pcr buffer Qiagen Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Qiagen qiagen asl buffer
    Qiagen Asl Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 51 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiagen asl buffer/product/Qiagen
    Average 95 stars, based on 51 article reviews
    Price from $9.99 to $1999.99
    qiagen asl buffer - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    99
    Qiagen polymerase chain reaction buffer
    Fingerprinting Xanthomonas isolates by <t>REP-PCR</t> and agarose gel electrophoresis. Lanes: M1, λ × Hin dIII (Life Technologies, Gaithersburg, Md.); M2 = kilobase <t>DNA</t> ladder (Stratagene, La Jolla, Calif.); 1, E. coli strain B; 2, P. putida 39169; 3, X. campestris pv. campestris 33913; 4, X. campestris pv. campestris X3; 5, X. campestris pv. campestris KX-1; 6, X. axonopodis pv. citrumelo 3048; 7, X. axonopodis pv. malvacearum N; 8, X. axonopodis pv. axonopodis 19132; 9, X. axonopodis pv. citri 62; 10, X. axonopodis pv. citri 3213; 11, X. axonopodis pv. citri 100; 12, X. axonopodis pv. citri 166; 13, X. axonopodis pv. citri 169; 14, X. oryzae pv. oryzae 43836; 15, X. oryzae pv. oryzae 43837; 16, X. oryzae pv. oryzicola 49072; 17, no-template control.
    Polymerase Chain Reaction Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 252 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction buffer/product/Qiagen
    Average 99 stars, based on 252 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction buffer - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Qiagen polymerase chain reaction pcr purification kit
    Fingerprinting Xanthomonas isolates by <t>REP-PCR</t> and agarose gel electrophoresis. Lanes: M1, λ × Hin dIII (Life Technologies, Gaithersburg, Md.); M2 = kilobase <t>DNA</t> ladder (Stratagene, La Jolla, Calif.); 1, E. coli strain B; 2, P. putida 39169; 3, X. campestris pv. campestris 33913; 4, X. campestris pv. campestris X3; 5, X. campestris pv. campestris KX-1; 6, X. axonopodis pv. citrumelo 3048; 7, X. axonopodis pv. malvacearum N; 8, X. axonopodis pv. axonopodis 19132; 9, X. axonopodis pv. citri 62; 10, X. axonopodis pv. citri 3213; 11, X. axonopodis pv. citri 100; 12, X. axonopodis pv. citri 166; 13, X. axonopodis pv. citri 169; 14, X. oryzae pv. oryzae 43836; 15, X. oryzae pv. oryzae 43837; 16, X. oryzae pv. oryzicola 49072; 17, no-template control.
    Polymerase Chain Reaction Pcr Purification Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 77 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr purification kit/product/Qiagen
    Average 99 stars, based on 77 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr purification kit - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    83
    Qiagen 1x polymerase chain reaction pcr buffer
    Fingerprinting Xanthomonas isolates by <t>REP-PCR</t> and agarose gel electrophoresis. Lanes: M1, λ × Hin dIII (Life Technologies, Gaithersburg, Md.); M2 = kilobase <t>DNA</t> ladder (Stratagene, La Jolla, Calif.); 1, E. coli strain B; 2, P. putida 39169; 3, X. campestris pv. campestris 33913; 4, X. campestris pv. campestris X3; 5, X. campestris pv. campestris KX-1; 6, X. axonopodis pv. citrumelo 3048; 7, X. axonopodis pv. malvacearum N; 8, X. axonopodis pv. axonopodis 19132; 9, X. axonopodis pv. citri 62; 10, X. axonopodis pv. citri 3213; 11, X. axonopodis pv. citri 100; 12, X. axonopodis pv. citri 166; 13, X. axonopodis pv. citri 169; 14, X. oryzae pv. oryzae 43836; 15, X. oryzae pv. oryzae 43837; 16, X. oryzae pv. oryzicola 49072; 17, no-template control.
    1x Polymerase Chain Reaction Pcr Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 83/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x polymerase chain reaction pcr buffer/product/Qiagen
    Average 83 stars, based on 94 article reviews
    Price from $9.99 to $1999.99
    1x polymerase chain reaction pcr buffer - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    77
    Qiagen sybr green polymerase chain reaction reagents
    Fingerprinting Xanthomonas isolates by <t>REP-PCR</t> and agarose gel electrophoresis. Lanes: M1, λ × Hin dIII (Life Technologies, Gaithersburg, Md.); M2 = kilobase <t>DNA</t> ladder (Stratagene, La Jolla, Calif.); 1, E. coli strain B; 2, P. putida 39169; 3, X. campestris pv. campestris 33913; 4, X. campestris pv. campestris X3; 5, X. campestris pv. campestris KX-1; 6, X. axonopodis pv. citrumelo 3048; 7, X. axonopodis pv. malvacearum N; 8, X. axonopodis pv. axonopodis 19132; 9, X. axonopodis pv. citri 62; 10, X. axonopodis pv. citri 3213; 11, X. axonopodis pv. citri 100; 12, X. axonopodis pv. citri 166; 13, X. axonopodis pv. citri 169; 14, X. oryzae pv. oryzae 43836; 15, X. oryzae pv. oryzae 43837; 16, X. oryzae pv. oryzicola 49072; 17, no-template control.
    Sybr Green Polymerase Chain Reaction Reagents, supplied by Qiagen, used in various techniques. Bioz Stars score: 77/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr green polymerase chain reaction reagents/product/Qiagen
    Average 77 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    sybr green polymerase chain reaction reagents - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    78
    Qiagen 1×qiagen pcr buffer
    Fingerprinting Xanthomonas isolates by <t>REP-PCR</t> and agarose gel electrophoresis. Lanes: M1, λ × Hin dIII (Life Technologies, Gaithersburg, Md.); M2 = kilobase <t>DNA</t> ladder (Stratagene, La Jolla, Calif.); 1, E. coli strain B; 2, P. putida 39169; 3, X. campestris pv. campestris 33913; 4, X. campestris pv. campestris X3; 5, X. campestris pv. campestris KX-1; 6, X. axonopodis pv. citrumelo 3048; 7, X. axonopodis pv. malvacearum N; 8, X. axonopodis pv. axonopodis 19132; 9, X. axonopodis pv. citri 62; 10, X. axonopodis pv. citri 3213; 11, X. axonopodis pv. citri 100; 12, X. axonopodis pv. citri 166; 13, X. axonopodis pv. citri 169; 14, X. oryzae pv. oryzae 43836; 15, X. oryzae pv. oryzae 43837; 16, X. oryzae pv. oryzicola 49072; 17, no-template control.
    1×Qiagen Pcr Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 78/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1×qiagen pcr buffer/product/Qiagen
    Average 78 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    1×qiagen pcr buffer - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    78
    Qiagen 10×qiagen pcr buffer
    Fingerprinting Xanthomonas isolates by <t>REP-PCR</t> and agarose gel electrophoresis. Lanes: M1, λ × Hin dIII (Life Technologies, Gaithersburg, Md.); M2 = kilobase <t>DNA</t> ladder (Stratagene, La Jolla, Calif.); 1, E. coli strain B; 2, P. putida 39169; 3, X. campestris pv. campestris 33913; 4, X. campestris pv. campestris X3; 5, X. campestris pv. campestris KX-1; 6, X. axonopodis pv. citrumelo 3048; 7, X. axonopodis pv. malvacearum N; 8, X. axonopodis pv. axonopodis 19132; 9, X. axonopodis pv. citri 62; 10, X. axonopodis pv. citri 3213; 11, X. axonopodis pv. citri 100; 12, X. axonopodis pv. citri 166; 13, X. axonopodis pv. citri 169; 14, X. oryzae pv. oryzae 43836; 15, X. oryzae pv. oryzae 43837; 16, X. oryzae pv. oryzicola 49072; 17, no-template control.
    10×Qiagen Pcr Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 78/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/10×qiagen pcr buffer/product/Qiagen
    Average 78 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    10×qiagen pcr buffer - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    95
    Qiagen qiagen ae buffer
    s-LA versus m-LA with <t>Qiagen</t> Spin blood kit <t>DNA</t> extraction.
    Qiagen Ae Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 119 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiagen ae buffer/product/Qiagen
    Average 95 stars, based on 119 article reviews
    Price from $9.99 to $1999.99
    qiagen ae buffer - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen buffer avl
    ELISAs to demonstrate inactivation efficacy of Buffer <t>AVL,</t> ethanol, or heat alone or in combination on <t>EBOV-Kikwit.</t> Replicate samples of EBOV-Kikwit-infected marmoset serum or EBOV-Kikwit-spiked blood were treated as described below for individual panels.
    Buffer Avl, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 244 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/buffer avl/product/Qiagen
    Average 95 stars, based on 244 article reviews
    Price from $9.99 to $1999.99
    buffer avl - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen eb buffer
    ELISAs to demonstrate inactivation efficacy of Buffer <t>AVL,</t> ethanol, or heat alone or in combination on <t>EBOV-Kikwit.</t> Replicate samples of EBOV-Kikwit-infected marmoset serum or EBOV-Kikwit-spiked blood were treated as described below for individual panels.
    Eb Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 1949 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/eb buffer/product/Qiagen
    Average 95 stars, based on 1949 article reviews
