pcr amplification Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher pcr buffer
    Expression of the mea-1 allele during early seed development. Amplification of MEA-1 ( top ) and ACTIN-11 ( ACT11 ) as a control for cDNA synthesis. <t>RNA</t> was isolated from siliques derived from self-pollinated mea-1 homozygous pistils ( mea × mea ), self-pollinated wild-type pistils (wt × wt), a cross between a homozygous mea-1 female and wild-type male ( mea × wt), and a cross between wild-type female and homozygous mea-1 male (wt × mea ). Primers that specifically amplify the mea-1 allele under these <t>PCR</t> conditions were used for RT–PCR. (M) Marker lane; (G) genomic DNA as a control.
    Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1144 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr buffer/product/Thermo Fisher
    Average 99 stars, based on 1144 article reviews
    Price from $9.99 to $1999.99
    pcr buffer - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore polymerase chain reaction pcr
    Expression of the mea-1 allele during early seed development. Amplification of MEA-1 ( top ) and ACTIN-11 ( ACT11 ) as a control for cDNA synthesis. <t>RNA</t> was isolated from siliques derived from self-pollinated mea-1 homozygous pistils ( mea × mea ), self-pollinated wild-type pistils (wt × wt), a cross between a homozygous mea-1 female and wild-type male ( mea × wt), and a cross between wild-type female and homozygous mea-1 male (wt × mea ). Primers that specifically amplify the mea-1 allele under these <t>PCR</t> conditions were used for RT–PCR. (M) Marker lane; (G) genomic DNA as a control.
    Polymerase Chain Reaction Pcr, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 297 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr/product/Millipore
    Average 99 stars, based on 297 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    4Gene polymerase chain reaction polymerase chain reaction pcr amplification
    Agarose gel (2%) showing <t>PCR</t> amplification of <t>TLR-4</t> (a, b) and restriction digestion of PCR products (c, d). Lanes M:Φ×BsuR1(HaeIII)[NEB]; 5-11 (c) and 1,2,6-9 (d): wild-type allele; 1,2 (c) and 3,4,10 (d) heterozygous alleles; 3,4 (c) and 11 (d): homozygous variant allele
    Polymerase Chain Reaction Polymerase Chain Reaction Pcr Amplification, supplied by 4Gene, used in various techniques. Bioz Stars score: 86/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction polymerase chain reaction pcr amplification/product/4Gene
    Average 86 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction polymerase chain reaction pcr amplification - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    99
    Thermo Fisher pcr amplification
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Pcr Amplification, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 52385 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Thermo Fisher
    Average 99 stars, based on 52385 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    85
    Brinkmann Instruments polymerase chain reaction pcr amplification
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Polymerase Chain Reaction Pcr Amplification, supplied by Brinkmann Instruments, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplification/product/Brinkmann Instruments
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplification - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    85
    Bangalore Genei polymerase chain reaction pcr amplification
    Human cerebral organoids recapitulate various brain region identities a, <t>RT-PCR</t> for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain <t>cDNA</t> was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.
    Polymerase Chain Reaction Pcr Amplification, supplied by Bangalore Genei, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplification/product/Bangalore Genei
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplification - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    99
    Roche pcr amplification
    <t>PCR</t> results of <t>mecA</t> gene in 7 isolates staphylococcus epidermidis. Column 10: Size marker (50 bp). Column 8, 1-6: Isolates of Staphylococcus epidermidis containing mecA gene. Column 7: Positive control of staphylococcus aureus ATC 33591. Column 9: Negative control of staphylococcus aureus ATCC 25923
    Pcr Amplification, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 9753 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Roche
    Average 99 stars, based on 9753 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    97
    Bio-Rad polymerase chain reaction pcr amplification
    <t>PCR</t> results of <t>mecA</t> gene in 7 isolates staphylococcus epidermidis. Column 10: Size marker (50 bp). Column 8, 1-6: Isolates of Staphylococcus epidermidis containing mecA gene. Column 7: Positive control of staphylococcus aureus ATC 33591. Column 9: Negative control of staphylococcus aureus ATCC 25923
    Polymerase Chain Reaction Pcr Amplification, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 227 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplification/product/Bio-Rad
    Average 97 stars, based on 227 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplification - by Bioz Stars, 2020-04
    97/100 stars
      Buy from Supplier

