Article Snippet: The copy number validation for HER2, WIP1 , and MIR21 were determined by quantitative PCR assays using iTaq Universal SYBR Green Supermix (Bio-Rad) on an Applied Biosystems 7900HT Sequence Detection System.

    Techniques: Amplification, Immunoprecipitation, Western Blot, Negative Control, RNA Binding Assay, Positive Control, Binding Assay, Quantitative RT-PCR, In Situ Hybridization, Immunohistochemistry, Staining, Transduction, Plasmid Preparation, Expressing

    Overexpression of miR-21 and WIP1 promotes oncogenic transformation of HER2+ breast cancer cells. a The differential expression heat map of miR-21 target genes in the mammary epithelial cells (MMECs) derived from MIR21−/−;MMTV-ErbB2 mice (8 weeks old). b Relative expression levels of the predicted miR-21 targets in primary MMECs isolated from wild-type or MIR21-/- virgin females at the age of 8 weeks. Data represents the mean expression levels normalized to the endogenous snoRNA55 control from three independent experiments. c MMECs derived from MMTV-ErbB2 mice were transduced with lentivirus expressing miR-21 and/or WIP1. Top panel: representative photomicrographs of SA-β-galactosidase (SA-β-Gal) staining observed in bright field. Bottom panel: miR-21 and WIP1 expression levels as determined by q-PCR, and percentages of SA-β-Gal-positive cells were calculated. Scale bar, 10 µm. * p

    Journal: Nature Communications

    Article Title: Targeting 17q23 amplicon to overcome the resistance to anti-HER2 therapy in HER2+ breast cancer

    doi: 10.1038/s41467-018-07264-0

    Figure Lengend Snippet: Overexpression of miR-21 and WIP1 promotes oncogenic transformation of HER2+ breast cancer cells. a The differential expression heat map of miR-21 target genes in the mammary epithelial cells (MMECs) derived from MIR21−/−;MMTV-ErbB2 mice (8 weeks old). b Relative expression levels of the predicted miR-21 targets in primary MMECs isolated from wild-type or MIR21-/- virgin females at the age of 8 weeks. Data represents the mean expression levels normalized to the endogenous snoRNA55 control from three independent experiments. c MMECs derived from MMTV-ErbB2 mice were transduced with lentivirus expressing miR-21 and/or WIP1. Top panel: representative photomicrographs of SA-β-galactosidase (SA-β-Gal) staining observed in bright field. Bottom panel: miR-21 and WIP1 expression levels as determined by q-PCR, and percentages of SA-β-Gal-positive cells were calculated. Scale bar, 10 µm. * p

    Article Snippet: The copy number validation for HER2, WIP1 , and MIR21 were determined by quantitative PCR assays using iTaq Universal SYBR Green Supermix (Bio-Rad) on an Applied Biosystems 7900HT Sequence Detection System.

    Techniques: Over Expression, Transformation Assay, Expressing, Derivative Assay, Mouse Assay, Isolation, Transduction, Staining, Polymerase Chain Reaction

    Mixture of wild-type and mutant Xylella fastidiosa strains after second isolation. The XfΔ pilJ mutant confirmed in Figure 3 (isolate 12) was streaked onto periwinkle agar plates amended with kanamycin and the genotype assessed for 32 single colonies. Each number denotes a single colony. A . The pilJ E/ pilJ F (EF) primers amplified a 2030 bp band for non-transformed bacteria and no equivalent bands for the transformed XfΔ pilJ mutant strains or the deletion plasmid (P). B . The pilJ A/ pilJ D (AD) primers amplified a 3082 bp band for non-transformed cells and a 2200 bp fragment from the XfΔ pilJ strain and the deletion plasmid (P). Wild-type X. fastidiosa DNA (wt) was used as a positive control for the PCR reactions, while primer reaction without template DNA represented by H 2 O, was used as negative controls for each PCR reaction.

    Journal: BMC Research Notes

    Article Title: Potential complications when developing gene deletion clones in Xylella fastidiosa

    doi: 10.1186/s13104-015-1117-9

    Figure Lengend Snippet: Mixture of wild-type and mutant Xylella fastidiosa strains after second isolation. The XfΔ pilJ mutant confirmed in Figure 3 (isolate 12) was streaked onto periwinkle agar plates amended with kanamycin and the genotype assessed for 32 single colonies. Each number denotes a single colony. A . The pilJ E/ pilJ F (EF) primers amplified a 2030 bp band for non-transformed bacteria and no equivalent bands for the transformed XfΔ pilJ mutant strains or the deletion plasmid (P). B . The pilJ A/ pilJ D (AD) primers amplified a 3082 bp band for non-transformed cells and a 2200 bp fragment from the XfΔ pilJ strain and the deletion plasmid (P). Wild-type X. fastidiosa DNA (wt) was used as a positive control for the PCR reactions, while primer reaction without template DNA represented by H 2 O, was used as negative controls for each PCR reaction.

    Article Snippet: Real-time (RT) PCR amplification to confirm deletion of pilJ gene The real time PCR mix included 12.5 μL SybrGreen real-time PCR mix (Bio-Rad) and 40nM of each primer in a total of 25 μL.

    Techniques: Mutagenesis, Isolation, Amplification, Transformation Assay, Plasmid Preparation, Positive Control, Polymerase Chain Reaction

    Protection of wild-type Xylella fastidiosa from antibiotic selection pressure. Wild-type X. fastidiosa (wt), XfΔ pilJ mutant (J), or an equal mixture of both (M) were grown in PD2 liquid media before being plated onto agar plates with 0, 4, 10, 25, or 50 μg/mL kanamycin, and tested by PCR. The pilJ A/ pilJ D (AD) primers amplified a 3082 bp band for wild-type cells and a 2200 bp fragment from the XfΔ pilJ strain. The pilJ E/ pilJ F (EF) primers amplified a 2030 bp band for wild-type bacteria and no equivalent bands for the XfΔ pilJ mutant strains. For mixed samples, the AD primers amplified a Xf pilJ strain fragment and the EF primers amplified a wild-type band. The RST31/33 (RST) primers confirmed that the bacteria were X. fastidiosa . Wells of each cell type and kanamycin concentration condition are numbered as follows: (1) AD amplification, (2) EF amplification, and (3) RST amplification.

    Journal: BMC Research Notes

    Article Title: Potential complications when developing gene deletion clones in Xylella fastidiosa

    doi: 10.1186/s13104-015-1117-9

    Figure Lengend Snippet: Protection of wild-type Xylella fastidiosa from antibiotic selection pressure. Wild-type X. fastidiosa (wt), XfΔ pilJ mutant (J), or an equal mixture of both (M) were grown in PD2 liquid media before being plated onto agar plates with 0, 4, 10, 25, or 50 μg/mL kanamycin, and tested by PCR. The pilJ A/ pilJ D (AD) primers amplified a 3082 bp band for wild-type cells and a 2200 bp fragment from the XfΔ pilJ strain. The pilJ E/ pilJ F (EF) primers amplified a 2030 bp band for wild-type bacteria and no equivalent bands for the XfΔ pilJ mutant strains. For mixed samples, the AD primers amplified a Xf pilJ strain fragment and the EF primers amplified a wild-type band. The RST31/33 (RST) primers confirmed that the bacteria were X. fastidiosa . Wells of each cell type and kanamycin concentration condition are numbered as follows: (1) AD amplification, (2) EF amplification, and (3) RST amplification.

    Article Snippet: Real-time (RT) PCR amplification to confirm deletion of pilJ gene The real time PCR mix included 12.5 μL SybrGreen real-time PCR mix (Bio-Rad) and 40nM of each primer in a total of 25 μL.

    Techniques: Selection, Mutagenesis, Polymerase Chain Reaction, Amplification, Concentration Assay

    Mixture of wild-type and mutant Xylella fastidiosa strains after first isolation. The XfΔ pilJ mutant confirmed in Figure 2 was stored at -80°C, streaked onto periwinkle agar plates amended with kanamycin, and the genotype assessed for 12 single colonies. Each number denotes a single colony. The pilJ E/ pilJ F (EF) primers amplified a 2030 bp band for non-transformed X. fastidiosa and no band for the XfΔ pilJ mutant. Wild-type X. fastidiosa DNA (wt) was used as a positive control for the PCR reaction, while primer reaction without template DNA represented by H 2 O, was used as a negative control.

    Journal: BMC Research Notes

    Article Title: Potential complications when developing gene deletion clones in Xylella fastidiosa

    doi: 10.1186/s13104-015-1117-9

    Figure Lengend Snippet: Mixture of wild-type and mutant Xylella fastidiosa strains after first isolation. The XfΔ pilJ mutant confirmed in Figure 2 was stored at -80°C, streaked onto periwinkle agar plates amended with kanamycin, and the genotype assessed for 12 single colonies. Each number denotes a single colony. The pilJ E/ pilJ F (EF) primers amplified a 2030 bp band for non-transformed X. fastidiosa and no band for the XfΔ pilJ mutant. Wild-type X. fastidiosa DNA (wt) was used as a positive control for the PCR reaction, while primer reaction without template DNA represented by H 2 O, was used as a negative control.

    Article Snippet: Real-time (RT) PCR amplification to confirm deletion of pilJ gene The real time PCR mix included 12.5 μL SybrGreen real-time PCR mix (Bio-Rad) and 40nM of each primer in a total of 25 μL.

    Techniques: Mutagenesis, Isolation, Amplification, Transformation Assay, Positive Control, Polymerase Chain Reaction, Negative Control

    Mixture of wild-type and mutant Xylella fastidiosa strains after third isolation. The XfΔ pilJ mutants confirmed in Figure 4 (isolates 4 and 17) were streaked onto PW agar plates amended with kanamycin and the genotype assessed for 16 single colonies. Each number denotes a single colony. A . The pilJ E/ pilJ F (EF) primers amplified a 2030 bp band for non-transformed bacteria and no equivalent band for the XfΔ pilJ strains or the deletion plasmid (P). B . The pilJ A/ pilJ D (AD) primers amplified a 3082 bp band for non-transformed cells and a 2200 bp fragment from the XfΔ pilJ strains and the deletion plasmid (P). Wild-type X. fastidiosa DNA (wt) was used as a positive control for the PCR reactions, while primer reaction without template DNA represented by H 2 O, was used as negative controls for both PCR reactions.

