pcr amplification Thermo Fisher Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher taq dna polymerase
    Differential peak morphologies of androgen receptor alleles resulting from <t>DNA</t> dilution and reagent use. Lynx positive control DNA sample amplified with Invitrogen <t>Taq</t> DNA Polymerase and diluted to 1:10 ( a ), 1:20 ( b ), and 1:50 ( c ) ratios with deionized water. Lynx positive control DNA sample amplified with Invitrogen Platinum Taq DNA Polymerase (no dilution necessary) ( d )
    Taq Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 33236 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Thermo Fisher
    Average 90 stars, based on 33236 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    78
    Thermo Fisher polymerase chain reaction trizol
    Differential peak morphologies of androgen receptor alleles resulting from <t>DNA</t> dilution and reagent use. Lynx positive control DNA sample amplified with Invitrogen <t>Taq</t> DNA Polymerase and diluted to 1:10 ( a ), 1:20 ( b ), and 1:50 ( c ) ratios with deionized water. Lynx positive control DNA sample amplified with Invitrogen Platinum Taq DNA Polymerase (no dilution necessary) ( d )
    Polymerase Chain Reaction Trizol, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction trizol/product/Thermo Fisher
    Average 78 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction trizol - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    82
    Thermo Fisher polymerase chain reaction mastermix
    Differential peak morphologies of androgen receptor alleles resulting from <t>DNA</t> dilution and reagent use. Lynx positive control DNA sample amplified with Invitrogen <t>Taq</t> DNA Polymerase and diluted to 1:10 ( a ), 1:20 ( b ), and 1:50 ( c ) ratios with deionized water. Lynx positive control DNA sample amplified with Invitrogen Platinum Taq DNA Polymerase (no dilution necessary) ( d )
    Polymerase Chain Reaction Mastermix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 82/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction mastermix/product/Thermo Fisher
    Average 82 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction mastermix - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    99
    Thermo Fisher polymerase chain reaction amplification
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Polymerase Chain Reaction Amplification, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 8542 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction amplification/product/Thermo Fisher
    Average 99 stars, based on 8542 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction amplification - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    89
    Thermo Fisher polymerase chain reaction pcr system
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Polymerase Chain Reaction Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr system/product/Thermo Fisher
    Average 89 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr system - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    85
    Thermo Fisher phusion polymerase based polymerase chain reaction pcr
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Phusion Polymerase Based Polymerase Chain Reaction Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion polymerase based polymerase chain reaction pcr/product/Thermo Fisher
    Average 85 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    phusion polymerase based polymerase chain reaction pcr - by Bioz Stars, 2020-02
    85/100 stars
      Buy from Supplier

    77
    Thermo Fisher polymerase chain reaction pcr amplification kits
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Polymerase Chain Reaction Pcr Amplification Kits, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplification kits/product/Thermo Fisher
    Average 77 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplification kits - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    91
    Thermo Fisher polymerase chain reaction qpcr amplification
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Polymerase Chain Reaction Qpcr Amplification, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 68 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction qpcr amplification/product/Thermo Fisher
    Average 91 stars, based on 68 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction qpcr amplification - by Bioz Stars, 2020-02
    91/100 stars
      Buy from Supplier

    77
    Thermo Fisher polymerase chain reaction geneamp 9700 thermocycler
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Polymerase Chain Reaction Geneamp 9700 Thermocycler, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction geneamp 9700 thermocycler/product/Thermo Fisher
    Average 77 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction geneamp 9700 thermocycler - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    84
    Thermo Fisher transcriptase polymerase chain reaction kit
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Transcriptase Polymerase Chain Reaction Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 84/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transcriptase polymerase chain reaction kit/product/Thermo Fisher
    Average 84 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    transcriptase polymerase chain reaction kit - by Bioz Stars, 2020-02
    84/100 stars
      Buy from Supplier

