pcr amplification Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Kapa Biosystems pcr amplification
    Pcr Amplification, supplied by Kapa Biosystems, used in various techniques. Bioz Stars score: 99/100, based on 1654 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Kapa Biosystems
    Average 99 stars, based on 1654 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher pcr amplification
    Pcr Amplification, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 69101 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Thermo Fisher
    Average 99 stars, based on 69101 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    99
    TaKaRa pcr amplification
    Pcr Amplification, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 21524 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/TaKaRa
    Average 99 stars, based on 21524 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    95
    Bio-Rad pcr amplification
    Visualization of <t>PCR</t> amplification products of soil <t>DNA</t> isolated by five different methods using 18S rRNA by different methods. Lane M: λ DNA Eco RI/ Hin d III double digest marker; lane 1: mannitol-PBS-CTAB method; lane 2: PEG/NaCl method without liquid nitrogen; lane 3: mannitol-PBS-PEG/NaCl method; lane 4: mannitol-PBS-PCI method; lane 5: Soil Master DNA extraction kit.
    Pcr Amplification, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 95/100, based on 13747 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Bio-Rad
    Average 95 stars, based on 13747 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    95/100 stars
      Buy from Supplier

    94
    Illumina Inc pcr amplification
    Confirmation of CAF-1 reprogramming phenotype with alternative transgenic and non-transgenic vector systems (a) Alkaline phosphatase (AP)-positive, transgene-independent iPSC colonies at day 14 following transduction of R26-M2rtTA MEFs with tetO-STEMCCA lentiviral OKSM expression vector and either Chaf1a.164 or Ren.713 <t>shRNA</t> vectors and treatment with high (2 μg/ml) or low (0.2 μg/ml) doses of dox for 10 days. (b) Quantification of data shown in (a). Experiment was performed at 3 different plating densities (n=1 experiment per density), representative data are shown. (c) Comparison of reprogramming efficiencies between Col1a1::tetOP-OKSM; R26-M2rtTA reprogrammable MEFs and wild type MEFs infected directly with OKSM-expressing lentiviral vectors containing either a strong Ef1a full-length promoter (Ef1a-OKSM long) or a weaker truncated promoter (Ef1a-OKSM short). TRE3G-OKSM is a lentiviral vector with a strong promoter, whose activity is downregulated over time upon infection of CAGS-rtTA3 transgenic MEFs (see below). Error bars show standard deviation from biological triplicates. (d) Quantitative <t>RT-PCR</t> data showing variability in OKSM expression levels over time using different vector systems. Cells were analyzed after 3 and 6 days of infection (lentiviral vectors) or dox exposure (reprogrammable MEFs). Error bars show standard deviation from biological triplicates. OGR MEF, transgenic MEFs carrying O ct4- G FP and CAGS- r tTA3 alleles. (e) Quantification of Oct4 protein levels by intracellular flow cytometry (top) and cellular granularity/complexity by side scatter (SSC) analysis of indicated samples (bottom). Error bars show standard deviation from biological triplicates.
    Pcr Amplification, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 12844 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Illumina Inc
    Average 94 stars, based on 12844 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    94/100 stars
      Buy from Supplier

    99
    Millipore pcr amplification
    Confirmation of CAF-1 reprogramming phenotype with alternative transgenic and non-transgenic vector systems (a) Alkaline phosphatase (AP)-positive, transgene-independent iPSC colonies at day 14 following transduction of R26-M2rtTA MEFs with tetO-STEMCCA lentiviral OKSM expression vector and either Chaf1a.164 or Ren.713 <t>shRNA</t> vectors and treatment with high (2 μg/ml) or low (0.2 μg/ml) doses of dox for 10 days. (b) Quantification of data shown in (a). Experiment was performed at 3 different plating densities (n=1 experiment per density), representative data are shown. (c) Comparison of reprogramming efficiencies between Col1a1::tetOP-OKSM; R26-M2rtTA reprogrammable MEFs and wild type MEFs infected directly with OKSM-expressing lentiviral vectors containing either a strong Ef1a full-length promoter (Ef1a-OKSM long) or a weaker truncated promoter (Ef1a-OKSM short). TRE3G-OKSM is a lentiviral vector with a strong promoter, whose activity is downregulated over time upon infection of CAGS-rtTA3 transgenic MEFs (see below). Error bars show standard deviation from biological triplicates. (d) Quantitative <t>RT-PCR</t> data showing variability in OKSM expression levels over time using different vector systems. Cells were analyzed after 3 and 6 days of infection (lentiviral vectors) or dox exposure (reprogrammable MEFs). Error bars show standard deviation from biological triplicates. OGR MEF, transgenic MEFs carrying O ct4- G FP and CAGS- r tTA3 alleles. (e) Quantification of Oct4 protein levels by intracellular flow cytometry (top) and cellular granularity/complexity by side scatter (SSC) analysis of indicated samples (bottom). Error bars show standard deviation from biological triplicates.
    Pcr Amplification, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 6447 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Millipore
    Average 99 stars, based on 6447 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    94
    Stratagene pcr amplification
    Trans-activation of the endogenous Abcc6 gene in TIB-73 cells Hepatocytes were transfected with a vector expressing the HNF1 α , HNF4 α or p45-NFE2 cDNAs. As a negative control, the cells were transfected with an empty vector. The levels of the endogenous <t>mAbcc6</t> gene were determined by quantitative <t>PCR</t> with TaqMan probes specific to the murine mAbcc6 cDNA. The results were normalized to the transfection efficiency by measuring the level of expression of the neomycin-resistance gene present on the vector expressing the transcription factors. The assays were performed three times at least in triplicate. Standard errors are indicated.
    Pcr Amplification, supplied by Stratagene, used in various techniques. Bioz Stars score: 94/100, based on 6479 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Stratagene
    Average 94 stars, based on 6479 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    94/100 stars
      Buy from Supplier

    92
    Eppendorf AG pcr amplification
    Histogram of polymerase chain reaction results in colon, bladder and prostate cancer samples, as well as HT-29, Caco-2, HT-1376, LNCaP, and HepG2 cancer cell lines. <t>Oct4</t> was expressed in 100% of bladder, colon, and prostate tumor samples. Expression of Nanog was detected in 100% of the colon cancer samples, 90% of the bladder cancer samples and 80% of the prostate cancer samples. Nucleostemin was detected in 100% of the prostate cancer samples, 80% of the bladder cancer samples, and 60% of the colon cancer samples.
    Pcr Amplification, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 92/100, based on 3495 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Eppendorf AG
    Average 92 stars, based on 3495 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    92/100 stars
      Buy from Supplier

    94
    Bio-Rad pcr amplifications
    <t>PCR</t> profiles of parental genotypes using <t>SSR</t> markers VR040 (L1–L6), VR062 (L7–L12) and VR0111 (L13–L18). ∗ Marker for recombination .
    Pcr Amplifications, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 3356 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplifications/product/Bio-Rad
    Average 94 stars, based on 3356 article reviews
    Price from $9.99 to $1999.99
    pcr amplifications - by Bioz Stars, 2020-10
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher ampflstr identifiler direct pcr amplification kit
    <t>PCR</t> profiles of parental genotypes using <t>SSR</t> markers VR040 (L1–L6), VR062 (L7–L12) and VR0111 (L13–L18). ∗ Marker for recombination .
    Ampflstr Identifiler Direct Pcr Amplification Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ampflstr identifiler direct pcr amplification kit/product/Thermo Fisher
    Average 99 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    ampflstr identifiler direct pcr amplification kit - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    92
    MJ Research pcr amplification
    Amplification of M. Ieprae <t>DNA</t> from patient's blood using nested <t>PCR.</t>
    Pcr Amplification, supplied by MJ Research, used in various techniques. Bioz Stars score: 92/100, based on 2750 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/MJ Research
    Average 92 stars, based on 2750 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    92/100 stars
      Buy from Supplier

    94
    Illumina Inc pcr amplified
    Sm proteins associate with mature mRNAs. (a) Meta-gene analysis of read density around splice sites for all Drosophila and human Sm-associated intron-containing mRNAs in all RIP-seq experiments. (b) Meta-gene analysis of read density along the gene length for all Drosophila Sm-associated mRNAs quantified from oligodT and random hexamer primed libraries. (c) Example tracks for read density along the gene length for oligodT and random hexamer primed libraries. (d) Poly(A) tail length Sm-associated mRNAs (CG3997, CG1349 and CG3776) and non-associated mRNA (RpS2) from Y12 IP in S2 cells. IN, input total RNA; IP, <t>immunoprecipitated</t> RNA. The labels denote the length of poly(A) tails. Oligo(dT) 20 was used as the reverse primer for the reverse transcription and subsequent <t>PCR,</t> therefore producing the ‘smear’ of poly(A) tail. See Figure S11 in Additional file 1 for analysis of poly(A) containing reads for selected Sm-associated mRNAs.
    Pcr Amplified, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 2551 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Illumina Inc
    Average 94 stars, based on 2551 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-10
    94/100 stars
      Buy from Supplier

    94
    Agilent technologies pcr amplification
    Real-time <t>PCR</t> quantitation of IGF2 and H19 mRNA transcripts. IGF2 , H19 , and the housekeeping β-actin genes were coamplified from each cDNA synthesized from normal tissue (human breast and skin), control, and decoy <t>CTCF–expressing</t> cells in MCF7 (A), HBF1, and WSF7 cells (B). IGF2 and H19 were quantitated in duplicate for each sample and were determined by a ΔCT and Δ2ΔCT calculation with reference to human β-actin gene control. IGF2 and H19 expression was normalized and presented as the number by using the IGF2 and H19 level in controls (white) as 1 (tissue, n = 6; control, n = 6; treatment, n = 6). *, P
    Pcr Amplification, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 94/100, based on 3349 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Agilent technologies
    Average 94 stars, based on 3349 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher ampflstr identifiler pcr amplification kit
    Real-time <t>PCR</t> quantitation of IGF2 and H19 mRNA transcripts. IGF2 , H19 , and the housekeeping β-actin genes were coamplified from each cDNA synthesized from normal tissue (human breast and skin), control, and decoy <t>CTCF–expressing</t> cells in MCF7 (A), HBF1, and WSF7 cells (B). IGF2 and H19 were quantitated in duplicate for each sample and were determined by a ΔCT and Δ2ΔCT calculation with reference to human β-actin gene control. IGF2 and H19 expression was normalized and presented as the number by using the IGF2 and H19 level in controls (white) as 1 (tissue, n = 6; control, n = 6; treatment, n = 6). *, P
    Ampflstr Identifiler Pcr Amplification Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1290 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ampflstr identifiler pcr amplification kit/product/Thermo Fisher
    Average 99 stars, based on 1290 article reviews
    Price from $9.99 to $1999.99
    ampflstr identifiler pcr amplification kit - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    92
    Toyobo pcr amplification
    Comparison of Pcdhb1 and Pcdh7 expression in cortical tissues from wild-type and <t>Mecp2</t> -null mice . Total RNA was extracted from the Mecp2 -null and wild-type mice at postnatal day 14 (P14) and cDNA was synthesized with random primers. The expression levels of Mecp2 (A), Pcdhb1 (B) and Pcdh7 (C) were examined by <t>qRT-PCR</t> and normalized using the expression level of Gapdh. All results are shown as the mean ± SEM of three replicates with the mean Control normalized to 1.0.
    Pcr Amplification, supplied by Toyobo, used in various techniques. Bioz Stars score: 92/100, based on 2091 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Toyobo
    Average 92 stars, based on 2091 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    92/100 stars
      Buy from Supplier

    92
    Meridian Life Science pcr amplification
    <t>DNA</t> separation and size identification. We used a reference signal with a DNA ladder in the upper channel and conveyed the analyte in the bottom channel. During calibration, we analyzed amplicons from non-repetitive sequences originating from plasmid DNA (45 cycles of <t>PCR).</t> ( A ) A fluorescence micrograph showing the two channels after concentration and separation during 30 s using a target sample with three fragments of 466, 798 and 1512 bp at 80 pg µL −1 . Actuation parameters are set to 6 bar and 82 V, corresponding to maximal flow velocity and electric field of ~7.1 cm s −1 and 6.9 MV m −1 , respectively. ( B ) The two plots represent the intensity profile along the two arrows represented in panel ( B ). The raw data is in black and the corresponding fits with Gaussian functions in blue and red. Based on the position of the center of each Gaussian peak in the ladder (top), we assign the size of the three bands in the sample by linear interpolation. More complex interpolation functions did not have a significant impact on accuracy of size determination. ( C ) The same experiment as in panel ( A ) with six bands of a kb ladder, and two bands of 1091 and 3314 bp diluted a concentration of 100 pg μL −1 . Actuation parameters are set to 1 bar and 50 V. The results were obtained after 1 min of enrichment. ( D ) The two plots correspond to the fluorescence intensity distribution along the symmetry line of the two channels with the corresponding Gaussian fits. The scale bars correspond to 300 µm in ( A ) and 400 µm in ( C ).
    Pcr Amplification, supplied by Meridian Life Science, used in various techniques. Bioz Stars score: 92/100, based on 2240 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Meridian Life Science
    Average 92 stars, based on 2240 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    92/100 stars
      Buy from Supplier

    94
    Addgene inc pcr amplified
    <t>miR-450b-5p</t> directly targets SIAH1 and SFRP2 A. Predicted miR-450b-5p target sequences in the 3′-UTR of SIAH1 (SIAH1-3′UTR-WT) and SFRP2 (SFRP2-3′UTR-WT), and sequences with mutated nucleotides (SIAH1-3′UTR-MUT and SFRP2-3′UTR-MUT). B. Real-time <t>PCR</t> analysis of SIAH1 and SFRP2 expression, normalized by GAPDH. C. Western blotting analysis of SIAH1 and SFRP1 in indicated cells. D. Western blotting analyses of GFP proteins in indicated cells. α-Tubulin served as loading control. E. Luciferase activity analysis of indicated cells transfused with indicated reporters of a different amount of miR-450b-5p (20 and 50 nM). Data were presented in mean ± SD of three independent experiments. * p
    Pcr Amplified, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1690 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Addgene inc
    Average 94 stars, based on 1690 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-10
    94/100 stars
      Buy from Supplier

    92
    Stratagene pcr amplified
    Constructs for plastid and nuclear transformations. ( a ) Construct for plastid transformation. lacO DNA (1 or ∼2.5 kb; dashed lines) was inserted between the HindIII and SmaI restriction sites into a polylinker in the unique Bsu36I site ( 31 ) of pZS197 ( 30 ). P rrn , plastid rrn promoter driving the aadA gene conferring resistance to spectinomycin; T psbA , terminator region from plastid psbA . Plastid rbcL and accD sequences are used for recombination into the plastid genome; their direction of transcription is shown by the arrowheads. The EcoRV restriction site was destroyed in the production of pZS197 but is restored in transplastomic plants. 1: position of 1.24 kb probe used in Southern DNA analysis. 2: position of the rbcL primer used to determine the size of the lacO insert in (b); 3: position of the forward and reverse primers used to analyse immunoprecipitated DNA for the presence of lacO . ( b ) <t>PCR</t> analysis of leaf DNA from transplastomic lacO lines. Lanes 1–4 and 5–8, putative transplastomic lines containing lacO constructs with 1 or ∼2.5 kb lacO DNA, respectively. Lane 9, no-template negative control. Lane 10, positive control, PCR on plasmid containing 1 kb lacO. Marker sizes are shown on the left. Primers were used to amplify a region extending from rbcL to accD and were expected to give band sizes of 2.6 or ∼4.0 kb with 1 kb or ∼2.5 kb of lacO , respectively. ( c ) Southern blot analysis of transplastomic tobacco lines, regenerated following bombardment with a plasmid containing ∼2.5 kb lacO repeat sequence. Total leaf DNA (0.3 µg) was cut with EcoRV and SacII and probed with a 32 P-labelled 1.24 kb BamHI fragment from rbcL [see (a) above]. Lanes 1–6, putative transplastomic lines. WT, ‘Petite Havana’ wild-type. Band sizes are shown on the left. ( d , e ) Constructs for nuclear transformation containing the CaMV 35S promoter and nos terminator in pBIN19 ( 32 ). (d) <t>gfp-lacI</t> DNA was inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and SacI restriction sites. (e) lacI-gfp has been inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and StuI restriction sites.
    Pcr Amplified, supplied by Stratagene, used in various techniques. Bioz Stars score: 92/100, based on 1672 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Stratagene
    Average 92 stars, based on 1672 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-10
    92/100 stars
      Buy from Supplier

    99
    TaKaRa pcr kit
    Constructs for plastid and nuclear transformations. ( a ) Construct for plastid transformation. lacO DNA (1 or ∼2.5 kb; dashed lines) was inserted between the HindIII and SmaI restriction sites into a polylinker in the unique Bsu36I site ( 31 ) of pZS197 ( 30 ). P rrn , plastid rrn promoter driving the aadA gene conferring resistance to spectinomycin; T psbA , terminator region from plastid psbA . Plastid rbcL and accD sequences are used for recombination into the plastid genome; their direction of transcription is shown by the arrowheads. The EcoRV restriction site was destroyed in the production of pZS197 but is restored in transplastomic plants. 1: position of 1.24 kb probe used in Southern DNA analysis. 2: position of the rbcL primer used to determine the size of the lacO insert in (b); 3: position of the forward and reverse primers used to analyse immunoprecipitated DNA for the presence of lacO . ( b ) <t>PCR</t> analysis of leaf DNA from transplastomic lacO lines. Lanes 1–4 and 5–8, putative transplastomic lines containing lacO constructs with 1 or ∼2.5 kb lacO DNA, respectively. Lane 9, no-template negative control. Lane 10, positive control, PCR on plasmid containing 1 kb lacO. Marker sizes are shown on the left. Primers were used to amplify a region extending from rbcL to accD and were expected to give band sizes of 2.6 or ∼4.0 kb with 1 kb or ∼2.5 kb of lacO , respectively. ( c ) Southern blot analysis of transplastomic tobacco lines, regenerated following bombardment with a plasmid containing ∼2.5 kb lacO repeat sequence. Total leaf DNA (0.3 µg) was cut with EcoRV and SacII and probed with a 32 P-labelled 1.24 kb BamHI fragment from rbcL [see (a) above]. Lanes 1–6, putative transplastomic lines. WT, ‘Petite Havana’ wild-type. Band sizes are shown on the left. ( d , e ) Constructs for nuclear transformation containing the CaMV 35S promoter and nos terminator in pBIN19 ( 32 ). (d) <t>gfp-lacI</t> DNA was inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and SacI restriction sites. (e) lacI-gfp has been inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and StuI restriction sites.
    Pcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1962 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr kit/product/TaKaRa
    Average 99 stars, based on 1962 article reviews
    Price from $9.99 to $1999.99
    pcr kit - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    92
    Promega pcr amplification
    Tissue distribution of <t>BLINaC</t> mRNA in different mouse and rat tissues A , <t>RT-PCR</t> experiments performed with RNA isolated from different mouse tissues (indicated on top of each lane). PCR products were hybridized with an α- 32 P-labelled mouse BLINaC cDNA probe (upper panel). The expected PCR product size is given on the left. Amplification of GAPDH was used for control (lower panel, ethidium bromide staining). B , analysis of BLINaC expression on different rat tissues (indicated on top) by RT-PCR. Specificity was confirmed by hybridization of the expected 365 bp PCR product with an α- 32 P-labelled rat BLINaC cDNA probe (upper panel). A control amplification of β-actin was performed in parallel (lower panel, ethidium bromide staining). C , detection of BLINaC transcript on mouse brain, liver and small intestine poly A + RNA (5 μg per lane) by Northern blot analysis. The probe used corresponds to an α- 32 P-labelled mouse BLINaC cDNA fragment. The filter was reprobed with a GAPDH probe as an RNA loading control (lower panel). A transcript of 2.1 kb was strongly detected in liver while a smaller transcript of 1.6 kb was found in small intestine. D , BLINaC mRNA expression in mouse liver and in freshly prepared hepatocytes was assessed by RT-PCR experiments. Specific amplification in liver and pure hepatocytes of a 737 bp product (upper panel, Southern blot) and β-actin control amplification (lower panel, ethidium bromide staining) are shown. The control corresponds to a PCR without cDNA.
    Pcr Amplification, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 15328 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Promega
    Average 92 stars, based on 15328 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    92/100 stars
      Buy from Supplier

