|
Sangon Biotech
tctagcagagcacggatgtgtttg3 Tctagcagagcacggatgtgtttg3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38/10__1016_slash_j__isci__2025__113396-606-34-35?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
tctagcagagcacggatgtgtttg3 - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
R&D Systems
pan p38 α ![]() Pan P38 α, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38/pmc03944267-122-114-122?v=R%26D+Systems Average 94 stars, based on 1 article reviews
pan p38 α - by Bioz Stars,
2026-06
94/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
p p38 ![]() P P38, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38/us11352399-145-41-49?v=Santa+Cruz+Biotechnology Average 96 stars, based on 1 article reviews
p p38 - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Proteintech
p38 66234 1 ig mouse ![]() P38 66234 1 Ig Mouse, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38/pmc12512320__13287_2025_4666_MOESM1_ESM-13-135-140?v=Proteintech Average 96 stars, based on 1 article reviews
p38 66234 1 ig mouse - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Elabscience Biotechnology
nfκb ![]() Nfκb, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38/10__3390_slash_cells15080667-77-17-19?v=Elabscience+Biotechnology Average 96 stars, based on 1 article reviews
nfκb - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
OriGene
anti phosphorylated p p38 mapk ![]() Anti Phosphorylated P P38 Mapk, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38/pm30320396-75-18-52?v=OriGene Average 94 stars, based on 1 article reviews
anti phosphorylated p p38 mapk - by Bioz Stars,
2026-06
94/100 stars
|
Buy from Supplier |
|
Addgene inc
p38 construct ![]() P38 Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38/pmc07460594-156-1-5?v=Addgene+inc Average 93 stars, based on 1 article reviews
p38 construct - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
OriGene
p38α cdna ![]() P38α Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38/pm23110695-141-0-2?v=OriGene Average 90 stars, based on 1 article reviews
p38α cdna - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
p38 map kinase inhibitor sb203580 ![]() P38 Map Kinase Inhibitor Sb203580, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38/10__1074_slash_jbc__m500639200-19-22-43?v=Santa+Cruz+Biotechnology Average 93 stars, based on 1 article reviews
p38 map kinase inhibitor sb203580 - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
R&D Systems
p38α r d systems af8691 western ![]() P38α R D Systems Af8691 Western, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38/pm29930081-496-0-1?v=R%26D+Systems Average 93 stars, based on 1 article reviews
p38α r d systems af8691 western - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
OriGene
p38 ![]() P38, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38/pm28518137-284-91-93?v=OriGene Average 90 stars, based on 1 article reviews
p38 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
OriGene
aha1 gfp plasmid ![]() Aha1 Gfp Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38/pmc04861406-132-0-5?v=OriGene Average 90 stars, based on 1 article reviews
aha1 gfp plasmid - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell Death & Disease
Article Title: Cell differentiation versus cell death: extracellular glucose is a key determinant of cell fate following oxidative stress exposure
doi: 10.1038/cddis.2014.52