    Journal: BMC Research Notes

    Article Title: Potential complications when developing gene deletion clones in Xylella fastidiosa

    doi: 10.1186/s13104-015-1117-9

    Figure Lengend Snippet: Mixture of wild-type and mutant Xylella fastidiosa strains after third isolation. The XfΔ pilJ mutants confirmed in Figure 4 (isolates 4 and 17) were streaked onto PW agar plates amended with kanamycin and the genotype assessed for 16 single colonies. Each number denotes a single colony. A . The pilJ E/ pilJ F (EF) primers amplified a 2030 bp band for non-transformed bacteria and no equivalent band for the XfΔ pilJ strains or the deletion plasmid (P). B . The pilJ A/ pilJ D (AD) primers amplified a 3082 bp band for non-transformed cells and a 2200 bp fragment from the XfΔ pilJ strains and the deletion plasmid (P). Wild-type X. fastidiosa DNA (wt) was used as a positive control for the PCR reactions, while primer reaction without template DNA represented by H 2 O, was used as negative controls for both PCR reactions.

    Article Snippet: Real-time (RT) PCR amplification to confirm deletion of pilJ gene The real time PCR mix included 12.5 μL SybrGreen real-time PCR mix (Bio-Rad) and 40nM of each primer in a total of 25 μL.

    Techniques: Mutagenesis, Isolation, Amplification, Transformation Assay, Plasmid Preparation, Positive Control, Polymerase Chain Reaction

    Orientation of primers for Xylella fastidiosa pilJ gene deletion. Location of binding sites for PCR primers and length of resulting PCR products for transformed XfΔ pilJ strains and for wild-type control or non-transformed cells. RST31/33 are primers specific to X. fastidiosa and used for bacteria confirmation.

    Journal: BMC Research Notes

    Article Title: Potential complications when developing gene deletion clones in Xylella fastidiosa

    doi: 10.1186/s13104-015-1117-9

    Figure Lengend Snippet: Orientation of primers for Xylella fastidiosa pilJ gene deletion. Location of binding sites for PCR primers and length of resulting PCR products for transformed XfΔ pilJ strains and for wild-type control or non-transformed cells. RST31/33 are primers specific to X. fastidiosa and used for bacteria confirmation.

    Article Snippet: Real-time (RT) PCR amplification to confirm deletion of pilJ gene The real time PCR mix included 12.5 μL SybrGreen real-time PCR mix (Bio-Rad) and 40nM of each primer in a total of 25 μL.

    Techniques: Binding Assay, Polymerase Chain Reaction, Transformation Assay

    Development of transgenic alfalfa expressing IbOr under the control of the SWPA2 promoter (SOR plants). (A) Diagram of the oxidative stress-inducible SWPA2 promoter: IbOr construct used for alfalfa transformation. Vertical bar shows the primer set ( A2pro :: IbOr ) used for genomic PCR analysis. (B) Genomic DNA PCR analysis using the A2pro :: IbOr primer set. Numbers (1–11) represent independent transgenic lines. M, size markers; NT, non-transgenic plant; PC, positive control. (C) RT-PCR analysis of 11 lines expressing stable IbOr gene integration in transgenic plants following 2 h of 5 μM MV treatment.

    Journal: PLoS ONE

    Article Title: Transgenic Alfalfa Plants Expressing the Sweetpotato Orange Gene Exhibit Enhanced Abiotic Stress Tolerance

    doi: 10.1371/journal.pone.0126050

    Figure Lengend Snippet: Development of transgenic alfalfa expressing IbOr under the control of the SWPA2 promoter (SOR plants). (A) Diagram of the oxidative stress-inducible SWPA2 promoter: IbOr construct used for alfalfa transformation. Vertical bar shows the primer set ( A2pro :: IbOr ) used for genomic PCR analysis. (B) Genomic DNA PCR analysis using the A2pro :: IbOr primer set. Numbers (1–11) represent independent transgenic lines. M, size markers; NT, non-transgenic plant; PC, positive control. (C) RT-PCR analysis of 11 lines expressing stable IbOr gene integration in transgenic plants following 2 h of 5 μM MV treatment.

    Article Snippet: PCR was conducted with purified genomic DNA in a PCR premix (Cat. no. K-2012, Bioneer, Korea) using a specific primer set designed based on the sequence of the IbOr gene and part of the SWPA2 promoter to confirm the integration of IbOr ( ).

    Techniques: Transgenic Assay, Expressing, Construct, Transformation Assay, Polymerase Chain Reaction, Positive Control, Reverse Transcription Polymerase Chain Reaction

    Characterization of transplastomic tobacco plants. (A) Southern blot confirming homoplastomy of the transformed tobacco lines. Tobacco DNA was cut with restriction enzymes and separated on an agarose gel for blotting. A probe hybridizing to homologous recombination regions in tobacco plastids was used to confirm insertion/integration of dsRNA expression cassettes into plastid DNA. A single band of the expected size was observed in each DNA sample; 1, DIG-labeled marker; 2 DNA from WT tobacco; 3, DNA from tobacco with v-ATPaseA dsRNA expression cassette; 4, DNA from tobacco with GFP dsRNA expression cassette. All DNA samples display single bands which confirm homoplastomy of transformed plants. (B) RT-PCR confirming expression of v-ATPaseA dsRNA and GFP dsRNA in transplastomic plants. Primers annealing to dsRNA sequences were used to confirm production of dsRNA in transplastomic tobacco plants. Tobacco EF1-α gene was used as a positive control and NRT reactions confirmed absence of DNA contamination in cDNA preparations.

    Journal: Frontiers in Plant Science

    Article Title: RNA Interference in the Tobacco Hornworm, Manduca sexta, Using Plastid-Encoded Long Double-Stranded RNA

    doi: 10.3389/fpls.2019.00313

    Figure Lengend Snippet: Characterization of transplastomic tobacco plants. (A) Southern blot confirming homoplastomy of the transformed tobacco lines. Tobacco DNA was cut with restriction enzymes and separated on an agarose gel for blotting. A probe hybridizing to homologous recombination regions in tobacco plastids was used to confirm insertion/integration of dsRNA expression cassettes into plastid DNA. A single band of the expected size was observed in each DNA sample; 1, DIG-labeled marker; 2 DNA from WT tobacco; 3, DNA from tobacco with v-ATPaseA dsRNA expression cassette; 4, DNA from tobacco with GFP dsRNA expression cassette. All DNA samples display single bands which confirm homoplastomy of transformed plants. (B) RT-PCR confirming expression of v-ATPaseA dsRNA and GFP dsRNA in transplastomic plants. Primers annealing to dsRNA sequences were used to confirm production of dsRNA in transplastomic tobacco plants. Tobacco EF1-α gene was used as a positive control and NRT reactions confirmed absence of DNA contamination in cDNA preparations.

    Article Snippet: The hybridization probe was prepared using the PCR DIG Probe Synthesis Kit (Sigma-Aldrich) with primers ( ) that generated a 1181 bp DIG-labeled probe from the homologous recombination regions.

    Techniques: Southern Blot, Transformation Assay, Agarose Gel Electrophoresis, Homologous Recombination, Expressing, Labeling, Marker, Reverse Transcription Polymerase Chain Reaction, Positive Control

    Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis of the expression of the transformed gene Gh_A07G0747 ( GhTOM ) . ( A ) Total RNA isolated from two-week-old cotton plant under normal conditions; ( B ) Total RNA extracted from salt-stressed cotton seedlings; ( C ) Polymerase chain reaction (PCR) analysis performed to check 978 bp coding sequence (CDS) integration in transformed T0 generation, number 1–13 transgenic lines, 14 positive control ( pWM101-Gh_A07G0747 ( GhTOM )), and 15 is the negative control (wild-type, WT). Expression of the transformed genes in transgenic; ( D ) the transcripts levels of the Gh_A07G0747 (GhTOM) of T2 transgenic lines analysed through qRT-PCR.

    Journal: Genes

    Article Title: A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis

    doi: 10.3390/genes9040209

    Figure Lengend Snippet: Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis of the expression of the transformed gene Gh_A07G0747 ( GhTOM ) . ( A ) Total RNA isolated from two-week-old cotton plant under normal conditions; ( B ) Total RNA extracted from salt-stressed cotton seedlings; ( C ) Polymerase chain reaction (PCR) analysis performed to check 978 bp coding sequence (CDS) integration in transformed T0 generation, number 1–13 transgenic lines, 14 positive control ( pWM101-Gh_A07G0747 ( GhTOM )), and 15 is the negative control (wild-type, WT). Expression of the transformed genes in transgenic; ( D ) the transcripts levels of the Gh_A07G0747 (GhTOM) of T2 transgenic lines analysed through qRT-PCR.