    94
    Biometra pcr amplification
    Determination of variation of genetic make-up under the influence of host factor(s) through <t>PCR</t> amplification of (A) 7 days and (B) 14 days fungal genome <t>DNA</t> with ISSR-18 and RAPD-16 primers. L, 100 bp ladder: 1, P9 (T); 2, P9 (C); 3, P16 (T); 4, P16 (C); 5, P7(T); 6, P7(C); 7, KBPN(C); 8, KBPN (T); T, Treated with host factor(s); C, Control no host factor(s).
    Pcr Amplification, supplied by Biometra, used in various techniques. Bioz Stars score: 94/100, based on 1529 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Biometra
    Average 94 stars, based on 1529 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    94/100 stars
      Buy from Supplier

    93
    tiangen biotech co pcr amplification
    The disruption rates induced by transfecting Cas9, eGFP and sgRNA co-expression vector for three genomic loci in different cancer cell lines. a and b show the disruption efficiency induced by transfecting Cas9, eGFP and sgRNA co-expression vector in c-ABL and BCR gene loci in K562 cells as determined by T7E1 assay. “−” represents cells without GFP sorting; “+” represents cells with GFP sorting; and “M” represents <t>DNA</t> size marker. c – e show the disruption rate induced by transfecting Cas9, eGFP and AAVS1-sgRNA co-expression vector in K562, MCF-7 and HCT-116 cells using TA cloning and sequencing analysis. Approximately 20–30 TA clones were randomly picked up for DNA sequencing, and the disruption rate (%) was calculated based on DNA sequencing. All cells were transfected with 4 μg of pCS2-Cas9-IRES-GFP-polyA-gRNA (AAVS1) co-expression vector. Seventy-two hours after transfection, GFP-positive cells were enriched through FACS sorting and genomic DNA was extracted from the sorted cells. The <t>PCR</t> amplification, T7E1 assay and TA cloning into PMD18-T vector were performed as described in “ Methods ”
    Pcr Amplification, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 93/100, based on 1336 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/tiangen biotech co
    Average 93 stars, based on 1336 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    93/100 stars
      Buy from Supplier

    94
    Addgene inc pcr amplification
    Targeting the MUC1-C cytoplasmic domain downregulates <t>BMI1</t> expression A. Schema of the MUC1-C subunit with the 58 aa extracellular domain (ED), the 28 aa transmembrane domain (TM), and the sequence of the 72 aa cytoplasmic domain (CD). The MUC1-C cytoplasmic domain contains a CQC motif that is necessary and sufficient for MUC1-C homodimerization and oncogenic function. GO-203 is a cell-penetrating peptide that binds the CQC motif and blocks MUC1-C homodimerization. Highlighted are MUC1-C-induced pathways that confer the activation of ZEB1 and MYC. B. BT-549 cells were transfected with a control or MUC1-C(AQA) vector in which the CQC motif had been mutated to AQA. Lysates were immunoblotted with the indicated antibodies. C–E. BT-549 (C), MDA-MB-231 (D), and BT-20/MUC1-C (E) cells treated with 5 μM CP-2 or 5 μM GO-203 for 12 h were analyzed for BMI1 mRNA levels by <t>qRT-PCR.</t> The results (mean±SD) are expressed as relative BMI1 mRNA levels compared to that obtained for CP-2 (assigned a value of 1) (left). Cell lysates treated with 5 μM CP-2 or 5 μM GO-203 for 48 h were immunoblotted with the indicated antibodies (right).
    Pcr Amplification, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1532 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Addgene inc
    Average 94 stars, based on 1532 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-10
    94/100 stars
      Buy from Supplier

    Image Search Results


    Visualization of PCR amplification products of soil DNA isolated by five different methods using 18S rRNA by different methods. Lane M: λ DNA Eco RI/ Hin d III double digest marker; lane 1: mannitol-PBS-CTAB method; lane 2: PEG/NaCl method without liquid nitrogen; lane 3: mannitol-PBS-PEG/NaCl method; lane 4: mannitol-PBS-PCI method; lane 5: Soil Master DNA extraction kit.

    Journal: Molecular Biology International

    Article Title: An Improved Method for Soil DNA Extraction to Study the Microbial Assortment within Rhizospheric Region

    doi: 10.1155/2014/518960

    Figure Lengend Snippet: Visualization of PCR amplification products of soil DNA isolated by five different methods using 18S rRNA by different methods. Lane M: λ DNA Eco RI/ Hin d III double digest marker; lane 1: mannitol-PBS-CTAB method; lane 2: PEG/NaCl method without liquid nitrogen; lane 3: mannitol-PBS-PEG/NaCl method; lane 4: mannitol-PBS-PCI method; lane 5: Soil Master DNA extraction kit.

    Article Snippet: PCR Amplification of Soil DNA Extract Using 18S rRNA Primers for Fungal Identification Soil DNA was submitted for PCR amplification by using PCR BIORAD Thermal Cycler (United Kingdom).

    Techniques: Polymerase Chain Reaction, Amplification, Isolation, Marker, DNA Extraction

    Visualization of PCR amplification products of soil DNA isolated by five different methods using 16S rRNA by different methods. Lane M: λ DNA Eco RI/ Hin d III double digest marker; lane 1: mannitol-PBS-PCI method; lane 2: Soil Master DNA extraction kit; lane 3: mannitol-PBS-CTAB method; lane 4: PEG/NaCl method without liquid nitrogen; lane 5: mannitol-PBS-PEG/NaCl method.

    Journal: Molecular Biology International

    Article Title: An Improved Method for Soil DNA Extraction to Study the Microbial Assortment within Rhizospheric Region

    doi: 10.1155/2014/518960

    Figure Lengend Snippet: Visualization of PCR amplification products of soil DNA isolated by five different methods using 16S rRNA by different methods. Lane M: λ DNA Eco RI/ Hin d III double digest marker; lane 1: mannitol-PBS-PCI method; lane 2: Soil Master DNA extraction kit; lane 3: mannitol-PBS-CTAB method; lane 4: PEG/NaCl method without liquid nitrogen; lane 5: mannitol-PBS-PEG/NaCl method.

    Article Snippet: PCR Amplification of Soil DNA Extract Using 18S rRNA Primers for Fungal Identification Soil DNA was submitted for PCR amplification by using PCR BIORAD Thermal Cycler (United Kingdom).

    Techniques: Polymerase Chain Reaction, Amplification, Isolation, Marker, DNA Extraction

    cDNA sequence of mRNA de novo transcribed from TNFSF9 in HepG2 clone 9-1 (A) HepG2 clone 9-1 cells were incubated with 500 ng/ml LPS for the indicated times. cDNA was synthesized from total RNA, and TNFSF9 expression was quantified by real-time PCR as described in “Materials and Methods”. (B) HepG2 cells were incubated with 500 ng/ml LPS in the presence of 5-ethynyl uridine (EU) for 16 hrs. EU-labeled RNA was isolated as described in “Materials and Methods”. TNFSF9 cDNA was amplified by PCR and the PCR products were isolated and sequenced. This experiment is representative of four independent experiments.

    Journal: Molecules and Cells

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript

    doi: 10.14348/molcells.2018.0209

    Figure Lengend Snippet: cDNA sequence of mRNA de novo transcribed from TNFSF9 in HepG2 clone 9-1 (A) HepG2 clone 9-1 cells were incubated with 500 ng/ml LPS for the indicated times. cDNA was synthesized from total RNA, and TNFSF9 expression was quantified by real-time PCR as described in “Materials and Methods”. (B) HepG2 cells were incubated with 500 ng/ml LPS in the presence of 5-ethynyl uridine (EU) for 16 hrs. EU-labeled RNA was isolated as described in “Materials and Methods”. TNFSF9 cDNA was amplified by PCR and the PCR products were isolated and sequenced. This experiment is representative of four independent experiments.

    Article Snippet: Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression).

    Techniques: Sequencing, Incubation, Synthesized, Expressing, Real-time Polymerase Chain Reaction, Labeling, Isolation, Amplification, Polymerase Chain Reaction

    DNA sequence of genomic TNFSF9 gene edited by CRISPR-Cas9 The TNFSF9 genes in genomic DNAs from wild type and mutated HepG2 cells were amplified by PCR. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the genomic TNFSF9 sequence. On the right are shown the DNA sequences around the region of the mutated triplet in the wildtype and mutant clones. This is one representative of five independent experiments.

    Journal: Molecules and Cells

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript

    doi: 10.14348/molcells.2018.0209

    Figure Lengend Snippet: DNA sequence of genomic TNFSF9 gene edited by CRISPR-Cas9 The TNFSF9 genes in genomic DNAs from wild type and mutated HepG2 cells were amplified by PCR. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the genomic TNFSF9 sequence. On the right are shown the DNA sequences around the region of the mutated triplet in the wildtype and mutant clones. This is one representative of five independent experiments.

    Article Snippet: Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression).

    Techniques: Sequencing, CRISPR, Amplification, Polymerase Chain Reaction, Isolation, Mutagenesis, Clone Assay

    Heteroduplex formation by the cDNA of de novo transcripts of TNFSF9 from HepG2 clone 9-1 Total RNA and EU-labeled RNAs were isolated from clone 9-1 HepG2 cells. cDNA was synthesized and the TNFSF9 cDNA was amplified by PCR as described in “Materials and Methods”. The PCR products were annealed and incubated in the presence or absence of T7E1 endonuclease, and the products were fractionated on 1.2% agarose gels and visualized under UV. This is one representative of three independent experiments.

    Journal: Molecules and Cells

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript

    doi: 10.14348/molcells.2018.0209

    Figure Lengend Snippet: Heteroduplex formation by the cDNA of de novo transcripts of TNFSF9 from HepG2 clone 9-1 Total RNA and EU-labeled RNAs were isolated from clone 9-1 HepG2 cells. cDNA was synthesized and the TNFSF9 cDNA was amplified by PCR as described in “Materials and Methods”. The PCR products were annealed and incubated in the presence or absence of T7E1 endonuclease, and the products were fractionated on 1.2% agarose gels and visualized under UV. This is one representative of three independent experiments.

    Article Snippet: Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression).

    Techniques: Labeling, Isolation, Synthesized, Amplification, Polymerase Chain Reaction, Incubation

    cDNA sequence of mRNA transcribed from mutant genomic TNFSF9 TNFSF9 cDNA was synthesized and amplified by PCR from total RNA extracted from wild type and mutated HepG2 cells. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the TNFSF9 cDNA sequences. On the right are shown the cDNA sequences around the region of the mutated triplet in the wild type and mutant clones. This is one representative of four independent experiments.

    Journal: Molecules and Cells

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript

    doi: 10.14348/molcells.2018.0209

    Figure Lengend Snippet: cDNA sequence of mRNA transcribed from mutant genomic TNFSF9 TNFSF9 cDNA was synthesized and amplified by PCR from total RNA extracted from wild type and mutated HepG2 cells. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the TNFSF9 cDNA sequences. On the right are shown the cDNA sequences around the region of the mutated triplet in the wild type and mutant clones. This is one representative of four independent experiments.

    Article Snippet: Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression).

    Techniques: Sequencing, Mutagenesis, Synthesized, Amplification, Polymerase Chain Reaction, Isolation, Clone Assay

    Confirmation of CAF-1 reprogramming phenotype with alternative transgenic and non-transgenic vector systems (a) Alkaline phosphatase (AP)-positive, transgene-independent iPSC colonies at day 14 following transduction of R26-M2rtTA MEFs with tetO-STEMCCA lentiviral OKSM expression vector and either Chaf1a.164 or Ren.713 shRNA vectors and treatment with high (2 μg/ml) or low (0.2 μg/ml) doses of dox for 10 days. (b) Quantification of data shown in (a). Experiment was performed at 3 different plating densities (n=1 experiment per density), representative data are shown. (c) Comparison of reprogramming efficiencies between Col1a1::tetOP-OKSM; R26-M2rtTA reprogrammable MEFs and wild type MEFs infected directly with OKSM-expressing lentiviral vectors containing either a strong Ef1a full-length promoter (Ef1a-OKSM long) or a weaker truncated promoter (Ef1a-OKSM short). TRE3G-OKSM is a lentiviral vector with a strong promoter, whose activity is downregulated over time upon infection of CAGS-rtTA3 transgenic MEFs (see below). Error bars show standard deviation from biological triplicates. (d) Quantitative RT-PCR data showing variability in OKSM expression levels over time using different vector systems. Cells were analyzed after 3 and 6 days of infection (lentiviral vectors) or dox exposure (reprogrammable MEFs). Error bars show standard deviation from biological triplicates. OGR MEF, transgenic MEFs carrying O ct4- G FP and CAGS- r tTA3 alleles. (e) Quantification of Oct4 protein levels by intracellular flow cytometry (top) and cellular granularity/complexity by side scatter (SSC) analysis of indicated samples (bottom). Error bars show standard deviation from biological triplicates.

    Journal: Nature

    Article Title: The histone chaperone CAF-1 safeguards somatic cell identity

    doi: 10.1038/nature15749

    Figure Lengend Snippet: Confirmation of CAF-1 reprogramming phenotype with alternative transgenic and non-transgenic vector systems (a) Alkaline phosphatase (AP)-positive, transgene-independent iPSC colonies at day 14 following transduction of R26-M2rtTA MEFs with tetO-STEMCCA lentiviral OKSM expression vector and either Chaf1a.164 or Ren.713 shRNA vectors and treatment with high (2 μg/ml) or low (0.2 μg/ml) doses of dox for 10 days. (b) Quantification of data shown in (a). Experiment was performed at 3 different plating densities (n=1 experiment per density), representative data are shown. (c) Comparison of reprogramming efficiencies between Col1a1::tetOP-OKSM; R26-M2rtTA reprogrammable MEFs and wild type MEFs infected directly with OKSM-expressing lentiviral vectors containing either a strong Ef1a full-length promoter (Ef1a-OKSM long) or a weaker truncated promoter (Ef1a-OKSM short). TRE3G-OKSM is a lentiviral vector with a strong promoter, whose activity is downregulated over time upon infection of CAGS-rtTA3 transgenic MEFs (see below). Error bars show standard deviation from biological triplicates. (d) Quantitative RT-PCR data showing variability in OKSM expression levels over time using different vector systems. Cells were analyzed after 3 and 6 days of infection (lentiviral vectors) or dox exposure (reprogrammable MEFs). Error bars show standard deviation from biological triplicates. OGR MEF, transgenic MEFs carrying O ct4- G FP and CAGS- r tTA3 alleles. (e) Quantification of Oct4 protein levels by intracellular flow cytometry (top) and cellular granularity/complexity by side scatter (SSC) analysis of indicated samples (bottom). Error bars show standard deviation from biological triplicates.

    Article Snippet: Templates for deep-sequencing were generated by PCR amplification of shRNA guide strands using primers that tag the product with standard Illumina adapters (p7+loop, CAAGCAGAAGACGGCATACGA[INDEX]TAGTGAAGCCACAGATGT; p5+PGK, AATGATACGGCGACCACCGATGGATGTGGAATGTGTGCGAGG).

    Techniques: Transgenic Assay, Plasmid Preparation, Transduction, Expressing, shRNA, Infection, Activity Assay, Standard Deviation, Quantitative RT-PCR, Flow Cytometry, Cytometry

    Effect of CAF-1 suppression on HSPC reprogramming and transdifferentiation (a) Gating strategy for determining Pecam + fraction (shaded area) in panel (b); data identical to Fig. 4c . (b) Quantification of the fraction of Pecam + cells at day 4 and day 6 of reprogramming. Data obtained from one experiment using 2 different Chaf1 shRNAs. (c) Transgene dependence assay during the reprogramming of hematopoietic stem and progenitor cells (HSPCs) into iPSCs in the presence of Chaf1a or Renilla shRNAs. Dox pulses were given for 3 or 6 days and alkaline phosphatase (AP)-positive colonies were scored at day 10. (d) Quantitative RT-PCR analysis of Chaf1a expression to confirm knockdown after 3 days of dox induction, i.e. coexpression of shRNAmiR and Ascl1 (n=4 independent infections of the same Col1a1::tetOP-Chaf1a.164 shRNA MEF line; mean value +/− standard deviation). (e) Gating strategy for determining Cd14 + and Mac1 + fractions (shaded area) shown in (f); data identical to Fig. 4g . Positive gates were based on untreated (0 hour) control cells. (f) Quantification of the fraction of Cd14 + and Mac1 + cells at 0, 24 and 48 hours of transdifferentiation using indicated CAF-1 shRNA or empty control vector (n=2 independent infections; rep, replicate). (g) Quantitative RT-PCR analysis of Chaf1a and Chaf1b expression to confirm knockdown in transduced pre-B cell line prior to induction of transdifferentiation (kd/ctrl, knockdown/empty vector control; n=1 experiment, representative of 2 independent infections).

    Journal: Nature

    Article Title: The histone chaperone CAF-1 safeguards somatic cell identity

    doi: 10.1038/nature15749

    Figure Lengend Snippet: Effect of CAF-1 suppression on HSPC reprogramming and transdifferentiation (a) Gating strategy for determining Pecam + fraction (shaded area) in panel (b); data identical to Fig. 4c . (b) Quantification of the fraction of Pecam + cells at day 4 and day 6 of reprogramming. Data obtained from one experiment using 2 different Chaf1 shRNAs. (c) Transgene dependence assay during the reprogramming of hematopoietic stem and progenitor cells (HSPCs) into iPSCs in the presence of Chaf1a or Renilla shRNAs. Dox pulses were given for 3 or 6 days and alkaline phosphatase (AP)-positive colonies were scored at day 10. (d) Quantitative RT-PCR analysis of Chaf1a expression to confirm knockdown after 3 days of dox induction, i.e. coexpression of shRNAmiR and Ascl1 (n=4 independent infections of the same Col1a1::tetOP-Chaf1a.164 shRNA MEF line; mean value +/− standard deviation). (e) Gating strategy for determining Cd14 + and Mac1 + fractions (shaded area) shown in (f); data identical to Fig. 4g . Positive gates were based on untreated (0 hour) control cells. (f) Quantification of the fraction of Cd14 + and Mac1 + cells at 0, 24 and 48 hours of transdifferentiation using indicated CAF-1 shRNA or empty control vector (n=2 independent infections; rep, replicate). (g) Quantitative RT-PCR analysis of Chaf1a and Chaf1b expression to confirm knockdown in transduced pre-B cell line prior to induction of transdifferentiation (kd/ctrl, knockdown/empty vector control; n=1 experiment, representative of 2 independent infections).

    Article Snippet: Templates for deep-sequencing were generated by PCR amplification of shRNA guide strands using primers that tag the product with standard Illumina adapters (p7+loop, CAAGCAGAAGACGGCATACGA[INDEX]TAGTGAAGCCACAGATGT; p5+PGK, AATGATACGGCGACCACCGATGGATGTGGAATGTGTGCGAGG).

