pcr primers Illumina Inc Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs index primer
    Index Primer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 210 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/index primer/product/New England Biolabs
    Average 99 stars, based on 210 article reviews
    Price from $9.99 to $1999.99
    index primer - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher dntp mix
    Dntp Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 10231 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp mix/product/Thermo Fisher
    Average 99 stars, based on 10231 article reviews
    Price from $9.99 to $1999.99
    dntp mix - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    94
    Illumina Inc pcr primers
    Identification of introns . (A) Non strand-specific RNA-seq (data is from YPD media at 30°C) showing the expression level for gene Cpar2_601470. Although expression of the 3' UTR region is low, two potential introns were identified. The red arrows show the location of oligonucleotide primers designed to confirm the presence of the introns. (B) Intron validation by <t>PCR.</t> Pairs of oligonucleotide primers flanking the intronic region were used to amplify products from genomic <t>DNA</t> (D) or cDNA (R). Introns were confirmed in the 3' UTR of Cpar2_601470, the 5' UTRs of Cpar2_400980 and Cpar2_205880, and within the coding sequence of 5 other genes (details of expected sizes are shown in Additional file 8 ). The small bands in Cpar2_601830 and Cpar2_807560 are likely due to the presence of excess primers or to nonspecific amplification.
    Pcr Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 1615 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr primers/product/Illumina Inc
    Average 94 stars, based on 1615 article reviews
    Price from $9.99 to $1999.99
    pcr primers - by Bioz Stars, 2020-01
    94/100 stars
      Buy from Supplier

    99
    Illumina Inc truseq pcr primers
    Identification of introns . (A) Non strand-specific RNA-seq (data is from YPD media at 30°C) showing the expression level for gene Cpar2_601470. Although expression of the 3' UTR region is low, two potential introns were identified. The red arrows show the location of oligonucleotide primers designed to confirm the presence of the introns. (B) Intron validation by <t>PCR.</t> Pairs of oligonucleotide primers flanking the intronic region were used to amplify products from genomic <t>DNA</t> (D) or cDNA (R). Introns were confirmed in the 3' UTR of Cpar2_601470, the 5' UTRs of Cpar2_400980 and Cpar2_205880, and within the coding sequence of 5 other genes (details of expected sizes are shown in Additional file 8 ). The small bands in Cpar2_601830 and Cpar2_807560 are likely due to the presence of excess primers or to nonspecific amplification.
    Truseq Pcr Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 153 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/truseq pcr primers/product/Illumina Inc
    Average 99 stars, based on 153 article reviews
    Price from $9.99 to $1999.99
    truseq pcr primers - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    78
    Illumina Inc genomic pcr primer
    Identification of introns . (A) Non strand-specific RNA-seq (data is from YPD media at 30°C) showing the expression level for gene Cpar2_601470. Although expression of the 3' UTR region is low, two potential introns were identified. The red arrows show the location of oligonucleotide primers designed to confirm the presence of the introns. (B) Intron validation by <t>PCR.</t> Pairs of oligonucleotide primers flanking the intronic region were used to amplify products from genomic <t>DNA</t> (D) or cDNA (R). Introns were confirmed in the 3' UTR of Cpar2_601470, the 5' UTRs of Cpar2_400980 and Cpar2_205880, and within the coding sequence of 5 other genes (details of expected sizes are shown in Additional file 8 ). The small bands in Cpar2_601830 and Cpar2_807560 are likely due to the presence of excess primers or to nonspecific amplification.
    Genomic Pcr Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 78/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic pcr primer/product/Illumina Inc
    Average 78 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    genomic pcr primer - by Bioz Stars, 2020-01
    78/100 stars
      Buy from Supplier

    93
    Illumina Inc nextera pcr primers
    Identification of introns . (A) Non strand-specific RNA-seq (data is from YPD media at 30°C) showing the expression level for gene Cpar2_601470. Although expression of the 3' UTR region is low, two potential introns were identified. The red arrows show the location of oligonucleotide primers designed to confirm the presence of the introns. (B) Intron validation by <t>PCR.</t> Pairs of oligonucleotide primers flanking the intronic region were used to amplify products from genomic <t>DNA</t> (D) or cDNA (R). Introns were confirmed in the 3' UTR of Cpar2_601470, the 5' UTRs of Cpar2_400980 and Cpar2_205880, and within the coding sequence of 5 other genes (details of expected sizes are shown in Additional file 8 ). The small bands in Cpar2_601830 and Cpar2_807560 are likely due to the presence of excess primers or to nonspecific amplification.
    Nextera Pcr Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 93/100, based on 83 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nextera pcr primers/product/Illumina Inc
    Average 93 stars, based on 83 article reviews
    Price from $9.99 to $1999.99
    nextera pcr primers - by Bioz Stars, 2020-01
    93/100 stars
      Buy from Supplier