    85
    GeneDx Inc polymerase chain reaction amplified fragments
    <t>PCR</t> results of <t>mecA</t> gene in 7 isolates staphylococcus epidermidis. Column 10: Size marker (50 bp). Column 8, 1-6: Isolates of Staphylococcus epidermidis containing mecA gene. Column 7: Positive control of staphylococcus aureus ATC 33591. Column 9: Negative control of staphylococcus aureus ATCC 25923
    Polymerase Chain Reaction Amplified Fragments, supplied by GeneDx Inc, used in various techniques. Bioz Stars score: 85/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction amplified fragments/product/GeneDx Inc
    Average 85 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction amplified fragments - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    99
    Thermo Fisher pcr
    <t>PCR</t> results of <t>mecA</t> gene in 7 isolates staphylococcus epidermidis. Column 10: Size marker (50 bp). Column 8, 1-6: Isolates of Staphylococcus epidermidis containing mecA gene. Column 7: Positive control of staphylococcus aureus ATC 33591. Column 9: Negative control of staphylococcus aureus ATCC 25923
    Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 83969 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr/product/Thermo Fisher
    Average 99 stars, based on 83969 article reviews
    Price from $9.99 to $1999.99
    pcr - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    91
    Promega polymerase chain reaction kit
    <t>PCR</t> results of <t>mecA</t> gene in 7 isolates staphylococcus epidermidis. Column 10: Size marker (50 bp). Column 8, 1-6: Isolates of Staphylococcus epidermidis containing mecA gene. Column 7: Positive control of staphylococcus aureus ATC 33591. Column 9: Negative control of staphylococcus aureus ATCC 25923
    Polymerase Chain Reaction Kit, supplied by Promega, used in various techniques. Bioz Stars score: 91/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction kit/product/Promega
    Average 91 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction kit - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    85
    BioMed Diagnostics Inc polymerase chain reaction processor
    <t>PCR</t> results of <t>mecA</t> gene in 7 isolates staphylococcus epidermidis. Column 10: Size marker (50 bp). Column 8, 1-6: Isolates of Staphylococcus epidermidis containing mecA gene. Column 7: Positive control of staphylococcus aureus ATC 33591. Column 9: Negative control of staphylococcus aureus ATCC 25923
    Polymerase Chain Reaction Processor, supplied by BioMed Diagnostics Inc, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction processor/product/BioMed Diagnostics Inc
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction processor - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    93
    TaKaRa polymerase chain reaction amplification polymerase chain reactions
    TFE3 and TFEB increase TMEM55B expression to cluster lysosomes during starvation. a – c ARPE-19 cells were infected with adenovirus expressing TFE3-S321A-Myc, TFEB-S211A-FLAG, or null virus for 36 h. a Relative quantitative real-time <t>PCR</t> analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH mRNA, n = 4). b Representative immunoblot of lysates from TFE3-S321A-Myc and TFEB-S211A-FLAG expressing cells. c Quantification of TMEM55B protein levels. d Control MEFs untreated or starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against TFE3. e – g Relative quantitative real-time PCR analysis of e MCOLN1, f TMEM55B and g <t>TMEM55A</t> mRNA transcript levels from null- or TFE3/TFEB knockout MEFs, untreated or starved in EBSS for 4 h (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH) n = 6 from three independent experiments. h HeLa cells stably expressing control or TFEB shRNAs were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. i HeLa cells expressing control, TMEM55B, and JIP4 RNAis were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. j Quantification of lysosome distribution, percentage of total fluorescence signal detected > 15 μm from nuclear rim. Quantified results are presented as mean ± s.e.m. using two-tailed t -test ∗ P
    Polymerase Chain Reaction Amplification Polymerase Chain Reactions, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction amplification polymerase chain reactions/product/TaKaRa
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction amplification polymerase chain reactions - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    91
    CinnaGen Co polymerase chain reaction polymerase chain reaction amplification
    TFE3 and TFEB increase TMEM55B expression to cluster lysosomes during starvation. a – c ARPE-19 cells were infected with adenovirus expressing TFE3-S321A-Myc, TFEB-S211A-FLAG, or null virus for 36 h. a Relative quantitative real-time <t>PCR</t> analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH mRNA, n = 4). b Representative immunoblot of lysates from TFE3-S321A-Myc and TFEB-S211A-FLAG expressing cells. c Quantification of TMEM55B protein levels. d Control MEFs untreated or starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against TFE3. e – g Relative quantitative real-time PCR analysis of e MCOLN1, f TMEM55B and g <t>TMEM55A</t> mRNA transcript levels from null- or TFE3/TFEB knockout MEFs, untreated or starved in EBSS for 4 h (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH) n = 6 from three independent experiments. h HeLa cells stably expressing control or TFEB shRNAs were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. i HeLa cells expressing control, TMEM55B, and JIP4 RNAis were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. j Quantification of lysosome distribution, percentage of total fluorescence signal detected > 15 μm from nuclear rim. Quantified results are presented as mean ± s.e.m. using two-tailed t -test ∗ P
    Polymerase Chain Reaction Polymerase Chain Reaction Amplification, supplied by CinnaGen Co, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction polymerase chain reaction amplification/product/CinnaGen Co
    Average 91 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction polymerase chain reaction amplification - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    91
    PerkinElmer polymerase chain reaction pcr buffer
    TFE3 and TFEB increase TMEM55B expression to cluster lysosomes during starvation. a – c ARPE-19 cells were infected with adenovirus expressing TFE3-S321A-Myc, TFEB-S211A-FLAG, or null virus for 36 h. a Relative quantitative real-time <t>PCR</t> analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH mRNA, n = 4). b Representative immunoblot of lysates from TFE3-S321A-Myc and TFEB-S211A-FLAG expressing cells. c Quantification of TMEM55B protein levels. d Control MEFs untreated or starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against TFE3. e – g Relative quantitative real-time PCR analysis of e MCOLN1, f TMEM55B and g <t>TMEM55A</t> mRNA transcript levels from null- or TFE3/TFEB knockout MEFs, untreated or starved in EBSS for 4 h (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH) n = 6 from three independent experiments. h HeLa cells stably expressing control or TFEB shRNAs were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. i HeLa cells expressing control, TMEM55B, and JIP4 RNAis were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. j Quantification of lysosome distribution, percentage of total fluorescence signal detected > 15 μm from nuclear rim. Quantified results are presented as mean ± s.e.m. using two-tailed t -test ∗ P
    Polymerase Chain Reaction Pcr Buffer, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 91/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr buffer/product/PerkinElmer
    Average 91 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr buffer - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    86
    Thermo Fisher polymerase chain reaction pcr amplification kits
    TFE3 and TFEB increase TMEM55B expression to cluster lysosomes during starvation. a – c ARPE-19 cells were infected with adenovirus expressing TFE3-S321A-Myc, TFEB-S211A-FLAG, or null virus for 36 h. a Relative quantitative real-time <t>PCR</t> analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH mRNA, n = 4). b Representative immunoblot of lysates from TFE3-S321A-Myc and TFEB-S211A-FLAG expressing cells. c Quantification of TMEM55B protein levels. d Control MEFs untreated or starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against TFE3. e – g Relative quantitative real-time PCR analysis of e MCOLN1, f TMEM55B and g <t>TMEM55A</t> mRNA transcript levels from null- or TFE3/TFEB knockout MEFs, untreated or starved in EBSS for 4 h (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH) n = 6 from three independent experiments. h HeLa cells stably expressing control or TFEB shRNAs were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. i HeLa cells expressing control, TMEM55B, and JIP4 RNAis were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. j Quantification of lysosome distribution, percentage of total fluorescence signal detected > 15 μm from nuclear rim. Quantified results are presented as mean ± s.e.m. using two-tailed t -test ∗ P
    Polymerase Chain Reaction Pcr Amplification Kits, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplification kits/product/Thermo Fisher
    Average 86 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplification kits - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    86
    Thermo Fisher polymerase chain reaction mastermix
    TFE3 and TFEB increase TMEM55B expression to cluster lysosomes during starvation. a – c ARPE-19 cells were infected with adenovirus expressing TFE3-S321A-Myc, TFEB-S211A-FLAG, or null virus for 36 h. a Relative quantitative real-time <t>PCR</t> analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH mRNA, n = 4). b Representative immunoblot of lysates from TFE3-S321A-Myc and TFEB-S211A-FLAG expressing cells. c Quantification of TMEM55B protein levels. d Control MEFs untreated or starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against TFE3. e – g Relative quantitative real-time PCR analysis of e MCOLN1, f TMEM55B and g <t>TMEM55A</t> mRNA transcript levels from null- or TFE3/TFEB knockout MEFs, untreated or starved in EBSS for 4 h (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH) n = 6 from three independent experiments. h HeLa cells stably expressing control or TFEB shRNAs were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. i HeLa cells expressing control, TMEM55B, and JIP4 RNAis were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. j Quantification of lysosome distribution, percentage of total fluorescence signal detected > 15 μm from nuclear rim. Quantified results are presented as mean ± s.e.m. using two-tailed t -test ∗ P