    Techniques: Quantitative RT-PCR, Expressing, shRNA, Standard Deviation, Plasmid Preparation

    Effect of CAF-1 suppression on OKSM levels and cellular growth, and shRNA rescue experiment (a) Quantitative RT-PCR for transgenic OKSM expression using reprogrammable MEFs transduced with indicated shRNA vectors. Error bars show standard deviation from biological triplicates. (b) RNA-seq analysis of OKSM transgene expression in reprogrammable MEFs transduced with Renilla and Chaf1a shRNAs and exposed to dox for 0, 3 or 6 days. Error bars indicate standard deviation from biological triplicates. (c) Western blot analysis for Sox2 and Tbp (loading control) in reprogrammable MEFs transduced with shRNA vectors targeting Renilla (Ren.713) or different CAF-1 components and exposed to dox for 3 days (see Supplementary Figure 1 for full scans). The same membrane was probed with anti-CAF-1 p150 and anti-CAF-1 p60 antibody to confirm knockdown (data not shown). (d) Rescue experiment to demonstrate specificity of Chaf1b.367 shRNA vector. Reprogrammable MEFs carrying Oct4-tomato knock-in reporter were infected with lentiviral vectors expressing either EGFP or human CAF-1 p60 (CHAF1B) before transducing cells with Renilla or Cha1fb.367 shRNAs and applying dox for 6 days. Colonies were counted at day 11. Note that CAF-1 p60 overexpression attenuates enhanced reprogramming elicited by Chaf1b suppression. (e,f) Competitive proliferation assay between shRNA vector-infected and non-infected reprogrammable cells using indicated shRNAs in the presence or absence of dox (OKSM expression). Note that CAF-1 suppression does not substantially affect the proliferation potential of reprogrammable MEFs after 1-3 days of dox (OKSM) induction while it impairs the long-term growth potential of uninduced MEFs. Data were normalized to cell counts in “no OKSM” condition for (e) and “day 2” time point for (f). Error bars show standard deviation from biological triplicates.

    Journal: Nature

    Article Title: The histone chaperone CAF-1 safeguards somatic cell identity

    doi: 10.1038/nature15749

    Figure Lengend Snippet: Effect of CAF-1 suppression on OKSM levels and cellular growth, and shRNA rescue experiment (a) Quantitative RT-PCR for transgenic OKSM expression using reprogrammable MEFs transduced with indicated shRNA vectors. Error bars show standard deviation from biological triplicates. (b) RNA-seq analysis of OKSM transgene expression in reprogrammable MEFs transduced with Renilla and Chaf1a shRNAs and exposed to dox for 0, 3 or 6 days. Error bars indicate standard deviation from biological triplicates. (c) Western blot analysis for Sox2 and Tbp (loading control) in reprogrammable MEFs transduced with shRNA vectors targeting Renilla (Ren.713) or different CAF-1 components and exposed to dox for 3 days (see Supplementary Figure 1 for full scans). The same membrane was probed with anti-CAF-1 p150 and anti-CAF-1 p60 antibody to confirm knockdown (data not shown). (d) Rescue experiment to demonstrate specificity of Chaf1b.367 shRNA vector. Reprogrammable MEFs carrying Oct4-tomato knock-in reporter were infected with lentiviral vectors expressing either EGFP or human CAF-1 p60 (CHAF1B) before transducing cells with Renilla or Cha1fb.367 shRNAs and applying dox for 6 days. Colonies were counted at day 11. Note that CAF-1 p60 overexpression attenuates enhanced reprogramming elicited by Chaf1b suppression. (e,f) Competitive proliferation assay between shRNA vector-infected and non-infected reprogrammable cells using indicated shRNAs in the presence or absence of dox (OKSM expression). Note that CAF-1 suppression does not substantially affect the proliferation potential of reprogrammable MEFs after 1-3 days of dox (OKSM) induction while it impairs the long-term growth potential of uninduced MEFs. Data were normalized to cell counts in “no OKSM” condition for (e) and “day 2” time point for (f). Error bars show standard deviation from biological triplicates.

    Article Snippet: Templates for deep-sequencing were generated by PCR amplification of shRNA guide strands using primers that tag the product with standard Illumina adapters (p7+loop, CAAGCAGAAGACGGCATACGA[INDEX]TAGTGAAGCCACAGATGT; p5+PGK, AATGATACGGCGACCACCGATGGATGTGGAATGTGTGCGAGG).

    Techniques: shRNA, Quantitative RT-PCR, Transgenic Assay, Expressing, Transduction, Standard Deviation, RNA Sequencing Assay, Western Blot, Plasmid Preparation, Knock-In, Infection, Over Expression, Proliferation Assay

    Validation of hits from chromatin-focused shRNA screens (a) Quantitative RT-PCR analysis to confirm suppression of Chaf1a and Chaf1b expression with miR-30-based vectors from arrayed screen. Sh Chaf1a pool, sh Chaf1b pool and sh CAF-1 pool denote pools of shRNAs targeting either Chaf1a, Chaf1b or both. (b) Western blot analysis to confirm knockdown of CAF-1 components using the top-scoring miR-30-based shRNAs from arrayed screen (see Supplementary Figure 1 for full scans). (c) Quantification of data shown in Fig. 1f . (d) Quantitative RT-PCR analysis confirming knockdown with top-scoring miR-E-based shRNAmiRs targeting Chaf1a, Chaf1b or Ube2i from multiplexed screen. Error bars show standard deviation from biological triplicates. RNA and protein were extracted from reprogrammable MEFs 72 hours after dox induction in panels a-d. (e) Suppression of CAF-1 components, Ube2i and Setdb2 enhances reprogramming in the presence or absence of ascorbic acid (AA) as well as in serum replacement media containing LIF (SR-LIF). Oct4-GFP + cells were scored by flow cytometry on day 11 after 7 days of OKSM induction and 4 days of transgene-independent growth. Error bars show standard deviation from biological triplicates. (f) Number of dox-independent, alkaline phosphatase (AP)-positive colonies emerging 2 weeks after plating 10,000 reprogrammable MEFs carrying shRNA vectors against indicated targets and cultured in serum replacement media containing 2i (SR-2i), n=1 experiment. (g) Effect of suppressing SUMO E2 ligase Ube2i, E1 ligases Sae1 and Uba2 on iPSC formation. Shown is fraction of Oct4-GFP + cells at day 11 (7 days of OKSM induction, 4 days of transgene-independent growth). Error bars depict standard deviation from biological triplicates.

    Journal: Nature

    Article Title: The histone chaperone CAF-1 safeguards somatic cell identity

    doi: 10.1038/nature15749

    Figure Lengend Snippet: Validation of hits from chromatin-focused shRNA screens (a) Quantitative RT-PCR analysis to confirm suppression of Chaf1a and Chaf1b expression with miR-30-based vectors from arrayed screen. Sh Chaf1a pool, sh Chaf1b pool and sh CAF-1 pool denote pools of shRNAs targeting either Chaf1a, Chaf1b or both. (b) Western blot analysis to confirm knockdown of CAF-1 components using the top-scoring miR-30-based shRNAs from arrayed screen (see Supplementary Figure 1 for full scans). (c) Quantification of data shown in Fig. 1f . (d) Quantitative RT-PCR analysis confirming knockdown with top-scoring miR-E-based shRNAmiRs targeting Chaf1a, Chaf1b or Ube2i from multiplexed screen. Error bars show standard deviation from biological triplicates. RNA and protein were extracted from reprogrammable MEFs 72 hours after dox induction in panels a-d. (e) Suppression of CAF-1 components, Ube2i and Setdb2 enhances reprogramming in the presence or absence of ascorbic acid (AA) as well as in serum replacement media containing LIF (SR-LIF). Oct4-GFP + cells were scored by flow cytometry on day 11 after 7 days of OKSM induction and 4 days of transgene-independent growth. Error bars show standard deviation from biological triplicates. (f) Number of dox-independent, alkaline phosphatase (AP)-positive colonies emerging 2 weeks after plating 10,000 reprogrammable MEFs carrying shRNA vectors against indicated targets and cultured in serum replacement media containing 2i (SR-2i), n=1 experiment. (g) Effect of suppressing SUMO E2 ligase Ube2i, E1 ligases Sae1 and Uba2 on iPSC formation. Shown is fraction of Oct4-GFP + cells at day 11 (7 days of OKSM induction, 4 days of transgene-independent growth). Error bars depict standard deviation from biological triplicates.

    Article Snippet: Templates for deep-sequencing were generated by PCR amplification of shRNA guide strands using primers that tag the product with standard Illumina adapters (p7+loop, CAAGCAGAAGACGGCATACGA[INDEX]TAGTGAAGCCACAGATGT; p5+PGK, AATGATACGGCGACCACCGATGGATGTGGAATGTGTGCGAGG).

    Techniques: shRNA, Quantitative RT-PCR, Expressing, Western Blot, Standard Deviation, Flow Cytometry, Cytometry, Cell Culture

    Trans-activation of the endogenous Abcc6 gene in TIB-73 cells Hepatocytes were transfected with a vector expressing the HNF1 α , HNF4 α or p45-NFE2 cDNAs. As a negative control, the cells were transfected with an empty vector. The levels of the endogenous mAbcc6 gene were determined by quantitative PCR with TaqMan probes specific to the murine mAbcc6 cDNA. The results were normalized to the transfection efficiency by measuring the level of expression of the neomycin-resistance gene present on the vector expressing the transcription factors. The assays were performed three times at least in triplicate. Standard errors are indicated.

    Journal: Biochimica et biophysica acta

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression

    doi: 10.1016/j.bbaexp.2006.08.002

    Figure Lengend Snippet: Trans-activation of the endogenous Abcc6 gene in TIB-73 cells Hepatocytes were transfected with a vector expressing the HNF1 α , HNF4 α or p45-NFE2 cDNAs. As a negative control, the cells were transfected with an empty vector. The levels of the endogenous mAbcc6 gene were determined by quantitative PCR with TaqMan probes specific to the murine mAbcc6 cDNA. The results were normalized to the transfection efficiency by measuring the level of expression of the neomycin-resistance gene present on the vector expressing the transcription factors. The assays were performed three times at least in triplicate. Standard errors are indicated.

    Article Snippet: Six mAbcc6 gene fragments were generated by PCR amplification using Pfu DNA polymerase (Stratagene).

    Techniques: Activation Assay, Transfection, Plasmid Preparation, Expressing, Negative Control, Real-time Polymerase Chain Reaction

    Relative in vivo association of the mAbcc6 promoter with the HNF1α, HNF4 α and p45-NFE2 transcription factors Fragments of chromatin from TIB-73 cells were immunoprecipitated with anti-HNF1α, -HNF4α and -p45-NFE2 antibodies and quantified by real-time PCR using primers specific to the proximal region of the mAbcc6 promoter (−152/+162). The data was normalized to the total input of DNA used prior to immunoprecipitation and the control assay (noAB). The differences in relative association are shown as relative to the negative control (noAB). Data represents the mean of 5 independent immunoprecipitations quantified in duplicate assays. Standard errors are indicated.

    Journal: Biochimica et biophysica acta

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression

    doi: 10.1016/j.bbaexp.2006.08.002

    Figure Lengend Snippet: Relative in vivo association of the mAbcc6 promoter with the HNF1α, HNF4 α and p45-NFE2 transcription factors Fragments of chromatin from TIB-73 cells were immunoprecipitated with anti-HNF1α, -HNF4α and -p45-NFE2 antibodies and quantified by real-time PCR using primers specific to the proximal region of the mAbcc6 promoter (−152/+162). The data was normalized to the total input of DNA used prior to immunoprecipitation and the control assay (noAB). The differences in relative association are shown as relative to the negative control (noAB). Data represents the mean of 5 independent immunoprecipitations quantified in duplicate assays. Standard errors are indicated.

    Article Snippet: Six mAbcc6 gene fragments were generated by PCR amplification using Pfu DNA polymerase (Stratagene).

    Techniques: In Vivo, Immunoprecipitation, Real-time Polymerase Chain Reaction, Control Assay, Negative Control

    The mAbcc6 proximal promoter region is a TATA-less gene promoter (A) Luciferase reporter plasmids bearing the −2926/+162bp fragment of the mAbcc6 promoter and the same fragment with a mutated CCAAT box (indicated as CCAAT*) were transfected into hepatocytes (TIB-73). The luciferase activity that was normalized to the transfection efficiency is shown as relative to the promoter-less vector (pGL3 basic). Results were obtained from at least three independent transfection experiments performed in triplicate. (B) Hepatocytes (TIB-73) and fibroblasts (NIH/3T3) were co-transfected with a luciferase reporter plasmids (pGL3-basic) containing the −152/+162bp fragment of the mAbcc6 promoter and an expression vector bearing the Sp1 transcription factor cDNA. An empty expression vector was used as a negative control. The level of luciferase activity induction is shown as relative to the pGL3 basic and was normalized to the transfection efficiency. Results were derived from at least three independent transfection experiments performed in triplicate. (C) Electrophoretic mobility shift assays (EMSA) were performed with the mAbcc6 proximal promoter (−152/+162bp) fragment and nuclear extract from hepatocytes (TIB-73). For the supershift assay, 2μg of the Sp1 antibody was pre-incubated with nuclear extracts before adding the −152/162 mAbcc6 fragment . (D) Chromatin Immunoprecipitation assays. Soluble chromatin from TIB-73 cells was immunoprecipitated with the Sp1 antibody (αSp1) or incubated with normal goat serum (noAb) for control purposes. The total extracted DNA (Input) prior to immunoprecipitation and the immunoprecipitated samples (αSp1, noAB) were PCR-amplified using primers specific to the −162/+152bp fragment.

    Journal: Biochimica et biophysica acta

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression

    doi: 10.1016/j.bbaexp.2006.08.002

    Figure Lengend Snippet: The mAbcc6 proximal promoter region is a TATA-less gene promoter (A) Luciferase reporter plasmids bearing the −2926/+162bp fragment of the mAbcc6 promoter and the same fragment with a mutated CCAAT box (indicated as CCAAT*) were transfected into hepatocytes (TIB-73). The luciferase activity that was normalized to the transfection efficiency is shown as relative to the promoter-less vector (pGL3 basic). Results were obtained from at least three independent transfection experiments performed in triplicate. (B) Hepatocytes (TIB-73) and fibroblasts (NIH/3T3) were co-transfected with a luciferase reporter plasmids (pGL3-basic) containing the −152/+162bp fragment of the mAbcc6 promoter and an expression vector bearing the Sp1 transcription factor cDNA. An empty expression vector was used as a negative control. The level of luciferase activity induction is shown as relative to the pGL3 basic and was normalized to the transfection efficiency. Results were derived from at least three independent transfection experiments performed in triplicate. (C) Electrophoretic mobility shift assays (EMSA) were performed with the mAbcc6 proximal promoter (−152/+162bp) fragment and nuclear extract from hepatocytes (TIB-73). For the supershift assay, 2μg of the Sp1 antibody was pre-incubated with nuclear extracts before adding the −152/162 mAbcc6 fragment . (D) Chromatin Immunoprecipitation assays. Soluble chromatin from TIB-73 cells was immunoprecipitated with the Sp1 antibody (αSp1) or incubated with normal goat serum (noAb) for control purposes. The total extracted DNA (Input) prior to immunoprecipitation and the immunoprecipitated samples (αSp1, noAB) were PCR-amplified using primers specific to the −162/+152bp fragment.

    Article Snippet: Six mAbcc6 gene fragments were generated by PCR amplification using Pfu DNA polymerase (Stratagene).

    Techniques: Luciferase, Transfection, Activity Assay, Plasmid Preparation, Expressing, Negative Control, Derivative Assay, Electrophoretic Mobility Shift Assay, Incubation, Chromatin Immunoprecipitation, Immunoprecipitation, Polymerase Chain Reaction, Amplification

    Histogram of polymerase chain reaction results in colon, bladder and prostate cancer samples, as well as HT-29, Caco-2, HT-1376, LNCaP, and HepG2 cancer cell lines. Oct4 was expressed in 100% of bladder, colon, and prostate tumor samples. Expression of Nanog was detected in 100% of the colon cancer samples, 90% of the bladder cancer samples and 80% of the prostate cancer samples. Nucleostemin was detected in 100% of the prostate cancer samples, 80% of the bladder cancer samples, and 60% of the colon cancer samples.

    Journal: Anatomy & Cell Biology

    Article Title: The expressions of stem cell markers: Oct4, Nanog, Sox2, nucleostemin, Bmi, Zfx, Tcl1, Tbx3, Dppa4, and Esrrb in bladder, colon, and prostate cancer, and certain cancer cell lines

    doi: 10.5115/acb.2014.47.1.1

    Figure Lengend Snippet: Histogram of polymerase chain reaction results in colon, bladder and prostate cancer samples, as well as HT-29, Caco-2, HT-1376, LNCaP, and HepG2 cancer cell lines. Oct4 was expressed in 100% of bladder, colon, and prostate tumor samples. Expression of Nanog was detected in 100% of the colon cancer samples, 90% of the bladder cancer samples and 80% of the prostate cancer samples. Nucleostemin was detected in 100% of the prostate cancer samples, 80% of the bladder cancer samples, and 60% of the colon cancer samples.

    Article Snippet: PCR amplification was performed for either 36 (Oct4, Nanog, Sox2, Bmi), 40 (nucleostemin, Tcl1, Esrrb, Dppa4), or 32 (Tbx3, Zfx) cycles with the following cycle conditions: 94℃ for 45 seconds, 60℃ (Oct4, Nanog, Sox2, nucleostemin); 59℃ (GAPDH); 58℃ (Tbx3); and 62℃ (Dppa4, Esrrb) for 45 seconds by the Thermal cycler (Eppendorf, Hamburg, Germany).

    Techniques: Polymerase Chain Reaction, Expressing

    Reverse transcriptase polymerase chain reaction (RT-PCR) analysis of the expressions of Oct4, Nanog, Sox2, nucleostemin, Esrrb, Tbx3, Tcl1, Dppa4, Zfx, and Bmi in HT-1376 (bladder cancer cell line), LNCaP (pro state cancer cell line), HepG2 (hepa tocarcinoma cell line), HT-29, and Caco-2 (colon cancer cell lines). RT-PCR analysis was performed using carefully designated primers for specific amplification of each gene. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was the internal control. U87, a glioblastoma cell line, was the positive control for Sox2, nucle ostemin, and Zfx. NT2, a human embryonal carcinoma cell line, was the positive control for Oct4, Nanog, Bmi, Tcl1, Tbx3, Dppa4, Zfx, and Esrrb. Note: All genes were expressed in the cancer cell lines.

    Journal: Anatomy & Cell Biology

    Article Title: The expressions of stem cell markers: Oct4, Nanog, Sox2, nucleostemin, Bmi, Zfx, Tcl1, Tbx3, Dppa4, and Esrrb in bladder, colon, and prostate cancer, and certain cancer cell lines

    doi: 10.5115/acb.2014.47.1.1

    Figure Lengend Snippet: Reverse transcriptase polymerase chain reaction (RT-PCR) analysis of the expressions of Oct4, Nanog, Sox2, nucleostemin, Esrrb, Tbx3, Tcl1, Dppa4, Zfx, and Bmi in HT-1376 (bladder cancer cell line), LNCaP (pro state cancer cell line), HepG2 (hepa tocarcinoma cell line), HT-29, and Caco-2 (colon cancer cell lines). RT-PCR analysis was performed using carefully designated primers for specific amplification of each gene. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was the internal control. U87, a glioblastoma cell line, was the positive control for Sox2, nucle ostemin, and Zfx. NT2, a human embryonal carcinoma cell line, was the positive control for Oct4, Nanog, Bmi, Tcl1, Tbx3, Dppa4, Zfx, and Esrrb. Note: All genes were expressed in the cancer cell lines.

    Article Snippet: PCR amplification was performed for either 36 (Oct4, Nanog, Sox2, Bmi), 40 (nucleostemin, Tcl1, Esrrb, Dppa4), or 32 (Tbx3, Zfx) cycles with the following cycle conditions: 94℃ for 45 seconds, 60℃ (Oct4, Nanog, Sox2, nucleostemin); 59℃ (GAPDH); 58℃ (Tbx3); and 62℃ (Dppa4, Esrrb) for 45 seconds by the Thermal cycler (Eppendorf, Hamburg, Germany).