    98
    Illumina Inc paired end pcr primers
    Identification of introns . (A) Non strand-specific RNA-seq (data is from YPD media at 30°C) showing the expression level for gene Cpar2_601470. Although expression of the 3' UTR region is low, two potential introns were identified. The red arrows show the location of oligonucleotide primers designed to confirm the presence of the introns. (B) Intron validation by <t>PCR.</t> Pairs of oligonucleotide primers flanking the intronic region were used to amplify products from genomic <t>DNA</t> (D) or cDNA (R). Introns were confirmed in the 3' UTR of Cpar2_601470, the 5' UTRs of Cpar2_400980 and Cpar2_205880, and within the coding sequence of 5 other genes (details of expected sizes are shown in Additional file 8 ). The small bands in Cpar2_601830 and Cpar2_807560 are likely due to the presence of excess primers or to nonspecific amplification.
    Paired End Pcr Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 98/100, based on 141 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/paired end pcr primers/product/Illumina Inc
    Average 98 stars, based on 141 article reviews
    Price from $9.99 to $1999.99
    paired end pcr primers - by Bioz Stars, 2020-01
    98/100 stars
      Buy from Supplier

    89
    Illumina Inc i7 series pcr primers
    Identification of introns . (A) Non strand-specific RNA-seq (data is from YPD media at 30°C) showing the expression level for gene Cpar2_601470. Although expression of the 3' UTR region is low, two potential introns were identified. The red arrows show the location of oligonucleotide primers designed to confirm the presence of the introns. (B) Intron validation by <t>PCR.</t> Pairs of oligonucleotide primers flanking the intronic region were used to amplify products from genomic <t>DNA</t> (D) or cDNA (R). Introns were confirmed in the 3' UTR of Cpar2_601470, the 5' UTRs of Cpar2_400980 and Cpar2_205880, and within the coding sequence of 5 other genes (details of expected sizes are shown in Additional file 8 ). The small bands in Cpar2_601830 and Cpar2_807560 are likely due to the presence of excess primers or to nonspecific amplification.
    I7 Series Pcr Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 89/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/i7 series pcr primers/product/Illumina Inc
    Average 89 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    i7 series pcr primers - by Bioz Stars, 2020-01
    89/100 stars
      Buy from Supplier

    78
    Illumina Inc pcr primer 2
    Identification of introns . (A) Non strand-specific RNA-seq (data is from YPD media at 30°C) showing the expression level for gene Cpar2_601470. Although expression of the 3' UTR region is low, two potential introns were identified. The red arrows show the location of oligonucleotide primers designed to confirm the presence of the introns. (B) Intron validation by <t>PCR.</t> Pairs of oligonucleotide primers flanking the intronic region were used to amplify products from genomic <t>DNA</t> (D) or cDNA (R). Introns were confirmed in the 3' UTR of Cpar2_601470, the 5' UTRs of Cpar2_400980 and Cpar2_205880, and within the coding sequence of 5 other genes (details of expected sizes are shown in Additional file 8 ). The small bands in Cpar2_601830 and Cpar2_807560 are likely due to the presence of excess primers or to nonspecific amplification.
    Pcr Primer 2, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 78/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr primer 2/product/Illumina Inc
    Average 78 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    pcr primer 2 - by Bioz Stars, 2020-01
    78/100 stars
      Buy from Supplier

    79
    Illumina Inc pcr primer inpe1 0
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Pcr Primer Inpe1 0, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 79/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr primer inpe1 0/product/Illumina Inc
    Average 79 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    pcr primer inpe1 0 - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    77
    Illumina Inc acactctttccctacacgacgctcttccgatct multiplexing pcr primers
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Acactctttccctacacgacgctcttccgatct Multiplexing Pcr Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 77/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/acactctttccctacacgacgctcttccgatct multiplexing pcr primers/product/Illumina Inc
    Average 77 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    acactctttccctacacgacgctcttccgatct multiplexing pcr primers - by Bioz Stars, 2020-01
    77/100 stars
      Buy from Supplier