    Polymerase Chain Reaction Mastermix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction mastermix/product/Thermo Fisher
    Average 86 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction mastermix - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    93
    TaKaRa polymerase chain reaction pcr system
    TFE3 and TFEB increase TMEM55B expression to cluster lysosomes during starvation. a – c ARPE-19 cells were infected with adenovirus expressing TFE3-S321A-Myc, TFEB-S211A-FLAG, or null virus for 36 h. a Relative quantitative real-time <t>PCR</t> analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH mRNA, n = 4). b Representative immunoblot of lysates from TFE3-S321A-Myc and TFEB-S211A-FLAG expressing cells. c Quantification of TMEM55B protein levels. d Control MEFs untreated or starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against TFE3. e – g Relative quantitative real-time PCR analysis of e MCOLN1, f TMEM55B and g <t>TMEM55A</t> mRNA transcript levels from null- or TFE3/TFEB knockout MEFs, untreated or starved in EBSS for 4 h (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH) n = 6 from three independent experiments. h HeLa cells stably expressing control or TFEB shRNAs were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. i HeLa cells expressing control, TMEM55B, and JIP4 RNAis were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. j Quantification of lysosome distribution, percentage of total fluorescence signal detected > 15 μm from nuclear rim. Quantified results are presented as mean ± s.e.m. using two-tailed t -test ∗ P
    Polymerase Chain Reaction Pcr System, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr system/product/TaKaRa
    Average 93 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr system - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    94
    Bioneer Corporation polymerase chain reaction pcr premix
    TFE3 and TFEB increase TMEM55B expression to cluster lysosomes during starvation. a – c ARPE-19 cells were infected with adenovirus expressing TFE3-S321A-Myc, TFEB-S211A-FLAG, or null virus for 36 h. a Relative quantitative real-time <t>PCR</t> analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH mRNA, n = 4). b Representative immunoblot of lysates from TFE3-S321A-Myc and TFEB-S211A-FLAG expressing cells. c Quantification of TMEM55B protein levels. d Control MEFs untreated or starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against TFE3. e – g Relative quantitative real-time PCR analysis of e MCOLN1, f TMEM55B and g <t>TMEM55A</t> mRNA transcript levels from null- or TFE3/TFEB knockout MEFs, untreated or starved in EBSS for 4 h (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH) n = 6 from three independent experiments. h HeLa cells stably expressing control or TFEB shRNAs were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. i HeLa cells expressing control, TMEM55B, and JIP4 RNAis were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. j Quantification of lysosome distribution, percentage of total fluorescence signal detected > 15 μm from nuclear rim. Quantified results are presented as mean ± s.e.m. using two-tailed t -test ∗ P
    Polymerase Chain Reaction Pcr Premix, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 94/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr premix/product/Bioneer Corporation
    Average 94 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr premix - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    94
    Thermo Fisher polymerase chain reaction pcr system
    TFE3 and TFEB increase TMEM55B expression to cluster lysosomes during starvation. a – c ARPE-19 cells were infected with adenovirus expressing TFE3-S321A-Myc, TFEB-S211A-FLAG, or null virus for 36 h. a Relative quantitative real-time <t>PCR</t> analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH mRNA, n = 4). b Representative immunoblot of lysates from TFE3-S321A-Myc and TFEB-S211A-FLAG expressing cells. c Quantification of TMEM55B protein levels. d Control MEFs untreated or starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against TFE3. e – g Relative quantitative real-time PCR analysis of e MCOLN1, f TMEM55B and g <t>TMEM55A</t> mRNA transcript levels from null- or TFE3/TFEB knockout MEFs, untreated or starved in EBSS for 4 h (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH) n = 6 from three independent experiments. h HeLa cells stably expressing control or TFEB shRNAs were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. i HeLa cells expressing control, TMEM55B, and JIP4 RNAis were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. j Quantification of lysosome distribution, percentage of total fluorescence signal detected > 15 μm from nuclear rim. Quantified results are presented as mean ± s.e.m. using two-tailed t -test ∗ P
    Polymerase Chain Reaction Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr system/product/Thermo Fisher
    Average 94 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr system - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    88
    Thermo Fisher polymerase chain reaction trizol
    TFE3 and TFEB increase TMEM55B expression to cluster lysosomes during starvation. a – c ARPE-19 cells were infected with adenovirus expressing TFE3-S321A-Myc, TFEB-S211A-FLAG, or null virus for 36 h. a Relative quantitative real-time <t>PCR</t> analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH mRNA, n = 4). b Representative immunoblot of lysates from TFE3-S321A-Myc and TFEB-S211A-FLAG expressing cells. c Quantification of TMEM55B protein levels. d Control MEFs untreated or starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against TFE3. e – g Relative quantitative real-time PCR analysis of e MCOLN1, f TMEM55B and g <t>TMEM55A</t> mRNA transcript levels from null- or TFE3/TFEB knockout MEFs, untreated or starved in EBSS for 4 h (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH) n = 6 from three independent experiments. h HeLa cells stably expressing control or TFEB shRNAs were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. i HeLa cells expressing control, TMEM55B, and JIP4 RNAis were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. j Quantification of lysosome distribution, percentage of total fluorescence signal detected > 15 μm from nuclear rim. Quantified results are presented as mean ± s.e.m. using two-tailed t -test ∗ P
    Polymerase Chain Reaction Trizol, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction trizol/product/Thermo Fisher
    Average 88 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction trizol - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    86
    Bioneer Corporation polymerase chain reaction pcr kit
    TFE3 and TFEB increase TMEM55B expression to cluster lysosomes during starvation. a – c ARPE-19 cells were infected with adenovirus expressing TFE3-S321A-Myc, TFEB-S211A-FLAG, or null virus for 36 h. a Relative quantitative real-time <t>PCR</t> analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH mRNA, n = 4). b Representative immunoblot of lysates from TFE3-S321A-Myc and TFEB-S211A-FLAG expressing cells. c Quantification of TMEM55B protein levels. d Control MEFs untreated or starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against TFE3. e – g Relative quantitative real-time PCR analysis of e MCOLN1, f TMEM55B and g <t>TMEM55A</t> mRNA transcript levels from null- or TFE3/TFEB knockout MEFs, untreated or starved in EBSS for 4 h (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH) n = 6 from three independent experiments. h HeLa cells stably expressing control or TFEB shRNAs were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. i HeLa cells expressing control, TMEM55B, and JIP4 RNAis were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. j Quantification of lysosome distribution, percentage of total fluorescence signal detected > 15 μm from nuclear rim. Quantified results are presented as mean ± s.e.m. using two-tailed t -test ∗ P
    Polymerase Chain Reaction Pcr Kit, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 86/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr kit/product/Bioneer Corporation
    Average 86 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr kit - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    94
    Bio-Rad polymerase chain reaction pcr machine
    TFE3 and TFEB increase TMEM55B expression to cluster lysosomes during starvation. a – c ARPE-19 cells were infected with adenovirus expressing TFE3-S321A-Myc, TFEB-S211A-FLAG, or null virus for 36 h. a Relative quantitative real-time <t>PCR</t> analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH mRNA, n = 4). b Representative immunoblot of lysates from TFE3-S321A-Myc and TFEB-S211A-FLAG expressing cells. c Quantification of TMEM55B protein levels. d Control MEFs untreated or starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against TFE3. e – g Relative quantitative real-time PCR analysis of e MCOLN1, f TMEM55B and g <t>TMEM55A</t> mRNA transcript levels from null- or TFE3/TFEB knockout MEFs, untreated or starved in EBSS for 4 h (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH) n = 6 from three independent experiments. h HeLa cells stably expressing control or TFEB shRNAs were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. i HeLa cells expressing control, TMEM55B, and JIP4 RNAis were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. j Quantification of lysosome distribution, percentage of total fluorescence signal detected > 15 μm from nuclear rim. Quantified results are presented as mean ± s.e.m. using two-tailed t -test ∗ P
    Polymerase Chain Reaction Pcr Machine, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr machine/product/Bio-Rad
    Average 94 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr machine - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    89
    TaKaRa polymerase chain reaction pcr machine
    <t>PCR</t> amplified object fragment. The agarose gel electrophoresis revealed that the object band was in the expected position. M, DL2000 DNA marker; 1 and 2, PCR product (502 bp) <t>cDNA.</t> PCR, polymerase chain reaction.
    Polymerase Chain Reaction Pcr Machine, supplied by TaKaRa, used in various techniques. Bioz Stars score: 89/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr machine/product/TaKaRa
    Average 89 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr machine - by Bioz Stars, 2020-04
    89/100 stars
      Buy from Supplier