    Price from $9.99 to $1999.99
    eb buffer - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen pe buffer
    ELISAs to demonstrate inactivation efficacy of Buffer <t>AVL,</t> ethanol, or heat alone or in combination on <t>EBOV-Kikwit.</t> Replicate samples of EBOV-Kikwit-infected marmoset serum or EBOV-Kikwit-spiked blood were treated as described below for individual panels.
    Pe Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 168 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pe buffer/product/Qiagen
    Average 95 stars, based on 168 article reviews
    Price from $9.99 to $1999.99
    pe buffer - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen rlt lysis buffer
    Asymmetric competition is dependent on direct interactions between resident and challenger pneumococci. a, Day 4–5 old pups were inoculated with a heat-killed serotype 23F resident strain (10 5 CFU) for 6h before introduction of the live isogenic challenger strain with increasing CFU (10 1 -10 3 ). Nasal lavages were cultured 3 days later to determine challenger colonization densities, n=3–4. Median values are shown. b, Pups were inoculated with live (10 3 CFU) or heat-killed (10 5 CFU) resident strain for 6h and nasal lavages with <t>RLT</t> lysis buffer were obtained to isolate host <t>RNA.</t> Early inflammatory cytokine expression levels were assessed by SYBR green real-time quantitative RT-PCR. Cytokine expression induced by heat-killed S. pneumoniae were shown as fold change relative to that elicited by live bacteria, n=5–6. Data are shown as mean ± SEM. c-d, Pups were inoculated with either a streptomycin sensitive ( c ) or resistant ( d ) resident strain for 3 days before intranasal administration of streptomycin. An isogenic streptomycin resistant challenger was inoculated 6h later and its colonization density determined after 3 days. Median values are shown. Colonization levels by 10 1 CFU challenger alone, and in resident-colonized pups treated with either phosphate buffered saline (PBS) or streptomycin, were compared by Kruskal–Wallis one-way analysis of variance in ( d ), n=4–8, * p
    Rlt Lysis Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 4335 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rlt lysis buffer/product/Qiagen
    Average 95 stars, based on 4335 article reviews
    Price from $9.99 to $1999.99
    rlt lysis buffer - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen buffer g2
    Asymmetric competition is dependent on direct interactions between resident and challenger pneumococci. a, Day 4–5 old pups were inoculated with a heat-killed serotype 23F resident strain (10 5 CFU) for 6h before introduction of the live isogenic challenger strain with increasing CFU (10 1 -10 3 ). Nasal lavages were cultured 3 days later to determine challenger colonization densities, n=3–4. Median values are shown. b, Pups were inoculated with live (10 3 CFU) or heat-killed (10 5 CFU) resident strain for 6h and nasal lavages with <t>RLT</t> lysis buffer were obtained to isolate host <t>RNA.</t> Early inflammatory cytokine expression levels were assessed by SYBR green real-time quantitative RT-PCR. Cytokine expression induced by heat-killed S. pneumoniae were shown as fold change relative to that elicited by live bacteria, n=5–6. Data are shown as mean ± SEM. c-d, Pups were inoculated with either a streptomycin sensitive ( c ) or resistant ( d ) resident strain for 3 days before intranasal administration of streptomycin. An isogenic streptomycin resistant challenger was inoculated 6h later and its colonization density determined after 3 days. Median values are shown. Colonization levels by 10 1 CFU challenger alone, and in resident-colonized pups treated with either phosphate buffered saline (PBS) or streptomycin, were compared by Kruskal–Wallis one-way analysis of variance in ( d ), n=4–8, * p
    Buffer G2, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 147 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/buffer g2/product/Qiagen
    Average 95 stars, based on 147 article reviews
    Price from $9.99 to $1999.99
    buffer g2 - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen qiagen al buffer
    Comparison of AOM and <t>Qiagen</t> extraction efficiencies. Nucleic acid extraction using the AOM method was compared to the QDM extraction method using <t>HSV-positive</t> CSF. Neat HSV1-PC + was diluted 1:100 and 1:100,000 and extracted using the AOM and QDM methods as described in Materials and Methods. Equal amounts of input nucleic acid were extracted, amplified, and detected by real-time PCR. The AOM extracted, amplified, and detected HSV dilution series is represented by solid lines . The QDM extracted HSV-1 DNA from the serial dilutions was amplified and detected in AOM tubes ( dashed lines ). HSV-negative CSF was extracted by the AOM method and represented by the light solid line . AOM extractions were performed in quadruplicate and the QDM extractions were performed in parallel.
    Qiagen Al Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 65 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiagen al buffer/product/Qiagen
    Average 95 stars, based on 65 article reviews
    Price from $9.99 to $1999.99
    qiagen al buffer - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen pb dna binding buffer
    Comparison of AOM and <t>Qiagen</t> extraction efficiencies. Nucleic acid extraction using the AOM method was compared to the QDM extraction method using <t>HSV-positive</t> CSF. Neat HSV1-PC + was diluted 1:100 and 1:100,000 and extracted using the AOM and QDM methods as described in Materials and Methods. Equal amounts of input nucleic acid were extracted, amplified, and detected by real-time PCR. The AOM extracted, amplified, and detected HSV dilution series is represented by solid lines . The QDM extracted HSV-1 DNA from the serial dilutions was amplified and detected in AOM tubes ( dashed lines ). HSV-negative CSF was extracted by the AOM method and represented by the light solid line . AOM extractions were performed in quadruplicate and the QDM extractions were performed in parallel.
    Pb Dna Binding Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pb dna binding buffer/product/Qiagen
    Average 95 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    pb dna binding buffer - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen ave buffer
    Comparison of AOM and <t>Qiagen</t> extraction efficiencies. Nucleic acid extraction using the AOM method was compared to the QDM extraction method using <t>HSV-positive</t> CSF. Neat HSV1-PC + was diluted 1:100 and 1:100,000 and extracted using the AOM and QDM methods as described in Materials and Methods. Equal amounts of input nucleic acid were extracted, amplified, and detected by real-time PCR. The AOM extracted, amplified, and detected HSV dilution series is represented by solid lines . The QDM extracted HSV-1 DNA from the serial dilutions was amplified and detected in AOM tubes ( dashed lines ). HSV-negative CSF was extracted by the AOM method and represented by the light solid line . AOM extractions were performed in quadruplicate and the QDM extractions were performed in parallel.
    Ave Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 212 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ave buffer/product/Qiagen
    Average 95 stars, based on 212 article reviews
    Price from $9.99 to $1999.99
    ave buffer - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen qiaquick pcr purification kit
    Comparison of AOM and <t>Qiagen</t> extraction efficiencies. Nucleic acid extraction using the AOM method was compared to the QDM extraction method using <t>HSV-positive</t> CSF. Neat HSV1-PC + was diluted 1:100 and 1:100,000 and extracted using the AOM and QDM methods as described in Materials and Methods. Equal amounts of input nucleic acid were extracted, amplified, and detected by real-time PCR. The AOM extracted, amplified, and detected HSV dilution series is represented by solid lines . The QDM extracted HSV-1 DNA from the serial dilutions was amplified and detected in AOM tubes ( dashed lines ). HSV-negative CSF was extracted by the AOM method and represented by the light solid line . AOM extractions were performed in quadruplicate and the QDM extractions were performed in parallel.
    Qiaquick Pcr Purification Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 103222 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaquick pcr purification kit/product/Qiagen
    Average 95 stars, based on 103222 article reviews
    Price from $9.99 to $1999.99
    qiaquick pcr purification kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    79
    Qiagen qiagen s hotstar buffer