    Techniques: Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Amplification, Positive Control

    Reverse transcriptase polymerase chain reaction (RT-PCR) analysis shows the expressions of Oct4, Nanog, Sox2, nucleostemin, Esrrb, Tbx3, Tcl1, Dppa4, Zfx, and Bmi in the colon cancer tissues. RT-PCR analysis was performed using carefully designated primers for specific amplification of each gene. Note: All genes were expressed in some of the samples, however other samples did not express some of genes. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control.

    Journal: Anatomy & Cell Biology

    Article Title: The expressions of stem cell markers: Oct4, Nanog, Sox2, nucleostemin, Bmi, Zfx, Tcl1, Tbx3, Dppa4, and Esrrb in bladder, colon, and prostate cancer, and certain cancer cell lines

    doi: 10.5115/acb.2014.47.1.1

    Figure Lengend Snippet: Reverse transcriptase polymerase chain reaction (RT-PCR) analysis shows the expressions of Oct4, Nanog, Sox2, nucleostemin, Esrrb, Tbx3, Tcl1, Dppa4, Zfx, and Bmi in the colon cancer tissues. RT-PCR analysis was performed using carefully designated primers for specific amplification of each gene. Note: All genes were expressed in some of the samples, however other samples did not express some of genes. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control.

    Article Snippet: PCR amplification was performed for either 36 (Oct4, Nanog, Sox2, Bmi), 40 (nucleostemin, Tcl1, Esrrb, Dppa4), or 32 (Tbx3, Zfx) cycles with the following cycle conditions: 94℃ for 45 seconds, 60℃ (Oct4, Nanog, Sox2, nucleostemin); 59℃ (GAPDH); 58℃ (Tbx3); and 62℃ (Dppa4, Esrrb) for 45 seconds by the Thermal cycler (Eppendorf, Hamburg, Germany).

    Techniques: Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Amplification

    PCR profiles of parental genotypes using SSR markers VR040 (L1–L6), VR062 (L7–L12) and VR0111 (L13–L18). ∗ Marker for recombination .

    Journal: Frontiers in Plant Science

    Article Title: Genetic Confirmation of Mungbean (Vigna radiata) and Mashbean (Vigna mungo) Interspecific Recombinants using Molecular Markers

    doi: 10.3389/fpls.2015.01107

    Figure Lengend Snippet: PCR profiles of parental genotypes using SSR markers VR040 (L1–L6), VR062 (L7–L12) and VR0111 (L13–L18). ∗ Marker for recombination .

    Article Snippet: PCR amplifications for URP and SSR (RIS) markers were performed using thermal cycler (Bio RAD T-100, USA) with initial denaturation at 94°C for 3 min and then 40 cycles of denaturation at 94°C for 1 min, primer annealing at 55°C for 1 min, primer extension at 72°C for 2 min with a final extension step at 72°C for 10 min. PCR amplifications for RAPD were performed with initial denaturation at 94°C for 4 min and then 40 cycles of denaturation at 94°C for 30 s, primer annealing at 35°C for 1 min, primer extension at 72°C for 2 min and final extension step at 72°C for 7 min. PCR conditions used for SSR markers include initial denaturation at 94°C for 2 min and then 35 cycles of denaturation at 94°C for 30 s, primer annealing at 50–60°C for 30 s, primer extension at 72°C for 1 min and final extension step at 72°C for 10 min.

    Techniques: Polymerase Chain Reaction, Marker

    PCR profiles of parental genotypes along with interspecific recombinants using SSR marker VR040. ∗ Marker for recombination .

    Journal: Frontiers in Plant Science

    Article Title: Genetic Confirmation of Mungbean (Vigna radiata) and Mashbean (Vigna mungo) Interspecific Recombinants using Molecular Markers

    doi: 10.3389/fpls.2015.01107

    Figure Lengend Snippet: PCR profiles of parental genotypes along with interspecific recombinants using SSR marker VR040. ∗ Marker for recombination .

    Article Snippet: PCR amplifications for URP and SSR (RIS) markers were performed using thermal cycler (Bio RAD T-100, USA) with initial denaturation at 94°C for 3 min and then 40 cycles of denaturation at 94°C for 1 min, primer annealing at 55°C for 1 min, primer extension at 72°C for 2 min with a final extension step at 72°C for 10 min. PCR amplifications for RAPD were performed with initial denaturation at 94°C for 4 min and then 40 cycles of denaturation at 94°C for 30 s, primer annealing at 35°C for 1 min, primer extension at 72°C for 2 min and final extension step at 72°C for 7 min. PCR conditions used for SSR markers include initial denaturation at 94°C for 2 min and then 35 cycles of denaturation at 94°C for 30 s, primer annealing at 50–60°C for 30 s, primer extension at 72°C for 1 min and final extension step at 72°C for 10 min.

    Techniques: Polymerase Chain Reaction, Marker

    PCR profiles of parental genotypes along with interspecific recombinants using SSR marker VR0304. ∗ Marker for recombination .

    Journal: Frontiers in Plant Science

    Article Title: Genetic Confirmation of Mungbean (Vigna radiata) and Mashbean (Vigna mungo) Interspecific Recombinants using Molecular Markers

    doi: 10.3389/fpls.2015.01107

    Figure Lengend Snippet: PCR profiles of parental genotypes along with interspecific recombinants using SSR marker VR0304. ∗ Marker for recombination .

    Article Snippet: PCR amplifications for URP and SSR (RIS) markers were performed using thermal cycler (Bio RAD T-100, USA) with initial denaturation at 94°C for 3 min and then 40 cycles of denaturation at 94°C for 1 min, primer annealing at 55°C for 1 min, primer extension at 72°C for 2 min with a final extension step at 72°C for 10 min. PCR amplifications for RAPD were performed with initial denaturation at 94°C for 4 min and then 40 cycles of denaturation at 94°C for 30 s, primer annealing at 35°C for 1 min, primer extension at 72°C for 2 min and final extension step at 72°C for 7 min. PCR conditions used for SSR markers include initial denaturation at 94°C for 2 min and then 35 cycles of denaturation at 94°C for 30 s, primer annealing at 50–60°C for 30 s, primer extension at 72°C for 1 min and final extension step at 72°C for 10 min.

    Techniques: Polymerase Chain Reaction, Marker

    PCR profiles of parental genotypes along with interspecific recombinants using SSR marker VR062. ∗ Marker for recombination .

    Journal: Frontiers in Plant Science

    Article Title: Genetic Confirmation of Mungbean (Vigna radiata) and Mashbean (Vigna mungo) Interspecific Recombinants using Molecular Markers

    doi: 10.3389/fpls.2015.01107

    Figure Lengend Snippet: PCR profiles of parental genotypes along with interspecific recombinants using SSR marker VR062. ∗ Marker for recombination .

    Article Snippet: PCR amplifications for URP and SSR (RIS) markers were performed using thermal cycler (Bio RAD T-100, USA) with initial denaturation at 94°C for 3 min and then 40 cycles of denaturation at 94°C for 1 min, primer annealing at 55°C for 1 min, primer extension at 72°C for 2 min with a final extension step at 72°C for 10 min. PCR amplifications for RAPD were performed with initial denaturation at 94°C for 4 min and then 40 cycles of denaturation at 94°C for 30 s, primer annealing at 35°C for 1 min, primer extension at 72°C for 2 min and final extension step at 72°C for 7 min. PCR conditions used for SSR markers include initial denaturation at 94°C for 2 min and then 35 cycles of denaturation at 94°C for 30 s, primer annealing at 50–60°C for 30 s, primer extension at 72°C for 1 min and final extension step at 72°C for 10 min.

    Techniques: Polymerase Chain Reaction, Marker

    PCR profiles of parental genotypes using RIS-F (A) and RIS-R (B) marker .

    Journal: Frontiers in Plant Science

    Article Title: Genetic Confirmation of Mungbean (Vigna radiata) and Mashbean (Vigna mungo) Interspecific Recombinants using Molecular Markers

    doi: 10.3389/fpls.2015.01107

    Figure Lengend Snippet: PCR profiles of parental genotypes using RIS-F (A) and RIS-R (B) marker .

    Article Snippet: PCR amplifications for URP and SSR (RIS) markers were performed using thermal cycler (Bio RAD T-100, USA) with initial denaturation at 94°C for 3 min and then 40 cycles of denaturation at 94°C for 1 min, primer annealing at 55°C for 1 min, primer extension at 72°C for 2 min with a final extension step at 72°C for 10 min. PCR amplifications for RAPD were performed with initial denaturation at 94°C for 4 min and then 40 cycles of denaturation at 94°C for 30 s, primer annealing at 35°C for 1 min, primer extension at 72°C for 2 min and final extension step at 72°C for 7 min. PCR conditions used for SSR markers include initial denaturation at 94°C for 2 min and then 35 cycles of denaturation at 94°C for 30 s, primer annealing at 50–60°C for 30 s, primer extension at 72°C for 1 min and final extension step at 72°C for 10 min.

    Techniques: Polymerase Chain Reaction, Marker

    PCR profiles of parental genotypes along with interspecific recombinants using SSR marker VR0111. ∗ Marker for recombination .

    Journal: Frontiers in Plant Science

    Article Title: Genetic Confirmation of Mungbean (Vigna radiata) and Mashbean (Vigna mungo) Interspecific Recombinants using Molecular Markers

    doi: 10.3389/fpls.2015.01107

    Figure Lengend Snippet: PCR profiles of parental genotypes along with interspecific recombinants using SSR marker VR0111. ∗ Marker for recombination .

    Article Snippet: PCR amplifications for URP and SSR (RIS) markers were performed using thermal cycler (Bio RAD T-100, USA) with initial denaturation at 94°C for 3 min and then 40 cycles of denaturation at 94°C for 1 min, primer annealing at 55°C for 1 min, primer extension at 72°C for 2 min with a final extension step at 72°C for 10 min. PCR amplifications for RAPD were performed with initial denaturation at 94°C for 4 min and then 40 cycles of denaturation at 94°C for 30 s, primer annealing at 35°C for 1 min, primer extension at 72°C for 2 min and final extension step at 72°C for 7 min. PCR conditions used for SSR markers include initial denaturation at 94°C for 2 min and then 35 cycles of denaturation at 94°C for 30 s, primer annealing at 50–60°C for 30 s, primer extension at 72°C for 1 min and final extension step at 72°C for 10 min.

    Techniques: Polymerase Chain Reaction, Marker

    PCR profiles of parental genotypes along with interspecific recombinants using RIS-F. ∗ Marker for recombination .

    Journal: Frontiers in Plant Science

    Article Title: Genetic Confirmation of Mungbean (Vigna radiata) and Mashbean (Vigna mungo) Interspecific Recombinants using Molecular Markers

    doi: 10.3389/fpls.2015.01107

    Figure Lengend Snippet: PCR profiles of parental genotypes along with interspecific recombinants using RIS-F. ∗ Marker for recombination .

    Article Snippet: PCR amplifications for URP and SSR (RIS) markers were performed using thermal cycler (Bio RAD T-100, USA) with initial denaturation at 94°C for 3 min and then 40 cycles of denaturation at 94°C for 1 min, primer annealing at 55°C for 1 min, primer extension at 72°C for 2 min with a final extension step at 72°C for 10 min. PCR amplifications for RAPD were performed with initial denaturation at 94°C for 4 min and then 40 cycles of denaturation at 94°C for 30 s, primer annealing at 35°C for 1 min, primer extension at 72°C for 2 min and final extension step at 72°C for 7 min. PCR conditions used for SSR markers include initial denaturation at 94°C for 2 min and then 35 cycles of denaturation at 94°C for 30 s, primer annealing at 50–60°C for 30 s, primer extension at 72°C for 1 min and final extension step at 72°C for 10 min.

    Techniques: Polymerase Chain Reaction, Marker

    Amplification of M. Ieprae DNA from patient's blood using nested PCR.

    Journal: The American Journal of Tropical Medicine and Hygiene

    Article Title: Whole-Blood Nested-PCR Amplification of M. leprae-Specific DNA for Early Diagnosis of Leprosy

    doi: 10.4269/ajtmh.11-0253

    Figure Lengend Snippet: Amplification of M. Ieprae DNA from patient's blood using nested PCR.

    Article Snippet: PCR amplification of template DNA was carried out using a thermal cycler PTC 200 (MJ Research, Bio-Rad, Munich, Germany).

    Techniques: Amplification, Nested PCR

    Negative PCR products ( N = 10) spiked with 10 fg M. Ieprae DNA followed by nested PCR.

    Journal: The American Journal of Tropical Medicine and Hygiene

    Article Title: Whole-Blood Nested-PCR Amplification of M. leprae-Specific DNA for Early Diagnosis of Leprosy

    doi: 10.4269/ajtmh.11-0253

    Figure Lengend Snippet: Negative PCR products ( N = 10) spiked with 10 fg M. Ieprae DNA followed by nested PCR.

    Article Snippet: PCR amplification of template DNA was carried out using a thermal cycler PTC 200 (MJ Research, Bio-Rad, Munich, Germany).

    Techniques: Polymerase Chain Reaction, Nested PCR

    Sm proteins associate with mature mRNAs. (a) Meta-gene analysis of read density around splice sites for all Drosophila and human Sm-associated intron-containing mRNAs in all RIP-seq experiments. (b) Meta-gene analysis of read density along the gene length for all Drosophila Sm-associated mRNAs quantified from oligodT and random hexamer primed libraries. (c) Example tracks for read density along the gene length for oligodT and random hexamer primed libraries. (d) Poly(A) tail length Sm-associated mRNAs (CG3997, CG1349 and CG3776) and non-associated mRNA (RpS2) from Y12 IP in S2 cells. IN, input total RNA; IP, immunoprecipitated RNA. The labels denote the length of poly(A) tails. Oligo(dT) 20 was used as the reverse primer for the reverse transcription and subsequent PCR, therefore producing the ‘smear’ of poly(A) tail. See Figure S11 in Additional file 1 for analysis of poly(A) containing reads for selected Sm-associated mRNAs.

    Journal: Genome Biology

    Article Title: RIP-seq analysis of eukaryotic Sm proteins identifies three major categories of Sm-containing ribonucleoproteins

    doi: 10.1186/gb-2014-15-1-r7

    Figure Lengend Snippet: Sm proteins associate with mature mRNAs. (a) Meta-gene analysis of read density around splice sites for all Drosophila and human Sm-associated intron-containing mRNAs in all RIP-seq experiments. (b) Meta-gene analysis of read density along the gene length for all Drosophila Sm-associated mRNAs quantified from oligodT and random hexamer primed libraries. (c) Example tracks for read density along the gene length for oligodT and random hexamer primed libraries. (d) Poly(A) tail length Sm-associated mRNAs (CG3997, CG1349 and CG3776) and non-associated mRNA (RpS2) from Y12 IP in S2 cells. IN, input total RNA; IP, immunoprecipitated RNA. The labels denote the length of poly(A) tails. Oligo(dT) 20 was used as the reverse primer for the reverse transcription and subsequent PCR, therefore producing the ‘smear’ of poly(A) tail. See Figure S11 in Additional file 1 for analysis of poly(A) containing reads for selected Sm-associated mRNAs.

    Article Snippet: Immunoprecipitated RNA was reverse transcribed to cDNA, fragmented, ligated with adapters, PCR-amplified and sequenced on an Illumina Genome Analyzer II.

    Techniques: Random Hexamer Labeling, Immunoprecipitation, Polymerase Chain Reaction

    RNA-Sm association is cell type-specific and not due to re-assortment. (a) RIP-qRT-PCR in da-Gal4 VFP-SmD1 fly ovary (anti-GFP) and S2 cells (Y12). Negative controls (Ctrl) used are 5S rRNA, Act5C and Smt3. CG9042 (Gapdh) is used as the normalization standard. snRNAs are shown separately due to the difference in scale. (b) mRNAs associated with Sm proteins in ovaries but not in S2 cells are expressed in S2 cells. t -Test for significance between IP and Ctrl: * P

    Journal: Genome Biology

    Article Title: RIP-seq analysis of eukaryotic Sm proteins identifies three major categories of Sm-containing ribonucleoproteins

    doi: 10.1186/gb-2014-15-1-r7

    Figure Lengend Snippet: RNA-Sm association is cell type-specific and not due to re-assortment. (a) RIP-qRT-PCR in da-Gal4 VFP-SmD1 fly ovary (anti-GFP) and S2 cells (Y12). Negative controls (Ctrl) used are 5S rRNA, Act5C and Smt3. CG9042 (Gapdh) is used as the normalization standard. snRNAs are shown separately due to the difference in scale. (b) mRNAs associated with Sm proteins in ovaries but not in S2 cells are expressed in S2 cells. t -Test for significance between IP and Ctrl: * P

    Article Snippet: Immunoprecipitated RNA was reverse transcribed to cDNA, fragmented, ligated with adapters, PCR-amplified and sequenced on an Illumina Genome Analyzer II.

    Techniques: Quantitative RT-PCR

    U1 snRNP binds mature mRNAs. (a) Putative base pairs between the 5′ end of U1 snRNA and the CG3776 mRNA coding region (upper panel). Within the putative region of base pairing, three translationally silent point mutations were introduced (bold blue letters) to disrupt the helix (lower panel). (b) Cartoon of the S2 cell transfection construct, showing the CG3776 expression unit. CG3776endo and CG3776tag indicate locations of primers for qRT-PCR. CG3776endo amplifies both endogenous and transfected CG3776 mRNAs, whereas CG3776tag amplifies transfected CG3776 mRNA only. The black star indicates the location of the putative U1 binding site. (c) pAW vector, pAW-CG3776wt and pAW-CG3776mut were transfected into S2 cells, and CG3776wt and CG3776mut expression was measured using qRT-PCR with the CG3776endo primer pair. GAPDH was used as normalization standard. (d) After pAW-CG3776wt and pAW-CG3776mut were transfected, anti-Sm (Y12) IPs were performed using S2 cell lysate. GAPDH was used as normalization standard. (e) Proposed model of snRNP-mRNA interactions. Distinct snRNPs (U1 and potentially others) associate with mature mRNAs via base pairing and/or protein-mediated interaction. Such interactions could serve as a platform to recruit RNA processing factors that act on multiple levels of RNA metabolism. t -Test for significance between IP and control (Ctrl): * P

    Journal: Genome Biology

    Article Title: RIP-seq analysis of eukaryotic Sm proteins identifies three major categories of Sm-containing ribonucleoproteins

    doi: 10.1186/gb-2014-15-1-r7

    Figure Lengend Snippet: U1 snRNP binds mature mRNAs. (a) Putative base pairs between the 5′ end of U1 snRNA and the CG3776 mRNA coding region (upper panel). Within the putative region of base pairing, three translationally silent point mutations were introduced (bold blue letters) to disrupt the helix (lower panel). (b) Cartoon of the S2 cell transfection construct, showing the CG3776 expression unit. CG3776endo and CG3776tag indicate locations of primers for qRT-PCR. CG3776endo amplifies both endogenous and transfected CG3776 mRNAs, whereas CG3776tag amplifies transfected CG3776 mRNA only. The black star indicates the location of the putative U1 binding site. (c) pAW vector, pAW-CG3776wt and pAW-CG3776mut were transfected into S2 cells, and CG3776wt and CG3776mut expression was measured using qRT-PCR with the CG3776endo primer pair. GAPDH was used as normalization standard. (d) After pAW-CG3776wt and pAW-CG3776mut were transfected, anti-Sm (Y12) IPs were performed using S2 cell lysate. GAPDH was used as normalization standard. (e) Proposed model of snRNP-mRNA interactions. Distinct snRNPs (U1 and potentially others) associate with mature mRNAs via base pairing and/or protein-mediated interaction. Such interactions could serve as a platform to recruit RNA processing factors that act on multiple levels of RNA metabolism. t -Test for significance between IP and control (Ctrl): * P

    Article Snippet: Immunoprecipitated RNA was reverse transcribed to cDNA, fragmented, ligated with adapters, PCR-amplified and sequenced on an Illumina Genome Analyzer II.