    90
    Thermo Fisher phusion polymerase based polymerase chain reaction pcr
    <t>PCR</t> amplified object fragment. The agarose gel electrophoresis revealed that the object band was in the expected position. M, DL2000 DNA marker; 1 and 2, PCR product (502 bp) <t>cDNA.</t> PCR, polymerase chain reaction.
    Phusion Polymerase Based Polymerase Chain Reaction Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion polymerase based polymerase chain reaction pcr/product/Thermo Fisher
    Average 90 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    phusion polymerase based polymerase chain reaction pcr - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    94
    Thermo Fisher polymerase chain reaction qpcr amplification
    <t>PCR</t> amplified object fragment. The agarose gel electrophoresis revealed that the object band was in the expected position. M, DL2000 DNA marker; 1 and 2, PCR product (502 bp) <t>cDNA.</t> PCR, polymerase chain reaction.
    Polymerase Chain Reaction Qpcr Amplification, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 68 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction qpcr amplification/product/Thermo Fisher
    Average 94 stars, based on 68 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction qpcr amplification - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    86
    Millipore multiscreen polymerase chain reaction pcr plate
    <t>PCR</t> amplified object fragment. The agarose gel electrophoresis revealed that the object band was in the expected position. M, DL2000 DNA marker; 1 and 2, PCR product (502 bp) <t>cDNA.</t> PCR, polymerase chain reaction.
    Multiscreen Polymerase Chain Reaction Pcr Plate, supplied by Millipore, used in various techniques. Bioz Stars score: 86/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiscreen polymerase chain reaction pcr plate/product/Millipore
    Average 86 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    multiscreen polymerase chain reaction pcr plate - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    91
    Biometra professional polymerase chain reaction pcr amplification instrument
    <t>PCR</t> amplified object fragment. The agarose gel electrophoresis revealed that the object band was in the expected position. M, DL2000 DNA marker; 1 and 2, PCR product (502 bp) <t>cDNA.</t> PCR, polymerase chain reaction.
    Professional Polymerase Chain Reaction Pcr Amplification Instrument, supplied by Biometra, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/professional polymerase chain reaction pcr amplification instrument/product/Biometra
    Average 91 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    professional polymerase chain reaction pcr amplification instrument - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    85
    PerkinElmer polymerase chain reaction pcr mixture
    <t>PCR</t> amplified object fragment. The agarose gel electrophoresis revealed that the object band was in the expected position. M, DL2000 DNA marker; 1 and 2, PCR product (502 bp) <t>cDNA.</t> PCR, polymerase chain reaction.
    Polymerase Chain Reaction Pcr Mixture, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 85/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr mixture/product/PerkinElmer
    Average 85 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr mixture - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    99
    Bio-Rad pcr amplifications
    Specificity of MRSA <t>PCR</t> using 17 strains of MRSA. M- 100 bp <t>DNA</t> ladder; C- Negative control; 1- MRSA HA 1; 2- MRSA HA 2; 3- MRSA HA 3; 4- MRSA HA 4; 5- MRSA HA 5; 6- MRSA HA 7; 7- MRSA HA 9; 8- MRSA HA 10; 9- Staphylococcus epidermidis ; 10- MRSA HA 12; 11- MRSA K 1; 12- Bacillus subtilis ; 13- MRSA K 3; 14- MRSA K 5; 15- MRSA K 6; 16- MRSA S 2; 17- B . thuringiensis ; 18- Enterobacter aerogenes ; 19- Acinetobacter baumannii ; 20- MRSA S 8; 21- Staphylococcus haemolyticus ; 22- MRSA S 10; 23- Salmonella typhi ; 24- Salmonella typhimurium ; 25- Staphylococcus aureus; 26- MRSA S 12. ‘+’ indicates a positive result. Triangle arrowhead shows the band position.
    Pcr Amplifications, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 2457 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplifications/product/Bio-Rad
    Average 99 stars, based on 2457 article reviews
    Price from $9.99 to $1999.99
    pcr amplifications - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Expression of the mea-1 allele during early seed development. Amplification of MEA-1 ( top ) and ACTIN-11 ( ACT11 ) as a control for cDNA synthesis. RNA was isolated from siliques derived from self-pollinated mea-1 homozygous pistils ( mea × mea ), self-pollinated wild-type pistils (wt × wt), a cross between a homozygous mea-1 female and wild-type male ( mea × wt), and a cross between wild-type female and homozygous mea-1 male (wt × mea ). Primers that specifically amplify the mea-1 allele under these PCR conditions were used for RT–PCR. (M) Marker lane; (G) genomic DNA as a control.