    96
    Thermo Fisher polymerase chain reactions pcrs
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Polymerase Chain Reactions Pcrs, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 783 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reactions pcrs/product/Thermo Fisher
    Average 96 stars, based on 783 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reactions pcrs - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    88
    Thermo Fisher geneamp polymerase chain reaction pcr system 9700
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Geneamp Polymerase Chain Reaction Pcr System 9700, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/geneamp polymerase chain reaction pcr system 9700/product/Thermo Fisher
    Average 88 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    geneamp polymerase chain reaction pcr system 9700 - by Bioz Stars, 2020-02
    88/100 stars
      Buy from Supplier

    78
    Thermo Fisher 2400 geneamp polymerase chain reaction pcr system
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    2400 Geneamp Polymerase Chain Reaction Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/2400 geneamp polymerase chain reaction pcr system/product/Thermo Fisher
    Average 78 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    2400 geneamp polymerase chain reaction pcr system - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    78
    Thermo Fisher abi9700 polymerase chain reaction
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Abi9700 Polymerase Chain Reaction, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abi9700 polymerase chain reaction/product/Thermo Fisher
    Average 78 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    abi9700 polymerase chain reaction - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    93
    Thermo Fisher taqman polymerase chain reaction
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Taqman Polymerase Chain Reaction, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman polymerase chain reaction/product/Thermo Fisher
    Average 93 stars, based on 32 article reviews
    Price from $9.99 to $1999.99
    taqman polymerase chain reaction - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher emulsion polymerase chain reaction
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Emulsion Polymerase Chain Reaction, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 188 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/emulsion polymerase chain reaction/product/Thermo Fisher
    Average 99 stars, based on 188 article reviews
    Price from $9.99 to $1999.99
    emulsion polymerase chain reaction - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    84
    Thermo Fisher ab steponeplus polymerase chain reaction system
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Ab Steponeplus Polymerase Chain Reaction System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 84/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ab steponeplus polymerase chain reaction system/product/Thermo Fisher
    Average 84 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    ab steponeplus polymerase chain reaction system - by Bioz Stars, 2020-02
    84/100 stars
      Buy from Supplier

    77
    Thermo Fisher taqman polymerase chain reaction amplification method
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Taqman Polymerase Chain Reaction Amplification Method, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman polymerase chain reaction amplification method/product/Thermo Fisher
    Average 77 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    taqman polymerase chain reaction amplification method - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    81
    Thermo Fisher polymerase chain reaction pcr protocol
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Polymerase Chain Reaction Pcr Protocol, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 81/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr protocol/product/Thermo Fisher
    Average 81 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr protocol - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    80
    Thermo Fisher polymerase chain reaction conditions 1x pcr gold buffer
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Polymerase Chain Reaction Conditions 1x Pcr Gold Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction conditions 1x pcr gold buffer/product/Thermo Fisher
    Average 80 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction conditions 1x pcr gold buffer - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    90
    Thermo Fisher sybrgreen polymerase chain reaction pcr master mix
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Sybrgreen Polymerase Chain Reaction Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybrgreen polymerase chain reaction pcr master mix/product/Thermo Fisher
    Average 90 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    sybrgreen polymerase chain reaction pcr master mix - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    97
    Thermo Fisher real time polymerase chain reaction pcr system
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Real Time Polymerase Chain Reaction Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time polymerase chain reaction pcr system/product/Thermo Fisher
    Average 97 stars, based on 94 article reviews
    Price from $9.99 to $1999.99
    real time polymerase chain reaction pcr system - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    78
    Thermo Fisher geneamp xl polymerase chain reaction
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Geneamp Xl Polymerase Chain Reaction, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/geneamp xl polymerase chain reaction/product/Thermo Fisher
    Average 78 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    geneamp xl polymerase chain reaction - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    78
    Thermo Fisher inst aclone polymerase chain reaction
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Inst Aclone Polymerase Chain Reaction, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/inst aclone polymerase chain reaction/product/Thermo Fisher
    Average 78 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    inst aclone polymerase chain reaction - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    90
    Thermo Fisher polymerase chain reaction thermal cycler
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Polymerase Chain Reaction Thermal Cycler, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction thermal cycler/product/Thermo Fisher
    Average 90 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction thermal cycler - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    79
    Thermo Fisher accuprime polymerase chain reaction buffer
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Accuprime Polymerase Chain Reaction Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/accuprime polymerase chain reaction buffer/product/Thermo Fisher
    Average 79 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    accuprime polymerase chain reaction buffer - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    93
    Thermo Fisher taqman universal polymerase chain reaction master mix
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Taqman Universal Polymerase Chain Reaction Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 37 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman universal polymerase chain reaction master mix/product/Thermo Fisher
    Average 93 stars, based on 37 article reviews
    Price from $9.99 to $1999.99
    taqman universal polymerase chain reaction master mix - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    79
    Thermo Fisher polymerase chain reaction pcr system thermocycler
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Polymerase Chain Reaction Pcr System Thermocycler, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr system thermocycler/product/Thermo Fisher
    Average 79 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr system thermocycler - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    87
    Thermo Fisher multiplexed polymerase chain reaction pcr amplification
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Multiplexed Polymerase Chain Reaction Pcr Amplification, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplexed polymerase chain reaction pcr amplification/product/Thermo Fisher
    Average 87 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    multiplexed polymerase chain reaction pcr amplification - by Bioz Stars, 2020-02
    87/100 stars
      Buy from Supplier