    Comparison of AOM and <t>Qiagen</t> extraction efficiencies. Nucleic acid extraction using the AOM method was compared to the QDM extraction method using <t>HSV-positive</t> CSF. Neat HSV1-PC + was diluted 1:100 and 1:100,000 and extracted using the AOM and QDM methods as described in Materials and Methods. Equal amounts of input nucleic acid were extracted, amplified, and detected by real-time PCR. The AOM extracted, amplified, and detected HSV dilution series is represented by solid lines . The QDM extracted HSV-1 DNA from the serial dilutions was amplified and detected in AOM tubes ( dashed lines ). HSV-negative CSF was extracted by the AOM method and represented by the light solid line . AOM extractions were performed in quadruplicate and the QDM extractions were performed in parallel.
    Qiagen S Hotstar Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 79/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiagen s hotstar buffer/product/Qiagen
    Average 79 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    qiagen s hotstar buffer - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    79
    Qiagen qiagen loading buffer
    Comparison of AOM and <t>Qiagen</t> extraction efficiencies. Nucleic acid extraction using the AOM method was compared to the QDM extraction method using <t>HSV-positive</t> CSF. Neat HSV1-PC + was diluted 1:100 and 1:100,000 and extracted using the AOM and QDM methods as described in Materials and Methods. Equal amounts of input nucleic acid were extracted, amplified, and detected by real-time PCR. The AOM extracted, amplified, and detected HSV dilution series is represented by solid lines . The QDM extracted HSV-1 DNA from the serial dilutions was amplified and detected in AOM tubes ( dashed lines ). HSV-negative CSF was extracted by the AOM method and represented by the light solid line . AOM extractions were performed in quadruplicate and the QDM extractions were performed in parallel.
    Qiagen Loading Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 79/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiagen loading buffer/product/Qiagen
    Average 79 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    qiagen loading buffer - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    95
    Qiagen pyromark annealing buffer
    Comparison of AOM and <t>Qiagen</t> extraction efficiencies. Nucleic acid extraction using the AOM method was compared to the QDM extraction method using <t>HSV-positive</t> CSF. Neat HSV1-PC + was diluted 1:100 and 1:100,000 and extracted using the AOM and QDM methods as described in Materials and Methods. Equal amounts of input nucleic acid were extracted, amplified, and detected by real-time PCR. The AOM extracted, amplified, and detected HSV dilution series is represented by solid lines . The QDM extracted HSV-1 DNA from the serial dilutions was amplified and detected in AOM tubes ( dashed lines ). HSV-negative CSF was extracted by the AOM method and represented by the light solid line . AOM extractions were performed in quadruplicate and the QDM extractions were performed in parallel.
    Pyromark Annealing Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 162 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pyromark annealing buffer/product/Qiagen
    Average 95 stars, based on 162 article reviews
    Price from $9.99 to $1999.99
    pyromark annealing buffer - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen genomic dna buffer set
    Complete genome sequence of <t>Ureaplasma</t> OMC-P162 strain and <t>DNA</t> modification. (A) The distribution of genes was depicted on the two outermost concentric circles. First concentric circle: predicted coding DNA sequences (CDSs) on the plus strand. Second concentric circle: predicted CDSs on the minus strand. The gray portion of the middle circle represents the nucleotides sequences while the pink portion indicated tRNA and rRNA. The innermost circle represents the GC skew. This figure was generated using DNAPlotter: Release 1.10 from Artemis Release 15.0.0, Sanger Institute. CDSs were classified by KEGG pathway categories and color codes for KEGG pathway categories were shown in the right. The genome size, GC content and numbers of CDS, rRNA and tRNA were also shown. (B) The upper panel shows the coverage of sequence reads and the bottom two panels show modification types and numbers of modification events within 2 kb of the genome of the plus (+) and minus strands (−).
    Genomic Dna Buffer Set, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 413 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna buffer set/product/Qiagen
    Average 95 stars, based on 413 article reviews
    Price from $9.99 to $1999.99
    genomic dna buffer set - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen taq polymerase
    Complete genome sequence of <t>Ureaplasma</t> OMC-P162 strain and <t>DNA</t> modification. (A) The distribution of genes was depicted on the two outermost concentric circles. First concentric circle: predicted coding DNA sequences (CDSs) on the plus strand. Second concentric circle: predicted CDSs on the minus strand. The gray portion of the middle circle represents the nucleotides sequences while the pink portion indicated tRNA and rRNA. The innermost circle represents the GC skew. This figure was generated using DNAPlotter: Release 1.10 from Artemis Release 15.0.0, Sanger Institute. CDSs were classified by KEGG pathway categories and color codes for KEGG pathway categories were shown in the right. The genome size, GC content and numbers of CDS, rRNA and tRNA were also shown. (B) The upper panel shows the coverage of sequence reads and the bottom two panels show modification types and numbers of modification events within 2 kb of the genome of the plus (+) and minus strands (−).
    Taq Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 5083 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq polymerase/product/Qiagen
    Average 95 stars, based on 5083 article reviews
    Price from $9.99 to $1999.99
    taq polymerase - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen taq pcr core kit
    Complete genome sequence of <t>Ureaplasma</t> OMC-P162 strain and <t>DNA</t> modification. (A) The distribution of genes was depicted on the two outermost concentric circles. First concentric circle: predicted coding DNA sequences (CDSs) on the plus strand. Second concentric circle: predicted CDSs on the minus strand. The gray portion of the middle circle represents the nucleotides sequences while the pink portion indicated tRNA and rRNA. The innermost circle represents the GC skew. This figure was generated using DNAPlotter: Release 1.10 from Artemis Release 15.0.0, Sanger Institute. CDSs were classified by KEGG pathway categories and color codes for KEGG pathway categories were shown in the right. The genome size, GC content and numbers of CDS, rRNA and tRNA were also shown. (B) The upper panel shows the coverage of sequence reads and the bottom two panels show modification types and numbers of modification events within 2 kb of the genome of the plus (+) and minus strands (−).
    Taq Pcr Core Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 1105 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq pcr core kit/product/Qiagen
    Average 95 stars, based on 1105 article reviews
    Price from $9.99 to $1999.99
    taq pcr core kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen minelute pcr purification kit
    Complete genome sequence of <t>Ureaplasma</t> OMC-P162 strain and <t>DNA</t> modification. (A) The distribution of genes was depicted on the two outermost concentric circles. First concentric circle: predicted coding DNA sequences (CDSs) on the plus strand. Second concentric circle: predicted CDSs on the minus strand. The gray portion of the middle circle represents the nucleotides sequences while the pink portion indicated tRNA and rRNA. The innermost circle represents the GC skew. This figure was generated using DNAPlotter: Release 1.10 from Artemis Release 15.0.0, Sanger Institute. CDSs were classified by KEGG pathway categories and color codes for KEGG pathway categories were shown in the right. The genome size, GC content and numbers of CDS, rRNA and tRNA were also shown. (B) The upper panel shows the coverage of sequence reads and the bottom two panels show modification types and numbers of modification events within 2 kb of the genome of the plus (+) and minus strands (−).
    Minelute Pcr Purification Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 16148 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/minelute pcr purification kit/product/Qiagen
    Average 95 stars, based on 16148 article reviews
    Price from $9.99 to $1999.99
    minelute pcr purification kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen quantifast probe pcr kit