    Journal: Genes & Development

    Article Title: Maintenance of genomic imprinting at the Arabidopsis medea locus requires zygotic DDM1 activity

    doi:

    Figure Lengend Snippet: Expression of the mea-1 allele during early seed development. Amplification of MEA-1 ( top ) and ACTIN-11 ( ACT11 ) as a control for cDNA synthesis. RNA was isolated from siliques derived from self-pollinated mea-1 homozygous pistils ( mea × mea ), self-pollinated wild-type pistils (wt × wt), a cross between a homozygous mea-1 female and wild-type male ( mea × wt), and a cross between wild-type female and homozygous mea-1 male (wt × mea ). Primers that specifically amplify the mea-1 allele under these PCR conditions were used for RT–PCR. (M) Marker lane; (G) genomic DNA as a control.

    Article Snippet: For RT–PCR, ∼5 μg of total RNA were treated with 5 units of RNase-free DNase (Boehringer-Mannheim) in 1× PCR buffer (GIBCO-BRL) containing 2.5 m m MgCl2 at 37°C for 30 min. After heat inactivation at 80°C for 5 min, samples were extracted with phenol-chloroform-isoamyl alcohol (25:24:1), and precipitated with ethanol.

    Techniques: Expressing, Microelectrode Array, Amplification, Isolation, Derivative Assay, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Marker

    Agarose gel (2%) showing PCR amplification of TLR-4 (a, b) and restriction digestion of PCR products (c, d). Lanes M:Φ×BsuR1(HaeIII)[NEB]; 5-11 (c) and 1,2,6-9 (d): wild-type allele; 1,2 (c) and 3,4,10 (d) heterozygous alleles; 3,4 (c) and 11 (d): homozygous variant allele

    Journal: Indian Journal of Urology : IJU : Journal of the Urological Society of India

    Article Title: Asp299Gly and Thr399Ile polymorphism of TLR-4 gene in patients with prostate cancer from North India

    doi: 10.4103/0970-1591.109982

    Figure Lengend Snippet: Agarose gel (2%) showing PCR amplification of TLR-4 (a, b) and restriction digestion of PCR products (c, d). Lanes M:Φ×BsuR1(HaeIII)[NEB]; 5-11 (c) and 1,2,6-9 (d): wild-type allele; 1,2 (c) and 3,4,10 (d) heterozygous alleles; 3,4 (c) and 11 (d): homozygous variant allele

    Article Snippet: Polymerase chain reaction Polymerase chain reaction (PCR) amplification of TLR-4 gene fragments was performed in Perkin Elmer thermocycler (USA) using gene-specific primers [ ].

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Variant Assay

    Human cerebral organoids recapitulate various brain region identities a, RT-PCR for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain cDNA was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.

    Journal: Nature

    Article Title: Cerebral organoids model human brain development and microcephaly

    doi: 10.1038/nature12517

    Figure Lengend Snippet: Human cerebral organoids recapitulate various brain region identities a, RT-PCR for forebrain markers (BF1 and Six3) and hindbrain markers (Krox20 and Isl1) at 12, 16 and 20 days of differentiation. Human fetal brain cDNA was used as positive control. b, Immunohistochemistry in serial sections for the forebrain marker Pax6 (red, first panel) and the hindbrain markers Krox20 (green, first panel) and Pax2 (red, second panel) at 16 days of differentiation. Note the juxtaposition reminiscent of the mid-hindbrain boundary (arrows). DAPI marks nuclei (blue). c,-i, Staining for various brain region identities: forebrain, FoxG1 ( c ); dorsal cortex, Emx1 ( d ); prefrontal cortex (note the discrete boundary, arrow), Auts2 ( e ); hippocampus, Nrp2, Fzd9, Prox1 ( f ); ventral forebrain, Nkx2.1 ( g ) and choroid plexus, TTR ( i ). g, Staining for adjacent ventral (arrow) and dorsal (Pax6, arrowhead) forebrain and for calretinin (green) in a serial section revealing cortical interneurons in the ventral region (arrow). Calretinin interneurons within dorsal cortex ( h ) exhibit typical morphology of tangential migration (arrows). j, Hematoxylin-eosin staining of retinal tissue exhibiting stereotypical layering: retinal pigment epithelium (RPE), outer nuclear layer (ONL) and inner nuclear layer (INL). Scale bars: 100 μm.

    Article Snippet: The CDK5RAP2 expression construct was generated using the Gateway system (Invitrogen) by PCR amplification of CDK5RAP2 from MGC human CDK5RAP2 cDNA (clone ID: 9052276) using the primers with AttB sites: Forward: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGATGGACTTGGTGTTGGAAGA, Reverse: GGGGACCACTTTGTACAAGAAAGCTGGGTCAGCTTTATTGGCTGAAAGTTCTTCTC.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Positive Control, Immunohistochemistry, Marker, Staining, Migration

    PCR results of mecA gene in 7 isolates staphylococcus epidermidis. Column 10: Size marker (50 bp). Column 8, 1-6: Isolates of Staphylococcus epidermidis containing mecA gene. Column 7: Positive control of staphylococcus aureus ATC 33591. Column 9: Negative control of staphylococcus aureus ATCC 25923

    Journal: Advanced Biomedical Research

    Article Title: Detection of methicillin-resistance gene in Staphylococcus epidermidis strains isolated from patients in Al-Zahra Hospital using polymerase chain reaction and minimum inhibitory concentration methods

    doi: 10.4103/2277-9175.108008

    Figure Lengend Snippet: PCR results of mecA gene in 7 isolates staphylococcus epidermidis. Column 10: Size marker (50 bp). Column 8, 1-6: Isolates of Staphylococcus epidermidis containing mecA gene. Column 7: Positive control of staphylococcus aureus ATC 33591. Column 9: Negative control of staphylococcus aureus ATCC 25923

    Article Snippet: The following primers were used for PCR amplification of mecA gene:[ ] mecA-F: 5′-TGGCTATCGTGTCACAATCG-3′ mecA-R: 5′-CTGGAACTTGTTGAGCAGAG-3′ PCR was performed in a mixture of 25 μl volume containing: 2.5 μl 10 × buffer (Roche Germany, Berlin), 0.4 μl of each dNTP (200 μm), 2.5 μl (50 mm) MgCl2, 2.5 U of Taq DNA polymerase, 10 pmol of each primer, and 5 μl of template DNA.

    Techniques: Polymerase Chain Reaction, Marker, Positive Control, Negative Control

    Genotyping results for the rs1333049 using the melting temperature shift polymerase chain reaction.

    Journal: Clinical Psychopharmacology and Neuroscience

    Article Title: Association of CDKN2B-AS1 rs1333049 with Brain Diseases: A Case-control Study and a Meta-analysis

    doi: 10.9758/cpn.2017.15.1.53

    Figure Lengend Snippet: Genotyping results for the rs1333049 using the melting temperature shift polymerase chain reaction.