    97
    Illumina Inc scriptseq index pcr primers
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Scriptseq Index Pcr Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 97/100, based on 64 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scriptseq index pcr primers/product/Illumina Inc
    Average 97 stars, based on 64 article reviews
    Price from $9.99 to $1999.99
    scriptseq index pcr primers - by Bioz Stars, 2020-01
    97/100 stars
      Buy from Supplier

    77
    Illumina Inc gtgactggagttcagacgtgtgctcttccgatct pcr indexing primers
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Gtgactggagttcagacgtgtgctcttccgatct Pcr Indexing Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 77/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gtgactggagttcagacgtgtgctcttccgatct pcr indexing primers/product/Illumina Inc
    Average 77 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    gtgactggagttcagacgtgtgctcttccgatct pcr indexing primers - by Bioz Stars, 2020-01
    77/100 stars
      Buy from Supplier

    80
    Illumina Inc epicentre scriptseq index pcr primer
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Epicentre Scriptseq Index Pcr Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 80/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/epicentre scriptseq index pcr primer/product/Illumina Inc
    Average 80 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    epicentre scriptseq index pcr primer - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    78
    Illumina Inc small rna pcr primers 1
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Small Rna Pcr Primers 1, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 78/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/small rna pcr primers 1/product/Illumina Inc
    Average 78 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    small rna pcr primers 1 - by Bioz Stars, 2020-01
    78/100 stars
      Buy from Supplier

    80
    Illumina Inc rna pcr primer index rpi1
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Rna Pcr Primer Index Rpi1, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 80/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna pcr primer index rpi1/product/Illumina Inc
    Average 80 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    rna pcr primer index rpi1 - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    84
    Illumina Inc pcr employing nextera xt index primer
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Pcr Employing Nextera Xt Index Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 84/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr employing nextera xt index primer/product/Illumina Inc
    Average 84 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    pcr employing nextera xt index primer - by Bioz Stars, 2020-01
    84/100 stars
      Buy from Supplier

    79
    Illumina Inc full length pcr primer pe 1 0
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Full Length Pcr Primer Pe 1 0, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 79/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/full length pcr primer pe 1 0/product/Illumina Inc
    Average 79 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    full length pcr primer pe 1 0 - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    89
    Illumina Inc truseq small rna 3 indexed pcr primers
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Truseq Small Rna 3 Indexed Pcr Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 89/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/truseq small rna 3 indexed pcr primers/product/Illumina Inc
    Average 89 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    truseq small rna 3 indexed pcr primers - by Bioz Stars, 2020-01
    89/100 stars
      Buy from Supplier

    92
    Illumina Inc truseq dna methylation index pcr primers
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Truseq Dna Methylation Index Pcr Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 58 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/truseq dna methylation index pcr primers/product/Illumina Inc
    Average 92 stars, based on 58 article reviews
    Price from $9.99 to $1999.99
    truseq dna methylation index pcr primers - by Bioz Stars, 2020-01
    92/100 stars
      Buy from Supplier

    88
    Illumina Inc truseq dna methylation kit index pcr primers
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Truseq Dna Methylation Kit Index Pcr Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 88/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/truseq dna methylation kit index pcr primers/product/Illumina Inc
    Average 88 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    truseq dna methylation kit index pcr primers - by Bioz Stars, 2020-01
    88/100 stars
      Buy from Supplier

    99
    Illumina Inc eco real time pcr system
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Eco Real Time Pcr System, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 3052 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/eco real time pcr system/product/Illumina Inc
    Average 99 stars, based on 3052 article reviews
    Price from $9.99 to $1999.99
    eco real time pcr system - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    81
    Illumina Inc e502 nextera barcoding primer
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    E502 Nextera Barcoding Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 81/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e502 nextera barcoding primer/product/Illumina Inc
    Average 81 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    e502 nextera barcoding primer - by Bioz Stars, 2020-01
    81/100 stars
      Buy from Supplier

    81
    Illumina Inc n12 nextera barcoding primer
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    N12 Nextera Barcoding Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 81/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/n12 nextera barcoding primer/product/Illumina Inc
    Average 81 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    n12 nextera barcoding primer - by Bioz Stars, 2020-01
    81/100 stars
      Buy from Supplier

    83
    Illumina Inc primer 2 1
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Primer 2 1, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 83/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer 2 1/product/Illumina Inc
    Average 83 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    primer 2 1 - by Bioz Stars, 2020-01
    83/100 stars
      Buy from Supplier