    Techniques: Transfection, Construct, Expressing, Quantitative RT-PCR, Binding Assay, Plasmid Preparation, Activated Clotting Time Assay

    Real-time PCR quantitation of IGF2 and H19 mRNA transcripts. IGF2 , H19 , and the housekeeping β-actin genes were coamplified from each cDNA synthesized from normal tissue (human breast and skin), control, and decoy CTCF–expressing cells in MCF7 (A), HBF1, and WSF7 cells (B). IGF2 and H19 were quantitated in duplicate for each sample and were determined by a ΔCT and Δ2ΔCT calculation with reference to human β-actin gene control. IGF2 and H19 expression was normalized and presented as the number by using the IGF2 and H19 level in controls (white) as 1 (tissue, n = 6; control, n = 6; treatment, n = 6). *, P

    Journal: The Journal of Cell Biology

    Article Title: Interruption of intrachromosomal looping by CCCTC binding factor decoy proteins abrogates genomic imprinting of human insulin-like growth factor II

    doi: 10.1083/jcb.201101021

    Figure Lengend Snippet: Real-time PCR quantitation of IGF2 and H19 mRNA transcripts. IGF2 , H19 , and the housekeeping β-actin genes were coamplified from each cDNA synthesized from normal tissue (human breast and skin), control, and decoy CTCF–expressing cells in MCF7 (A), HBF1, and WSF7 cells (B). IGF2 and H19 were quantitated in duplicate for each sample and were determined by a ΔCT and Δ2ΔCT calculation with reference to human β-actin gene control. IGF2 and H19 expression was normalized and presented as the number by using the IGF2 and H19 level in controls (white) as 1 (tissue, n = 6; control, n = 6; treatment, n = 6). *, P

    Article Snippet: GST-CTCF constructs To construct recombinant GST fusion proteins, the various CTCF cDNA fragments (full-length CTCF, CTCF-NT, CTCF-ZF, CTCF-ZFCT, and CTCF-CT) were generated from template pOBT7-CTCF vector by PCR amplification containing BamHI–XhoI restriction enzyme ( Table S1 ) using pfu polymerase (Agilent Technologies) and were cloned into pGEX-4T-2 vector (Invitrogen).

    Techniques: Real-time Polymerase Chain Reaction, Quantitation Assay, Synthesized, Expressing

    Overexpression of the decoy CTCF abolishes the IGF2/H19 ICR binding of the endogenous CTCF. The expression of decoy CTCF was measured by RT-PCR (A and B), fluorescence microscopy (C), and Western blotting (D). Binding of endogenous CTCF and decoy CTCFs to the ICR was detected by ChIP using two antibodies that recognize the CT and ZF regions of CTCF, respectively (E and F, CTCF sites 1 and 3; and G, CTCF site 6). The competitive binding of native CTCF and ZF-EGFP to the sixth site was detected by a GFP antibody that specifically recognizes the ZF-EGFP and an antibody against the CTCF CT domain (H). Bars, 400 µm.

    Journal: The Journal of Cell Biology

    Article Title: Interruption of intrachromosomal looping by CCCTC binding factor decoy proteins abrogates genomic imprinting of human insulin-like growth factor II

    doi: 10.1083/jcb.201101021

    Figure Lengend Snippet: Overexpression of the decoy CTCF abolishes the IGF2/H19 ICR binding of the endogenous CTCF. The expression of decoy CTCF was measured by RT-PCR (A and B), fluorescence microscopy (C), and Western blotting (D). Binding of endogenous CTCF and decoy CTCFs to the ICR was detected by ChIP using two antibodies that recognize the CT and ZF regions of CTCF, respectively (E and F, CTCF sites 1 and 3; and G, CTCF site 6). The competitive binding of native CTCF and ZF-EGFP to the sixth site was detected by a GFP antibody that specifically recognizes the ZF-EGFP and an antibody against the CTCF CT domain (H). Bars, 400 µm.

    Article Snippet: GST-CTCF constructs To construct recombinant GST fusion proteins, the various CTCF cDNA fragments (full-length CTCF, CTCF-NT, CTCF-ZF, CTCF-ZFCT, and CTCF-CT) were generated from template pOBT7-CTCF vector by PCR amplification containing BamHI–XhoI restriction enzyme ( Table S1 ) using pfu polymerase (Agilent Technologies) and were cloned into pGEX-4T-2 vector (Invitrogen).

    Techniques: Over Expression, Binding Assay, Expressing, Reverse Transcription Polymerase Chain Reaction, Fluorescence, Microscopy, Western Blot, Chromatin Immunoprecipitation

    ChIP assays demonstrating protein binding at the IGF2 promoter region. (A) A schematic diagram of the IGF2/H19 imprinting domain. The exons are depicted as solid boxes. The bottom arrows mark the orientation of ChIP-specific primers. (B and C) Alteration of CTCF binding, SUZ12 interaction, and histone H3-K27 methylation across IGF2 promoters in decoy CTCF ZF-Sss1–expressing MCF7 breast tumor cells (B) and HBF1 fibroblasts (C). Cross-linked DNA–protein complexes were immunoprecipitated with antiserum against CTCF, SUZ12, or dimethyl-H3-K27 (mK27), followed by PCR amplification with specific primers for the IGF2 promoters (P1–P4). Input: genomic DNA collected before antibody precipitation.

    Journal: The Journal of Cell Biology

    Article Title: Interruption of intrachromosomal looping by CCCTC binding factor decoy proteins abrogates genomic imprinting of human insulin-like growth factor II

    doi: 10.1083/jcb.201101021

    Figure Lengend Snippet: ChIP assays demonstrating protein binding at the IGF2 promoter region. (A) A schematic diagram of the IGF2/H19 imprinting domain. The exons are depicted as solid boxes. The bottom arrows mark the orientation of ChIP-specific primers. (B and C) Alteration of CTCF binding, SUZ12 interaction, and histone H3-K27 methylation across IGF2 promoters in decoy CTCF ZF-Sss1–expressing MCF7 breast tumor cells (B) and HBF1 fibroblasts (C). Cross-linked DNA–protein complexes were immunoprecipitated with antiserum against CTCF, SUZ12, or dimethyl-H3-K27 (mK27), followed by PCR amplification with specific primers for the IGF2 promoters (P1–P4). Input: genomic DNA collected before antibody precipitation.

    Article Snippet: GST-CTCF constructs To construct recombinant GST fusion proteins, the various CTCF cDNA fragments (full-length CTCF, CTCF-NT, CTCF-ZF, CTCF-ZFCT, and CTCF-CT) were generated from template pOBT7-CTCF vector by PCR amplification containing BamHI–XhoI restriction enzyme ( Table S1 ) using pfu polymerase (Agilent Technologies) and were cloned into pGEX-4T-2 vector (Invitrogen).

    Techniques: Chromatin Immunoprecipitation, Protein Binding, Binding Assay, Methylation, Expressing, Immunoprecipitation, Polymerase Chain Reaction, Amplification

    Comparison of Pcdhb1 and Pcdh7 expression in cortical tissues from wild-type and Mecp2 -null mice . Total RNA was extracted from the Mecp2 -null and wild-type mice at postnatal day 14 (P14) and cDNA was synthesized with random primers. The expression levels of Mecp2 (A), Pcdhb1 (B) and Pcdh7 (C) were examined by qRT-PCR and normalized using the expression level of Gapdh. All results are shown as the mean ± SEM of three replicates with the mean Control normalized to 1.0.

    Journal: BMC Neuroscience

    Article Title: The protocadherins, PCDHB1 and PCDH7, are regulated by MeCP2 in neuronal cells and brain tissues: implication for pathogenesis of Rett syndrome

    doi: 10.1186/1471-2202-12-81

    Figure Lengend Snippet: Comparison of Pcdhb1 and Pcdh7 expression in cortical tissues from wild-type and Mecp2 -null mice . Total RNA was extracted from the Mecp2 -null and wild-type mice at postnatal day 14 (P14) and cDNA was synthesized with random primers. The expression levels of Mecp2 (A), Pcdhb1 (B) and Pcdh7 (C) were examined by qRT-PCR and normalized using the expression level of Gapdh. All results are shown as the mean ± SEM of three replicates with the mean Control normalized to 1.0.

    Article Snippet: MECP2 cDNA lacking the methyl-binding domain (MBD) was made by PCR amplification using KOD-Plus-Mutagenesis Kit (Toyobo, Osaka, Japan).

    Techniques: Expressing, Mouse Assay, Synthesized, Quantitative RT-PCR

    Mapping the methylation status of the PCDHB1 (A) and PCDH7 (B) regions in SH-SY5Y cells by bisulfite genomic DNA sequencing . The top diagram depicts the 5' flanking region of each gene with its transcription start site. CpG island regions are shown as gray areas. Methylated-CpG sites are shown as closed circles and unmethylated CpG sites as open circles. The triangles represent the CpG sites with A/T bases ([A/T] > 4 ) located 1-3 or 6-9 base pairs from the CpG sites, indicating the putative MeCP2-binding sequences. Arrows at the bottom indicate the region that was amplified for ChIP-PCR. (A) 5' flanking region of the PCDHB1 gene. (B) 5' flanking region of the PCDH7 gene.

    Journal: BMC Neuroscience

    Article Title: The protocadherins, PCDHB1 and PCDH7, are regulated by MeCP2 in neuronal cells and brain tissues: implication for pathogenesis of Rett syndrome

    doi: 10.1186/1471-2202-12-81

    Figure Lengend Snippet: Mapping the methylation status of the PCDHB1 (A) and PCDH7 (B) regions in SH-SY5Y cells by bisulfite genomic DNA sequencing . The top diagram depicts the 5' flanking region of each gene with its transcription start site. CpG island regions are shown as gray areas. Methylated-CpG sites are shown as closed circles and unmethylated CpG sites as open circles. The triangles represent the CpG sites with A/T bases ([A/T] > 4 ) located 1-3 or 6-9 base pairs from the CpG sites, indicating the putative MeCP2-binding sequences. Arrows at the bottom indicate the region that was amplified for ChIP-PCR. (A) 5' flanking region of the PCDHB1 gene. (B) 5' flanking region of the PCDH7 gene.

    Article Snippet: MECP2 cDNA lacking the methyl-binding domain (MBD) was made by PCR amplification using KOD-Plus-Mutagenesis Kit (Toyobo, Osaka, Japan).

    Techniques: Methylation, DNA Sequencing, Binding Assay, Amplification, Chromatin Immunoprecipitation, Polymerase Chain Reaction

    Expression of PCDHB1 and PCDH7 by RNAi-mediated knockdown of MECP2 in SH-SY5Y cells . SH-SY5Y cells were transfected with MECP2 -siRNA or Scramble siRNA (Control) for 24 h. The expression level of MECP2 (A), PCDHB1 (B) and PCDH7 (C) were examined by qRT-PCR and normalized using the expression level of GAPDH. All results are shown as the mean ± SEM of three replicates with the mean Control normalized to 1.0.

    Journal: BMC Neuroscience

    Article Title: The protocadherins, PCDHB1 and PCDH7, are regulated by MeCP2 in neuronal cells and brain tissues: implication for pathogenesis of Rett syndrome

    doi: 10.1186/1471-2202-12-81

    Figure Lengend Snippet: Expression of PCDHB1 and PCDH7 by RNAi-mediated knockdown of MECP2 in SH-SY5Y cells . SH-SY5Y cells were transfected with MECP2 -siRNA or Scramble siRNA (Control) for 24 h. The expression level of MECP2 (A), PCDHB1 (B) and PCDH7 (C) were examined by qRT-PCR and normalized using the expression level of GAPDH. All results are shown as the mean ± SEM of three replicates with the mean Control normalized to 1.0.

    Article Snippet: MECP2 cDNA lacking the methyl-binding domain (MBD) was made by PCR amplification using KOD-Plus-Mutagenesis Kit (Toyobo, Osaka, Japan).

    Techniques: Expressing, Transfection, Quantitative RT-PCR

    MeCP2 binds to the promoter region of two target genes in SH-SY5Y cells . Immunoprecipitation (IP) was performed using an anti-MeCP2 antibody or normal rabbit serum (NRS) as negative control. Equal amounts of precleared chromatin were processed without IP as total input control. The purified DNA was amplified by PCR using primers located within the 1.0 kb upstream genomic regions from the transcriptional start sites of the APBB3, PCDHB1, or PCDH7 genes. SNURF/SNRPN was used as a positive control for a promoter previously demonstrated to bind MeCP2. GAPDH was used as a negative control.

    Journal: BMC Neuroscience

    Article Title: The protocadherins, PCDHB1 and PCDH7, are regulated by MeCP2 in neuronal cells and brain tissues: implication for pathogenesis of Rett syndrome

    doi: 10.1186/1471-2202-12-81

    Figure Lengend Snippet: MeCP2 binds to the promoter region of two target genes in SH-SY5Y cells . Immunoprecipitation (IP) was performed using an anti-MeCP2 antibody or normal rabbit serum (NRS) as negative control. Equal amounts of precleared chromatin were processed without IP as total input control. The purified DNA was amplified by PCR using primers located within the 1.0 kb upstream genomic regions from the transcriptional start sites of the APBB3, PCDHB1, or PCDH7 genes. SNURF/SNRPN was used as a positive control for a promoter previously demonstrated to bind MeCP2. GAPDH was used as a negative control.

    Article Snippet: MECP2 cDNA lacking the methyl-binding domain (MBD) was made by PCR amplification using KOD-Plus-Mutagenesis Kit (Toyobo, Osaka, Japan).

    Techniques: Immunoprecipitation, Negative Control, Purification, Amplification, Polymerase Chain Reaction, Positive Control

    DNA separation and size identification. We used a reference signal with a DNA ladder in the upper channel and conveyed the analyte in the bottom channel. During calibration, we analyzed amplicons from non-repetitive sequences originating from plasmid DNA (45 cycles of PCR). ( A ) A fluorescence micrograph showing the two channels after concentration and separation during 30 s using a target sample with three fragments of 466, 798 and 1512 bp at 80 pg µL −1 . Actuation parameters are set to 6 bar and 82 V, corresponding to maximal flow velocity and electric field of ~7.1 cm s −1 and 6.9 MV m −1 , respectively. ( B ) The two plots represent the intensity profile along the two arrows represented in panel ( B ). The raw data is in black and the corresponding fits with Gaussian functions in blue and red. Based on the position of the center of each Gaussian peak in the ladder (top), we assign the size of the three bands in the sample by linear interpolation. More complex interpolation functions did not have a significant impact on accuracy of size determination. ( C ) The same experiment as in panel ( A ) with six bands of a kb ladder, and two bands of 1091 and 3314 bp diluted a concentration of 100 pg μL −1 . Actuation parameters are set to 1 bar and 50 V. The results were obtained after 1 min of enrichment. ( D ) The two plots correspond to the fluorescence intensity distribution along the symmetry line of the two channels with the corresponding Gaussian fits. The scale bars correspond to 300 µm in ( A ) and 400 µm in ( C ).

    Journal: Scientific Reports

    Article Title: µLAS: Sizing of expanded trinucleotide repeats with femtomolar sensitivity in less than 5 minutes

    doi: 10.1038/s41598-018-36632-5

    Figure Lengend Snippet: DNA separation and size identification. We used a reference signal with a DNA ladder in the upper channel and conveyed the analyte in the bottom channel. During calibration, we analyzed amplicons from non-repetitive sequences originating from plasmid DNA (45 cycles of PCR). ( A ) A fluorescence micrograph showing the two channels after concentration and separation during 30 s using a target sample with three fragments of 466, 798 and 1512 bp at 80 pg µL −1 . Actuation parameters are set to 6 bar and 82 V, corresponding to maximal flow velocity and electric field of ~7.1 cm s −1 and 6.9 MV m −1 , respectively. ( B ) The two plots represent the intensity profile along the two arrows represented in panel ( B ). The raw data is in black and the corresponding fits with Gaussian functions in blue and red. Based on the position of the center of each Gaussian peak in the ladder (top), we assign the size of the three bands in the sample by linear interpolation. More complex interpolation functions did not have a significant impact on accuracy of size determination. ( C ) The same experiment as in panel ( A ) with six bands of a kb ladder, and two bands of 1091 and 3314 bp diluted a concentration of 100 pg μL −1 . Actuation parameters are set to 1 bar and 50 V. The results were obtained after 1 min of enrichment. ( D ) The two plots correspond to the fluorescence intensity distribution along the symmetry line of the two channels with the corresponding Gaussian fits. The scale bars correspond to 300 µm in ( A ) and 400 µm in ( C ).

    Article Snippet: PCR amplification and DNA templates The PCR amplification for the HD and GFP(CAG)x samples was done with five units of MangoTaq DNA polymerase (Bioline) using 100 ng of genomic DNA (equivalently 30,000 allele copies) in the supplied buffer supplemented with 1 mM MgCl2 , 200 µM dNTP, 0.5 µM of each primer, and 3% DMSO.

    Techniques: Plasmid Preparation, Polymerase Chain Reaction, Fluorescence, Concentration Assay, Flow Cytometry

    Analysis of PCR amplification from genomic DNA of a patient with 18 and 60 CAG repeats. Amplicons obtained after 20, 25, 35, and 45 PCR cycles are conveyed in the microfluidic channel using a constriction with a parabolic profile and actuation parameters of 2 bar and 130 V, corresponding to ~5.7 cm s −1 and 1.52 MV m −1 for the maximum flow velocity and electric field, respectively. Each panel shows the fluorescence micrographs. The corresponding intensity profiles along the symmetry line of the channel are shown in Supplementary Fig. S4 . ( A ) 100 bp MW ladder after 30 s of concentration. ( B ) 20 cycles of PCR after 30 s of concentration. ( C ) 20 cycles of PCR after 100 s of concentration. ( D ) 25 cycles of PCR after 30 s of concentration. ( E ) 35 cycles of PCR after 30 s of concentration. ( F ) 45 cycles of PCR after 30 s of concentration. The vertical blue lines in the plots in Supplementary Fig. S4 are the positions of the bands of the ladder, as inferred from Gaussian fitting of the data in (Supplementary Fig. S4A ). The scale bars correspond to 200 µm.

    Journal: Scientific Reports

    Article Title: µLAS: Sizing of expanded trinucleotide repeats with femtomolar sensitivity in less than 5 minutes

    doi: 10.1038/s41598-018-36632-5

    Figure Lengend Snippet: Analysis of PCR amplification from genomic DNA of a patient with 18 and 60 CAG repeats. Amplicons obtained after 20, 25, 35, and 45 PCR cycles are conveyed in the microfluidic channel using a constriction with a parabolic profile and actuation parameters of 2 bar and 130 V, corresponding to ~5.7 cm s −1 and 1.52 MV m −1 for the maximum flow velocity and electric field, respectively. Each panel shows the fluorescence micrographs. The corresponding intensity profiles along the symmetry line of the channel are shown in Supplementary Fig. S4 . ( A ) 100 bp MW ladder after 30 s of concentration. ( B ) 20 cycles of PCR after 30 s of concentration. ( C ) 20 cycles of PCR after 100 s of concentration. ( D ) 25 cycles of PCR after 30 s of concentration. ( E ) 35 cycles of PCR after 30 s of concentration. ( F ) 45 cycles of PCR after 30 s of concentration. The vertical blue lines in the plots in Supplementary Fig. S4 are the positions of the bands of the ladder, as inferred from Gaussian fitting of the data in (Supplementary Fig. S4A ). The scale bars correspond to 200 µm.

    Article Snippet: PCR amplification and DNA templates The PCR amplification for the HD and GFP(CAG)x samples was done with five units of MangoTaq DNA polymerase (Bioline) using 100 ng of genomic DNA (equivalently 30,000 allele copies) in the supplied buffer supplemented with 1 mM MgCl2 , 200 µM dNTP, 0.5 µM of each primer, and 3% DMSO.