    Complete genome sequence of <t>Ureaplasma</t> OMC-P162 strain and <t>DNA</t> modification. (A) The distribution of genes was depicted on the two outermost concentric circles. First concentric circle: predicted coding DNA sequences (CDSs) on the plus strand. Second concentric circle: predicted CDSs on the minus strand. The gray portion of the middle circle represents the nucleotides sequences while the pink portion indicated tRNA and rRNA. The innermost circle represents the GC skew. This figure was generated using DNAPlotter: Release 1.10 from Artemis Release 15.0.0, Sanger Institute. CDSs were classified by KEGG pathway categories and color codes for KEGG pathway categories were shown in the right. The genome size, GC content and numbers of CDS, rRNA and tRNA were also shown. (B) The upper panel shows the coverage of sequence reads and the bottom two panels show modification types and numbers of modification events within 2 kb of the genome of the plus (+) and minus strands (−).
    Quantifast Probe Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 267 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantifast probe pcr kit/product/Qiagen
    Average 95 stars, based on 267 article reviews
    Price from $9.99 to $1999.99
    quantifast probe pcr kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    99
    Qiagen pcr additive
    Complete genome sequence of <t>Ureaplasma</t> OMC-P162 strain and <t>DNA</t> modification. (A) The distribution of genes was depicted on the two outermost concentric circles. First concentric circle: predicted coding DNA sequences (CDSs) on the plus strand. Second concentric circle: predicted CDSs on the minus strand. The gray portion of the middle circle represents the nucleotides sequences while the pink portion indicated tRNA and rRNA. The innermost circle represents the GC skew. This figure was generated using DNAPlotter: Release 1.10 from Artemis Release 15.0.0, Sanger Institute. CDSs were classified by KEGG pathway categories and color codes for KEGG pathway categories were shown in the right. The genome size, GC content and numbers of CDS, rRNA and tRNA were also shown. (B) The upper panel shows the coverage of sequence reads and the bottom two panels show modification types and numbers of modification events within 2 kb of the genome of the plus (+) and minus strands (−).
    Pcr Additive, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr additive/product/Qiagen
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    pcr additive - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    95
    Qiagen quantifast sybr green pcr
    Complete genome sequence of <t>Ureaplasma</t> OMC-P162 strain and <t>DNA</t> modification. (A) The distribution of genes was depicted on the two outermost concentric circles. First concentric circle: predicted coding DNA sequences (CDSs) on the plus strand. Second concentric circle: predicted CDSs on the minus strand. The gray portion of the middle circle represents the nucleotides sequences while the pink portion indicated tRNA and rRNA. The innermost circle represents the GC skew. This figure was generated using DNAPlotter: Release 1.10 from Artemis Release 15.0.0, Sanger Institute. CDSs were classified by KEGG pathway categories and color codes for KEGG pathway categories were shown in the right. The genome size, GC content and numbers of CDS, rRNA and tRNA were also shown. (B) The upper panel shows the coverage of sequence reads and the bottom two panels show modification types and numbers of modification events within 2 kb of the genome of the plus (+) and minus strands (−).
    Quantifast Sybr Green Pcr, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 316 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantifast sybr green pcr/product/Qiagen
    Average 95 stars, based on 316 article reviews
    Price from $9.99 to $1999.99
    quantifast sybr green pcr - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen type it microsatellite pcr kit
    Complete genome sequence of <t>Ureaplasma</t> OMC-P162 strain and <t>DNA</t> modification. (A) The distribution of genes was depicted on the two outermost concentric circles. First concentric circle: predicted coding DNA sequences (CDSs) on the plus strand. Second concentric circle: predicted CDSs on the minus strand. The gray portion of the middle circle represents the nucleotides sequences while the pink portion indicated tRNA and rRNA. The innermost circle represents the GC skew. This figure was generated using DNAPlotter: Release 1.10 from Artemis Release 15.0.0, Sanger Institute. CDSs were classified by KEGG pathway categories and color codes for KEGG pathway categories were shown in the right. The genome size, GC content and numbers of CDS, rRNA and tRNA were also shown. (B) The upper panel shows the coverage of sequence reads and the bottom two panels show modification types and numbers of modification events within 2 kb of the genome of the plus (+) and minus strands (−).
    Type It Microsatellite Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 967 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/type it microsatellite pcr kit/product/Qiagen
    Average 95 stars, based on 967 article reviews
    Price from $9.99 to $1999.99
    type it microsatellite pcr kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen quantitect sybr green pcr kit solution
    Complete genome sequence of <t>Ureaplasma</t> OMC-P162 strain and <t>DNA</t> modification. (A) The distribution of genes was depicted on the two outermost concentric circles. First concentric circle: predicted coding DNA sequences (CDSs) on the plus strand. Second concentric circle: predicted CDSs on the minus strand. The gray portion of the middle circle represents the nucleotides sequences while the pink portion indicated tRNA and rRNA. The innermost circle represents the GC skew. This figure was generated using DNAPlotter: Release 1.10 from Artemis Release 15.0.0, Sanger Institute. CDSs were classified by KEGG pathway categories and color codes for KEGG pathway categories were shown in the right. The genome size, GC content and numbers of CDS, rRNA and tRNA were also shown. (B) The upper panel shows the coverage of sequence reads and the bottom two panels show modification types and numbers of modification events within 2 kb of the genome of the plus (+) and minus strands (−).
    Quantitect Sybr Green Pcr Kit Solution, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitect sybr green pcr kit solution/product/Qiagen
    Average 95 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    quantitect sybr green pcr kit solution - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Qiagen qiaquick 96 pcr purification kit
    Complete genome sequence of <t>Ureaplasma</t> OMC-P162 strain and <t>DNA</t> modification. (A) The distribution of genes was depicted on the two outermost concentric circles. First concentric circle: predicted coding DNA sequences (CDSs) on the plus strand. Second concentric circle: predicted CDSs on the minus strand. The gray portion of the middle circle represents the nucleotides sequences while the pink portion indicated tRNA and rRNA. The innermost circle represents the GC skew. This figure was generated using DNAPlotter: Release 1.10 from Artemis Release 15.0.0, Sanger Institute. CDSs were classified by KEGG pathway categories and color codes for KEGG pathway categories were shown in the right. The genome size, GC content and numbers of CDS, rRNA and tRNA were also shown. (B) The upper panel shows the coverage of sequence reads and the bottom two panels show modification types and numbers of modification events within 2 kb of the genome of the plus (+) and minus strands (−).
    Qiaquick 96 Pcr Purification Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 714 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaquick 96 pcr purification kit/product/Qiagen
    Average 95 stars, based on 714 article reviews
    Price from $9.99 to $1999.99
    qiaquick 96 pcr purification kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    96
    Qiagen pcr reaction buffer
    (a) UGT1A1 (TA) n promoter <t>PCR</t> products on 15.0% acrylamide gel electrophoresis stained with Ag-nitrate. Wells 1 and 4: 6/6 TA repeats (71 bp); well 2: 7/7 TA repeats (73 bp); well 5: 6/7 TA repeats (71 and 73 bp); well 3: 5 bp <t>DNA</t> ladder. (b) Electophoretograms obtained with fragment length analysis of UGT1A1 (TA) n promoter repeats. The upper peak is 7/7 TA repeats (102 bp); the lower peak is 6/6 TA repeats (100 bp). (c) Electophoretogram obtained with sequencing analysis of promoter of UGT1A1 gene with 6/6 TA repeats. (d) Electophoretogram obtained with sequencing analysis of promoter of UGT1A1 gene with 7/7 TA repeats.
    Pcr Reaction Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 150 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr reaction buffer/product/Qiagen
    Average 96 stars, based on 150 article reviews
    Price from $9.99 to $1999.99
    pcr reaction buffer - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    Image Search Results