    Article Snippet: Expression of Gh_A07G0747 ( GhTOM ) and the NaCl-responsive genes in the transgenic Arabidopsis plants was carried out through qRT-PCR analysis with gene-specific primers , using the fluorescent intercalating dye FastaStart Universal SYBR-Green Master in a detection system (Roche Diagnostics GmbH, Mannheim, Germany).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Expressing, Transformation Assay, Isolation, Polymerase Chain Reaction, Sequencing, Transgenic Assay, Positive Control, Negative Control

    E2FA and RBR control the expression of FBL17 . (A) Sketch of the genomic region of FBL17 in the Arabidopsis genome. Genes are represented by large arrows with exons in black and introns in white, predicted E2F binding sites are marked with an asterisk, and the five PCR amplicons used in ChIP analyses are boxed (a, b, c, d, e). (B) E2FA ChIP. Wild-type plants were used for ChIP experiments with an antibody directed against E2FA. The amplicon ‘c’ in the promoter region of FBL17 showed enrichment for E2FA, whereas the regions ‘a’, ‘b’, ‘d’ and ‘e’ were not specifically amplified. The known E2FA target, PCNA1 , was used as positive control. Negative controls were done without antibody (IgG). (C) RBR1 ChIP. Transgenetic plants expressing PRO RBR1 :RBR1-mRFP were used in ChIP with a DsRed antibody. The amplicon ‘c’ in the promoter region of FBL17 showed enrichment for RBR1-mRFP, in contrast to the regions ‘a’, ‘b’, ‘d’ and ‘e’. The known RBR1 target, PCNA1 , was used as positive control. Negative controls were done without antibody (IgG). (D) Quantitative expression analysis of FBL17 by qRT-PCR in the wild type and rbr1–2 −/− mutants. The mean plus/minus standard deviation of the normalized relative quantities (NRQ) of three biological replicates are shown. The stars indicate statistically significant differences based on a t-test of log-transformed data with a p

    Journal: PLoS Genetics

    Article Title: A General G1/S-Phase Cell-Cycle Control Module in the Flowering Plant Arabidopsis thaliana

    doi: 10.1371/journal.pgen.1002847

    Figure Lengend Snippet: E2FA and RBR control the expression of FBL17 . (A) Sketch of the genomic region of FBL17 in the Arabidopsis genome. Genes are represented by large arrows with exons in black and introns in white, predicted E2F binding sites are marked with an asterisk, and the five PCR amplicons used in ChIP analyses are boxed (a, b, c, d, e). (B) E2FA ChIP. Wild-type plants were used for ChIP experiments with an antibody directed against E2FA. The amplicon ‘c’ in the promoter region of FBL17 showed enrichment for E2FA, whereas the regions ‘a’, ‘b’, ‘d’ and ‘e’ were not specifically amplified. The known E2FA target, PCNA1 , was used as positive control. Negative controls were done without antibody (IgG). (C) RBR1 ChIP. Transgenetic plants expressing PRO RBR1 :RBR1-mRFP were used in ChIP with a DsRed antibody. The amplicon ‘c’ in the promoter region of FBL17 showed enrichment for RBR1-mRFP, in contrast to the regions ‘a’, ‘b’, ‘d’ and ‘e’. The known RBR1 target, PCNA1 , was used as positive control. Negative controls were done without antibody (IgG). (D) Quantitative expression analysis of FBL17 by qRT-PCR in the wild type and rbr1–2 −/− mutants. The mean plus/minus standard deviation of the normalized relative quantities (NRQ) of three biological replicates are shown. The stars indicate statistically significant differences based on a t-test of log-transformed data with a p

    Article Snippet: The resulting cDNA was used for quantitative Real Time-PCR (qRT-PCR) using the Roche LightCycler 480 system.

    Techniques: Expressing, Binding Assay, Polymerase Chain Reaction, Chromatin Immunoprecipitation, Amplification, Positive Control, Quantitative RT-PCR, Standard Deviation, Transformation Assay

    Genetic analysis of LCF1. ( a ) Southern blot on Nco I digested genomic DNA (gDNA) of empty vector control plants (Col-0 transformed with pRF-VP16-Kana not containing a 3F fragment; lane 2) and LCF1 (lane 3). Lane 1 contains DIG-labelled DNA ladder. The DIG-labelled probe was expected to hybridize with fragments of the promoter of the endogenous RPS5a gene (10695 bp fragment), the RPS5a promoter (p RPS5a ) from the T-DNA construct (2590 bp fragment with intensity depending on the copy number of the insert), and the (3F)-VP16 fusion encoding part of each T-DNA insert in the genome (fragments of ≥~1500 bp for LCF1 and ≥~800 bp for the empty vector control without 3F). ( b ) Map of the 3F-VP16 encoding T-DNA construct in MORC2 (At4g36280) of LCF1. MORC2 is presented to scale. Exons are presented as grey boxes. 5′ and 3′ untranslated regions (UTRs) are presented as white boxes. The T-DNA insert is not presented to scale. ( c ) RT-PCR analysis of MORC2 expression in Col-0 and LCF1 plants. The genes ATG6 (At3g61710) and SCAMP5 (At1g32050) serve as a controls for gene expression. Expression of the 3F-VP16 construct in LCF1 was verified as a positive control. ( d ) False color φPSII images of Col-0 and LCF1 plants (T1 generation; obtained through selection with PPT) harboring T-DNA constructs with either the GUS gene under control of the CaMV 35S promoter ( p35S::GUS ), the full length genomic sequence of MORC2 under control of its own promoter and terminator sequences (p MORC::MORC2 ) to assay for complementation, or the cDNA encoding MORC2 under control of the NOS promoter and terminator sequences ( pNOS::MORC2 ) to assay for complementation. The variation in size among the transformants was due to herbicide selection and subsequent transfer from selection medium to soil. ( e ) RT-qPCR analysis of the expression of the 5′ end of MORC2 ( MORC2Δ3 ′) and of the two neighboring genes At4g36270 and At4g36290 ( MORC1 ). Expression of the 3F-VP16 construct in LCF1 was quantified as a positive control. Relative expression values were obtained by normalizing to the expression values of the genes ATG6 and SCAMP5 . Error bars represent SEM values (n = 4). The presented data are the average of two technical replicates.

    Journal: Scientific Reports

    Article Title: An Arabidopsis mutant with high operating efficiency of Photosystem II and low chlorophyll fluorescence

    doi: 10.1038/s41598-017-03611-1

    Figure Lengend Snippet: Genetic analysis of LCF1. ( a ) Southern blot on Nco I digested genomic DNA (gDNA) of empty vector control plants (Col-0 transformed with pRF-VP16-Kana not containing a 3F fragment; lane 2) and LCF1 (lane 3). Lane 1 contains DIG-labelled DNA ladder. The DIG-labelled probe was expected to hybridize with fragments of the promoter of the endogenous RPS5a gene (10695 bp fragment), the RPS5a promoter (p RPS5a ) from the T-DNA construct (2590 bp fragment with intensity depending on the copy number of the insert), and the (3F)-VP16 fusion encoding part of each T-DNA insert in the genome (fragments of ≥~1500 bp for LCF1 and ≥~800 bp for the empty vector control without 3F). ( b ) Map of the 3F-VP16 encoding T-DNA construct in MORC2 (At4g36280) of LCF1. MORC2 is presented to scale. Exons are presented as grey boxes. 5′ and 3′ untranslated regions (UTRs) are presented as white boxes. The T-DNA insert is not presented to scale. ( c ) RT-PCR analysis of MORC2 expression in Col-0 and LCF1 plants. The genes ATG6 (At3g61710) and SCAMP5 (At1g32050) serve as a controls for gene expression. Expression of the 3F-VP16 construct in LCF1 was verified as a positive control. ( d ) False color φPSII images of Col-0 and LCF1 plants (T1 generation; obtained through selection with PPT) harboring T-DNA constructs with either the GUS gene under control of the CaMV 35S promoter ( p35S::GUS ), the full length genomic sequence of MORC2 under control of its own promoter and terminator sequences (p MORC::MORC2 ) to assay for complementation, or the cDNA encoding MORC2 under control of the NOS promoter and terminator sequences ( pNOS::MORC2 ) to assay for complementation. The variation in size among the transformants was due to herbicide selection and subsequent transfer from selection medium to soil. ( e ) RT-qPCR analysis of the expression of the 5′ end of MORC2 ( MORC2Δ3 ′) and of the two neighboring genes At4g36270 and At4g36290 ( MORC1 ). Expression of the 3F-VP16 construct in LCF1 was quantified as a positive control. Relative expression values were obtained by normalizing to the expression values of the genes ATG6 and SCAMP5 . Error bars represent SEM values (n = 4). The presented data are the average of two technical replicates.

    Article Snippet: As a probe, DIG-labelled PCR product was generated with the primer combination RPS5a FW and tNOS REV (Table ) from LCF genomic DNA, using PCR DIG Labelling Mix (Roche).

    Techniques: Southern Blot, Plasmid Preparation, Transformation Assay, Construct, Reverse Transcription Polymerase Chain Reaction, Expressing, Positive Control, Selection, Sequencing, Quantitative RT-PCR

    Correlation of IL-13 upregulation with HTLV-1 Tax synthesis. The impact of Tax on endogenous IL-13 expression in Jurkat T cells and in Tax-immortalized primary human T cells (Tesi) was investigated. (A) Jurkat cells were transfected with a Tax expression plasmid; RNA was reverse transcribed and analyzed by PCR. As an internal standard, β-actin PCRs were performed with the same cDNA. (B) Human T cells transformed with a repressible Tax gene (Tesi) were kept under conditions of induced (Tesi) and repressed (Tesi+Tet) Tax expression. Total RNA was analyzed by Northern blotting with an IL-13-specific probe. C91-PL and StEd, HTLV-1-infected lymphocytes; PBMC + PHA and Jurkat, uninfected T lymphocytes. (C) Tissue culture supernatants of Jurkat, Tesi, and Tesi+Tet cells were subjected to IL-13 ELISA. The results represent the means from three experiments. Error bars show standard deviations.

    Journal: Journal of Virology

    Article Title: Interleukin-13 Overexpression by Tax Transactivation: a Potential Autocrine Stimulus in Human T-Cell Leukemia Virus-Infected Lymphocytes

    doi: 10.1128/JVI.78.12.6081-6090.2004

    Figure Lengend Snippet: Correlation of IL-13 upregulation with HTLV-1 Tax synthesis. The impact of Tax on endogenous IL-13 expression in Jurkat T cells and in Tax-immortalized primary human T cells (Tesi) was investigated. (A) Jurkat cells were transfected with a Tax expression plasmid; RNA was reverse transcribed and analyzed by PCR. As an internal standard, β-actin PCRs were performed with the same cDNA. (B) Human T cells transformed with a repressible Tax gene (Tesi) were kept under conditions of induced (Tesi) and repressed (Tesi+Tet) Tax expression. Total RNA was analyzed by Northern blotting with an IL-13-specific probe. C91-PL and StEd, HTLV-1-infected lymphocytes; PBMC + PHA and Jurkat, uninfected T lymphocytes. (C) Tissue culture supernatants of Jurkat, Tesi, and Tesi+Tet cells were subjected to IL-13 ELISA. The results represent the means from three experiments. Error bars show standard deviations.