    86
    Illumina Inc primers illumina qpcr 1
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Primers Illumina Qpcr 1, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 86/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primers illumina qpcr 1/product/Illumina Inc
    Average 86 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    primers illumina qpcr 1 - by Bioz Stars, 2020-01
    86/100 stars
      Buy from Supplier

    89
    Illumina Inc amplification primer mix
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Amplification Primer Mix, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 89/100, based on 149 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amplification primer mix/product/Illumina Inc
    Average 89 stars, based on 149 article reviews
    Price from $9.99 to $1999.99
    amplification primer mix - by Bioz Stars, 2020-01
    89/100 stars
      Buy from Supplier

    99
    Illumina Inc nextera index primers
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Nextera Index Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 100 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nextera index primers/product/Illumina Inc
    Average 99 stars, based on 100 article reviews
    Price from $9.99 to $1999.99
    nextera index primers - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    99
    Illumina Inc illumina miseq
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Illumina Miseq, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 34520 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina miseq/product/Illumina Inc
    Average 99 stars, based on 34520 article reviews
    Price from $9.99 to $1999.99
    illumina miseq - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    83
    Illumina Inc pe primer 1 0
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Pe Primer 1 0, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 83/100, based on 61 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pe primer 1 0/product/Illumina Inc
    Average 83 stars, based on 61 article reviews
    Price from $9.99 to $1999.99
    pe primer 1 0 - by Bioz Stars, 2020-01
    83/100 stars
      Buy from Supplier

    99
    Illumina Inc nextera dna library preparation kit
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Nextera Dna Library Preparation Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1342 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nextera dna library preparation kit/product/Illumina Inc
    Average 99 stars, based on 1342 article reviews
    Price from $9.99 to $1999.99
    nextera dna library preparation kit - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    78
    Illumina Inc pe primer 2 0 primers
    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through <t>PCR.</t> Note the relative positions and characteristics (Inset) of the <t>InPE1.0,</t> InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.
    Pe Primer 2 0 Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 78/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pe primer 2 0 primers/product/Illumina Inc
    Average 78 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    pe primer 2 0 primers - by Bioz Stars, 2020-01
    78/100 stars
      Buy from Supplier

    Image Search Results


    Identification of introns . (A) Non strand-specific RNA-seq (data is from YPD media at 30°C) showing the expression level for gene Cpar2_601470. Although expression of the 3' UTR region is low, two potential introns were identified. The red arrows show the location of oligonucleotide primers designed to confirm the presence of the introns. (B) Intron validation by PCR. Pairs of oligonucleotide primers flanking the intronic region were used to amplify products from genomic DNA (D) or cDNA (R). Introns were confirmed in the 3' UTR of Cpar2_601470, the 5' UTRs of Cpar2_400980 and Cpar2_205880, and within the coding sequence of 5 other genes (details of expected sizes are shown in Additional file 8 ). The small bands in Cpar2_601830 and Cpar2_807560 are likely due to the presence of excess primers or to nonspecific amplification.

    Journal: BMC Genomics

    Article Title: Using RNA-seq to determine the transcriptional landscape and the hypoxic response of the pathogenic yeast Candida parapsilosis

    doi: 10.1186/1471-2164-12-628

    Figure Lengend Snippet: Identification of introns . (A) Non strand-specific RNA-seq (data is from YPD media at 30°C) showing the expression level for gene Cpar2_601470. Although expression of the 3' UTR region is low, two potential introns were identified. The red arrows show the location of oligonucleotide primers designed to confirm the presence of the introns. (B) Intron validation by PCR. Pairs of oligonucleotide primers flanking the intronic region were used to amplify products from genomic DNA (D) or cDNA (R). Introns were confirmed in the 3' UTR of Cpar2_601470, the 5' UTRs of Cpar2_400980 and Cpar2_205880, and within the coding sequence of 5 other genes (details of expected sizes are shown in Additional file 8 ). The small bands in Cpar2_601830 and Cpar2_807560 are likely due to the presence of excess primers or to nonspecific amplification.

    Article Snippet: In all cases, purified adapter ligated DNA templates were then amplified through PCR enrichment, using PCR primers (Illumina), a dNTP mix, Phusion Polymerase (NEB) and 16 cycles of PCR.

    Techniques: RNA Sequencing Assay, Expressing, Polymerase Chain Reaction, Sequencing, Amplification

    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through PCR. Note the relative positions and characteristics (Inset) of the InPE1.0, InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.