    Techniques: Polymerase Chain Reaction, Amplification, Flow Cytometry, Fluorescence, Concentration Assay

    Measuring CAG repeat expansions in GFP(CAG) x cell lines. ( A ) Four samples containing 15 to 270 CAGs after 35 PCR cycles run on a 1% TAE agarose gel. The samples are pools of three reactions. ( B ) The four samples amplified using 25 PCR cycles were mixed together and processed during 30 s in our microfluidic platform. The scale bar corresponds to 300 µm.

    Journal: Scientific Reports

    Article Title: µLAS: Sizing of expanded trinucleotide repeats with femtomolar sensitivity in less than 5 minutes

    doi: 10.1038/s41598-018-36632-5

    Figure Lengend Snippet: Measuring CAG repeat expansions in GFP(CAG) x cell lines. ( A ) Four samples containing 15 to 270 CAGs after 35 PCR cycles run on a 1% TAE agarose gel. The samples are pools of three reactions. ( B ) The four samples amplified using 25 PCR cycles were mixed together and processed during 30 s in our microfluidic platform. The scale bar corresponds to 300 µm.

    Article Snippet: PCR amplification and DNA templates The PCR amplification for the HD and GFP(CAG)x samples was done with five units of MangoTaq DNA polymerase (Bioline) using 100 ng of genomic DNA (equivalently 30,000 allele copies) in the supplied buffer supplemented with 1 mM MgCl2 , 200 µM dNTP, 0.5 µM of each primer, and 3% DMSO.

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Amplification

    miR-450b-5p directly targets SIAH1 and SFRP2 A. Predicted miR-450b-5p target sequences in the 3′-UTR of SIAH1 (SIAH1-3′UTR-WT) and SFRP2 (SFRP2-3′UTR-WT), and sequences with mutated nucleotides (SIAH1-3′UTR-MUT and SFRP2-3′UTR-MUT). B. Real-time PCR analysis of SIAH1 and SFRP2 expression, normalized by GAPDH. C. Western blotting analysis of SIAH1 and SFRP1 in indicated cells. D. Western blotting analyses of GFP proteins in indicated cells. α-Tubulin served as loading control. E. Luciferase activity analysis of indicated cells transfused with indicated reporters of a different amount of miR-450b-5p (20 and 50 nM). Data were presented in mean ± SD of three independent experiments. * p

    Journal: Oncotarget

    Article Title: miR-450b-5p induced by oncogenic KRAS is required for colorectal cancer progression

    doi: 10.18632/oncotarget.11016

    Figure Lengend Snippet: miR-450b-5p directly targets SIAH1 and SFRP2 A. Predicted miR-450b-5p target sequences in the 3′-UTR of SIAH1 (SIAH1-3′UTR-WT) and SFRP2 (SFRP2-3′UTR-WT), and sequences with mutated nucleotides (SIAH1-3′UTR-MUT and SFRP2-3′UTR-MUT). B. Real-time PCR analysis of SIAH1 and SFRP2 expression, normalized by GAPDH. C. Western blotting analysis of SIAH1 and SFRP1 in indicated cells. D. Western blotting analyses of GFP proteins in indicated cells. α-Tubulin served as loading control. E. Luciferase activity analysis of indicated cells transfused with indicated reporters of a different amount of miR-450b-5p (20 and 50 nM). Data were presented in mean ± SD of three independent experiments. * p

    Article Snippet: Plasmids and transfection To construct the plasmid that overexpresses mir-450b-5p, a 78bp fragment of pri-mir-450b-5p was PCR-amplified, then generated into the lentiviral vector pLVTHM (Addgene Inc., Cambridge, MA, USA).

    Techniques: Real-time Polymerase Chain Reaction, Expressing, Western Blot, Luciferase, Activity Assay

    KRAS signaling enhances miR-450b-5p expression in CRC A. Real-time PCR analyses of miR-450b-5p expression in CRC samples with wild-type KRAS (n=52) and CRC samples with mutant-KRAS (n=31). B. Real-time PCR analyses of miR-450b-5p expression and western blotting analyses of KRAS expression in indicated CRC cell lines with different KRAS types. C, D. Real-time PCR analyses of miR-450b-5p expression and western blotting analyses of KRAS and its downstream genes expression in indicated cells transfected with mutant KRAS G12D or treated with KRAS G12D -siRNA. E. Chromatin immunoprecipitation assay (CHIP) for detection of c-FOS binding site on the promoter of miR-450b-5p. F. Luciferase activity analyses of c-FOS on promoter activity of miR-450b-5p transfected with wild-type and mutated-type reporter vector.

    Journal: Oncotarget

    Article Title: miR-450b-5p induced by oncogenic KRAS is required for colorectal cancer progression

    doi: 10.18632/oncotarget.11016

    Figure Lengend Snippet: KRAS signaling enhances miR-450b-5p expression in CRC A. Real-time PCR analyses of miR-450b-5p expression in CRC samples with wild-type KRAS (n=52) and CRC samples with mutant-KRAS (n=31). B. Real-time PCR analyses of miR-450b-5p expression and western blotting analyses of KRAS expression in indicated CRC cell lines with different KRAS types. C, D. Real-time PCR analyses of miR-450b-5p expression and western blotting analyses of KRAS and its downstream genes expression in indicated cells transfected with mutant KRAS G12D or treated with KRAS G12D -siRNA. E. Chromatin immunoprecipitation assay (CHIP) for detection of c-FOS binding site on the promoter of miR-450b-5p. F. Luciferase activity analyses of c-FOS on promoter activity of miR-450b-5p transfected with wild-type and mutated-type reporter vector.

    Article Snippet: Plasmids and transfection To construct the plasmid that overexpresses mir-450b-5p, a 78bp fragment of pri-mir-450b-5p was PCR-amplified, then generated into the lentiviral vector pLVTHM (Addgene Inc., Cambridge, MA, USA).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Mutagenesis, Western Blot, Transfection, Chromatin Immunoprecipitation, Binding Assay, Luciferase, Activity Assay, Plasmid Preparation

    miR-450b-5p activates Wnt signaling pathway in CRC A. GO enrichment and KEGG enrichment of pathways involving predicted miR-450b-5p targeting genes. B. The Wnt signaling luciferase reporter assay of indicated cells transfected with miR-450b-5p and miR-450b-5p-inhibitor. C. Western blotting assay for β-Catenin in cytoplasm and nucleus of indicated cells transfected with control, miR-450b-5p and miR-450b-5p-inhibitor. LamB1 and a-tubulin served as loading controls for nucleus and cytoplasm proteins, respectively. D. Western blot analysis in indicated cells of protein products of Wnt signaling pathway downstream genes. E. Q-PCR analysis in indicated cells of protein products of Wnt signaling pathway downstream genes.* p

    Journal: Oncotarget

    Article Title: miR-450b-5p induced by oncogenic KRAS is required for colorectal cancer progression

    doi: 10.18632/oncotarget.11016

    Figure Lengend Snippet: miR-450b-5p activates Wnt signaling pathway in CRC A. GO enrichment and KEGG enrichment of pathways involving predicted miR-450b-5p targeting genes. B. The Wnt signaling luciferase reporter assay of indicated cells transfected with miR-450b-5p and miR-450b-5p-inhibitor. C. Western blotting assay for β-Catenin in cytoplasm and nucleus of indicated cells transfected with control, miR-450b-5p and miR-450b-5p-inhibitor. LamB1 and a-tubulin served as loading controls for nucleus and cytoplasm proteins, respectively. D. Western blot analysis in indicated cells of protein products of Wnt signaling pathway downstream genes. E. Q-PCR analysis in indicated cells of protein products of Wnt signaling pathway downstream genes.* p

    Article Snippet: Plasmids and transfection To construct the plasmid that overexpresses mir-450b-5p, a 78bp fragment of pri-mir-450b-5p was PCR-amplified, then generated into the lentiviral vector pLVTHM (Addgene Inc., Cambridge, MA, USA).

    Techniques: Luciferase, Reporter Assay, Transfection, Western Blot, Polymerase Chain Reaction

    Repression of SIAH1 and SFRP2 inhibits the CRC progression induced by miR-450b-5p, and the clinical relevance of miR-450b-5p and its targets in CRC A. Western blotting and Real-time PCR analyses of SIAH1 and SFRP2 exogenous expression. B. MTT assays on indicated cells. The OD values (450 nm) of cells at day 7 were analyzed; C. Flow-cytometry of an apoptosis assay on indicated cells. Annexin-positive/PI-negative cells were calculated for apoptotic rate. D. Real-time PCR analyses of SFRP2, miR-450b-5p, and SIAH1 expression in 10 fresh human CRC samples. E. Spearman correlation analyses on relative expression of miR-450b-5p and relative expression of SIAH1 and SFRP2 in 10 fresh human CRC samples. F. Proposed model: miR450b-5p is increased by mutated KRAS through AP-1 binding to its promoter, and then down-regulates SIAH1 and SFRP2, finally activating Wnt signaling pathway. Error bars represent mean ± SD from three independent experiments, * p

    Journal: Oncotarget

    Article Title: miR-450b-5p induced by oncogenic KRAS is required for colorectal cancer progression

    doi: 10.18632/oncotarget.11016

    Figure Lengend Snippet: Repression of SIAH1 and SFRP2 inhibits the CRC progression induced by miR-450b-5p, and the clinical relevance of miR-450b-5p and its targets in CRC A. Western blotting and Real-time PCR analyses of SIAH1 and SFRP2 exogenous expression. B. MTT assays on indicated cells. The OD values (450 nm) of cells at day 7 were analyzed; C. Flow-cytometry of an apoptosis assay on indicated cells. Annexin-positive/PI-negative cells were calculated for apoptotic rate. D. Real-time PCR analyses of SFRP2, miR-450b-5p, and SIAH1 expression in 10 fresh human CRC samples. E. Spearman correlation analyses on relative expression of miR-450b-5p and relative expression of SIAH1 and SFRP2 in 10 fresh human CRC samples. F. Proposed model: miR450b-5p is increased by mutated KRAS through AP-1 binding to its promoter, and then down-regulates SIAH1 and SFRP2, finally activating Wnt signaling pathway. Error bars represent mean ± SD from three independent experiments, * p

    Article Snippet: Plasmids and transfection To construct the plasmid that overexpresses mir-450b-5p, a 78bp fragment of pri-mir-450b-5p was PCR-amplified, then generated into the lentiviral vector pLVTHM (Addgene Inc., Cambridge, MA, USA).

    Techniques: Western Blot, Real-time Polymerase Chain Reaction, Expressing, MTT Assay, Flow Cytometry, Cytometry, Apoptosis Assay, Binding Assay

    Overexpression of miR-miR-450b-5p correlates with CRC progression Real-time PCR analyses of miR-450b-5p in 10 normal intestine epithelial tissues (normal) and 170 CRC tissues (tumor), normalized by U6 expression. Boundaries of boxes represent bounding of the boxes stand for the lower and upper quartile. Lines within the boxes and whiskers represent median and extremum. A. Mean expression of miR-450b-5p in normal tissues (normal) and CRC tissues (tumor). B. Expression of miR-450b-5p in different T classification (T1-T4) of CRC compared with 10 normal intestine tissues. C. Expression of miR450b-5p in different N classification (N0-N2) of CRC. D. Expression of miR-450b-5p in different distant metastasis stage of CRC. E. Overall survival and disease-free survival time curves analyzed by Kaplan-Meier of patients with high (≥median; n=85) or low miR-450b-5p (

    Journal: Oncotarget

    Article Title: miR-450b-5p induced by oncogenic KRAS is required for colorectal cancer progression

    doi: 10.18632/oncotarget.11016

    Figure Lengend Snippet: Overexpression of miR-miR-450b-5p correlates with CRC progression Real-time PCR analyses of miR-450b-5p in 10 normal intestine epithelial tissues (normal) and 170 CRC tissues (tumor), normalized by U6 expression. Boundaries of boxes represent bounding of the boxes stand for the lower and upper quartile. Lines within the boxes and whiskers represent median and extremum. A. Mean expression of miR-450b-5p in normal tissues (normal) and CRC tissues (tumor). B. Expression of miR-450b-5p in different T classification (T1-T4) of CRC compared with 10 normal intestine tissues. C. Expression of miR450b-5p in different N classification (N0-N2) of CRC. D. Expression of miR-450b-5p in different distant metastasis stage of CRC. E. Overall survival and disease-free survival time curves analyzed by Kaplan-Meier of patients with high (≥median; n=85) or low miR-450b-5p (

    Article Snippet: Plasmids and transfection To construct the plasmid that overexpresses mir-450b-5p, a 78bp fragment of pri-mir-450b-5p was PCR-amplified, then generated into the lentiviral vector pLVTHM (Addgene Inc., Cambridge, MA, USA).

    Techniques: Over Expression, Real-time Polymerase Chain Reaction, Expressing

    Constructs for plastid and nuclear transformations. ( a ) Construct for plastid transformation. lacO DNA (1 or ∼2.5 kb; dashed lines) was inserted between the HindIII and SmaI restriction sites into a polylinker in the unique Bsu36I site ( 31 ) of pZS197 ( 30 ). P rrn , plastid rrn promoter driving the aadA gene conferring resistance to spectinomycin; T psbA , terminator region from plastid psbA . Plastid rbcL and accD sequences are used for recombination into the plastid genome; their direction of transcription is shown by the arrowheads. The EcoRV restriction site was destroyed in the production of pZS197 but is restored in transplastomic plants. 1: position of 1.24 kb probe used in Southern DNA analysis. 2: position of the rbcL primer used to determine the size of the lacO insert in (b); 3: position of the forward and reverse primers used to analyse immunoprecipitated DNA for the presence of lacO . ( b ) PCR analysis of leaf DNA from transplastomic lacO lines. Lanes 1–4 and 5–8, putative transplastomic lines containing lacO constructs with 1 or ∼2.5 kb lacO DNA, respectively. Lane 9, no-template negative control. Lane 10, positive control, PCR on plasmid containing 1 kb lacO. Marker sizes are shown on the left. Primers were used to amplify a region extending from rbcL to accD and were expected to give band sizes of 2.6 or ∼4.0 kb with 1 kb or ∼2.5 kb of lacO , respectively. ( c ) Southern blot analysis of transplastomic tobacco lines, regenerated following bombardment with a plasmid containing ∼2.5 kb lacO repeat sequence. Total leaf DNA (0.3 µg) was cut with EcoRV and SacII and probed with a 32 P-labelled 1.24 kb BamHI fragment from rbcL [see (a) above]. Lanes 1–6, putative transplastomic lines. WT, ‘Petite Havana’ wild-type. Band sizes are shown on the left. ( d , e ) Constructs for nuclear transformation containing the CaMV 35S promoter and nos terminator in pBIN19 ( 32 ). (d) gfp-lacI DNA was inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and SacI restriction sites. (e) lacI-gfp has been inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and StuI restriction sites.

    Journal: Nucleic Acids Research

    Article Title: Binding of lac repressor-GFP fusion protein to lac operator sites inserted in the tobacco chloroplast genome examined by chromatin immunoprecipitation

    doi: 10.1093/nar/gkq413

    Figure Lengend Snippet: Constructs for plastid and nuclear transformations. ( a ) Construct for plastid transformation. lacO DNA (1 or ∼2.5 kb; dashed lines) was inserted between the HindIII and SmaI restriction sites into a polylinker in the unique Bsu36I site ( 31 ) of pZS197 ( 30 ). P rrn , plastid rrn promoter driving the aadA gene conferring resistance to spectinomycin; T psbA , terminator region from plastid psbA . Plastid rbcL and accD sequences are used for recombination into the plastid genome; their direction of transcription is shown by the arrowheads. The EcoRV restriction site was destroyed in the production of pZS197 but is restored in transplastomic plants. 1: position of 1.24 kb probe used in Southern DNA analysis. 2: position of the rbcL primer used to determine the size of the lacO insert in (b); 3: position of the forward and reverse primers used to analyse immunoprecipitated DNA for the presence of lacO . ( b ) PCR analysis of leaf DNA from transplastomic lacO lines. Lanes 1–4 and 5–8, putative transplastomic lines containing lacO constructs with 1 or ∼2.5 kb lacO DNA, respectively. Lane 9, no-template negative control. Lane 10, positive control, PCR on plasmid containing 1 kb lacO. Marker sizes are shown on the left. Primers were used to amplify a region extending from rbcL to accD and were expected to give band sizes of 2.6 or ∼4.0 kb with 1 kb or ∼2.5 kb of lacO , respectively. ( c ) Southern blot analysis of transplastomic tobacco lines, regenerated following bombardment with a plasmid containing ∼2.5 kb lacO repeat sequence. Total leaf DNA (0.3 µg) was cut with EcoRV and SacII and probed with a 32 P-labelled 1.24 kb BamHI fragment from rbcL [see (a) above]. Lanes 1–6, putative transplastomic lines. WT, ‘Petite Havana’ wild-type. Band sizes are shown on the left. ( d , e ) Constructs for nuclear transformation containing the CaMV 35S promoter and nos terminator in pBIN19 ( 32 ). (d) gfp-lacI DNA was inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and SacI restriction sites. (e) lacI-gfp has been inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and StuI restriction sites.

    Article Snippet: For the gfp-lacI construct, the lacI coding sequence ( ) was PCR-amplified from E. coli XL1-Blue (Stratagene, http://www.stratagene.com ) using forward (5′-ACG GGATCC GTGAAACCAGTAACGTTATACGATGTC) and reverse (5′-TTATAA GAGCTC TCACTGCCCGCTTTCCAGTCGGG) primers, introducing a stop codon and inserting BamHI and SacI restriction sites (underlined) at the 5′- and 3′-ends, respectively.

    Techniques: Construct, Transformation Assay, Immunoprecipitation, Polymerase Chain Reaction, Negative Control, Positive Control, Plasmid Preparation, Marker, Southern Blot, Sequencing

    Binding of GFP-LacI to chloroplast-located lacO sequences. ( a ) PCR analysis of immunoprecipitated chloroplast DNA. Immunoprecipitation was carried out with the following treatments: antibody to A. thaliana TTG1, antibody to GFP or no antibody. Total DNA was extracted from a fraction of the chloroplast lysate that did not undergo immunoprecipitation. Control reactions for PCR included genomic DNA isolated from a transplastomic lacO line (+) and water (−). M, DNA size markers. (a) Binding of GFP-LacI to lacO. Primers were used to amplify a 409-bp sequence, which includes plastid-localized lacO (marked as position 3 in Figure 1(a). Experimental lines are listed on the left. Treatments shown in the left half of the panel were carried out following formaldehyde cross-linking, those on the right were not subjected to formaldehyde cross-linking. ( b ) Effect of IPTG on binding of GFP-LacI to lacO. PCR analysis of immunoprecipitated chloroplast DNA from lacO /GFP-LacI lines, using primers to amplify a 409-bp fragment encompassing lacO and a 396-bp fragment from atpBE (shown on left side). Treatments shown in the left half of the panel were carried out in the absence of IPTG, those in the right half were carried out in the presence of 20 mM IPTG.