    Article Snippet: Prior to reverse transcriptase PCR (RT-PCR), RNA preparations were treated for 2 h with 40 U of DNase I (Roche, Mannheim, Germany) per ml at 37°C and precipitated with ethanol.

    Techniques: Expressing, Transfection, Plasmid Preparation, Polymerase Chain Reaction, Transformation Assay, Northern Blot, Infection, Enzyme-linked Immunosorbent Assay

    Expression of both chains of a functional IL-13 receptor on HTLV-1-infected T cells. The functional IL-13 receptor consists of IL-13Rα1 and IL-4Rα. Its expression in ATL-derived cultures (Champ, ATL-1, and ATL-3), in in vitro-HTLV-1-transformed T-cell lines (C91-PL and MT-2), and in Jurkat T cells was analyzed. Bcbl1, a B-cell line, served as positive control for IL-13Rα1 expression. (A) RNA from HTLV-1-infected IL-13 producing T cells was analyzed by RT-PCR with specific primers for IL-13Rα1 and IL-4Rα. IL-4Rα was expected to be expressed on all T cells and B cells. (B) Absence of the decoy receptor IL-13Rα2. RT-PCR of the same cDNAs as in panel A is shown; pIL-13Rα2 is a positive control containing cloned receptor cDNA. The first nine lanes of the β-actin gel are identical to those in panel A. (C) Surface expression of IL-13Rα1. The cells indicated were stained with specific antibodies and analyzed by flow cytometry. (D) Surface expression of IL-4Rα. The cells indicated were stained with specific antibodies and analyzed by flow cytometry.

    Journal: Journal of Virology

    Article Title: Interleukin-13 Overexpression by Tax Transactivation: a Potential Autocrine Stimulus in Human T-Cell Leukemia Virus-Infected Lymphocytes

    doi: 10.1128/JVI.78.12.6081-6090.2004

    Figure Lengend Snippet: Expression of both chains of a functional IL-13 receptor on HTLV-1-infected T cells. The functional IL-13 receptor consists of IL-13Rα1 and IL-4Rα. Its expression in ATL-derived cultures (Champ, ATL-1, and ATL-3), in in vitro-HTLV-1-transformed T-cell lines (C91-PL and MT-2), and in Jurkat T cells was analyzed. Bcbl1, a B-cell line, served as positive control for IL-13Rα1 expression. (A) RNA from HTLV-1-infected IL-13 producing T cells was analyzed by RT-PCR with specific primers for IL-13Rα1 and IL-4Rα. IL-4Rα was expected to be expressed on all T cells and B cells. (B) Absence of the decoy receptor IL-13Rα2. RT-PCR of the same cDNAs as in panel A is shown; pIL-13Rα2 is a positive control containing cloned receptor cDNA. The first nine lanes of the β-actin gel are identical to those in panel A. (C) Surface expression of IL-13Rα1. The cells indicated were stained with specific antibodies and analyzed by flow cytometry. (D) Surface expression of IL-4Rα. The cells indicated were stained with specific antibodies and analyzed by flow cytometry.

    Article Snippet: Prior to reverse transcriptase PCR (RT-PCR), RNA preparations were treated for 2 h with 40 U of DNase I (Roche, Mannheim, Germany) per ml at 37°C and precipitated with ethanol.

    Techniques: Expressing, Functional Assay, Infection, Derivative Assay, In Vitro, Transformation Assay, Positive Control, Reverse Transcription Polymerase Chain Reaction, Clone Assay, Staining, Flow Cytometry, Cytometry

    PCR analysis of some progeny of transgenic plants. The presence of the gus gene was proven by electrophoresis of amplified product (300 bp) on gDNA from plants of T 1 families ( A ) and on cDNA from plants of T 2 progeny ( B ). DNA from non-transformed (control) plants was used as a negative control, while the plasmid (pWBVec10a) carried by the A. tumefaciens strain, was used as a positive control. The 1-kb DNA Molecular Weight Ladder is represented in the last lane.

    Journal: Molecules

    Article Title: Screening Auxin Response, In Vitro Culture Aptitude and Susceptibility to Agrobacterium-Mediated Transformation of Italian Commercial Durum Wheat Varieties

    doi: 10.3390/molecules21111440

    Figure Lengend Snippet: PCR analysis of some progeny of transgenic plants. The presence of the gus gene was proven by electrophoresis of amplified product (300 bp) on gDNA from plants of T 1 families ( A ) and on cDNA from plants of T 2 progeny ( B ). DNA from non-transformed (control) plants was used as a negative control, while the plasmid (pWBVec10a) carried by the A. tumefaciens strain, was used as a positive control. The 1-kb DNA Molecular Weight Ladder is represented in the last lane.

    Article Snippet: Amplicons were purified with DNA purification kit NucleoSpin® PCR Clean-up (Macherey-Nagel, Duren, Germany), quantified by Qubit® Fluorometer (Life Technologies, Carlsbad, CA, USA), and sequenced by Macrogen Europe (Amsterdam, The Netherlands).

    Techniques: Polymerase Chain Reaction, Transgenic Assay, Electrophoresis, Amplification, Transformation Assay, Negative Control, Plasmid Preparation, Positive Control, Molecular Weight

    Screening of T 0 and T 1 Tr cry1Ac transgenic tomato plants. A–C PCR amplification of 995 bp of cry1Ac gene. D–F 678 bp of npt II gene using gene specific primers in thirty T 0 transgenics. G , H RT-PCR analysis of ten randomly selected T 0 transgenic tomato plants of cry1Ac showing 995 bp cry1Ac gene and 678 bp npt II gene transcripts. M – 100 bp DNA ladder (NEB, USA). -C – non-transgenic control plant, +C – plasmid DNA positive control. I Real-time analysis for Bt- cry1Ac transcript levels in six T 0 transgenic tomato plants. TC – Transgenic plant with low expression of Bt-toxin used as control. J–O PCR amplification of 995 bp of cry1Ac gene and 678 bp of npt II gene using gene specific primers inT 1 progeny of promising T 0 parents. M −100 bp DNA ladder (NEB, USA). –C : non-transgenic control plant, +C : plasmid DNA positive control.

    Journal: SpringerPlus

    Article Title: Comparative performance of modified full-length and truncated Bacillus thuringiensis-cry1Ac genes in transgenic tomato

    doi: 10.1186/s40064-015-0991-x

    Figure Lengend Snippet: Screening of T 0 and T 1 Tr cry1Ac transgenic tomato plants. A–C PCR amplification of 995 bp of cry1Ac gene. D–F 678 bp of npt II gene using gene specific primers in thirty T 0 transgenics. G , H RT-PCR analysis of ten randomly selected T 0 transgenic tomato plants of cry1Ac showing 995 bp cry1Ac gene and 678 bp npt II gene transcripts. M – 100 bp DNA ladder (NEB, USA). -C – non-transgenic control plant, +C – plasmid DNA positive control. I Real-time analysis for Bt- cry1Ac transcript levels in six T 0 transgenic tomato plants. TC – Transgenic plant with low expression of Bt-toxin used as control. J–O PCR amplification of 995 bp of cry1Ac gene and 678 bp of npt II gene using gene specific primers inT 1 progeny of promising T 0 parents. M −100 bp DNA ladder (NEB, USA). –C : non-transgenic control plant, +C : plasmid DNA positive control.

    Article Snippet: Screening of transgenic plants by PCR Genomic DNA from leaves of T0 putative transformed plants as well as control plants was isolated using GenElute plant genomic DNA miniprep kit, according to the manufacturer’s instructions (Sigma, USA).

    Techniques: Transgenic Assay, Polymerase Chain Reaction, Amplification, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Positive Control, Expressing

    Molecular characterizations of T 0 and T 1 progeny of FlAc7 and FlAc11 transgenic tomato plants. A Comparative real-time PCR analysis of transcript in T 0 Fl cry1Ac transgenic plants showing fold change in expression with respect to FlAc 9 (low expressing transgenic plant taken as reference). Control : non-transgenic control. B , C RT-PCR and cDNA amplification of 678 bp npt II gene and 768 bp Fl cry1Ac gene of T 1 progeny using specific primers. M : 100 bp DNA ladder (NEB, USA). -C : non-transgenic control plant, +C : Fl cry1Ac gene plasmid DNA as positive control. D Southern blot probed with 3,510 bp Bam HI radiolabelled frament of FlCry1Ac gene. E Western immunoblot assay performed with crude leaf protein extract, lane1 purified Cry1Ac toxin protein, lane 12 : untransformed control, lane 2–11 : leaf protein extracts from progeny of T 0 FlAc7 and FlAc11. A protein band of ~130 kDa in transgenic plants showed hybridization with Cry1Ac antibodies, similar to positive control.

    Journal: SpringerPlus

    Article Title: Comparative performance of modified full-length and truncated Bacillus thuringiensis-cry1Ac genes in transgenic tomato

    doi: 10.1186/s40064-015-0991-x

    Figure Lengend Snippet: Molecular characterizations of T 0 and T 1 progeny of FlAc7 and FlAc11 transgenic tomato plants. A Comparative real-time PCR analysis of transcript in T 0 Fl cry1Ac transgenic plants showing fold change in expression with respect to FlAc 9 (low expressing transgenic plant taken as reference). Control : non-transgenic control. B , C RT-PCR and cDNA amplification of 678 bp npt II gene and 768 bp Fl cry1Ac gene of T 1 progeny using specific primers. M : 100 bp DNA ladder (NEB, USA). -C : non-transgenic control plant, +C : Fl cry1Ac gene plasmid DNA as positive control. D Southern blot probed with 3,510 bp Bam HI radiolabelled frament of FlCry1Ac gene. E Western immunoblot assay performed with crude leaf protein extract, lane1 purified Cry1Ac toxin protein, lane 12 : untransformed control, lane 2–11 : leaf protein extracts from progeny of T 0 FlAc7 and FlAc11. A protein band of ~130 kDa in transgenic plants showed hybridization with Cry1Ac antibodies, similar to positive control.