    Fingerprinting Xanthomonas isolates by REP-PCR and agarose gel electrophoresis. Lanes: M1, λ × Hin dIII (Life Technologies, Gaithersburg, Md.); M2 = kilobase DNA ladder (Stratagene, La Jolla, Calif.); 1, E. coli strain B; 2, P. putida 39169; 3, X. campestris pv. campestris 33913; 4, X. campestris pv. campestris X3; 5, X. campestris pv. campestris KX-1; 6, X. axonopodis pv. citrumelo 3048; 7, X. axonopodis pv. malvacearum N; 8, X. axonopodis pv. axonopodis 19132; 9, X. axonopodis pv. citri 62; 10, X. axonopodis pv. citri 3213; 11, X. axonopodis pv. citri 100; 12, X. axonopodis pv. citri 166; 13, X. axonopodis pv. citri 169; 14, X. oryzae pv. oryzae 43836; 15, X. oryzae pv. oryzae 43837; 16, X. oryzae pv. oryzicola 49072; 17, no-template control.

    Journal: Applied and Environmental Microbiology

    Article Title: Fingerprinting Closely Related Xanthomonas Pathovars with Random Nonamer Oligonucleotide Microarrays

    doi: 10.1128/AEM.68.12.6361-6370.2002

    Figure Lengend Snippet: Fingerprinting Xanthomonas isolates by REP-PCR and agarose gel electrophoresis. Lanes: M1, λ × Hin dIII (Life Technologies, Gaithersburg, Md.); M2 = kilobase DNA ladder (Stratagene, La Jolla, Calif.); 1, E. coli strain B; 2, P. putida 39169; 3, X. campestris pv. campestris 33913; 4, X. campestris pv. campestris X3; 5, X. campestris pv. campestris KX-1; 6, X. axonopodis pv. citrumelo 3048; 7, X. axonopodis pv. malvacearum N; 8, X. axonopodis pv. axonopodis 19132; 9, X. axonopodis pv. citri 62; 10, X. axonopodis pv. citri 3213; 11, X. axonopodis pv. citri 100; 12, X. axonopodis pv. citri 166; 13, X. axonopodis pv. citri 169; 14, X. oryzae pv. oryzae 43836; 15, X. oryzae pv. oryzae 43837; 16, X. oryzae pv. oryzicola 49072; 17, no-template control.

    Article Snippet: Final reaction conditions were (a minimum of) 150 ng of genomic DNA and 1× PCR buffer (Qiagen), 2.5 mM Mg2+ , 200 μM each dNTP, 1 U of Taq polymerase, and 0.6 μM each REP primer.

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Direct TP-PCR normalised melt curves (a, b) and the derivative melt peaks (c, d) of 13 CCR reference male and 16 CCR reference female samples, followed by the GeneScan electropherograms of representative samples (bottom). Grey melt curves and peaks indicate the MCA profiles of the internal reference controls. GeneScan electropherograms of samples marked with asterisk (*) are shown in Figure 1 .

    Journal: Expert Reviews in Molecular Medicine

    Article Title: Simplified strategy for rapid first-line screening of fragile X syndrome: closed-tube triplet-primed PCR and amplicon melt peak analysis

    doi: 10.1017/erm.2015.5

    Figure Lengend Snippet: Direct TP-PCR normalised melt curves (a, b) and the derivative melt peaks (c, d) of 13 CCR reference male and 16 CCR reference female samples, followed by the GeneScan electropherograms of representative samples (bottom). Grey melt curves and peaks indicate the MCA profiles of the internal reference controls. GeneScan electropherograms of samples marked with asterisk (*) are shown in Figure 1 .

    Article Snippet: Direct TP-PCR and MCA The dTP-PCR mix containing 1 X PCR buffer (Qiagen, Hilden, Germany), 2.5 X Q-solution (Qiagen), 0.1 X SYBR Green I nucleic acid dye (Roche Applied Science, Penzberg, Germany), 5 U HotStarTaq DNA polymerase (Qiagen), dNTP mix at a final concentration of 2 mM with a 5:1 dGTP and dCTP to dATP and dTTP ratio (Roche Applied Science), 100 ng of genomic DNA, and 0.60 μM each of primers, ‘F’ described by Fu YH et al. (Ref. ), tail (5′TGCTCTGGACCCTGAAGTGTGCCGTTGATA3′), and a 1000-fold diluted TP-primer (5′TGCTCTGGACCCTGAAGTGTGCCGTTGATA[CGG]5 3′) was prepared in a 15-μl reaction volume.

    Techniques: Polymerase Chain Reaction

    dTP-PCR MCA profiles (left) and GeneScan electropherograms (right) of eight FMR1 genotype-known reference male and female DNA samples. Coriell IDs and CGG repeat sizes of the samples are indicated on the left and the melt peak temperatures ( T m ) are indicated on the MCA profile of each sample. The −d F /d T values are shown on the y -axis and the temperatures (°C) are shown on the x -axis. Distribution pattern of AGG interruptions within the CGG repeat region are shown on the top right corner of each dTP-PCR GeneScan electropherogram, where a ‘+’ sign represents an AGG interruption. Number of CGG repeats is indicated by numbered black and grey arrows. Red arrowheads in the inset panels indicate the base-pair (bp) size, and the red peaks in the main panel are from a ROX-labelled internal size calibrator, whose bp sizes are indicated at the bottom of the electropherogram panel. rpts: total number of CGG repeats including AGG interruptions.

    Journal: Expert Reviews in Molecular Medicine

    Article Title: Simplified strategy for rapid first-line screening of fragile X syndrome: closed-tube triplet-primed PCR and amplicon melt peak analysis

    doi: 10.1017/erm.2015.5

    Figure Lengend Snippet: dTP-PCR MCA profiles (left) and GeneScan electropherograms (right) of eight FMR1 genotype-known reference male and female DNA samples. Coriell IDs and CGG repeat sizes of the samples are indicated on the left and the melt peak temperatures ( T m ) are indicated on the MCA profile of each sample. The −d F /d T values are shown on the y -axis and the temperatures (°C) are shown on the x -axis. Distribution pattern of AGG interruptions within the CGG repeat region are shown on the top right corner of each dTP-PCR GeneScan electropherogram, where a ‘+’ sign represents an AGG interruption. Number of CGG repeats is indicated by numbered black and grey arrows. Red arrowheads in the inset panels indicate the base-pair (bp) size, and the red peaks in the main panel are from a ROX-labelled internal size calibrator, whose bp sizes are indicated at the bottom of the electropherogram panel. rpts: total number of CGG repeats including AGG interruptions.