    Journal: Nucleic Acids Research

    Article Title: Binding of lac repressor-GFP fusion protein to lac operator sites inserted in the tobacco chloroplast genome examined by chromatin immunoprecipitation

    doi: 10.1093/nar/gkq413

    Figure Lengend Snippet: Binding of GFP-LacI to chloroplast-located lacO sequences. ( a ) PCR analysis of immunoprecipitated chloroplast DNA. Immunoprecipitation was carried out with the following treatments: antibody to A. thaliana TTG1, antibody to GFP or no antibody. Total DNA was extracted from a fraction of the chloroplast lysate that did not undergo immunoprecipitation. Control reactions for PCR included genomic DNA isolated from a transplastomic lacO line (+) and water (−). M, DNA size markers. (a) Binding of GFP-LacI to lacO. Primers were used to amplify a 409-bp sequence, which includes plastid-localized lacO (marked as position 3 in Figure 1(a). Experimental lines are listed on the left. Treatments shown in the left half of the panel were carried out following formaldehyde cross-linking, those on the right were not subjected to formaldehyde cross-linking. ( b ) Effect of IPTG on binding of GFP-LacI to lacO. PCR analysis of immunoprecipitated chloroplast DNA from lacO /GFP-LacI lines, using primers to amplify a 409-bp fragment encompassing lacO and a 396-bp fragment from atpBE (shown on left side). Treatments shown in the left half of the panel were carried out in the absence of IPTG, those in the right half were carried out in the presence of 20 mM IPTG.

    Article Snippet: For the gfp-lacI construct, the lacI coding sequence ( ) was PCR-amplified from E. coli XL1-Blue (Stratagene, http://www.stratagene.com ) using forward (5′-ACG GGATCC GTGAAACCAGTAACGTTATACGATGTC) and reverse (5′-TTATAA GAGCTC TCACTGCCCGCTTTCCAGTCGGG) primers, introducing a stop codon and inserting BamHI and SacI restriction sites (underlined) at the 5′- and 3′-ends, respectively.

    Techniques: Binding Assay, Polymerase Chain Reaction, Immunoprecipitation, Isolation, Sequencing

    Binding of GFP-LacI to chloroplast sequences. Experimental lines are listed on the left; treatments shown in the left half of the panels were carried out following a formaldehyde cross-linking step, those on the right were not subjected to cross-linking. ( a ) PCR analysis of immunoprecipitated chloroplast DNA using primers to amplify a 396-bp fragment from plastid atpB/E . ( b ) PCR analysis of formaldehyde cross-linked, immunoprecipitated chloroplast DNA using primers to amplify a 233-bp fragment from plastid 23S rDNA. ( c ) PCR analysis of immunoprecipitated chloroplast DNA using primers to amplify a 167-bp fragment from plastid psbT . Total DNA was extracted from a fraction of the lysate that did not undergo immunoprecipitation. Control reactions for PCR included genomic DNA isolated from a transplastomic lacO line (+) and water (−).

    Journal: Nucleic Acids Research

    Article Title: Binding of lac repressor-GFP fusion protein to lac operator sites inserted in the tobacco chloroplast genome examined by chromatin immunoprecipitation

    doi: 10.1093/nar/gkq413

    Figure Lengend Snippet: Binding of GFP-LacI to chloroplast sequences. Experimental lines are listed on the left; treatments shown in the left half of the panels were carried out following a formaldehyde cross-linking step, those on the right were not subjected to cross-linking. ( a ) PCR analysis of immunoprecipitated chloroplast DNA using primers to amplify a 396-bp fragment from plastid atpB/E . ( b ) PCR analysis of formaldehyde cross-linked, immunoprecipitated chloroplast DNA using primers to amplify a 233-bp fragment from plastid 23S rDNA. ( c ) PCR analysis of immunoprecipitated chloroplast DNA using primers to amplify a 167-bp fragment from plastid psbT . Total DNA was extracted from a fraction of the lysate that did not undergo immunoprecipitation. Control reactions for PCR included genomic DNA isolated from a transplastomic lacO line (+) and water (−).

    Article Snippet: For the gfp-lacI construct, the lacI coding sequence ( ) was PCR-amplified from E. coli XL1-Blue (Stratagene, http://www.stratagene.com ) using forward (5′-ACG GGATCC GTGAAACCAGTAACGTTATACGATGTC) and reverse (5′-TTATAA GAGCTC TCACTGCCCGCTTTCCAGTCGGG) primers, introducing a stop codon and inserting BamHI and SacI restriction sites (underlined) at the 5′- and 3′-ends, respectively.

    Techniques: Binding Assay, Polymerase Chain Reaction, Immunoprecipitation, Isolation

    Tissue distribution of BLINaC mRNA in different mouse and rat tissues A , RT-PCR experiments performed with RNA isolated from different mouse tissues (indicated on top of each lane). PCR products were hybridized with an α- 32 P-labelled mouse BLINaC cDNA probe (upper panel). The expected PCR product size is given on the left. Amplification of GAPDH was used for control (lower panel, ethidium bromide staining). B , analysis of BLINaC expression on different rat tissues (indicated on top) by RT-PCR. Specificity was confirmed by hybridization of the expected 365 bp PCR product with an α- 32 P-labelled rat BLINaC cDNA probe (upper panel). A control amplification of β-actin was performed in parallel (lower panel, ethidium bromide staining). C , detection of BLINaC transcript on mouse brain, liver and small intestine poly A + RNA (5 μg per lane) by Northern blot analysis. The probe used corresponds to an α- 32 P-labelled mouse BLINaC cDNA fragment. The filter was reprobed with a GAPDH probe as an RNA loading control (lower panel). A transcript of 2.1 kb was strongly detected in liver while a smaller transcript of 1.6 kb was found in small intestine. D , BLINaC mRNA expression in mouse liver and in freshly prepared hepatocytes was assessed by RT-PCR experiments. Specific amplification in liver and pure hepatocytes of a 737 bp product (upper panel, Southern blot) and β-actin control amplification (lower panel, ethidium bromide staining) are shown. The control corresponds to a PCR without cDNA.

    Journal: The Journal of Physiology

    Article Title: Cloning and functional expression of a novel degenerin-like Na+ channel gene in mammals

    doi: 10.1111/j.1469-7793.1999.0323m.x

    Figure Lengend Snippet: Tissue distribution of BLINaC mRNA in different mouse and rat tissues A , RT-PCR experiments performed with RNA isolated from different mouse tissues (indicated on top of each lane). PCR products were hybridized with an α- 32 P-labelled mouse BLINaC cDNA probe (upper panel). The expected PCR product size is given on the left. Amplification of GAPDH was used for control (lower panel, ethidium bromide staining). B , analysis of BLINaC expression on different rat tissues (indicated on top) by RT-PCR. Specificity was confirmed by hybridization of the expected 365 bp PCR product with an α- 32 P-labelled rat BLINaC cDNA probe (upper panel). A control amplification of β-actin was performed in parallel (lower panel, ethidium bromide staining). C , detection of BLINaC transcript on mouse brain, liver and small intestine poly A + RNA (5 μg per lane) by Northern blot analysis. The probe used corresponds to an α- 32 P-labelled mouse BLINaC cDNA fragment. The filter was reprobed with a GAPDH probe as an RNA loading control (lower panel). A transcript of 2.1 kb was strongly detected in liver while a smaller transcript of 1.6 kb was found in small intestine. D , BLINaC mRNA expression in mouse liver and in freshly prepared hepatocytes was assessed by RT-PCR experiments. Specific amplification in liver and pure hepatocytes of a 737 bp product (upper panel, Southern blot) and β-actin control amplification (lower panel, ethidium bromide staining) are shown. The control corresponds to a PCR without cDNA.

    Article Snippet: Fifteen micrograms of total RNA was reverse-transcribed according to the manufacturer's instructions (Gibco-BRL) and 1/40 of each sample was used as template for PCR amplification ( Taq DNA polymerase, Promega) using BLINaC primers overlapping rat and mouse sequences (nucleotide positions in rat 182-201: 5′-TGACCGGAAGAAGTTTGATC-3′; and 898-918: 5′-GCATCCCCACAGGAGAAGACA-3′) or GAPDH primers (Clontech).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Isolation, Polymerase Chain Reaction, Amplification, Staining, Expressing, Hybridization, Northern Blot, Southern Blot

    Determination of variation of genetic make-up under the influence of host factor(s) through PCR amplification of (A) 7 days and (B) 14 days fungal genome DNA with ISSR-18 and RAPD-16 primers. L, 100 bp ladder: 1, P9 (T); 2, P9 (C); 3, P16 (T); 4, P16 (C); 5, P7(T); 6, P7(C); 7, KBPN(C); 8, KBPN (T); T, Treated with host factor(s); C, Control no host factor(s).

    Journal: The Plant Pathology Journal

    Article Title: Alteration of Genetic Make-up in Karnal Bunt Pathogen (Tilletia indica) of Wheat in Presence of Host Determinants

    doi: 10.5423/PPJ.OA.10.2014.0106

    Figure Lengend Snippet: Determination of variation of genetic make-up under the influence of host factor(s) through PCR amplification of (A) 7 days and (B) 14 days fungal genome DNA with ISSR-18 and RAPD-16 primers. L, 100 bp ladder: 1, P9 (T); 2, P9 (C); 3, P16 (T); 4, P16 (C); 5, P7(T); 6, P7(C); 7, KBPN(C); 8, KBPN (T); T, Treated with host factor(s); C, Control no host factor(s).

    Article Snippet: The PCR amplification was achieved in a Biometra T-gradient DNA thermocycler.

    Techniques: Polymerase Chain Reaction, Amplification

    The disruption rates induced by transfecting Cas9, eGFP and sgRNA co-expression vector for three genomic loci in different cancer cell lines. a and b show the disruption efficiency induced by transfecting Cas9, eGFP and sgRNA co-expression vector in c-ABL and BCR gene loci in K562 cells as determined by T7E1 assay. “−” represents cells without GFP sorting; “+” represents cells with GFP sorting; and “M” represents DNA size marker. c – e show the disruption rate induced by transfecting Cas9, eGFP and AAVS1-sgRNA co-expression vector in K562, MCF-7 and HCT-116 cells using TA cloning and sequencing analysis. Approximately 20–30 TA clones were randomly picked up for DNA sequencing, and the disruption rate (%) was calculated based on DNA sequencing. All cells were transfected with 4 μg of pCS2-Cas9-IRES-GFP-polyA-gRNA (AAVS1) co-expression vector. Seventy-two hours after transfection, GFP-positive cells were enriched through FACS sorting and genomic DNA was extracted from the sorted cells. The PCR amplification, T7E1 assay and TA cloning into PMD18-T vector were performed as described in “ Methods ”

    Journal: Cell & Bioscience

    Article Title: Ligase IV inhibitor SCR7 enhances gene editing directed by CRISPR–Cas9 and ssODN in human cancer cells

    doi: 10.1186/s13578-018-0200-z

    Figure Lengend Snippet: The disruption rates induced by transfecting Cas9, eGFP and sgRNA co-expression vector for three genomic loci in different cancer cell lines. a and b show the disruption efficiency induced by transfecting Cas9, eGFP and sgRNA co-expression vector in c-ABL and BCR gene loci in K562 cells as determined by T7E1 assay. “−” represents cells without GFP sorting; “+” represents cells with GFP sorting; and “M” represents DNA size marker. c – e show the disruption rate induced by transfecting Cas9, eGFP and AAVS1-sgRNA co-expression vector in K562, MCF-7 and HCT-116 cells using TA cloning and sequencing analysis. Approximately 20–30 TA clones were randomly picked up for DNA sequencing, and the disruption rate (%) was calculated based on DNA sequencing. All cells were transfected with 4 μg of pCS2-Cas9-IRES-GFP-polyA-gRNA (AAVS1) co-expression vector. Seventy-two hours after transfection, GFP-positive cells were enriched through FACS sorting and genomic DNA was extracted from the sorted cells. The PCR amplification, T7E1 assay and TA cloning into PMD18-T vector were performed as described in “ Methods ”

    Article Snippet: Genomic DNA isolation, PCR amplification and mutation detection Genomic DNA was extracted from harvested cells using a DNA isolation kit (Tiangen, Beijing, China).

    Techniques: Expressing, Plasmid Preparation, Marker, TA Cloning, Sequencing, Clone Assay, DNA Sequencing, Transfection, FACS, Polymerase Chain Reaction, Amplification

    Effect of ssODN homology length on insertion efficiency at the AAVS1 locus. K562 cells were nucleofected with 4 μg of pCS2-Cas9-IRES-GFP-polyA-gRNA (AAVS1) co-expression vector and 0.3 nmol of ssODN donors with different lengths. Cells were harvested 2-day post nucleofection, and the GFP-positive cells were sorted. Genomic DNA was isolated and 100 ng DNA was used for PCR amplification with a P2P4 primer pair ( a ), or P2P4 and F1R1 primer pairs ( b ). The numbers on the top of the gel images represent the homology length in nucleotides of a ssODN donor. A 20-mer donor has two 10-base homology arms. Each ssODN contains an Eco RI site between the homology arms. The DNA sequence of each ssODN is shown in Supplementary Table 1 . M: DNA Marker. NC: PCR control; CON1: normal cells; CON2: cells transfected with pCS2-Cas9-IRES-GFP-polyA-gRNA (AAVS1) co-expression vector only; CON3: cells transfected with ssODN donor (80 nucleotides) only; 20–80: cells transfected with pCS2-Cas9-IRES-GFP-polyA-gRNA (AAVS1) co-expression vector plus various lengths of ssODNA donors. Arrows indicate the predicted amplified fragments

    Journal: Cell & Bioscience

    Article Title: Ligase IV inhibitor SCR7 enhances gene editing directed by CRISPR–Cas9 and ssODN in human cancer cells

    doi: 10.1186/s13578-018-0200-z

    Figure Lengend Snippet: Effect of ssODN homology length on insertion efficiency at the AAVS1 locus. K562 cells were nucleofected with 4 μg of pCS2-Cas9-IRES-GFP-polyA-gRNA (AAVS1) co-expression vector and 0.3 nmol of ssODN donors with different lengths. Cells were harvested 2-day post nucleofection, and the GFP-positive cells were sorted. Genomic DNA was isolated and 100 ng DNA was used for PCR amplification with a P2P4 primer pair ( a ), or P2P4 and F1R1 primer pairs ( b ). The numbers on the top of the gel images represent the homology length in nucleotides of a ssODN donor. A 20-mer donor has two 10-base homology arms. Each ssODN contains an Eco RI site between the homology arms. The DNA sequence of each ssODN is shown in Supplementary Table 1 . M: DNA Marker. NC: PCR control; CON1: normal cells; CON2: cells transfected with pCS2-Cas9-IRES-GFP-polyA-gRNA (AAVS1) co-expression vector only; CON3: cells transfected with ssODN donor (80 nucleotides) only; 20–80: cells transfected with pCS2-Cas9-IRES-GFP-polyA-gRNA (AAVS1) co-expression vector plus various lengths of ssODNA donors. Arrows indicate the predicted amplified fragments

    Article Snippet: Genomic DNA isolation, PCR amplification and mutation detection Genomic DNA was extracted from harvested cells using a DNA isolation kit (Tiangen, Beijing, China).

    Techniques: Expressing, Plasmid Preparation, Isolation, Polymerase Chain Reaction, Amplification, Sequencing, Marker, Transfection

    Determination of insertion repair efficiency and NHEJ rate at AAVS1 locus by restriction fragment length polymorphism assay, TA cloning and DNA sequencing. a and b show the enhancement of insertion repair by ssODN and SCR7 treatment in MCF-7 and HCT-116 cells as determined by restriction fragment length polymorphism assay. Genomic DNA was amplified by PCR, digested with Eco RI, and resolved in a 10% acrylamide gel. The original and cleaved DNA fragments are marked by arrows; the signals were quantified by densitometry; and the percentages of the cleaved fragments were calculated as described in “ Methods ”. c and d show the quantitation of insertion repair efficiency (%HDR), and Panels e and f show the percentages of NHEJ at AAVS1 locus by DNA sequencing of TA clones in MCF-7 and HCT-116 cells, respectively. Approximately 100 TA-clones were randomly picked up for DNA sequencing, and the insertion repair efficiency (%HDR) and NHEJ rate (%) in MCF-7 and HCT-116 cells was calculated based on DNA sequencing as described in the Methods. The data are the mean ± SD of three independent experiments. *p

    Journal: Cell & Bioscience

    Article Title: Ligase IV inhibitor SCR7 enhances gene editing directed by CRISPR–Cas9 and ssODN in human cancer cells

    doi: 10.1186/s13578-018-0200-z

    Figure Lengend Snippet: Determination of insertion repair efficiency and NHEJ rate at AAVS1 locus by restriction fragment length polymorphism assay, TA cloning and DNA sequencing. a and b show the enhancement of insertion repair by ssODN and SCR7 treatment in MCF-7 and HCT-116 cells as determined by restriction fragment length polymorphism assay. Genomic DNA was amplified by PCR, digested with Eco RI, and resolved in a 10% acrylamide gel. The original and cleaved DNA fragments are marked by arrows; the signals were quantified by densitometry; and the percentages of the cleaved fragments were calculated as described in “ Methods ”. c and d show the quantitation of insertion repair efficiency (%HDR), and Panels e and f show the percentages of NHEJ at AAVS1 locus by DNA sequencing of TA clones in MCF-7 and HCT-116 cells, respectively. Approximately 100 TA-clones were randomly picked up for DNA sequencing, and the insertion repair efficiency (%HDR) and NHEJ rate (%) in MCF-7 and HCT-116 cells was calculated based on DNA sequencing as described in the Methods. The data are the mean ± SD of three independent experiments. *p

    Article Snippet: Genomic DNA isolation, PCR amplification and mutation detection Genomic DNA was extracted from harvested cells using a DNA isolation kit (Tiangen, Beijing, China).

    Techniques: Non-Homologous End Joining, Polymorphism Assay, TA Cloning, DNA Sequencing, Amplification, Polymerase Chain Reaction, Acrylamide Gel Assay, Quantitation Assay, Clone Assay

    SCR7 promoted insertion repair efficiency at AAVS1 locus. a schematically illustrates the insertion repair mediated by ssODN and CRISPR/Cas9 for AAVS1, and the three methods used for the detection of insertion repair efficiency. A pair of primer P2 and P4 were used to examine insertion repair occurred in the Cas9-targeted locus by semi-quantitative PCR-gel electrophoresis. The two pairs of primers F3 and R3, F1 and R1 were used to amplify the sequences involved in the targeted site. The PCR-amplified products were analyzed by RFLP assay following Eco RI digestion and by TA cloning and DNA sequencing. b and c show representative images of PCR amplification with P2 and P4 primer and gel electrophoresis from at least three independent experiments. The data shows the enhancement of insertion repair by ssODN and SCR7 treatment in MCF-7 and HCT-116 cells in a SCR7 dose-dependent manner. “M”—DNA markers, “BC”—blank control without cells, “Con”—control cells without transfection of ssODN and CRISPR/Cas9 vector. d and e show the quantitative data of PCR-gel electrophoresis analysis using Image J software. GAPDH was used as an internal control. The data is the mean ± SD of three independent experiments. *p

    Journal: Cell & Bioscience

    Article Title: Ligase IV inhibitor SCR7 enhances gene editing directed by CRISPR–Cas9 and ssODN in human cancer cells

    doi: 10.1186/s13578-018-0200-z

    Figure Lengend Snippet: SCR7 promoted insertion repair efficiency at AAVS1 locus. a schematically illustrates the insertion repair mediated by ssODN and CRISPR/Cas9 for AAVS1, and the three methods used for the detection of insertion repair efficiency. A pair of primer P2 and P4 were used to examine insertion repair occurred in the Cas9-targeted locus by semi-quantitative PCR-gel electrophoresis. The two pairs of primers F3 and R3, F1 and R1 were used to amplify the sequences involved in the targeted site. The PCR-amplified products were analyzed by RFLP assay following Eco RI digestion and by TA cloning and DNA sequencing. b and c show representative images of PCR amplification with P2 and P4 primer and gel electrophoresis from at least three independent experiments. The data shows the enhancement of insertion repair by ssODN and SCR7 treatment in MCF-7 and HCT-116 cells in a SCR7 dose-dependent manner. “M”—DNA markers, “BC”—blank control without cells, “Con”—control cells without transfection of ssODN and CRISPR/Cas9 vector. d and e show the quantitative data of PCR-gel electrophoresis analysis using Image J software. GAPDH was used as an internal control. The data is the mean ± SD of three independent experiments. *p

    Article Snippet: Genomic DNA isolation, PCR amplification and mutation detection Genomic DNA was extracted from harvested cells using a DNA isolation kit (Tiangen, Beijing, China).