    85
    Thermo Fisher transcription polymerase chain reaction rt pcr amplification kit
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Transcription Polymerase Chain Reaction Rt Pcr Amplification Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transcription polymerase chain reaction rt pcr amplification kit/product/Thermo Fisher
    Average 85 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    transcription polymerase chain reaction rt pcr amplification kit - by Bioz Stars, 2020-02
    85/100 stars
      Buy from Supplier

    90
    Thermo Fisher 7900ht real time polymerase chain reaction pcr system
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    7900ht Real Time Polymerase Chain Reaction Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 74 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/7900ht real time polymerase chain reaction pcr system/product/Thermo Fisher
    Average 90 stars, based on 74 article reviews
    Price from $9.99 to $1999.99
    7900ht real time polymerase chain reaction pcr system - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher quantitative real time polymerase chain reaction qrt pcr
    <t>QRT-PCR</t> for 27-hydroxylase and ABCA1 message in NS398-treated THP-1 cells exposed to prostaglandins. (a) 27-Hydroxylase message is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 1 , E 2 , and D 2 . THP-1 human monocytes were exposed to the following conditions represented by the six bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 1 (0.1 μM) + NS398 (50 μM), (4) PGE 2 (0.1 μM) + NS398 (50 μM), (5) PGE 1 (0.1 μM) + PGE 2 (0.1 μM) + NS398 (50 μM), and (6) PGD 2 (14 μM) + NS398 (50 μM) (all 18-hour exposures). Cells were extracted for total RNA and were evaluated for 27-hydroxylase mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. (b) ABCA1 message is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 1 , E 2 , and D 2 . THP-1 human monocytes were exposed to the following conditions represented by the six bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 1 (0.1 μM) + NS398 (50 μM), (4) PGE 2 (0.1 μM) + NS398 (50 μM), (5) PGE 1 (0.1 μM) + PGE 2 (0.1 μM) + NS398 (50 μM), and (6) PGD 2 (14 μM) + NS398 (50 μM) (all 18-hour exposures). Cells were extracted for total RNA and were evaluated for ABCA1 mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. ** p
    Quantitative Real Time Polymerase Chain Reaction Qrt Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2163 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time polymerase chain reaction qrt pcr/product/Thermo Fisher
    Average 99 stars, based on 2163 article reviews
    Price from $9.99 to $1999.99
    quantitative real time polymerase chain reaction qrt pcr - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    Differential peak morphologies of androgen receptor alleles resulting from DNA dilution and reagent use. Lynx positive control DNA sample amplified with Invitrogen Taq DNA Polymerase and diluted to 1:10 ( a ), 1:20 ( b ), and 1:50 ( c ) ratios with deionized water. Lynx positive control DNA sample amplified with Invitrogen Platinum Taq DNA Polymerase (no dilution necessary) ( d )