    Article Snippet: Screening of transgenic plants by PCR Genomic DNA from leaves of T0 putative transformed plants as well as control plants was isolated using GenElute plant genomic DNA miniprep kit, according to the manufacturer’s instructions (Sigma, USA).

    Techniques: Transgenic Assay, Real-time Polymerase Chain Reaction, Expressing, Reverse Transcription Polymerase Chain Reaction, Amplification, Plasmid Preparation, Positive Control, Southern Blot, Western Blot, Purification, Hybridization

    Molecular characterizations of T 0 Fl cry1Ac transgenic tomato plants. Upper Panel A–C PCR amplification of 768 bp of Fl cry1Ac gene using specific primers in thirty T 0 transgenics. D–F RT-PCR analysis of T 0 transgenic tomato plants showing 768 bp amplicon of cry1Ac gene. M : 100 bp DNA ladder (NEB, USA). -C : non-transgenic control plant, +C : plasmid DNA positive control. Lower Panel G–I PCR amplification of 678 bp npt II gene using specific primers in T 0 transgenics. J–L RT-PCR analysis of T 0 transgenic tomato plants of showing 678 bp amplicon of npt II gene. M : 100 bp DNA ladder (NEB, USA). -C : non-transgenic control plant, +C : plasmid DNA positive control.

    Journal: SpringerPlus

    Article Title: Comparative performance of modified full-length and truncated Bacillus thuringiensis-cry1Ac genes in transgenic tomato

    doi: 10.1186/s40064-015-0991-x

    Figure Lengend Snippet: Molecular characterizations of T 0 Fl cry1Ac transgenic tomato plants. Upper Panel A–C PCR amplification of 768 bp of Fl cry1Ac gene using specific primers in thirty T 0 transgenics. D–F RT-PCR analysis of T 0 transgenic tomato plants showing 768 bp amplicon of cry1Ac gene. M : 100 bp DNA ladder (NEB, USA). -C : non-transgenic control plant, +C : plasmid DNA positive control. Lower Panel G–I PCR amplification of 678 bp npt II gene using specific primers in T 0 transgenics. J–L RT-PCR analysis of T 0 transgenic tomato plants of showing 678 bp amplicon of npt II gene. M : 100 bp DNA ladder (NEB, USA). -C : non-transgenic control plant, +C : plasmid DNA positive control.

    Article Snippet: Screening of transgenic plants by PCR Genomic DNA from leaves of T0 putative transformed plants as well as control plants was isolated using GenElute plant genomic DNA miniprep kit, according to the manufacturer’s instructions (Sigma, USA).

    Techniques: Transgenic Assay, Polymerase Chain Reaction, Amplification, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Positive Control

    Schematic diagram of T-DNA regions of expression vectors used for tomato transformation. A pRD400. B pNBRI–1. RB and LB-right and left border sequences; npt II-coding region of neomycin phosphotransferase gene; DECaMV35S - CaMV35S promoter with double enhancer; cry1Ac -sequence coding for cry1Ac gene; P nos -promoter sequence of nopaline synthase; T nos -terminator sequence of nopaline synthase. Bold lines ( ) show fragments used for DNA probe and arrows ( ) indicates oligo primer sites used for PCR amplification denoted as A 1 B 1, A 2 B 2 and A 3 B 3 respectively.

    Journal: SpringerPlus

    Article Title: Comparative performance of modified full-length and truncated Bacillus thuringiensis-cry1Ac genes in transgenic tomato

    doi: 10.1186/s40064-015-0991-x

    Figure Lengend Snippet: Schematic diagram of T-DNA regions of expression vectors used for tomato transformation. A pRD400. B pNBRI–1. RB and LB-right and left border sequences; npt II-coding region of neomycin phosphotransferase gene; DECaMV35S - CaMV35S promoter with double enhancer; cry1Ac -sequence coding for cry1Ac gene; P nos -promoter sequence of nopaline synthase; T nos -terminator sequence of nopaline synthase. Bold lines ( ) show fragments used for DNA probe and arrows ( ) indicates oligo primer sites used for PCR amplification denoted as A 1 B 1, A 2 B 2 and A 3 B 3 respectively.

    Article Snippet: Screening of transgenic plants by PCR Genomic DNA from leaves of T0 putative transformed plants as well as control plants was isolated using GenElute plant genomic DNA miniprep kit, according to the manufacturer’s instructions (Sigma, USA).

    Techniques: Expressing, Transformation Assay, Sequencing, Polymerase Chain Reaction, Amplification

    PCR confirming the natural transformation in E. anophelis endophthalmitis. Lane 1: 1 kb DNA ladder. Lane 2: Positive control (pCMV-6 BDNF plasmid used as template). Expected band size of BDNF gene is 750 bp. Lane 3–5: PCR products from plasmid isolated from E. anophelis endophthalmitis after natural transformation. Lane 6–7: Negative controls.

    Journal: Scientific Reports

    Article Title: Comparative genomic analysis of a naturally competent Elizabethkingia anophelis isolated from an eye infection

    doi: 10.1038/s41598-018-26874-8

    Figure Lengend Snippet: PCR confirming the natural transformation in E. anophelis endophthalmitis. Lane 1: 1 kb DNA ladder. Lane 2: Positive control (pCMV-6 BDNF plasmid used as template). Expected band size of BDNF gene is 750 bp. Lane 3–5: PCR products from plasmid isolated from E. anophelis endophthalmitis after natural transformation. Lane 6–7: Negative controls.

    Article Snippet: PCR was performed for the presence of BDNF gene in the plasmids isolated from the transformaned colonies using specific primers (forward Primer: 5′-GGATCCATGACCATCCTTTTCCTTACTATGG-3′; reverse Primer: 5′-AAGCTTCTATCTTCCCCTTTTAATGGTCAGT-3′) in a final volume of 20 μl containing 10 μl of PCR Master Mix (Takara) which includes dNTPs, MgCl2, Taq DNA polymerase and PCR buffer), 0.5 μM of forward and reverse primers, template DNA (2 μl) and nuclease free Water (4 μl).

    Techniques: Polymerase Chain Reaction, Transformation Assay, Positive Control, Plasmid Preparation, Isolation

    Expression of CmSPL genes ( a , b , c ) and cmo-MIR156 ( d , e ) in CmNF-YB8 -RNAi chrysanthemum plants. qRT-PCR was performed to evaluate the expression of each gene. UBIQUITIN was used as the control gene for CmSPL3 , CmSPL5 , CmSPL9 , and primary cmo-MIR156 expression. U6 was used as the control gene for cmo-miR156. Three independent experiments were performed and error bars indicate standard deviation. Asterisks indicate significant differences according to a Student’s t test (* P

    Journal: Nature Communications

    Article Title: Control of chrysanthemum flowering through integration with an aging pathway

    doi: 10.1038/s41467-017-00812-0

    Figure Lengend Snippet: Expression of CmSPL genes ( a , b , c ) and cmo-MIR156 ( d , e ) in CmNF-YB8 -RNAi chrysanthemum plants. qRT-PCR was performed to evaluate the expression of each gene. UBIQUITIN was used as the control gene for CmSPL3 , CmSPL5 , CmSPL9 , and primary cmo-MIR156 expression. U6 was used as the control gene for cmo-miR156. Three independent experiments were performed and error bars indicate standard deviation. Asterisks indicate significant differences according to a Student’s t test (* P

    Article Snippet: Stem-loop reverse transcription was performed to evaluate the expression of cmo-miR156. cDNAs were synthesized using a miR156 stem-loop primer and the SuperScript III RT-PCR system as described above. qRT-PCR reactions (20 μl volume containing 1 μl cDNA and the cmo-miR156F/stem-loop universal-R primer set) were run using the StepOne Real-Time PCR System (Applied Biosystems) as described above.

    Techniques: Expressing, Quantitative RT-PCR, Standard Deviation

    CmNF-YB8 binds to the promoter of cmo-MIRNA156 . a Schematic representation of the upstream region of the foldback structure of the cmo-miR156 precursors a and b (pre-miR156a and pre-miR156b, respectively; green boxes ). The blue box indicates the promoter of the cmo-MIR156 gene. Asterisks correspond to putative CCAAT boxes and lines above the blue box indicate the fragments amplified in the ChIP-PCR analysis. P0: +175 ~ +321 bp, P1: −266 ~ −498 bp, P2: −473 ~ −720 bp, P3: −701 ~ −914 bp, P4: −893 ~ −1086 bp, P5: −1121 ~ −1318 bp, P6: −1289 ~ −1621 bp, P7: −1599 ~ −1754 bp relative to the major transcription start site (TSS) of cmo-MIR156 . Lines below the blue box indicate the fragments used in the yeast one-hybrid analysis shown in d . P8: −1421 ~ −1754 bp, P9: −1083 ~ −1436 bp, P10: −610 ~ −1082 bp, P11: −263 ~ −501 bp. b ChIP-enrichment of the indicated fragments (P0–P7) in the cmo-MIR156 promoter. Chromatin from 35S:CmNF-YB8-GFP chrysanthemum was immuno-precipitated with an anti-GFP antibody, and the amount of the indicated DNA was determined by qPCR. A pre-cmo-miR156a fragment (P0) was amplified as a negative control. c The P9 wild-type cis -element (CAAT box) and its nucleotide substitutions in the mutant version (P9m) are underlined. d Analysis of CmNF-YB8 binding to the promoter of cmo-MIR156 in a yeast one-hybrid system. The empty prey vector (AD) was used as a negative control. Interactions between bait and prey were determined by cell growth on synthetic dropout nutrient medium lacking Trp, Leu, and His, and containing 3 mM 3-amino-1,2,4-triazole (3-AT). e Interaction between CmNF-YB8 and cmo-MIR156 promoter using a dual-luciferase reporter assay in Nicotiana benthamiana leaves. A cmo-MIR156 promoter fragment: 0 ~ −1436 bp (from P9 to TSS) was used in this assay. mPro-miR156 is the same promoter fragment with a mutated CAAT cis -element (P9m). LUC vectors contain the REN gene under the control of the 35S promoter as a positive control. Samples were infiltrated into N. benthamiana leaves, and LUC and REN activities were assayed 3 days after infiltration. The ratio of LUC/REN of the empty vector (SK) co-transformed with LUC empty vector was used as calibrator (set as 1). Three independent experiments were performed and error bars indicate standard deviation