Figure Lengend Snippet: Transcriptional activity of FOXO1 and HIF1 α is governed by p38. ( a ) Activity of a FOXO luciferase reporter was significantly higher in peroxide-treated cells cultured in high but not low glucose compared with untreated controls. ( b ) Levels of phosphorylated p38 (as determined by western blot) were higher in peroxide-treated cells cultured in low but not high glucose compared with untreated controls. ( c ) Protein levels of HIF1 α were higher in peroxide-treated cells cultured in either high or low glucose. Protein levels of HIF1 α were also higher in untreated cells cultured in low glucose compared with untreated cells cultured in high glucose. ( d ) Activity of a HIF luciferase reporter was significantly higher than untreated controls in peroxide-treated cells cultured in low but not high glucose. ( e ) In low glucose, activity of the HIF reporter was significantly lower in peroxide-treated cells cotreated with a p38 inhibitor (SB202190, 10 nM) compared with cells treated with peroxide alone. ( f ) Activity of the FOXO luciferase reporter was significantly higher in peroxide-treated cells in low glucose cotreated with the p38 inhibitor compared with non-inhibitor-treated cells. ( g ) RNA levels of SOD2 were significantly higher in peroxide-treated cells in low glucose compared with untreated controls. Knockdown of FOXO1 by RNAi had no effect on SOD2 RNA expression. However, ( h ) SOD2 RNA levels were significantly lower in peroxide-treated cells in which Hif1 α expression had been knocked down by RNAi. Statistically significant ( P ≤0.05) differences between treatments are indicated by *. ( i ) Activity of the HIF luciferase reporter (black bars) and FOXO luciferase reporter (white bars) in peroxide-treated cells cultured in varying concentrations of glucose compared with non-peroxide-treated cells (assigned the arbitrary value of 1 and shown by the dashed line). There was no difference in FOXO or HIF reporter activity between non-peroxide-treated cells cultured in different concentrations of glucose. Statistically significant ( P ≤0.05) differences in either FOXO or HIF reporter activity between peroxide-treated cells and untreated controls for each glucose concentration are indicated by *. Results are expressed as mean±S.D. All experiments were performed on cells isolated from at least three different patients. Images shown are representative of those obtained for all patients
Article Snippet: Primary antibodies used in this study were as follows: sirtuin 1 clone E54, Novus Biologicals, Cambridge, UK; p53 clone DO-1, Life Technologies, Paisley, UK; FOXO3a clone 75D8, FKHR (FOXO1) clone EP927Y, phospho-FOXO1 (Ser256) (cat. no. 9461), acetylated p53 (K382) clone EPR358(2), sirtuin 3 clone C73E3, phospho-p53 (cat. no. 9284P); phospho-Akt (S473) (clone 193H12 and pan Akt (cat. no. 9272), all from Cell Signaling Technologies, Danvers, MA, USA; Bim (cat. no. 202000), Merck KGaA, Darmstadt, Germany; HIF1 α (cat. no. 610959), BD Biosciences, Oxford, UK; acetyl-FOXO1 (K259, K262, K271) (cat. no. sc-49437) Santa Cruz Biotechnology; scleraxis (cat. no. ab58655), Abcam, Cambridge, UK; sox9 (cat. no. HPA001758) Sigma, Poole, UK; phospho-p38 (T180/Y182) (cat. no. AF869) and
Techniques: Activity Assay, Luciferase, Cell Culture, Western Blot, Knockdown, RNA Expression, Expressing, Concentration Assay, Isolation
Journal: Cell Death & Disease
Article Title: Cell differentiation versus cell death: extracellular glucose is a key determinant of cell fate following oxidative stress exposure
doi: 10.1038/cddis.2014.52
Figure Lengend Snippet: Proposed mechanism for the differential response of tenocytes to oxidative stress under different extracellular glucose concentrations. Oxidative stress results in upregulation of both FOXO1 as well as HIF1 α . Under high-glucose conditions, miR28-5p levels are also upregulated, particularly in oxidative stress-exposed cells. miR28-5p directly inhibits expression of the p53 deacetylase sirtuin 3, allowing accumulation of acetylated p53. FOXO1 promotes transcription of bim , the gene product of which is a proapoptotic protein. p53 inhibits expression of miR17-92, a cluster of miRNAs including the bim repressor miR17-5p. Downregulation of miR17-92 by p53 coupled with increased bim transcription by FOXO1 allows accumulation of bim RNA levels and increased bim-mediated apoptosis. Under low-glucose conditions, however, the miR28-5p–sirt3-p53 pathway is not stimulated. Instead, p38 MAPK is activated and acts on both FOXO1 and HIF1 α , resulting in the inhibition of FOXO1 transcriptional activity and activation of HIF1 α . HIF1 α promotes the expression of sox9 and scleraxis , two genes whose products are essential for tenocyte differentiation