    Journal: BMC Genetics

    Article Title: A test of somatic mosaicism in the androgen receptor gene of Canada lynx (Lynx canadensis)

    doi: 10.1186/s12863-015-0284-y

    Figure Lengend Snippet: Differential peak morphologies of androgen receptor alleles resulting from DNA dilution and reagent use. Lynx positive control DNA sample amplified with Invitrogen Taq DNA Polymerase and diluted to 1:10 ( a ), 1:20 ( b ), and 1:50 ( c ) ratios with deionized water. Lynx positive control DNA sample amplified with Invitrogen Platinum Taq DNA Polymerase (no dilution necessary) ( d )

    Article Snippet: Amplification was conducted in a 10ul reaction containing deionized water (Invitrogen), 10X PCR Reaction Buffer (Invitrogen), 50 mM MgCl2 (Invitrogen), 100 mM dNTP solution (Invitrogen), 3 mg/mL BSA, 40uM forward and reverse primers (Integrated DNA Technologies) mentioned above (forward primers labeled with the fluorescent dye HEX), 0.0375U Invitrogen Taq DNA Polymerase, and 5 ng of DNA.

    Techniques: Positive Control, Amplification

    Human cerebral organoids recapitulate various brain region identities a, RT-PCR for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain cDNA was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.

    Journal: Nature

    Article Title: Cerebral organoids model human brain development and microcephaly

    doi: 10.1038/nature12517

    Figure Lengend Snippet: Human cerebral organoids recapitulate various brain region identities a, RT-PCR for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain cDNA was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.

    Article Snippet: The CDK5RAP2 expression construct was generated using the Gateway system (Invitrogen) by PCR amplification of CDK5RAP2 from MGC human CDK5RAP2 cDNA (clone ID: 9052276) using the primers with AttB sites: Forward: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGATGGACTTGGTGTTGGAAGA, Reverse: GGGGACCACTTTGTACAAGAAAGCTGGGTCAGCTTTATTGGCTGAAAGTTCTTCTC.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Positive Control, Immunohistochemistry, Marker, Staining, Migration

    QRT-PCR for 27-hydroxylase and ABCA1 message in NS398-treated THP-1 cells exposed to prostaglandins. (a) 27-Hydroxylase message is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 1 , E 2 , and D 2 . THP-1 human monocytes were exposed to the following conditions represented by the six bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 1 (0.1 μM) + NS398 (50 μM), (4) PGE 2 (0.1 μM) + NS398 (50 μM), (5) PGE 1 (0.1 μM) + PGE 2 (0.1 μM) + NS398 (50 μM), and (6) PGD 2 (14 μM) + NS398 (50 μM) (all 18-hour exposures). Cells were extracted for total RNA and were evaluated for 27-hydroxylase mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. (b) ABCA1 message is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 1 , E 2 , and D 2 . THP-1 human monocytes were exposed to the following conditions represented by the six bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 1 (0.1 μM) + NS398 (50 μM), (4) PGE 2 (0.1 μM) + NS398 (50 μM), (5) PGE 1 (0.1 μM) + PGE 2 (0.1 μM) + NS398 (50 μM), and (6) PGD 2 (14 μM) + NS398 (50 μM) (all 18-hour exposures). Cells were extracted for total RNA and were evaluated for ABCA1 mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. ** p