    Techniques: CRISPR, Real-time Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Amplification, RFLP Assay, TA Cloning, DNA Sequencing, Transfection, Plasmid Preparation, Software

    Targeting the MUC1-C cytoplasmic domain downregulates BMI1 expression A. Schema of the MUC1-C subunit with the 58 aa extracellular domain (ED), the 28 aa transmembrane domain (TM), and the sequence of the 72 aa cytoplasmic domain (CD). The MUC1-C cytoplasmic domain contains a CQC motif that is necessary and sufficient for MUC1-C homodimerization and oncogenic function. GO-203 is a cell-penetrating peptide that binds the CQC motif and blocks MUC1-C homodimerization. Highlighted are MUC1-C-induced pathways that confer the activation of ZEB1 and MYC. B. BT-549 cells were transfected with a control or MUC1-C(AQA) vector in which the CQC motif had been mutated to AQA. Lysates were immunoblotted with the indicated antibodies. C–E. BT-549 (C), MDA-MB-231 (D), and BT-20/MUC1-C (E) cells treated with 5 μM CP-2 or 5 μM GO-203 for 12 h were analyzed for BMI1 mRNA levels by qRT-PCR. The results (mean±SD) are expressed as relative BMI1 mRNA levels compared to that obtained for CP-2 (assigned a value of 1) (left). Cell lysates treated with 5 μM CP-2 or 5 μM GO-203 for 48 h were immunoblotted with the indicated antibodies (right).

    Journal: Oncogene

    Article Title: MUC1-C ACTIVATES BMI1 IN HUMAN CANCER CELLS

    doi: 10.1038/onc.2016.439

    Figure Lengend Snippet: Targeting the MUC1-C cytoplasmic domain downregulates BMI1 expression A. Schema of the MUC1-C subunit with the 58 aa extracellular domain (ED), the 28 aa transmembrane domain (TM), and the sequence of the 72 aa cytoplasmic domain (CD). The MUC1-C cytoplasmic domain contains a CQC motif that is necessary and sufficient for MUC1-C homodimerization and oncogenic function. GO-203 is a cell-penetrating peptide that binds the CQC motif and blocks MUC1-C homodimerization. Highlighted are MUC1-C-induced pathways that confer the activation of ZEB1 and MYC. B. BT-549 cells were transfected with a control or MUC1-C(AQA) vector in which the CQC motif had been mutated to AQA. Lysates were immunoblotted with the indicated antibodies. C–E. BT-549 (C), MDA-MB-231 (D), and BT-20/MUC1-C (E) cells treated with 5 μM CP-2 or 5 μM GO-203 for 12 h were analyzed for BMI1 mRNA levels by qRT-PCR. The results (mean±SD) are expressed as relative BMI1 mRNA levels compared to that obtained for CP-2 (assigned a value of 1) (left). Cell lysates treated with 5 μM CP-2 or 5 μM GO-203 for 48 h were immunoblotted with the indicated antibodies (right).

    Article Snippet: GST-tagged BMI1 was generated by PCR amplification of the pT3-EF1a-BMI1 plasmid (Addgene) and subcloning into the pGEX-5X-1 expression vector (GE Healthcare, Pittsburg, PA, USA).

    Techniques: Expressing, Sequencing, Activation Assay, Transfection, Plasmid Preparation, Multiple Displacement Amplification, Quantitative RT-PCR

    MUC1-C activates BMI1 transcription by a MYC-dependent mechanism A. Schema of the BMI1 promoter region with positioning of the putative MYC binding site at −177 to −182 bp upstream of the transcription start site. The BMI1 promoter-luciferase (Luc) pGL3-BMI1PrWT vector includes the wild-type BMI1 promoter and pGL3-BMI1PrMut contains a mutation in the E-Box sequences (CACGTG has been mutated to CGCGTG)(upper panel). BT-549/tet-MUC1shRNA cells cultured with or without DOX for 5 d were transfected with the pGL3-Basic Luc or pGL3-BMI1PrWT reporter for 48 h and then analyzed for luciferase activity. The results (mean±SD of 3 determinations) are expressed as the relative luciferase activity compared to that obtained with pGL3-Basic Luc (assigned a value of 1)(lower panel). B. BT-549 cells were transfected with the pGL3-Basic Luc or pGL3-BMI1PrWT reporter for 6 h and then treated with 5 μM CP-2 or GO-203 for an additional 42 h. The results (mean±SD of 3 determinations) are expressed as the relative luciferase activity compared to that obtained with CP-2-treated cells (assigned a value of 1). C. BT-549 cells were transfected with the pGL3-Basic Luc, pGL3-BMI1PrWT or pGL3-BMI1PrMut reporter for 48 h and then analyzed for luciferase activity (left). BT-549 cells were transfected with (i) a control vector or one expressing MUC1-C, and (ii) the pGL3-Basic Luc, pGL3-BMI1PrWT or pGL3-BMI1PrMut reporter for 72 h and then analyzed for luciferase activity (right). The results (mean±SD of 3 determinations) are expressed as the relative luciferase activity compared to that obtained with pGL3-Basic Luc (assigned a value of 1). D. BT-549/tet-MUC1shRNA cells were treated with or without DOX for 5 d. MYC mRNA levels were determined by qRT-PCR. The results (mean±SD) are expressed as relative MYC mRNA levels compared to that obtained for control DOX-untreated cells (assigned a value of 1) (left). Lysates were immunoblotted with the indicated antibodies (right). E. BT-549/tet-MYCshRNA cells cultured with or without DOX for 12 h were analyzed for BMI1 mRNA levels by qRT-PCR. The results (mean±SD) are expressed as relative BMI1 mRNA levels compared to that obtained for control DOX-untreated cells (assigned a value of 1) (left). Cell lysates treated with DOX for 48 h were immunoblotted with the indicated antibodies (right). F. Soluble chromatin from BT-549/tet-MUC1shRNA cells was precipitated with anti-MYC or a control IgG (left). The final DNA samples were amplified by qPCR with primers for the BMI1 promoter. The results (mean±SD of three determinations) are expressed as the relative fold enrichment compared with that obtained with the IgG control (assigned a value of 1). Soluble chromatin from 549/tet-MUC1shRNA cells cultured with or without DOX for 5 d was precipitated with anti-MYC or a control IgG. The final DNA samples were amplified by qPCR. The results (mean±SEM of three determinations) are expressed as the relative fold enrichment compared to that obtained for control DOX-untreated cells (assigned a value of 1) (right).

    Journal: Oncogene

    Article Title: MUC1-C ACTIVATES BMI1 IN HUMAN CANCER CELLS

    doi: 10.1038/onc.2016.439

    Figure Lengend Snippet: MUC1-C activates BMI1 transcription by a MYC-dependent mechanism A. Schema of the BMI1 promoter region with positioning of the putative MYC binding site at −177 to −182 bp upstream of the transcription start site. The BMI1 promoter-luciferase (Luc) pGL3-BMI1PrWT vector includes the wild-type BMI1 promoter and pGL3-BMI1PrMut contains a mutation in the E-Box sequences (CACGTG has been mutated to CGCGTG)(upper panel). BT-549/tet-MUC1shRNA cells cultured with or without DOX for 5 d were transfected with the pGL3-Basic Luc or pGL3-BMI1PrWT reporter for 48 h and then analyzed for luciferase activity. The results (mean±SD of 3 determinations) are expressed as the relative luciferase activity compared to that obtained with pGL3-Basic Luc (assigned a value of 1)(lower panel). B. BT-549 cells were transfected with the pGL3-Basic Luc or pGL3-BMI1PrWT reporter for 6 h and then treated with 5 μM CP-2 or GO-203 for an additional 42 h. The results (mean±SD of 3 determinations) are expressed as the relative luciferase activity compared to that obtained with CP-2-treated cells (assigned a value of 1). C. BT-549 cells were transfected with the pGL3-Basic Luc, pGL3-BMI1PrWT or pGL3-BMI1PrMut reporter for 48 h and then analyzed for luciferase activity (left). BT-549 cells were transfected with (i) a control vector or one expressing MUC1-C, and (ii) the pGL3-Basic Luc, pGL3-BMI1PrWT or pGL3-BMI1PrMut reporter for 72 h and then analyzed for luciferase activity (right). The results (mean±SD of 3 determinations) are expressed as the relative luciferase activity compared to that obtained with pGL3-Basic Luc (assigned a value of 1). D. BT-549/tet-MUC1shRNA cells were treated with or without DOX for 5 d. MYC mRNA levels were determined by qRT-PCR. The results (mean±SD) are expressed as relative MYC mRNA levels compared to that obtained for control DOX-untreated cells (assigned a value of 1) (left). Lysates were immunoblotted with the indicated antibodies (right). E. BT-549/tet-MYCshRNA cells cultured with or without DOX for 12 h were analyzed for BMI1 mRNA levels by qRT-PCR. The results (mean±SD) are expressed as relative BMI1 mRNA levels compared to that obtained for control DOX-untreated cells (assigned a value of 1) (left). Cell lysates treated with DOX for 48 h were immunoblotted with the indicated antibodies (right). F. Soluble chromatin from BT-549/tet-MUC1shRNA cells was precipitated with anti-MYC or a control IgG (left). The final DNA samples were amplified by qPCR with primers for the BMI1 promoter. The results (mean±SD of three determinations) are expressed as the relative fold enrichment compared with that obtained with the IgG control (assigned a value of 1). Soluble chromatin from 549/tet-MUC1shRNA cells cultured with or without DOX for 5 d was precipitated with anti-MYC or a control IgG. The final DNA samples were amplified by qPCR. The results (mean±SEM of three determinations) are expressed as the relative fold enrichment compared to that obtained for control DOX-untreated cells (assigned a value of 1) (right).

    Article Snippet: GST-tagged BMI1 was generated by PCR amplification of the pT3-EF1a-BMI1 plasmid (Addgene) and subcloning into the pGEX-5X-1 expression vector (GE Healthcare, Pittsburg, PA, USA).

    Techniques: Binding Assay, Luciferase, Plasmid Preparation, Mutagenesis, Cell Culture, Transfection, Activity Assay, Expressing, Quantitative RT-PCR, Amplification, Real-time Polymerase Chain Reaction

    MUC1-C blocks miR-200c-mediated downregulation of BMI1 expression A. BT-549/tet-MUC1shRNA cells were treated with or without DOX for 4 d. Lysates were immunoblotted with the indicated antibodies. B. BT-549 cells were transduced with lentiviral vectors to stably express a control shRNA (CshRNA) or a NF-κB p65 shRNA. Lysates were immunoblotted with the indicated antibodies. C. BT-549 cells were treated with control DMSO vehicle or BAY-11-7085 for 16 h. Lysates were immunoblotted with the indicated antibodies. D. BT-549/tet-MUC1shRNA cells were treated with or without DOX for 4 d. The cells were analyzed for miR-200c levels by qRT-PCR. The results (mean±SD) are expressed as relative miR-200c/RNU48 levels compared to that obtained for control DOX-untreated cells (assigned a value of 1). E and F. BT-549/tet-MUC1shRNA cells cultured with DOX for 7 d were transfected with 12.5 nM anti-miR-200c or a negative control oligonucleotide for 4 d. The cells were then analyzed for BMI1 mRNA levels by qRT-PCR. The results (mean±SD) are expressed as relative BMI1 mRNA levels compared to that obtained for control anti-miR-200c-untreated cells (assigned a value of 1) (E). Lysates were immunoblotted with the indicated antibodies (F).

    Journal: Oncogene

    Article Title: MUC1-C ACTIVATES BMI1 IN HUMAN CANCER CELLS

    doi: 10.1038/onc.2016.439

    Figure Lengend Snippet: MUC1-C blocks miR-200c-mediated downregulation of BMI1 expression A. BT-549/tet-MUC1shRNA cells were treated with or without DOX for 4 d. Lysates were immunoblotted with the indicated antibodies. B. BT-549 cells were transduced with lentiviral vectors to stably express a control shRNA (CshRNA) or a NF-κB p65 shRNA. Lysates were immunoblotted with the indicated antibodies. C. BT-549 cells were treated with control DMSO vehicle or BAY-11-7085 for 16 h. Lysates were immunoblotted with the indicated antibodies. D. BT-549/tet-MUC1shRNA cells were treated with or without DOX for 4 d. The cells were analyzed for miR-200c levels by qRT-PCR. The results (mean±SD) are expressed as relative miR-200c/RNU48 levels compared to that obtained for control DOX-untreated cells (assigned a value of 1). E and F. BT-549/tet-MUC1shRNA cells cultured with DOX for 7 d were transfected with 12.5 nM anti-miR-200c or a negative control oligonucleotide for 4 d. The cells were then analyzed for BMI1 mRNA levels by qRT-PCR. The results (mean±SD) are expressed as relative BMI1 mRNA levels compared to that obtained for control anti-miR-200c-untreated cells (assigned a value of 1) (E). Lysates were immunoblotted with the indicated antibodies (F).

    Article Snippet: GST-tagged BMI1 was generated by PCR amplification of the pT3-EF1a-BMI1 plasmid (Addgene) and subcloning into the pGEX-5X-1 expression vector (GE Healthcare, Pittsburg, PA, USA).

    Techniques: Expressing, Transduction, Stable Transfection, shRNA, Quantitative RT-PCR, Cell Culture, Transfection, Negative Control

    MUC1-C/BMI1 complexes occupy the CDKN2A promoter A. Schema of the CDKN2A promoter with positioning of the BMI1-response element (BRE) at −423 to −446 and −474 to −480 bp upstream to the transcription start site. B. Soluble chromatin from BT−549 cells was precipitated with anti-BMI1 or a control IgG. C. In the re-ChIP analysis, BMI1 precipitates were released and re-immunoprecipitated with anti-MUC1-C and a control IgG. D. Soluble chromatin from BT-549 cells was precipitated with anti-MUC1-C or a control IgG. The final DNA samples were amplified by qPCR with primers for the CDKN2A promoter. The results (mean±SD of three determinations) are expressed as the relative fold enrichment compared with that obtained with the IgG control (assigned a value of 1). E. GST and GST-BMI1 were incubated with either purified MUC1-CD or MUC1-CD(AQA). The adsorbates were immunoblotted with anti-MUC1-C. Input of the GST proteins was assessed by Coomassie blue staining. F. BT-549/tet-MUC1shRNA cells were treated with or without DOX for 7 d. p16 INK4a mRNA levels were determined by qRT-PCR. The results (mean±SD) are expressed as relative p16 INK4a mRNA levels compared to that obtained for control DOX-untreated cells (assigned a value of 1) (left). Cell lysates cultured with or without DOX for 12 d were immunoblotted with the indicated antibodies (right).

    Journal: Oncogene

    Article Title: MUC1-C ACTIVATES BMI1 IN HUMAN CANCER CELLS

    doi: 10.1038/onc.2016.439

    Figure Lengend Snippet: MUC1-C/BMI1 complexes occupy the CDKN2A promoter A. Schema of the CDKN2A promoter with positioning of the BMI1-response element (BRE) at −423 to −446 and −474 to −480 bp upstream to the transcription start site. B. Soluble chromatin from BT−549 cells was precipitated with anti-BMI1 or a control IgG. C. In the re-ChIP analysis, BMI1 precipitates were released and re-immunoprecipitated with anti-MUC1-C and a control IgG. D. Soluble chromatin from BT-549 cells was precipitated with anti-MUC1-C or a control IgG. The final DNA samples were amplified by qPCR with primers for the CDKN2A promoter. The results (mean±SD of three determinations) are expressed as the relative fold enrichment compared with that obtained with the IgG control (assigned a value of 1). E. GST and GST-BMI1 were incubated with either purified MUC1-CD or MUC1-CD(AQA). The adsorbates were immunoblotted with anti-MUC1-C. Input of the GST proteins was assessed by Coomassie blue staining. F. BT-549/tet-MUC1shRNA cells were treated with or without DOX for 7 d. p16 INK4a mRNA levels were determined by qRT-PCR. The results (mean±SD) are expressed as relative p16 INK4a mRNA levels compared to that obtained for control DOX-untreated cells (assigned a value of 1) (left). Cell lysates cultured with or without DOX for 12 d were immunoblotted with the indicated antibodies (right).

    Article Snippet: GST-tagged BMI1 was generated by PCR amplification of the pT3-EF1a-BMI1 plasmid (Addgene) and subcloning into the pGEX-5X-1 expression vector (GE Healthcare, Pittsburg, PA, USA).

    Techniques: Chromatin Immunoprecipitation, Immunoprecipitation, Amplification, Real-time Polymerase Chain Reaction, Incubation, Purification, Staining, Quantitative RT-PCR, Cell Culture

    Silencing MUC1-C downregulates BMI1 expression A–C. BT-549 cells were stably transduced to express a tetracycline-inducible control shRNA (tet-CshRNA) (A) or a MUC1 shRNA (tet-MUC1shRNA) (B). Cells treated with 200 ng/ml DOX for 4 d were analyzed for MUC1 and BMI1 mRNA levels by qRT-PCR. The results (mean±SD) are expressed as relative mRNA levels compared to that obtained for control DOX-untreated cells (assigned a value of 1). Cell lysates treated with 200 ng/ml DOX for 7 d were immunoblotted with the indicated antibodies (C). D. MDA-MB-231/tet-MUC1shRNA cells treated with 200 ng/ml DOX for 4 d were analyzed for MUC1 and BMI1 mRNA levels by qRT-PCR (left). Cell lysates treated with 200 ng/ml DOX for 7 d were immunoblotted with the indicated antibodies (right). E. BT-20 cells stably expressing a control or MUC1-C vector were analyzed for BMI1 mRNA levels by qRT-PCR. The results (mean±SD) are expressed as relative BMI1 mRNA levels compared to that obtained for vector cells (assigned a value of 1) (left). Lysates were immunoblotted with the indicated antibodies (right).

    Journal: Oncogene

    Article Title: MUC1-C ACTIVATES BMI1 IN HUMAN CANCER CELLS

    doi: 10.1038/onc.2016.439

    Figure Lengend Snippet: Silencing MUC1-C downregulates BMI1 expression A–C. BT-549 cells were stably transduced to express a tetracycline-inducible control shRNA (tet-CshRNA) (A) or a MUC1 shRNA (tet-MUC1shRNA) (B). Cells treated with 200 ng/ml DOX for 4 d were analyzed for MUC1 and BMI1 mRNA levels by qRT-PCR. The results (mean±SD) are expressed as relative mRNA levels compared to that obtained for control DOX-untreated cells (assigned a value of 1). Cell lysates treated with 200 ng/ml DOX for 7 d were immunoblotted with the indicated antibodies (C). D. MDA-MB-231/tet-MUC1shRNA cells treated with 200 ng/ml DOX for 4 d were analyzed for MUC1 and BMI1 mRNA levels by qRT-PCR (left). Cell lysates treated with 200 ng/ml DOX for 7 d were immunoblotted with the indicated antibodies (right). E. BT-20 cells stably expressing a control or MUC1-C vector were analyzed for BMI1 mRNA levels by qRT-PCR. The results (mean±SD) are expressed as relative BMI1 mRNA levels compared to that obtained for vector cells (assigned a value of 1) (left). Lysates were immunoblotted with the indicated antibodies (right).

    Article Snippet: GST-tagged BMI1 was generated by PCR amplification of the pT3-EF1a-BMI1 plasmid (Addgene) and subcloning into the pGEX-5X-1 expression vector (GE Healthcare, Pittsburg, PA, USA).

    Techniques: Expressing, Stable Transfection, shRNA, Quantitative RT-PCR, Multiple Displacement Amplification, Plasmid Preparation