    Article Snippet: The polymerase chain reaction (PCR) amplification for genotyping was performed on the Roche Light Cycler® 480 (Roche, Mannheim, Germany) according to the manufacturer’s instructions.

    Techniques: Polymerase Chain Reaction

    TFE3 and TFEB increase TMEM55B expression to cluster lysosomes during starvation. a – c ARPE-19 cells were infected with adenovirus expressing TFE3-S321A-Myc, TFEB-S211A-FLAG, or null virus for 36 h. a Relative quantitative real-time PCR analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH mRNA, n = 4). b Representative immunoblot of lysates from TFE3-S321A-Myc and TFEB-S211A-FLAG expressing cells. c Quantification of TMEM55B protein levels. d Control MEFs untreated or starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against TFE3. e – g Relative quantitative real-time PCR analysis of e MCOLN1, f TMEM55B and g TMEM55A mRNA transcript levels from null- or TFE3/TFEB knockout MEFs, untreated or starved in EBSS for 4 h (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH) n = 6 from three independent experiments. h HeLa cells stably expressing control or TFEB shRNAs were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. i HeLa cells expressing control, TMEM55B, and JIP4 RNAis were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. j Quantification of lysosome distribution, percentage of total fluorescence signal detected > 15 μm from nuclear rim. Quantified results are presented as mean ± s.e.m. using two-tailed t -test ∗ P

    Journal: Nature Communications

    Article Title: TFEB regulates lysosomal positioning by modulating TMEM55B expression and JIP4 recruitment to lysosomes

    doi: 10.1038/s41467-017-01871-z

    Figure Lengend Snippet: TFE3 and TFEB increase TMEM55B expression to cluster lysosomes during starvation. a – c ARPE-19 cells were infected with adenovirus expressing TFE3-S321A-Myc, TFEB-S211A-FLAG, or null virus for 36 h. a Relative quantitative real-time PCR analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH mRNA, n = 4). b Representative immunoblot of lysates from TFE3-S321A-Myc and TFEB-S211A-FLAG expressing cells. c Quantification of TMEM55B protein levels. d Control MEFs untreated or starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against TFE3. e – g Relative quantitative real-time PCR analysis of e MCOLN1, f TMEM55B and g TMEM55A mRNA transcript levels from null- or TFE3/TFEB knockout MEFs, untreated or starved in EBSS for 4 h (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH) n = 6 from three independent experiments. h HeLa cells stably expressing control or TFEB shRNAs were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. i HeLa cells expressing control, TMEM55B, and JIP4 RNAis were starved in EBSS for 4 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1. j Quantification of lysosome distribution, percentage of total fluorescence signal detected > 15 μm from nuclear rim. Quantified results are presented as mean ± s.e.m. using two-tailed t -test ∗ P

    Article Snippet: GFP-TMEM55A and GFP-TMEM55B expression vectors were generated by cloning the full-length encoding sequence of human TMEM55A and TMEM55B obtained by PCR amplification from human heart marathon-ready cDNA (Takara Bio USA, Inc.) followed by in-frame cloning into EcoRI-SalI sites of pmEGFP-C2 (Takara Bio USA, Inc.) or pCiNeo-3xHA with a GFP or 3 in tandem HA tags fused to the amino-termini of TMEM55B respectively.

    Techniques: Expressing, Infection, Real-time Polymerase Chain Reaction, Knock-Out, Stable Transfection, Fluorescence, Two Tailed Test

    TFEB/3 and SREBF2 co-operate to regulate TMEM55B levels in response to changes in cholesterol levels. a , b HeLa cells were treated with drugs to deplete cellular cholesterol for 120 h, treated with 10 μM U18666A for 18 h, or left untreated. a Relative quantitative real-time PCR analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH mRNA, using two-tailed t-test ** P

    Journal: Nature Communications

    Article Title: TFEB regulates lysosomal positioning by modulating TMEM55B expression and JIP4 recruitment to lysosomes

    doi: 10.1038/s41467-017-01871-z

    Figure Lengend Snippet: TFEB/3 and SREBF2 co-operate to regulate TMEM55B levels in response to changes in cholesterol levels. a , b HeLa cells were treated with drugs to deplete cellular cholesterol for 120 h, treated with 10 μM U18666A for 18 h, or left untreated. a Relative quantitative real-time PCR analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to GAPDH mRNA, using two-tailed t-test ** P

    Article Snippet: GFP-TMEM55A and GFP-TMEM55B expression vectors were generated by cloning the full-length encoding sequence of human TMEM55A and TMEM55B obtained by PCR amplification from human heart marathon-ready cDNA (Takara Bio USA, Inc.) followed by in-frame cloning into EcoRI-SalI sites of pmEGFP-C2 (Takara Bio USA, Inc.) or pCiNeo-3xHA with a GFP or 3 in tandem HA tags fused to the amino-termini of TMEM55B respectively.

    Techniques: Real-time Polymerase Chain Reaction, Two Tailed Test

    TMEM55B regulates lysosomal positioning. a Schematic of the predicted membrane topology of TMEM55B. b ARPE-19 cells transfected with GFP-TMEM55B for 18 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1 (top) or HRS (bottom). Insets represent a 3.2- (top) and 4.5- (bottom) fold magnification of the indicated areas. c ARPE-19 cells infected with adenovirus expressing GFP-TMEM55B for 30 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1 (top) or EEA1 (bottom). Arrows denote bulk of lysosomal accumulation. d HeLa cells infected with adenovirus expressing GFP-TMEM55B for 30 h. Cells were fixed permeabilized and immunostained with antibodies against LAMP-1. Arrows denote bulk of lysosomal accumulation. e , f HeLa cells treated with TMEM55B or Control siRNAs for 6 days. e Relative quantitative real-time PCR analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to actin mRNA from three independent experiments; ∗∗∗ P

    Journal: Nature Communications

    Article Title: TFEB regulates lysosomal positioning by modulating TMEM55B expression and JIP4 recruitment to lysosomes

    doi: 10.1038/s41467-017-01871-z

    Figure Lengend Snippet: TMEM55B regulates lysosomal positioning. a Schematic of the predicted membrane topology of TMEM55B. b ARPE-19 cells transfected with GFP-TMEM55B for 18 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1 (top) or HRS (bottom). Insets represent a 3.2- (top) and 4.5- (bottom) fold magnification of the indicated areas. c ARPE-19 cells infected with adenovirus expressing GFP-TMEM55B for 30 h. Cells were fixed, permeabilized, and immunostained with antibodies against LAMP-1 (top) or EEA1 (bottom). Arrows denote bulk of lysosomal accumulation. d HeLa cells infected with adenovirus expressing GFP-TMEM55B for 30 h. Cells were fixed permeabilized and immunostained with antibodies against LAMP-1. Arrows denote bulk of lysosomal accumulation. e , f HeLa cells treated with TMEM55B or Control siRNAs for 6 days. e Relative quantitative real-time PCR analysis of TMEM55B mRNA transcript levels (mean ± s.e.m. of the RNA fold change of indicated TMEM55B normalized to actin mRNA from three independent experiments; ∗∗∗ P

    Article Snippet: GFP-TMEM55A and GFP-TMEM55B expression vectors were generated by cloning the full-length encoding sequence of human TMEM55A and TMEM55B obtained by PCR amplification from human heart marathon-ready cDNA (Takara Bio USA, Inc.) followed by in-frame cloning into EcoRI-SalI sites of pmEGFP-C2 (Takara Bio USA, Inc.) or pCiNeo-3xHA with a GFP or 3 in tandem HA tags fused to the amino-termini of TMEM55B respectively.