    Journal: Arthritis Research & Therapy

    Article Title: Effect of cyclooxygenase inhibition on cholesterol efflux proteins and atheromatous foam cell transformation in THP-1 human macrophages: a possible mechanism for increased cardiovascular risk

    doi: 10.1186/ar2109

    Figure Lengend Snippet: QRT-PCR for 27-hydroxylase and ABCA1 message in NS398-treated THP-1 cells exposed to prostaglandins. (a) 27-Hydroxylase message is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 1 , E 2 , and D 2 . THP-1 human monocytes were exposed to the following conditions represented by the six bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 1 (0.1 μM) + NS398 (50 μM), (4) PGE 2 (0.1 μM) + NS398 (50 μM), (5) PGE 1 (0.1 μM) + PGE 2 (0.1 μM) + NS398 (50 μM), and (6) PGD 2 (14 μM) + NS398 (50 μM) (all 18-hour exposures). Cells were extracted for total RNA and were evaluated for 27-hydroxylase mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. (b) ABCA1 message is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 1 , E 2 , and D 2 . THP-1 human monocytes were exposed to the following conditions represented by the six bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 1 (0.1 μM) + NS398 (50 μM), (4) PGE 2 (0.1 μM) + NS398 (50 μM), (5) PGE 1 (0.1 μM) + PGE 2 (0.1 μM) + NS398 (50 μM), and (6) PGD 2 (14 μM) + NS398 (50 μM) (all 18-hour exposures). Cells were extracted for total RNA and were evaluated for ABCA1 mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. ** p

    Article Snippet: All reagents for reverse transcription and quantitative real-time polymerase chain reaction (QRT-PCR) were purchased from Applied Biosystems (Foster City, CA, USA).

    Techniques: Quantitative RT-PCR, Expressing, Amplification

    QRT-PCR for 27-hydroxylase and ABCA1 message in indomethacin-treated THP-1 cells. (a) 27-Hydroxylase mRNA expression is decreased by the non-specific COX inhibitor indomethacin in a dose-dependent fashion in THP-1 monocytes. Cultured THP-1 monocytic cells were untreated or exposed to increasing doses of indomethacin for 18 hours. After isolation of total RNA, the RNA was reverse-transcribed and the cDNA amplified by QRT-PCR as described. Signals obtained from the amplification of GAPDH message were used as internal controls. (b) ABCA1 mRNA expression is decreased by the non-specific COX inhibitor indomethacin in a dose-dependent fashion in THP-1 monocytes. Cultured THP-1 monocytic cells were untreated or exposed to increasing doses of indomethacin for 18 hours. After isolation of total RNA, the RNA was reverse-transcribed and the cDNA amplified by QRT-PCR as described. Signals obtained from the amplification of GAPDH message were used as internal controls. At 50 mM indomethacin concentration, cell death was statistically significant (16.8% ± 1.0%). ABCA1, ATP-binding cassette transporter A1; COX, cyclooxygenase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; QRT-PCR, quantitative real-time polymerase chain reaction. * p

    Journal: Arthritis Research & Therapy

    Article Title: Effect of cyclooxygenase inhibition on cholesterol efflux proteins and atheromatous foam cell transformation in THP-1 human macrophages: a possible mechanism for increased cardiovascular risk

    doi: 10.1186/ar2109

    Figure Lengend Snippet: QRT-PCR for 27-hydroxylase and ABCA1 message in indomethacin-treated THP-1 cells. (a) 27-Hydroxylase mRNA expression is decreased by the non-specific COX inhibitor indomethacin in a dose-dependent fashion in THP-1 monocytes. Cultured THP-1 monocytic cells were untreated or exposed to increasing doses of indomethacin for 18 hours. After isolation of total RNA, the RNA was reverse-transcribed and the cDNA amplified by QRT-PCR as described. Signals obtained from the amplification of GAPDH message were used as internal controls. (b) ABCA1 mRNA expression is decreased by the non-specific COX inhibitor indomethacin in a dose-dependent fashion in THP-1 monocytes. Cultured THP-1 monocytic cells were untreated or exposed to increasing doses of indomethacin for 18 hours. After isolation of total RNA, the RNA was reverse-transcribed and the cDNA amplified by QRT-PCR as described. Signals obtained from the amplification of GAPDH message were used as internal controls. At 50 mM indomethacin concentration, cell death was statistically significant (16.8% ± 1.0%). ABCA1, ATP-binding cassette transporter A1; COX, cyclooxygenase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; QRT-PCR, quantitative real-time polymerase chain reaction. * p

    Article Snippet: All reagents for reverse transcription and quantitative real-time polymerase chain reaction (QRT-PCR) were purchased from Applied Biosystems (Foster City, CA, USA).