    Article Snippet: Direct TP-PCR and MCA The dTP-PCR mix containing 1 X PCR buffer (Qiagen, Hilden, Germany), 2.5 X Q-solution (Qiagen), 0.1 X SYBR Green I nucleic acid dye (Roche Applied Science, Penzberg, Germany), 5 U HotStarTaq DNA polymerase (Qiagen), dNTP mix at a final concentration of 2 mM with a 5:1 dGTP and dCTP to dATP and dTTP ratio (Roche Applied Science), 100 ng of genomic DNA, and 0.60 μM each of primers, ‘F’ described by Fu YH et al. (Ref. ), tail (5′TGCTCTGGACCCTGAAGTGTGCCGTTGATA3′), and a 1000-fold diluted TP-primer (5′TGCTCTGGACCCTGAAGTGTGCCGTTGATA[CGG]5 3′) was prepared in a 15-μl reaction volume.

    Techniques: Polymerase Chain Reaction

    Direct TP-PCR normalised melt curves (a, b) and the derivative melt peaks (c, d) of 107 archived patient DNA samples, followed by the GeneScan electropherograms (bottom) of selected samples. MCA profiles of samples carrying NL and expanded FMR1 alleles are clustered to the left and right of the ‘Indeterminate Zones’ (highlighted in grey), respectively.

    Journal: Expert Reviews in Molecular Medicine

    Article Title: Simplified strategy for rapid first-line screening of fragile X syndrome: closed-tube triplet-primed PCR and amplicon melt peak analysis

    doi: 10.1017/erm.2015.5

    Figure Lengend Snippet: Direct TP-PCR normalised melt curves (a, b) and the derivative melt peaks (c, d) of 107 archived patient DNA samples, followed by the GeneScan electropherograms (bottom) of selected samples. MCA profiles of samples carrying NL and expanded FMR1 alleles are clustered to the left and right of the ‘Indeterminate Zones’ (highlighted in grey), respectively.

    Article Snippet: Direct TP-PCR and MCA The dTP-PCR mix containing 1 X PCR buffer (Qiagen, Hilden, Germany), 2.5 X Q-solution (Qiagen), 0.1 X SYBR Green I nucleic acid dye (Roche Applied Science, Penzberg, Germany), 5 U HotStarTaq DNA polymerase (Qiagen), dNTP mix at a final concentration of 2 mM with a 5:1 dGTP and dCTP to dATP and dTTP ratio (Roche Applied Science), 100 ng of genomic DNA, and 0.60 μM each of primers, ‘F’ described by Fu YH et al. (Ref. ), tail (5′TGCTCTGGACCCTGAAGTGTGCCGTTGATA3′), and a 1000-fold diluted TP-primer (5′TGCTCTGGACCCTGAAGTGTGCCGTTGATA[CGG]5 3′) was prepared in a 15-μl reaction volume.

    Techniques: Polymerase Chain Reaction

    Direct TP-PCR melt peaks (left) and GeneScan electropherograms (right) of NL/FM DNA mixtures. Presence of FM allele in the NL/FM DNA mixtures was confirmed by the identification of MCA peaks with higher T m in the melting domains highlighted in pink.

    Journal: Expert Reviews in Molecular Medicine

    Article Title: Simplified strategy for rapid first-line screening of fragile X syndrome: closed-tube triplet-primed PCR and amplicon melt peak analysis

    doi: 10.1017/erm.2015.5

    Figure Lengend Snippet: Direct TP-PCR melt peaks (left) and GeneScan electropherograms (right) of NL/FM DNA mixtures. Presence of FM allele in the NL/FM DNA mixtures was confirmed by the identification of MCA peaks with higher T m in the melting domains highlighted in pink.

    Article Snippet: Direct TP-PCR and MCA The dTP-PCR mix containing 1 X PCR buffer (Qiagen, Hilden, Germany), 2.5 X Q-solution (Qiagen), 0.1 X SYBR Green I nucleic acid dye (Roche Applied Science, Penzberg, Germany), 5 U HotStarTaq DNA polymerase (Qiagen), dNTP mix at a final concentration of 2 mM with a 5:1 dGTP and dCTP to dATP and dTTP ratio (Roche Applied Science), 100 ng of genomic DNA, and 0.60 μM each of primers, ‘F’ described by Fu YH et al. (Ref. ), tail (5′TGCTCTGGACCCTGAAGTGTGCCGTTGATA3′), and a 1000-fold diluted TP-primer (5′TGCTCTGGACCCTGAAGTGTGCCGTTGATA[CGG]5 3′) was prepared in a 15-μl reaction volume.

    Techniques: Polymerase Chain Reaction

    Evidence for TALEN-induced mutation of Platynereis vasotocin-neurophysin . (A) Schematic of the vtn locus showing TALEN target site (yellow) in exon 2 (L, left TALEN; R, right TALEN). Blue arrows (F1/R3) indicate primers used for mutation screening PCR [size of amplicon (bp) indicated by double-ended arrows]. Green block indicates position of sequence from intron 3 detected as an insertion (sample 72). The mature peptide (highlighted in purple) is included by the majority of the TALEN spacer and includes the Mfe I-screening site. (B) Restriction digest screening of 24-hpf larvae injected with vtn Ex2_L and vtn Ex2_R TALEN mRNA at concentration of 200 ng/µl/TALEN. Samples contain pools of four larvae. Black arrow indicates size of uncut PCR product; red arrow indicates 109-bp insertion detected in sample 72. (C) Results of Mfe I digest of PCR products from adult worms: uncut PCR product (black arrowhead) cloned from adult injected worm vtn+13 , representing 9-bp deletion. (B and C) PCR, un-digested PCR product; NI, non-injected; asterisk (*) indicates samples digested with Mfe I. (D) Results of sequence analysis of uncut and insertion bands from samples in B and C. Length of mutations indicated by ∆ symbol with “−” indicating deletions and “+” indicating insertions. Restriction site is shown in boldface type; asterisks indicate frameshift mutations. Shading key: yellow, TALEN-binding sites; gray, spacer; blue, nucleotides differing from wild type; green, inserted nucleotides.

    Journal: Genetics

    Article Title: TALENs Mediate Efficient and Heritable Mutation of Endogenous Genes in the Marine Annelid Platynereis dumerilii

    doi: 10.1534/genetics.113.161091

    Figure Lengend Snippet: Evidence for TALEN-induced mutation of Platynereis vasotocin-neurophysin . (A) Schematic of the vtn locus showing TALEN target site (yellow) in exon 2 (L, left TALEN; R, right TALEN). Blue arrows (F1/R3) indicate primers used for mutation screening PCR [size of amplicon (bp) indicated by double-ended arrows]. Green block indicates position of sequence from intron 3 detected as an insertion (sample 72). The mature peptide (highlighted in purple) is included by the majority of the TALEN spacer and includes the Mfe I-screening site. (B) Restriction digest screening of 24-hpf larvae injected with vtn Ex2_L and vtn Ex2_R TALEN mRNA at concentration of 200 ng/µl/TALEN. Samples contain pools of four larvae. Black arrow indicates size of uncut PCR product; red arrow indicates 109-bp insertion detected in sample 72. (C) Results of Mfe I digest of PCR products from adult worms: uncut PCR product (black arrowhead) cloned from adult injected worm vtn+13 , representing 9-bp deletion. (B and C) PCR, un-digested PCR product; NI, non-injected; asterisk (*) indicates samples digested with Mfe I. (D) Results of sequence analysis of uncut and insertion bands from samples in B and C. Length of mutations indicated by ∆ symbol with “−” indicating deletions and “+” indicating insertions. Restriction site is shown in boldface type; asterisks indicate frameshift mutations. Shading key: yellow, TALEN-binding sites; gray, spacer; blue, nucleotides differing from wild type; green, inserted nucleotides.