    Techniques: Transfection, Infection, Expressing, Real-time Polymerase Chain Reaction

    RORγ regulates the rhythmic expression of Prox1. ( A ) Genome-wide mapping of ROR-binding sites by ChIP-Seq analysis showed a strong association of both RORγ and RORα with several sites within the Prox1 gene in mouse liver. Arrows indicate the peaks corresponding to ROR recruitment. Gene tracks were taken from the UCSC Genome Browser using the mouse mm9 reference genome. A, B and C indicate peaks common to RORα and RORγ ChIP-Seq analysis. ( B ) ChIP–QPCR was performed using either anti-RORγ or -RORα antibody and chromatin prepared from the livers ( n = 4) collected from WT mice at ZT22. The putative ROR-binding sites A, B and C were amplified by ChIP–QPCR analysis. Amplification of Gapdh and a non-specific IgG antibody served as negative controls. Data represent mean ± SEM. ( C ) ROR enhanced the transactivation of the Luc reporter driven by the A and B sites. Huh-7 cells were co-transfected with pCMV-β-Gal, pCMV10-3× Flag-RORγ or -RORα and pGL4.27 reporter plasmid under the control of either the ROR-binding site A, B or C. Data represent mean ± SEM. ( D ) RORγ regulates the rhythmic expression of Prox1 . Circadian expression of Prox1 was analyzed by QRT–PCR in liver tissue isolated from WT, RORγ − / − or RORα sg/sg mice ( n = 4) every 4 h over a period of 24 h. The 24 h expression pattern was double-plotted. ( E ) Exogenous expression of RORγ in mouse primary hepatocyte ( n = 3) increased Prox1 transcription. Data represent mean ± SD, * P

    Journal: Nucleic Acids Research

    Article Title: Prospero-related homeobox 1 (Prox1) functions as a novel modulator of retinoic acid-related orphan receptors ?- and ?-mediated transactivation

    doi: 10.1093/nar/gkt447

    Figure Lengend Snippet: RORγ regulates the rhythmic expression of Prox1. ( A ) Genome-wide mapping of ROR-binding sites by ChIP-Seq analysis showed a strong association of both RORγ and RORα with several sites within the Prox1 gene in mouse liver. Arrows indicate the peaks corresponding to ROR recruitment. Gene tracks were taken from the UCSC Genome Browser using the mouse mm9 reference genome. A, B and C indicate peaks common to RORα and RORγ ChIP-Seq analysis. ( B ) ChIP–QPCR was performed using either anti-RORγ or -RORα antibody and chromatin prepared from the livers ( n = 4) collected from WT mice at ZT22. The putative ROR-binding sites A, B and C were amplified by ChIP–QPCR analysis. Amplification of Gapdh and a non-specific IgG antibody served as negative controls. Data represent mean ± SEM. ( C ) ROR enhanced the transactivation of the Luc reporter driven by the A and B sites. Huh-7 cells were co-transfected with pCMV-β-Gal, pCMV10-3× Flag-RORγ or -RORα and pGL4.27 reporter plasmid under the control of either the ROR-binding site A, B or C. Data represent mean ± SEM. ( D ) RORγ regulates the rhythmic expression of Prox1 . Circadian expression of Prox1 was analyzed by QRT–PCR in liver tissue isolated from WT, RORγ − / − or RORα sg/sg mice ( n = 4) every 4 h over a period of 24 h. The 24 h expression pattern was double-plotted. ( E ) Exogenous expression of RORγ in mouse primary hepatocyte ( n = 3) increased Prox1 transcription. Data represent mean ± SD, * P

    Article Snippet: Prox1 and Prox1 mutants were generated by polymerase chain reaction (PCR) amplification and cDNA fragments inserted into the EcoRI and XhoI sites of pCMV-Myc and pEGFP-C1 (Clontech, Palo Alto, CA, USA), or the EcoRI and SalI sites of pMAL-c2X (New England BioLabs, Inc., Ipswich, MA, USA).

    Techniques: Expressing, Genome Wide, Binding Assay, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Mouse Assay, Amplification, Transfection, Plasmid Preparation, Quantitative RT-PCR, Isolation

    Prox1 represses transcription of ROR target genes. ( A ) Confirmation of the downregulation of Prox1 mRNA and protein levels in Huh-7 cells transfected with either control siRNA or Prox1 siRNA for 3 days. Gapdh mRNA and protein was used as an internal control. ( B ) Effect of the downregulation of Prox1 expression on the expression of RORγ , Bmal1 , Npas2 , Cry1 , Avpr1a , Pepck and Elovl3 . Gene expression levels in Huh-7 cells treated with either siRNA-control or siRNA-Prox1 ( n = 3) were analyzed by QRT–PCR. Data represent mean ± SD. ( C ) ChIP–QPCR was performed using anti-Prox1 antibody and chromatin prepared from Huh-7 treated with either siRNA-control or siRNA-Prox1 ( n = 3). The recruitment of Prox1 to the conserved ROREs of human Bmal1 , Npas2 and Cry1 was analyzed. Using non-specific IgG antibody and amplification of Gapdh served as a negative control. Data represent mean ± SEM, ** P

    Journal: Nucleic Acids Research

    Article Title: Prospero-related homeobox 1 (Prox1) functions as a novel modulator of retinoic acid-related orphan receptors ?- and ?-mediated transactivation

    doi: 10.1093/nar/gkt447

    Figure Lengend Snippet: Prox1 represses transcription of ROR target genes. ( A ) Confirmation of the downregulation of Prox1 mRNA and protein levels in Huh-7 cells transfected with either control siRNA or Prox1 siRNA for 3 days. Gapdh mRNA and protein was used as an internal control. ( B ) Effect of the downregulation of Prox1 expression on the expression of RORγ , Bmal1 , Npas2 , Cry1 , Avpr1a , Pepck and Elovl3 . Gene expression levels in Huh-7 cells treated with either siRNA-control or siRNA-Prox1 ( n = 3) were analyzed by QRT–PCR. Data represent mean ± SD. ( C ) ChIP–QPCR was performed using anti-Prox1 antibody and chromatin prepared from Huh-7 treated with either siRNA-control or siRNA-Prox1 ( n = 3). The recruitment of Prox1 to the conserved ROREs of human Bmal1 , Npas2 and Cry1 was analyzed. Using non-specific IgG antibody and amplification of Gapdh served as a negative control. Data represent mean ± SEM, ** P

    Article Snippet: Prox1 and Prox1 mutants were generated by polymerase chain reaction (PCR) amplification and cDNA fragments inserted into the EcoRI and XhoI sites of pCMV-Myc and pEGFP-C1 (Clontech, Palo Alto, CA, USA), or the EcoRI and SalI sites of pMAL-c2X (New England BioLabs, Inc., Ipswich, MA, USA).