    Journal: Nature Communications

    Article Title: Control of chrysanthemum flowering through integration with an aging pathway

    doi: 10.1038/s41467-017-00812-0

    Figure Lengend Snippet: CmNF-YB8 binds to the promoter of cmo-MIRNA156 . a Schematic representation of the upstream region of the foldback structure of the cmo-miR156 precursors a and b (pre-miR156a and pre-miR156b, respectively; green boxes ). The blue box indicates the promoter of the cmo-MIR156 gene. Asterisks correspond to putative CCAAT boxes and lines above the blue box indicate the fragments amplified in the ChIP-PCR analysis. P0: +175 ~ +321 bp, P1: −266 ~ −498 bp, P2: −473 ~ −720 bp, P3: −701 ~ −914 bp, P4: −893 ~ −1086 bp, P5: −1121 ~ −1318 bp, P6: −1289 ~ −1621 bp, P7: −1599 ~ −1754 bp relative to the major transcription start site (TSS) of cmo-MIR156 . Lines below the blue box indicate the fragments used in the yeast one-hybrid analysis shown in d . P8: −1421 ~ −1754 bp, P9: −1083 ~ −1436 bp, P10: −610 ~ −1082 bp, P11: −263 ~ −501 bp. b ChIP-enrichment of the indicated fragments (P0–P7) in the cmo-MIR156 promoter. Chromatin from 35S:CmNF-YB8-GFP chrysanthemum was immuno-precipitated with an anti-GFP antibody, and the amount of the indicated DNA was determined by qPCR. A pre-cmo-miR156a fragment (P0) was amplified as a negative control. c The P9 wild-type cis -element (CAAT box) and its nucleotide substitutions in the mutant version (P9m) are underlined. d Analysis of CmNF-YB8 binding to the promoter of cmo-MIR156 in a yeast one-hybrid system. The empty prey vector (AD) was used as a negative control. Interactions between bait and prey were determined by cell growth on synthetic dropout nutrient medium lacking Trp, Leu, and His, and containing 3 mM 3-amino-1,2,4-triazole (3-AT). e Interaction between CmNF-YB8 and cmo-MIR156 promoter using a dual-luciferase reporter assay in Nicotiana benthamiana leaves. A cmo-MIR156 promoter fragment: 0 ~ −1436 bp (from P9 to TSS) was used in this assay. mPro-miR156 is the same promoter fragment with a mutated CAAT cis -element (P9m). LUC vectors contain the REN gene under the control of the 35S promoter as a positive control. Samples were infiltrated into N. benthamiana leaves, and LUC and REN activities were assayed 3 days after infiltration. The ratio of LUC/REN of the empty vector (SK) co-transformed with LUC empty vector was used as calibrator (set as 1). Three independent experiments were performed and error bars indicate standard deviation

    Article Snippet: Stem-loop reverse transcription was performed to evaluate the expression of cmo-miR156. cDNAs were synthesized using a miR156 stem-loop primer and the SuperScript III RT-PCR system as described above. qRT-PCR reactions (20 μl volume containing 1 μl cDNA and the cmo-miR156F/stem-loop universal-R primer set) were run using the StepOne Real-Time PCR System (Applied Biosystems) as described above.

    Techniques: Amplification, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Negative Control, Mutagenesis, Binding Assay, Plasmid Preparation, Luciferase, Reporter Assay, Positive Control, Transformation Assay, Standard Deviation

    Transcript abundance of chrysanthemum CmNF-YB8 . a Transcript abundance of CmNF-YB8 in different organs. Plants at 5 days after transplanting and growth under long day (LD) conditions were used. Apical buds (AB), leaves (L), stems (St), and roots (R) were harvested. b Transcript abundance of CmNF-YB8 in apical buds and leaves of differently aged chrysanthemum. Plants were grown under LD conditions. Samples were harvested every 10 days from 5 days after propagation. c Transcript abundance of CmNF-YB8 in chrysanthemum grown under different day lengths conditions, including LD and SD, under a low-temperature (4 °C) regime, or following treatment with gibberellic acid (GA 4/7 ). Leaves were harvested 30 days after each treatment. qRT-PCR was performed to evaluate expression of CmNF-YB8 , using UBIQUITIN as the control. Three independent experiments were performed and error bars indicate standard deviation. Significant differences were determined using Duncan’s multiple range test ( P

    Journal: Nature Communications

    Article Title: Control of chrysanthemum flowering through integration with an aging pathway

    doi: 10.1038/s41467-017-00812-0

    Figure Lengend Snippet: Transcript abundance of chrysanthemum CmNF-YB8 . a Transcript abundance of CmNF-YB8 in different organs. Plants at 5 days after transplanting and growth under long day (LD) conditions were used. Apical buds (AB), leaves (L), stems (St), and roots (R) were harvested. b Transcript abundance of CmNF-YB8 in apical buds and leaves of differently aged chrysanthemum. Plants were grown under LD conditions. Samples were harvested every 10 days from 5 days after propagation. c Transcript abundance of CmNF-YB8 in chrysanthemum grown under different day lengths conditions, including LD and SD, under a low-temperature (4 °C) regime, or following treatment with gibberellic acid (GA 4/7 ). Leaves were harvested 30 days after each treatment. qRT-PCR was performed to evaluate expression of CmNF-YB8 , using UBIQUITIN as the control. Three independent experiments were performed and error bars indicate standard deviation. Significant differences were determined using Duncan’s multiple range test ( P

    Article Snippet: Stem-loop reverse transcription was performed to evaluate the expression of cmo-miR156. cDNAs were synthesized using a miR156 stem-loop primer and the SuperScript III RT-PCR system as described above. qRT-PCR reactions (20 μl volume containing 1 μl cDNA and the cmo-miR156F/stem-loop universal-R primer set) were run using the StepOne Real-Time PCR System (Applied Biosystems) as described above.

    Techniques: Quantitative RT-PCR, Expressing, Standard Deviation

    The juvenile vegetative phase of CmNF-YB8 -RNAi chrysanthemum plants. a Transcript abundance of CmNF-YB8 in wild type (WT) and CmNF-YB8 -RNAi plants determined by qRT-PCR. RNAi-4, -13, and -22 correspond to three independent CmNF-YB8 -RNAi lines. b Morphology of leaves of seven-leaf-old WT and CmNF-YB8 -RNAi chrysanthemum plants. Juvenile leaves were defined as small, with no, or minimal, marginal serration. c Percentage of juvenile leaves among the first five leaves in WT and CmNF-YB8 -RNAi chrysanthemum plants. Three independent experiments were performed and error bars indicate standard deviation. Asterisks indicate significant differences according to a Student’s t test (** P

    Journal: Nature Communications

    Article Title: Control of chrysanthemum flowering through integration with an aging pathway

    doi: 10.1038/s41467-017-00812-0

    Figure Lengend Snippet: The juvenile vegetative phase of CmNF-YB8 -RNAi chrysanthemum plants. a Transcript abundance of CmNF-YB8 in wild type (WT) and CmNF-YB8 -RNAi plants determined by qRT-PCR. RNAi-4, -13, and -22 correspond to three independent CmNF-YB8 -RNAi lines. b Morphology of leaves of seven-leaf-old WT and CmNF-YB8 -RNAi chrysanthemum plants. Juvenile leaves were defined as small, with no, or minimal, marginal serration. c Percentage of juvenile leaves among the first five leaves in WT and CmNF-YB8 -RNAi chrysanthemum plants. Three independent experiments were performed and error bars indicate standard deviation. Asterisks indicate significant differences according to a Student’s t test (** P

    Article Snippet: Stem-loop reverse transcription was performed to evaluate the expression of cmo-miR156. cDNAs were synthesized using a miR156 stem-loop primer and the SuperScript III RT-PCR system as described above. qRT-PCR reactions (20 μl volume containing 1 μl cDNA and the cmo-miR156F/stem-loop universal-R primer set) were run using the StepOne Real-Time PCR System (Applied Biosystems) as described above.