Article Snippet: Primary antibodies used in this study were as follows: sirtuin 1 clone E54, Novus Biologicals, Cambridge, UK; p53 clone DO-1, Life Technologies, Paisley, UK; FOXO3a clone 75D8, FKHR (FOXO1) clone EP927Y, phospho-FOXO1 (Ser256) (cat. no. 9461), acetylated p53 (K382) clone EPR358(2), sirtuin 3 clone C73E3, phospho-p53 (cat. no. 9284P); phospho-Akt (S473) (clone 193H12 and pan Akt (cat. no. 9272), all from Cell Signaling Technologies, Danvers, MA, USA; Bim (cat. no. 202000), Merck KGaA, Darmstadt, Germany; HIF1 α (cat. no. 610959), BD Biosciences, Oxford, UK; acetyl-FOXO1 (K259, K262, K271) (cat. no. sc-49437) Santa Cruz Biotechnology; scleraxis (cat. no. ab58655), Abcam, Cambridge, UK; sox9 (cat. no. HPA001758) Sigma, Poole, UK; phospho-p38 (T180/Y182) (cat. no. AF869) and
Techniques: Expressing, Histone Deacetylase Assay, Inhibition, Activity Assay, Activation Assay
Journal: Molecular medicine reports
Article Title: Helicobacter pylori infection enhances heparanase leading to cell proliferation via mitogen‑activated protein kinase signalling in human gastric cancer cells.
doi: 10.3892/mmr.2018.9558
Figure Lengend Snippet: Figure 2. H. pylori infection mediates the HPA protein expression increase in MKN‑45 cells via the MAPK signalling pathway. (A) Western blotting was used to detect the expression levels of p‑p38 MAPK, p38 MAPK, p‑p65 NF‑κB and p65 NF‑κB following different co‑culture durations. (B) p‑p38 MAPK protein expression. (C) p‑p65 NF‑κB protein expression levels were quantitatively analysed using densitometry. (D) Western blots and (E) quantitatively analysed expression of NF‑κB in MKN‑45 cells pre‑treated with SB203580 prior to co‑culture with H. pylori. *P<0.05 and **P<0.01, as indicated. MAPK, mitogen‑activated protein kinase; NF‑κB, nuclear factor‑κB; p‑, phosphorylated; H. pylori or Hp, Helicobacter pylori.
Article Snippet: Following the blocking step, the membranes were incubated with the following primary antibodies: anti-HPA1 (1:1,000; cat. no. ab128931),
Techniques: Infection, Expressing, Western Blot
Journal: International Journal of Molecular Sciences
Article Title: P38 Regulates Kainic Acid-Induced Seizure and Neuronal Firing via Kv4.2 Phosphorylation
doi: 10.3390/ijms21165921
Figure Lengend Snippet: p38 mitogen-activated protein kinase (MAPK) contributed to kainic acid-induced seizure in WT mice but not Kv4.2TA mice. ( A ) Time course of mean behavioral seizure score following kainic acid injection. The mean behavioral seizure score was significantly reduced in Kv4.2TA mice compared to WT mice. Furthermore, p38 inhibitor SB 203580 significantly reduced behavioral seizure score following kainic acid injection in WT mice but not in Kv4.2TA mice, n = 13–15 for each group, two-way ANOVA, * p < 0.05. ( B ) Total behavioral seizure score for each group, n = 13–15 for each group, t -test, * p < 0.05. ( C ) Latency to stage 3 seizure for each group. n = 13–15 for each group, t -test, ** p < 0.01.
Article Snippet: The
Techniques: Injection
Journal: International Journal of Molecular Sciences
Article Title: P38 Regulates Kainic Acid-Induced Seizure and Neuronal Firing via Kv4.2 Phosphorylation
doi: 10.3390/ijms21165921
Figure Lengend Snippet: p38 MAPK contributes to kainic acid-induced Kv4.2 phosphorylation at T607. ( A ) SB 203580, a potent p38 inhibitor (20 mg/kg, i.p., 15 min), blocked kainic acid-induced phosphorylation of Kv4.2 T607 in mouse hippocampus. ( B ) Statistical analysis of the effect of SB 203580 on kainic acid-induced phosphorylation of Kv4.2 at Thr607 in mouse hippocampus, n = 4–6 in each group, t -test, ** p < 0.01.