    Techniques: Transfection, Expressing, Quantitative RT-PCR, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Amplification, Negative Control

    PCR amplified object fragment. The agarose gel electrophoresis revealed that the object band was in the expected position. M, DL2000 DNA marker; 1 and 2, PCR product (502 bp) cDNA. PCR, polymerase chain reaction.

    Journal: Molecular Medicine Reports

    Article Title: Lentivirus transduced interleukin-1 receptor antagonist gene expression in murine bone marrow-derived mesenchymal stem cells in vitro

    doi: 10.3892/mmr.2015.4003

    Figure Lengend Snippet: PCR amplified object fragment. The agarose gel electrophoresis revealed that the object band was in the expected position. M, DL2000 DNA marker; 1 and 2, PCR product (502 bp) cDNA. PCR, polymerase chain reaction.

    Article Snippet: The IL-1Ra cDNA was amplified using a polymerase chain reaction (PCR) machine (Takara Bio, Inc.) and the expression vector was cloned and validated by sequencing (Invitrogen Life Technologies).

    Techniques: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Marker

    Specificity of MRSA PCR using 17 strains of MRSA. M- 100 bp DNA ladder; C- Negative control; 1- MRSA HA 1; 2- MRSA HA 2; 3- MRSA HA 3; 4- MRSA HA 4; 5- MRSA HA 5; 6- MRSA HA 7; 7- MRSA HA 9; 8- MRSA HA 10; 9- Staphylococcus epidermidis ; 10- MRSA HA 12; 11- MRSA K 1; 12- Bacillus subtilis ; 13- MRSA K 3; 14- MRSA K 5; 15- MRSA K 6; 16- MRSA S 2; 17- B . thuringiensis ; 18- Enterobacter aerogenes ; 19- Acinetobacter baumannii ; 20- MRSA S 8; 21- Staphylococcus haemolyticus ; 22- MRSA S 10; 23- Salmonella typhi ; 24- Salmonella typhimurium ; 25- Staphylococcus aureus; 26- MRSA S 12. ‘+’ indicates a positive result. Triangle arrowhead shows the band position.

    Journal: PLoS ONE

    Article Title: Molecular Detection of Methicillin-Resistant Staphylococcus aureus by Non-Protein Coding RNA-Mediated Monoplex Polymerase Chain Reaction

    doi: 10.1371/journal.pone.0158736

    Figure Lengend Snippet: Specificity of MRSA PCR using 17 strains of MRSA. M- 100 bp DNA ladder; C- Negative control; 1- MRSA HA 1; 2- MRSA HA 2; 3- MRSA HA 3; 4- MRSA HA 4; 5- MRSA HA 5; 6- MRSA HA 7; 7- MRSA HA 9; 8- MRSA HA 10; 9- Staphylococcus epidermidis ; 10- MRSA HA 12; 11- MRSA K 1; 12- Bacillus subtilis ; 13- MRSA K 3; 14- MRSA K 5; 15- MRSA K 6; 16- MRSA S 2; 17- B . thuringiensis ; 18- Enterobacter aerogenes ; 19- Acinetobacter baumannii ; 20- MRSA S 8; 21- Staphylococcus haemolyticus ; 22- MRSA S 10; 23- Salmonella typhi ; 24- Salmonella typhimurium ; 25- Staphylococcus aureus; 26- MRSA S 12. ‘+’ indicates a positive result. Triangle arrowhead shows the band position.

    Article Snippet: PCR amplifications were carried out using a Bio-Rad DNA Engine thermal cycler with single initial denaturation step (95°C for 300 s), 34 cycles of denaturation (95°C for 30 s), annealing (61°C for 30 s), and extension (72° for 30 s), followed by a final extension step (72°C for 600 s).

    Techniques: Polymerase Chain Reaction, Negative Control

    Specificity of MRSA PCR using various bacteria. M- 100bp DNA ladder; C- control; 1- Bacillus subtilis; 2- Salmonella typhi; 3- Shigella flexneri; 4- Salmonella typhimurium; 5- Staphylococcus epidermidis; 6- Pseudomonas aeruginosa; 7- Aeromonas hydrophila; 8- Acinetobacter baumannii .; 9- Citrobacter freundii; 10- Enterobacter aerogenes; 11- Klebsiella pneumoniae; 12- Staphylococcus aureus ; 13- Methicillin-resistant Staphylococcus aureus ; 14- Vibrio cholerae .’+’ indicates a positive result. Triangle arrowhead shows the band position. Lower panel is the scanned image from the ImageJ software.

    Journal: PLoS ONE

    Article Title: Molecular Detection of Methicillin-Resistant Staphylococcus aureus by Non-Protein Coding RNA-Mediated Monoplex Polymerase Chain Reaction

    doi: 10.1371/journal.pone.0158736

    Figure Lengend Snippet: Specificity of MRSA PCR using various bacteria. M- 100bp DNA ladder; C- control; 1- Bacillus subtilis; 2- Salmonella typhi; 3- Shigella flexneri; 4- Salmonella typhimurium; 5- Staphylococcus epidermidis; 6- Pseudomonas aeruginosa; 7- Aeromonas hydrophila; 8- Acinetobacter baumannii .; 9- Citrobacter freundii; 10- Enterobacter aerogenes; 11- Klebsiella pneumoniae; 12- Staphylococcus aureus ; 13- Methicillin-resistant Staphylococcus aureus ; 14- Vibrio cholerae .’+’ indicates a positive result. Triangle arrowhead shows the band position. Lower panel is the scanned image from the ImageJ software.

    Article Snippet: PCR amplifications were carried out using a Bio-Rad DNA Engine thermal cycler with single initial denaturation step (95°C for 300 s), 34 cycles of denaturation (95°C for 30 s), annealing (61°C for 30 s), and extension (72° for 30 s), followed by a final extension step (72°C for 600 s).

    Techniques: Polymerase Chain Reaction, Software