    Techniques: Quantitative RT-PCR, Standard Deviation

    Antiviral activity of shrimp fed mja-miR-35-expressing bacteria in vivo . (A) Expression of mature mja-miR-35 in bacteria. LITMUS 38i vector (vector alone) or LITMUS 38i-miR-35 expressing mja-miR-35 (recombinant plasmid) was transformed into Escherichia coli HT115 cells. After IPTG induction, Northern blotting was conducted to detect mja-miR-35. (B) Detection of mature mja-miR-35 in shrimp fed with bacteria expressing mja-miR-35. The bacteria expressing mja-miR-35 were mixed with shrimp feed and then the shrimp were fed with the mixed feed daily. At 48 h after feeding, the expression level of mja-miR-35 was detected by Northern blotting. U6 served as a loading control. (C) Influence of mja-miR-35 in shrimp fed with bacteria-mja-miR-35 on WSSV replication. The WSSV-infected shrimp were fed shrimp feed containing bacteria-mja-miR-35 or bacteria-mja-miR-35-scrambled daily. At different post-infection times, WSSV copy number was quantified by real-time PCR. WSSV alone was used as a positive control. (D) Effects of mja-miR-35 in shrimp fed with bacteria-mja-miR-35 on shrimp cumulative mortality. The shrimp were treated with WSSV and fed shrimp feed containing bacteria- mja-miR-35 or bacteria- mja-miR-35-scrambled. The shrimp cumulative mortality was examined every day. The treatments were shown at the top. (E) Impact of mja-miR-35 in shrimp fed with bacteria-mja-miR-35 on the expression of mja-miR-35 target viral genes. Shrimp were fed shrimp feed+bacteria-miR-34/bacteria-miR-34-scrambled daily. The shrimp were then infected with WSSV. WSSV alone was used as a control. At 48 h post-infection, the mRNA levels of viral genes were evaluated using quantitative real-time PCR. Statistically significant differences between treatments were indicated with asterisks (* p

    Journal: Frontiers in Immunology

    Article Title: Shrimp Antiviral mja-miR-35 Targets CHI3L1 in Human M2 Macrophages and Suppresses Breast Cancer Metastasis

    doi: 10.3389/fimmu.2018.02071

    Figure Lengend Snippet: Antiviral activity of shrimp fed mja-miR-35-expressing bacteria in vivo . (A) Expression of mature mja-miR-35 in bacteria. LITMUS 38i vector (vector alone) or LITMUS 38i-miR-35 expressing mja-miR-35 (recombinant plasmid) was transformed into Escherichia coli HT115 cells. After IPTG induction, Northern blotting was conducted to detect mja-miR-35. (B) Detection of mature mja-miR-35 in shrimp fed with bacteria expressing mja-miR-35. The bacteria expressing mja-miR-35 were mixed with shrimp feed and then the shrimp were fed with the mixed feed daily. At 48 h after feeding, the expression level of mja-miR-35 was detected by Northern blotting. U6 served as a loading control. (C) Influence of mja-miR-35 in shrimp fed with bacteria-mja-miR-35 on WSSV replication. The WSSV-infected shrimp were fed shrimp feed containing bacteria-mja-miR-35 or bacteria-mja-miR-35-scrambled daily. At different post-infection times, WSSV copy number was quantified by real-time PCR. WSSV alone was used as a positive control. (D) Effects of mja-miR-35 in shrimp fed with bacteria-mja-miR-35 on shrimp cumulative mortality. The shrimp were treated with WSSV and fed shrimp feed containing bacteria- mja-miR-35 or bacteria- mja-miR-35-scrambled. The shrimp cumulative mortality was examined every day. The treatments were shown at the top. (E) Impact of mja-miR-35 in shrimp fed with bacteria-mja-miR-35 on the expression of mja-miR-35 target viral genes. Shrimp were fed shrimp feed+bacteria-miR-34/bacteria-miR-34-scrambled daily. The shrimp were then infected with WSSV. WSSV alone was used as a control. At 48 h post-infection, the mRNA levels of viral genes were evaluated using quantitative real-time PCR. Statistically significant differences between treatments were indicated with asterisks (* p

    Article Snippet: Quantitative real-time PCR detection of mRNA Total RNAs were extracted from cells or tissues using an RNAprep Pure Cell/Bacteria kit (Tiangen, Shanghai, China).

    Techniques: Activity Assay, Expressing, In Vivo, Plasmid Preparation, Recombinant, Transformation Assay, Northern Blot, Infection, Real-time Polymerase Chain Reaction, Positive Control

    RIN-mediated transcriptional regulation of β-Hex. (A) EMSA demonstrates the formation of DNA–protein complex between RIN and tomato β-Hex promoter fragments. EMSA was performed using double-stranded radiolabelled probes containing either 26-bp or 200-bp promoter fragments with normal (CArG and HP-200) or mutated (mCArG and mHP-200) CArG box elements with their flanking sequences. Cytosine (C) and guanine (G) were replaced with thymine (T) and adenine (A), respectively, to create mutated CArG probes. Specificity of the DNA–protein complex was analysed by using competitor DNAs. Arrows indicate DNA–protein complex. (B) EMSA shows binding of RIN protein to six different CArG boxes identified within the tomato β-Hex promoter. (C) Activation of the β-Hex promoter in the wild type (cv. Ailsa Craig) and rin mutant was determined by transient expression of GUS reporter in fruits. Mature green tomato fruits were agroinjected with HP::GUS construct. Agroinjected fruits were harvested at R stage and histochemical and fluorometric GUS assays were performed. Control fruits were agroinjected with 35S::GUS construct for constitutive expression of GUS reporter driven by CaMV 35S promoter. (D) Relative expression of β-Hex in wild type (cv. Ailsa Craig) and rin mutant fruits was determined by qRT-PCR using actin as an endogenous control. Data are presented as the mean (±SE) of two biological replicates.

    Journal: Journal of Experimental Botany

    Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening

    doi: 10.1093/jxb/eru324

    Figure Lengend Snippet: RIN-mediated transcriptional regulation of β-Hex. (A) EMSA demonstrates the formation of DNA–protein complex between RIN and tomato β-Hex promoter fragments. EMSA was performed using double-stranded radiolabelled probes containing either 26-bp or 200-bp promoter fragments with normal (CArG and HP-200) or mutated (mCArG and mHP-200) CArG box elements with their flanking sequences. Cytosine (C) and guanine (G) were replaced with thymine (T) and adenine (A), respectively, to create mutated CArG probes. Specificity of the DNA–protein complex was analysed by using competitor DNAs. Arrows indicate DNA–protein complex. (B) EMSA shows binding of RIN protein to six different CArG boxes identified within the tomato β-Hex promoter. (C) Activation of the β-Hex promoter in the wild type (cv. Ailsa Craig) and rin mutant was determined by transient expression of GUS reporter in fruits. Mature green tomato fruits were agroinjected with HP::GUS construct. Agroinjected fruits were harvested at R stage and histochemical and fluorometric GUS assays were performed. Control fruits were agroinjected with 35S::GUS construct for constitutive expression of GUS reporter driven by CaMV 35S promoter. (D) Relative expression of β-Hex in wild type (cv. Ailsa Craig) and rin mutant fruits was determined by qRT-PCR using actin as an endogenous control. Data are presented as the mean (±SE) of two biological replicates.

    Article Snippet: Five micrograms of total RNA were quantified using a nanodrop (ND 1000) and reverse transcribed to cDNA using superscript II RT (Invitrogen). qRT-PCR was performed using One Step Real Time RT-PCR (Applied Biosystems) with SYBR Green, as described previously ( ).

    Techniques: Binding Assay, Activation Assay, Mutagenesis, Expressing, Construct, Quantitative RT-PCR

    Determination of GUS transcript level and activity (histochemical and fluorometric assays) in HP::GUS and CaMV 35S::GUS tomato fruits. (A) Schematic representation of HP::GUS fusion construct ( GUS gene fused with tomato β-Hex promoter). (B) Comparative analysis of histochemical GUS staining of fruits harvested from the wild type untransformed plants and tomato transgenic plants transformed with HP::GUS ( GUS under the control of tomato β-Hex promoter) and 35S::GUS ( GUS under the control of CaMV 35S) constructs. L30 and L39 denote two independent tomato transgenic lines generated by transforming with HP::GUS construct. (C) GUS transcript level and activity in transgenic fruits were determined by qRT-PCR and fluorometric GUS assay, respectively. Data are presented as the mean (±SE) of two biological replicates. Immature green (IG) represents 15 DAA fruits.

    Journal: Journal of Experimental Botany

    Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening

    doi: 10.1093/jxb/eru324

    Figure Lengend Snippet: Determination of GUS transcript level and activity (histochemical and fluorometric assays) in HP::GUS and CaMV 35S::GUS tomato fruits. (A) Schematic representation of HP::GUS fusion construct ( GUS gene fused with tomato β-Hex promoter). (B) Comparative analysis of histochemical GUS staining of fruits harvested from the wild type untransformed plants and tomato transgenic plants transformed with HP::GUS ( GUS under the control of tomato β-Hex promoter) and 35S::GUS ( GUS under the control of CaMV 35S) constructs. L30 and L39 denote two independent tomato transgenic lines generated by transforming with HP::GUS construct. (C) GUS transcript level and activity in transgenic fruits were determined by qRT-PCR and fluorometric GUS assay, respectively. Data are presented as the mean (±SE) of two biological replicates. Immature green (IG) represents 15 DAA fruits.

    Article Snippet: Five micrograms of total RNA were quantified using a nanodrop (ND 1000) and reverse transcribed to cDNA using superscript II RT (Invitrogen). qRT-PCR was performed using One Step Real Time RT-PCR (Applied Biosystems) with SYBR Green, as described previously ( ).

    Techniques: Activity Assay, Construct, Staining, Transgenic Assay, Transformation Assay, Generated, Quantitative RT-PCR, GUS Gene Assay

    RIN regulates the expression of SlASR1 during fruit ripening. (A) qRT PCR transcript analysis of SlASR1 during ripening stages of wild type (cv. Ailsa Craig) and corresponding ages of rin mutant fruits. Data are presented as the mean (±SE) of at least three biological replicates. (B) EMSA to determine the interaction of RIN with the promoter fragments of SlASR1. Radiolabelled double stranded 26-bp (left side gel image) and 142-bp (right side gel image) fragments of SlASR1 promoter were used as probes in EMSA. The specificity of the interaction was checked by using mutated CArG box (mCArG) and an excess of specific competitor DNAs (unlabelled probes) in EMSA. This figure is available in colour at JXB online.

    Journal: Journal of Experimental Botany

    Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening

    doi: 10.1093/jxb/eru324

    Figure Lengend Snippet: RIN regulates the expression of SlASR1 during fruit ripening. (A) qRT PCR transcript analysis of SlASR1 during ripening stages of wild type (cv. Ailsa Craig) and corresponding ages of rin mutant fruits. Data are presented as the mean (±SE) of at least three biological replicates. (B) EMSA to determine the interaction of RIN with the promoter fragments of SlASR1. Radiolabelled double stranded 26-bp (left side gel image) and 142-bp (right side gel image) fragments of SlASR1 promoter were used as probes in EMSA. The specificity of the interaction was checked by using mutated CArG box (mCArG) and an excess of specific competitor DNAs (unlabelled probes) in EMSA. This figure is available in colour at JXB online.