    Journal: Current protocols in microbiology

    Article Title: Preparing DNA Libraries for Multiplexed Paired-End Deep Sequencing for Illumina GA Sequencers

    doi: 10.1002/9780471729259.mc01e04s20

    Figure Lengend Snippet: Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through PCR. Note the relative positions and characteristics (Inset) of the InPE1.0, InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.

    Article Snippet: Adapter-ligated DNA sample PCR Primer InPE1.0 (Illumina Cat. #PE400-1001) PCR Primer InPE2.0 (Illumina Cat. #PE400-1001) PCR Index primer (Illumina Cat. #PE400-1001) 5x HF Phusion buffer (NEB Cat. #F-540S) 10 mM dNTP (NEB Cat. #N0447S) Phusion DNA polymerase (NEB Cat. #F-540S) 6X gel loading dye with Gel Green (see recipe) 100 bp Marker (NEB Cat. #N3231S) 1X TBE (see recipe) 5% TBE DNA acrylamide gel (BioRad Cat. #161-1109) Sterile double-distilled water (nuclease-free) PCR thermal cycler to hold 200 μl PCR tubes with heated lid DNA acrylamide gel electrophoresis set-up QIAquick PCR Purification kit (Qiagen Cat. #28104) NanoDrop spectrophotometer (NanoDrop Model #ND100) Prepare the following reaction mix on ice in a new 200 μl PCR tube, making sure that the Phusion DNA polymerase is the last component to be added to the mix: The PCR Index Primer used should be different for each strain DNA library constructed (e.g. strain 1 – Index Primer 1; strain 2 – Index Primer 2; strain 3 – Index Primer 3; etc) Amplify using the following PCR protocol: 30 sec at 98°C 18 cycles of: 10 sec at 98 °C 30 sec at 65 °C 30 sec at 72 °C 5 min at 72 °C Hold at 4 °C until ready to proceed with next step.

    Techniques: Sequencing, Purification, Modification, Polymerase Chain Reaction

    Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through PCR. Note the relative positions and characteristics (Inset) of the InPE1.0, InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.

    Journal: Current protocols in microbiology

    Article Title: Preparing DNA Libraries for Multiplexed Paired-End Deep Sequencing for Illumina GA Sequencers

    doi: 10.1002/9780471729259.mc01e04s20

    Figure Lengend Snippet: Overview of DNA library preparation for deep sequencing. The purified genomic DNA is processed and modified as described in the basic protocols. The adapter-modified DNA fragments (library) are then enriched through PCR. Note the relative positions and characteristics (Inset) of the InPE1.0, InPE2.0 and the Index primers used during PCR. For multiplexed paired-end PCR, the same InPE1.0 and InPE2.0 primers are used, however, up to 12 different Index primers can be added to the enrichment reactions individually. Sequencing is performed in one direction through sequencing by synthesis , and then in the alternate direction as described in the background information. The complementary sequences are shaded darker.

    Article Snippet: Adapter-ligated DNA sample PCR Primer InPE1.0 (Illumina Cat. #PE400-1001) PCR Primer InPE2.0 (Illumina Cat. #PE400-1001) PCR Index primer (Illumina Cat. #PE400-1001) 5x HF Phusion buffer (NEB Cat. #F-540S) 10 mM dNTP (NEB Cat. #N0447S) Phusion DNA polymerase (NEB Cat. #F-540S) 6X gel loading dye with Gel Green (see recipe) 100 bp Marker (NEB Cat. #N3231S) 1X TBE (see recipe) 5% TBE DNA acrylamide gel (BioRad Cat. #161-1109) Sterile double-distilled water (nuclease-free) PCR thermal cycler to hold 200 μl PCR tubes with heated lid DNA acrylamide gel electrophoresis set-up QIAquick PCR Purification kit (Qiagen Cat. #28104) NanoDrop spectrophotometer (NanoDrop Model #ND100) Prepare the following reaction mix on ice in a new 200 μl PCR tube, making sure that the Phusion DNA polymerase is the last component to be added to the mix: The PCR Index Primer used should be different for each strain DNA library constructed (e.g. strain 1 – Index Primer 1; strain 2 – Index Primer 2; strain 3 – Index Primer 3; etc) Amplify using the following PCR protocol: 30 sec at 98°C 18 cycles of: 10 sec at 98 °C 30 sec at 65 °C 30 sec at 72 °C 5 min at 72 °C Hold at 4 °C until ready to proceed with next step.

    Techniques: Sequencing, Purification, Modification, Polymerase Chain Reaction