    Article Snippet: Rapid digestion of single or pooled larvae for mutation screening Individual or pools of larvae (n = 4–5) were harvested at, or after, 24 hpf and digested in Proteinase K/1× PCR digestion buffer (10× Qiagen PCR buffer with 1 µl Proteinase K solution per 10 μl of solution) (NucleoSpin Tissue, Machery-Nagel) at 56° for 2–3 hr.

    Techniques: Mutagenesis, Polymerase Chain Reaction, Amplification, Blocking Assay, Sequencing, Injection, Concentration Assay, Clone Assay, Binding Assay

    s-LA versus m-LA with Qiagen Spin blood kit DNA extraction.

    Journal: Journal of Clinical Microbiology

    Article Title: Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection ▿Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection ▿ ‡

    doi: 10.1128/JCM.00235-10

    Figure Lengend Snippet: s-LA versus m-LA with Qiagen Spin blood kit DNA extraction.

    Article Snippet: The purified DNA was eluted in 200 μl of Qiagen AE buffer.

    Techniques: DNA Extraction

    Multiplex HPV PCR versus the standard Linear Array with Qiagen MinElute media kit DNA extraction.

    Journal: Journal of Clinical Microbiology

    Article Title: Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection ▿Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection ▿ ‡

    doi: 10.1128/JCM.00235-10

    Figure Lengend Snippet: Multiplex HPV PCR versus the standard Linear Array with Qiagen MinElute media kit DNA extraction.

    Article Snippet: The purified DNA was eluted in 200 μl of Qiagen AE buffer.

    Techniques: Multiplex Assay, Polymerase Chain Reaction, DNA Extraction

    Multiplex HPV PCR versus m-LA with Qiagen Spin blood kit DNA extraction.

    Journal: Journal of Clinical Microbiology

    Article Title: Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection ▿Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection ▿ ‡

    doi: 10.1128/JCM.00235-10

    Figure Lengend Snippet: Multiplex HPV PCR versus m-LA with Qiagen Spin blood kit DNA extraction.

    Article Snippet: The purified DNA was eluted in 200 μl of Qiagen AE buffer.

    Techniques: Multiplex Assay, Polymerase Chain Reaction, DNA Extraction

    Multiplex HPV PCR versus s-LA with Qiagen Spin blood kit DNA extraction.

    Journal: Journal of Clinical Microbiology

    Article Title: Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection ▿Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection ▿ ‡

    doi: 10.1128/JCM.00235-10

    Figure Lengend Snippet: Multiplex HPV PCR versus s-LA with Qiagen Spin blood kit DNA extraction.

    Article Snippet: The purified DNA was eluted in 200 μl of Qiagen AE buffer.

    Techniques: Multiplex Assay, Polymerase Chain Reaction, DNA Extraction

    ELISAs to demonstrate inactivation efficacy of Buffer AVL, ethanol, or heat alone or in combination on EBOV-Kikwit. Replicate samples of EBOV-Kikwit-infected marmoset serum or EBOV-Kikwit-spiked blood were treated as described below for individual panels.

    Journal: Journal of Clinical Microbiology

    Article Title: Buffer AVL Alone Does Not Inactivate Ebola Virus in a Representative Clinical Sample Type

    doi: 10.1128/JCM.01449-15

    Figure Lengend Snippet: ELISAs to demonstrate inactivation efficacy of Buffer AVL, ethanol, or heat alone or in combination on EBOV-Kikwit. Replicate samples of EBOV-Kikwit-infected marmoset serum or EBOV-Kikwit-spiked blood were treated as described below for individual panels.

    Article Snippet: In this study, we have shown that a combination of Buffer AVL and ethanol or Buffer AVL and heat can inactivate EBOV-Kikwit in whole mouse blood samples, which we believe are likely to form a worst-case sample type in terms of both inactivation and also being able to extract PCR-quality RNA.

    Techniques: Infection

    Asymmetric competition is dependent on direct interactions between resident and challenger pneumococci. a, Day 4–5 old pups were inoculated with a heat-killed serotype 23F resident strain (10 5 CFU) for 6h before introduction of the live isogenic challenger strain with increasing CFU (10 1 -10 3 ). Nasal lavages were cultured 3 days later to determine challenger colonization densities, n=3–4. Median values are shown. b, Pups were inoculated with live (10 3 CFU) or heat-killed (10 5 CFU) resident strain for 6h and nasal lavages with RLT lysis buffer were obtained to isolate host RNA. Early inflammatory cytokine expression levels were assessed by SYBR green real-time quantitative RT-PCR. Cytokine expression induced by heat-killed S. pneumoniae were shown as fold change relative to that elicited by live bacteria, n=5–6. Data are shown as mean ± SEM. c-d, Pups were inoculated with either a streptomycin sensitive ( c ) or resistant ( d ) resident strain for 3 days before intranasal administration of streptomycin. An isogenic streptomycin resistant challenger was inoculated 6h later and its colonization density determined after 3 days. Median values are shown. Colonization levels by 10 1 CFU challenger alone, and in resident-colonized pups treated with either phosphate buffered saline (PBS) or streptomycin, were compared by Kruskal–Wallis one-way analysis of variance in ( d ), n=4–8, * p

    Journal: Nature microbiology

    Article Title: Pneumococcal quorum sensing drives an asymmetric owner-intruder competitive strategy during carriage via the competence regulon

    doi: 10.1038/s41564-018-0314-4

    Figure Lengend Snippet: Asymmetric competition is dependent on direct interactions between resident and challenger pneumococci. a, Day 4–5 old pups were inoculated with a heat-killed serotype 23F resident strain (10 5 CFU) for 6h before introduction of the live isogenic challenger strain with increasing CFU (10 1 -10 3 ). Nasal lavages were cultured 3 days later to determine challenger colonization densities, n=3–4. Median values are shown. b, Pups were inoculated with live (10 3 CFU) or heat-killed (10 5 CFU) resident strain for 6h and nasal lavages with RLT lysis buffer were obtained to isolate host RNA. Early inflammatory cytokine expression levels were assessed by SYBR green real-time quantitative RT-PCR. Cytokine expression induced by heat-killed S. pneumoniae were shown as fold change relative to that elicited by live bacteria, n=5–6. Data are shown as mean ± SEM. c-d, Pups were inoculated with either a streptomycin sensitive ( c ) or resistant ( d ) resident strain for 3 days before intranasal administration of streptomycin. An isogenic streptomycin resistant challenger was inoculated 6h later and its colonization density determined after 3 days. Median values are shown. Colonization levels by 10 1 CFU challenger alone, and in resident-colonized pups treated with either phosphate buffered saline (PBS) or streptomycin, were compared by Kruskal–Wallis one-way analysis of variance in ( d ), n=4–8, * p

    Article Snippet: To obtain host RNA, nasal lavages with RLT lysis buffer (Qiagen) were performed and RNA isolated with the RNeasy minikit (Qiagen) as previously described . cDNA was reverse transcribed using a high-capacity cDNA kit (Applied Biosystems) following the manufacturer’s instructions.