    Article Snippet: Five micrograms of total RNA were quantified using a nanodrop (ND 1000) and reverse transcribed to cDNA using superscript II RT (Invitrogen). qRT-PCR was performed using One Step Real Time RT-PCR (Applied Biosystems) with SYBR Green, as described previously ( ).

    Techniques: Expressing, Quantitative RT-PCR, Mutagenesis

    Expression profiles of β-Hex during tomato fruit development and ripening stages. Flowers were tagged at anthesis and fruits were harvested at 3 to 20 DAA and MG, BR, P, and RR stages. Transcript level of β-Hex was measured by qRT-PCR analysis using tomato actin as an endogenous control. Data are presented as the mean (±SE) of at least three biological replicates.

    Journal: Journal of Experimental Botany

    Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening

    doi: 10.1093/jxb/eru324

    Figure Lengend Snippet: Expression profiles of β-Hex during tomato fruit development and ripening stages. Flowers were tagged at anthesis and fruits were harvested at 3 to 20 DAA and MG, BR, P, and RR stages. Transcript level of β-Hex was measured by qRT-PCR analysis using tomato actin as an endogenous control. Data are presented as the mean (±SE) of at least three biological replicates.

    Article Snippet: Five micrograms of total RNA were quantified using a nanodrop (ND 1000) and reverse transcribed to cDNA using superscript II RT (Invitrogen). qRT-PCR was performed using One Step Real Time RT-PCR (Applied Biosystems) with SYBR Green, as described previously ( ).

    Techniques: Expressing, Quantitative RT-PCR

    Activation of the β-Hex promoter in response to ethylene and ABA. Seedlings were treated with 1mM ACC or 0.1mM ABA in MS medium. GUS transcript level and activity were determined by qRT-PCR analysis and histochemical GUS assay, respectively. Histochemical assay was carried out after 4h of treatment. (A) GUS transcript level and activity were determined in HP::GUS (L30) seedlings after ACC treatment. (B) GUS transcript level and activity were determined in HP::GUS (L30) seedlings after ABA treatment. (C) β-Hex transcript level was determined in wild-type seedlings after ABA treatment. Data are presented as the mean (±SE) of atleast three biological replicates.

    Journal: Journal of Experimental Botany

    Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening

    doi: 10.1093/jxb/eru324

    Figure Lengend Snippet: Activation of the β-Hex promoter in response to ethylene and ABA. Seedlings were treated with 1mM ACC or 0.1mM ABA in MS medium. GUS transcript level and activity were determined by qRT-PCR analysis and histochemical GUS assay, respectively. Histochemical assay was carried out after 4h of treatment. (A) GUS transcript level and activity were determined in HP::GUS (L30) seedlings after ACC treatment. (B) GUS transcript level and activity were determined in HP::GUS (L30) seedlings after ABA treatment. (C) β-Hex transcript level was determined in wild-type seedlings after ABA treatment. Data are presented as the mean (±SE) of atleast three biological replicates.

    Article Snippet: Five micrograms of total RNA were quantified using a nanodrop (ND 1000) and reverse transcribed to cDNA using superscript II RT (Invitrogen). qRT-PCR was performed using One Step Real Time RT-PCR (Applied Biosystems) with SYBR Green, as described previously ( ).

    Techniques: Activation Assay, Mass Spectrometry, Activity Assay, Quantitative RT-PCR, GUS Gene Assay

    Transcriptional regulation of β-Hex expression by SlASR1. (A) Identification of SlASR1 as β-Hex promoter-interacting protein in Y1H screening. β-Hex promoter (HP) was inserted upstream of HIS3 reporter in pHIS2.1 vector and co-transformed into Saccharomyces cerevisiae strain Y187 along with pGADT7 vector that carried complete SlASR1 ORF upstream of the GAL4 transcription activation domain. Transformants were grown on SD medium lacking Trp, Leu, and His, but containing 5mM 3AT to determine HIS3 reporter gene activation. Empty pGADT7 vector co-transformed with pHIS2.1-HP and untransformed strain served as the controls. (B) EMSA to confirm the interaction of SlASR1 with the β-Hex promoter. GST-tagged SlASR1 and a radiolabelled 200-bp sequence of β-Hex promoter were used for EMSA. GST served as a control. The specificity of the DNA–protein complex was determined by using an excess of specific (unlabelled probe) and nonspecific competitor (tomato actin sequence) DNAs. (C) VIGS of SlASR1 in tomato fruits. For the silencing of SlASR1, Agrobacterium cultures containing pTRV1 and pTRV2- SlASR1 vectors were mixed in 1:1 ratio and infiltrated into tomato fruits while attached to the plants. pTRV2 was used as a vector control and pTRV2- SlPDS was used as a VIGS positive control for silencing of PDS . (D) The transcript levels of SlASR1 and β-Hex were determined in SlASR1 silenced fruits through qRT PCR analysis. (E) SlASR1 transcript level was determined in ACC-treated tomato seedlings by qRT-PCR analysis. Data are presented as the mean (±SE) of two biological replicates.

    Journal: Journal of Experimental Botany

    Article Title: Insights into transcriptional regulation of β-D-N-acetylhexosaminidase, an N-glycan-processing enzyme involved in ripening-associated fruit softening

    doi: 10.1093/jxb/eru324

    Figure Lengend Snippet: Transcriptional regulation of β-Hex expression by SlASR1. (A) Identification of SlASR1 as β-Hex promoter-interacting protein in Y1H screening. β-Hex promoter (HP) was inserted upstream of HIS3 reporter in pHIS2.1 vector and co-transformed into Saccharomyces cerevisiae strain Y187 along with pGADT7 vector that carried complete SlASR1 ORF upstream of the GAL4 transcription activation domain. Transformants were grown on SD medium lacking Trp, Leu, and His, but containing 5mM 3AT to determine HIS3 reporter gene activation. Empty pGADT7 vector co-transformed with pHIS2.1-HP and untransformed strain served as the controls. (B) EMSA to confirm the interaction of SlASR1 with the β-Hex promoter. GST-tagged SlASR1 and a radiolabelled 200-bp sequence of β-Hex promoter were used for EMSA. GST served as a control. The specificity of the DNA–protein complex was determined by using an excess of specific (unlabelled probe) and nonspecific competitor (tomato actin sequence) DNAs. (C) VIGS of SlASR1 in tomato fruits. For the silencing of SlASR1, Agrobacterium cultures containing pTRV1 and pTRV2- SlASR1 vectors were mixed in 1:1 ratio and infiltrated into tomato fruits while attached to the plants. pTRV2 was used as a vector control and pTRV2- SlPDS was used as a VIGS positive control for silencing of PDS . (D) The transcript levels of SlASR1 and β-Hex were determined in SlASR1 silenced fruits through qRT PCR analysis. (E) SlASR1 transcript level was determined in ACC-treated tomato seedlings by qRT-PCR analysis. Data are presented as the mean (±SE) of two biological replicates.

    Article Snippet: Five micrograms of total RNA were quantified using a nanodrop (ND 1000) and reverse transcribed to cDNA using superscript II RT (Invitrogen). qRT-PCR was performed using One Step Real Time RT-PCR (Applied Biosystems) with SYBR Green, as described previously ( ).

    Techniques: Expressing, Plasmid Preparation, Transformation Assay, Activation Assay, Sequencing, Positive Control, Quantitative RT-PCR

    HRVVP7-CTB molecular detection was performed using polymerase chain reaction and western blotting. Agarose gel electrophoresis was used to screen for positive transgenic lines following amplification. (A) HRVVP7-CTB fusion transgenic Arabidopsis thaliana lines. pUC19-HRVVP7-linker-CTB plasmid was used as the positive control (+). (B) HRVVP7 transgenic A. thaliana lines. pPHAP1301-HRVVP7 plasmid was used as the positive control (+). Proteins expressed by transgenic A. thaliana were assessed using western blotting. (C) HRVVP7-linker-CTB and (D) HRVVP7 expressed in seeds of T3 transgenic A. thaliana lines. HRVVP7, human rotavirus VP7; CTB, cholera toxin B subunit; WT, wild type A. thaliana; +, positive control; M, marker.

    Journal: Experimental and Therapeutic Medicine

    Article Title: Oral immunization with rotavirus VP7-CTB fusion expressed in transgenic Arabidopsis thaliana induces antigen-specific IgA and IgG and passive protection in mice

    doi: 10.3892/etm.2018.6003

    Figure Lengend Snippet: HRVVP7-CTB molecular detection was performed using polymerase chain reaction and western blotting. Agarose gel electrophoresis was used to screen for positive transgenic lines following amplification. (A) HRVVP7-CTB fusion transgenic Arabidopsis thaliana lines. pUC19-HRVVP7-linker-CTB plasmid was used as the positive control (+). (B) HRVVP7 transgenic A. thaliana lines. pPHAP1301-HRVVP7 plasmid was used as the positive control (+). Proteins expressed by transgenic A. thaliana were assessed using western blotting. (C) HRVVP7-linker-CTB and (D) HRVVP7 expressed in seeds of T3 transgenic A. thaliana lines. HRVVP7, human rotavirus VP7; CTB, cholera toxin B subunit; WT, wild type A. thaliana; +, positive control; M, marker.

    Article Snippet: Total RNA extraction and reverse transcription (RT)-PCR analysis of transformed A. thaliana seeds Total RNA was extracted from the seeds of the transformed and wild-type A. thaliana plants using a plant RNA extraction kit (MiniBEST Plant RNA Extraction kit; cat. no. 9769; Takara Bio, Inc.).

    Techniques: CtB Assay, Polymerase Chain Reaction, Western Blot, Agarose Gel Electrophoresis, Transgenic Assay, Amplification, Plasmid Preparation, Positive Control, Marker