    Techniques: Quantitative RT-PCR, Expressing, Cell Culture, Isolation, Amplification, Concentration Assay, Binding Assay, Real-time Polymerase Chain Reaction

    QRT-PCR for 27-hydroxylase and ABCA1 message in NS398-treated THP-1 macrophages exposed to prostaglandins or TXA 2 . (a) 27-Hydroxylase message in THP-1 macrophages is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 2 and D 2 , but not TXA 2 . THP-1 human macrophages were exposed to the following conditions represented by the five bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 2 (0.1 μM) + NS398 (50 μM), (4) PGD 2 (14 μM) + NS398 (50 μM), and (5) TXA 2 (3 μM) + NS398 (50 μM) (24-hour exposures to NS398 alone followed by addition of indicated PG or TXA 2 for a further 24 hours). Cells were extracted for total RNA and were evaluated for 27-hydroxylase mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. (b) ABCA1 message is decreased by the COX-2 inhibitor NS398 in THP-1 macrophages and this decrease is reversed by prostaglandins E 2 and D 2 , but not TXA 2 . THP-1 human macrophages were exposed to the following conditions represented by the five bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 2 (0.1 μM) + NS398 (50 μM), (4) PGD 2 (14 μM) + NS398 (50 μM), and (5) TXA 2 (3 μM) + NS398 (50 μM) (24-hour exposures to NS398 alone followed by addition of indicated PG or TXA 2 for a further 24 hours). Cells were extracted for total RNA and were evaluated for ABCA1 mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. * p

    Journal: Arthritis Research & Therapy

    Article Title: Effect of cyclooxygenase inhibition on cholesterol efflux proteins and atheromatous foam cell transformation in THP-1 human macrophages: a possible mechanism for increased cardiovascular risk

    doi: 10.1186/ar2109

    Figure Lengend Snippet: QRT-PCR for 27-hydroxylase and ABCA1 message in NS398-treated THP-1 macrophages exposed to prostaglandins or TXA 2 . (a) 27-Hydroxylase message in THP-1 macrophages is decreased by the COX-2 inhibitor NS398 and this decrease is reversed by prostaglandins E 2 and D 2 , but not TXA 2 . THP-1 human macrophages were exposed to the following conditions represented by the five bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 2 (0.1 μM) + NS398 (50 μM), (4) PGD 2 (14 μM) + NS398 (50 μM), and (5) TXA 2 (3 μM) + NS398 (50 μM) (24-hour exposures to NS398 alone followed by addition of indicated PG or TXA 2 for a further 24 hours). Cells were extracted for total RNA and were evaluated for 27-hydroxylase mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. (b) ABCA1 message is decreased by the COX-2 inhibitor NS398 in THP-1 macrophages and this decrease is reversed by prostaglandins E 2 and D 2 , but not TXA 2 . THP-1 human macrophages were exposed to the following conditions represented by the five bars (from left to right): (1) RPMI 1640, (2) NS398 (50 μM), (3) PGE 2 (0.1 μM) + NS398 (50 μM), (4) PGD 2 (14 μM) + NS398 (50 μM), and (5) TXA 2 (3 μM) + NS398 (50 μM) (24-hour exposures to NS398 alone followed by addition of indicated PG or TXA 2 for a further 24 hours). Cells were extracted for total RNA and were evaluated for ABCA1 mRNA expression by QRT-PCR. Signals obtained from the amplification of GAPDH message were used as internal controls. * p

    Article Snippet: All reagents for reverse transcription and quantitative real-time polymerase chain reaction (QRT-PCR) were purchased from Applied Biosystems (Foster City, CA, USA).

    Techniques: Quantitative RT-PCR, Expressing, Amplification