    Techniques: Cell Culture, Lysis, Expressing, SYBR Green Assay, Quantitative RT-PCR

    Comparison of AOM and Qiagen extraction efficiencies. Nucleic acid extraction using the AOM method was compared to the QDM extraction method using HSV-positive CSF. Neat HSV1-PC + was diluted 1:100 and 1:100,000 and extracted using the AOM and QDM methods as described in Materials and Methods. Equal amounts of input nucleic acid were extracted, amplified, and detected by real-time PCR. The AOM extracted, amplified, and detected HSV dilution series is represented by solid lines . The QDM extracted HSV-1 DNA from the serial dilutions was amplified and detected in AOM tubes ( dashed lines ). HSV-negative CSF was extracted by the AOM method and represented by the light solid line . AOM extractions were performed in quadruplicate and the QDM extractions were performed in parallel.

    Journal: The Journal of molecular diagnostics : JMD

    Article Title: A Single-Tube Nucleic Acid Extraction, Amplification, and Detection Method Using Aluminum Oxide

    doi: 10.2353/jmoldx.2006.040398

    Figure Lengend Snippet: Comparison of AOM and Qiagen extraction efficiencies. Nucleic acid extraction using the AOM method was compared to the QDM extraction method using HSV-positive CSF. Neat HSV1-PC + was diluted 1:100 and 1:100,000 and extracted using the AOM and QDM methods as described in Materials and Methods. Equal amounts of input nucleic acid were extracted, amplified, and detected by real-time PCR. The AOM extracted, amplified, and detected HSV dilution series is represented by solid lines . The QDM extracted HSV-1 DNA from the serial dilutions was amplified and detected in AOM tubes ( dashed lines ). HSV-negative CSF was extracted by the AOM method and represented by the light solid line . AOM extractions were performed in quadruplicate and the QDM extractions were performed in parallel.

    Article Snippet: The nonproprietary, α-casein lysis buffer is well suited for the extraction of HSV DNA from CSF and yields comparable results to Qiagen AL buffer.

    Techniques: Amplification, Real-time Polymerase Chain Reaction

    Complete genome sequence of Ureaplasma OMC-P162 strain and DNA modification. (A) The distribution of genes was depicted on the two outermost concentric circles. First concentric circle: predicted coding DNA sequences (CDSs) on the plus strand. Second concentric circle: predicted CDSs on the minus strand. The gray portion of the middle circle represents the nucleotides sequences while the pink portion indicated tRNA and rRNA. The innermost circle represents the GC skew. This figure was generated using DNAPlotter: Release 1.10 from Artemis Release 15.0.0, Sanger Institute. CDSs were classified by KEGG pathway categories and color codes for KEGG pathway categories were shown in the right. The genome size, GC content and numbers of CDS, rRNA and tRNA were also shown. (B) The upper panel shows the coverage of sequence reads and the bottom two panels show modification types and numbers of modification events within 2 kb of the genome of the plus (+) and minus strands (−).

    Journal: PLoS ONE

    Article Title: Type II restriction modification system in Ureaplasma parvum OMC-P162 strain

    doi: 10.1371/journal.pone.0205328

    Figure Lengend Snippet: Complete genome sequence of Ureaplasma OMC-P162 strain and DNA modification. (A) The distribution of genes was depicted on the two outermost concentric circles. First concentric circle: predicted coding DNA sequences (CDSs) on the plus strand. Second concentric circle: predicted CDSs on the minus strand. The gray portion of the middle circle represents the nucleotides sequences while the pink portion indicated tRNA and rRNA. The innermost circle represents the GC skew. This figure was generated using DNAPlotter: Release 1.10 from Artemis Release 15.0.0, Sanger Institute. CDSs were classified by KEGG pathway categories and color codes for KEGG pathway categories were shown in the right. The genome size, GC content and numbers of CDS, rRNA and tRNA were also shown. (B) The upper panel shows the coverage of sequence reads and the bottom two panels show modification types and numbers of modification events within 2 kb of the genome of the plus (+) and minus strands (−).

    Article Snippet: DNA extraction, plasmid construction and PCR mutagenesis Ureaplasma genomic DNA was prepared by Genomic DNA Buffer Set (Qiagen, Hilden, Germany) and isolated by QIAGEN Genomic-tip 20/G (Qiagen, Hilden, Germany), which was then amplified by polymerase chain reaction (PCR) using Ex Taq (Takara Bio, Shiga, Japan) for plasmid construction.

    Techniques: Sequencing, Modification, Generated

    DNA digestion by Upa P162 and Nla III. (A) The indicated Ureaplasma genomes were treated with either Upa P162 or Nla III for 1 h. (B) UPV229-treated and untreated pT7Blue plasmid was digested by either Upa P162 or Nla III for 1 h.

    Journal: PLoS ONE

    Article Title: Type II restriction modification system in Ureaplasma parvum OMC-P162 strain

    doi: 10.1371/journal.pone.0205328

    Figure Lengend Snippet: DNA digestion by Upa P162 and Nla III. (A) The indicated Ureaplasma genomes were treated with either Upa P162 or Nla III for 1 h. (B) UPV229-treated and untreated pT7Blue plasmid was digested by either Upa P162 or Nla III for 1 h.

    Article Snippet: DNA extraction, plasmid construction and PCR mutagenesis Ureaplasma genomic DNA was prepared by Genomic DNA Buffer Set (Qiagen, Hilden, Germany) and isolated by QIAGEN Genomic-tip 20/G (Qiagen, Hilden, Germany), which was then amplified by polymerase chain reaction (PCR) using Ex Taq (Takara Bio, Shiga, Japan) for plasmid construction.

    Techniques: Plasmid Preparation

    (a) UGT1A1 (TA) n promoter PCR products on 15.0% acrylamide gel electrophoresis stained with Ag-nitrate. Wells 1 and 4: 6/6 TA repeats (71 bp); well 2: 7/7 TA repeats (73 bp); well 5: 6/7 TA repeats (71 and 73 bp); well 3: 5 bp DNA ladder. (b) Electophoretograms obtained with fragment length analysis of UGT1A1 (TA) n promoter repeats. The upper peak is 7/7 TA repeats (102 bp); the lower peak is 6/6 TA repeats (100 bp). (c) Electophoretogram obtained with sequencing analysis of promoter of UGT1A1 gene with 6/6 TA repeats. (d) Electophoretogram obtained with sequencing analysis of promoter of UGT1A1 gene with 7/7 TA repeats.

    Journal: Balkan Journal of Medical Genetics : BJMG

    Article Title: UGT1A1 (TA)n Promoter Genotype: Diagnostic and Population Pharmacogenetic Marker in Serbia

    doi: 10.2478/bjmg-2018-0012

    Figure Lengend Snippet: (a) UGT1A1 (TA) n promoter PCR products on 15.0% acrylamide gel electrophoresis stained with Ag-nitrate. Wells 1 and 4: 6/6 TA repeats (71 bp); well 2: 7/7 TA repeats (73 bp); well 5: 6/7 TA repeats (71 and 73 bp); well 3: 5 bp DNA ladder. (b) Electophoretograms obtained with fragment length analysis of UGT1A1 (TA) n promoter repeats. The upper peak is 7/7 TA repeats (102 bp); the lower peak is 6/6 TA repeats (100 bp). (c) Electophoretogram obtained with sequencing analysis of promoter of UGT1A1 gene with 6/6 TA repeats. (d) Electophoretogram obtained with sequencing analysis of promoter of UGT1A1 gene with 7/7 TA repeats.

    Article Snippet: The amplification reaction was performed in a total volume of 25 μL, and the reaction mix contained 20 pmol of each primer, 50-100 ng of genomic DNA, 200 μmol/L of each dNTP (Fermentas, Burlington, ON, Canada), 1 × PCR reaction buffer (Qiagen GmbH), 1 × Q solution (Qiagen GmbH), 2.75 mM MgCl2 , 1 U HotStar DNA polymerase (Qiagen GmbH).

    Techniques: Polymerase Chain Reaction, Acrylamide Gel Assay, Electrophoresis, Staining, Sequencing