Article Snippet: The
Techniques: Phospho-proteomics
Journal: International Journal of Molecular Sciences
Article Title: P38 Regulates Kainic Acid-Induced Seizure and Neuronal Firing via Kv4.2 Phosphorylation
doi: 10.3390/ijms21165921
Figure Lengend Snippet: p38 MAPK colocalizes with Kv4.2. ( A ) HEK293T cells were transfected with GFP-Kv4.2 and Flag-p38. Cells were fixed and stained with GFP and Flag to show co-localization. Scale bar: 20 μm. ( B ) High magnification images and line scan analysis of colocalization. Scale bar: 5 μm. ( C ) Mouse brains were co-stained with Kv4.2 and pp38 antibody. Phosphorylated p38 is localized in the cell body and dendrites as well. Scale bar: 20 μm. ( D ) High magnification images showing Kv4.2 and pp38 colocalized in dendrites, as indicated with arrow heads. Scale bar: 5 μm.
Article Snippet: The
Techniques: Transfection, Staining
Journal: International Journal of Molecular Sciences
Article Title: P38 Regulates Kainic Acid-Induced Seizure and Neuronal Firing via Kv4.2 Phosphorylation
doi: 10.3390/ijms21165921
Figure Lengend Snippet: Kainic acid activates p38 MAPK in both WT and Kv4.2TA mice. ( A ) Immunostaining analysis showed p38 phosphorylation increased with kainic acid administration (25 mg/kg, i.p., 30 min) in mouse hippocampus, n = 26 cells in each group, t -test, *** p < 0.001. ( B ) Western blot analysis showed p38 phosphorylation increased with kainic acid administration (25 mg/kg, i.p., 30 min) in hippocampus in both WT and Kv4.2TA mice, n = 4–6 cells in each group, t -test, *** p < 0.001.
Article Snippet: The
Techniques: Immunostaining, Phospho-proteomics, Western Blot
Journal: International Journal of Molecular Sciences
Article Title: P38 Regulates Kainic Acid-Induced Seizure and Neuronal Firing via Kv4.2 Phosphorylation
doi: 10.3390/ijms21165921
Figure Lengend Snippet: p38 impacts hippocampal pyramidal neuron excitability through Kv4.2. ( A ) Current step of +300 pA induces repetitive firing in pyramidal neurons recorded from WT and Kv4.2TA mice with or without SB 203580 treatment. Scale 40 mV/250 ms. Square current inset 300 pA. ( B ) Sequential somatic current injections increasing in magnitude reveal p38 kinase inhibition reduces AP firing frequency in WT hippocampal neurons at +300 pA relative to vehicle ( n = 15 in vehicle, n = 19 in treatment; two-way ANOVA, * p < 0.05). Kv4.2TA neurons display reduced firing frequency at +300 pA relative to WT in vehicle, which is augmented in the presence of SB 203580 such that current magnitudes of +200 and +250 pA also exhibit significant differences ( n = 18 in vehicle, n = 14 in SB 203580; two-way ANOVA, * p < 0.05; *** p < 0.001). ( C ) Inter-spike intervals measured between the first two spikes in a train evoked by 150 pA injection display no significant difference among groups. Kruskal–Wallis test, p > 0.05. ( D ) Ramp current injections evoke repetitive firing in all pyramidal neurons recorded in each condition. Arrow indicates point at which action potential (AP) threshold, rheobase, and latency to fire were measured. Ramp current inset 400 pA/s. ( E ) Minimum current to elicit AP firing at threshold (rheobase) is not significantly different among the populations. One-way ANOVA, p > 0.05. ( F ) Latency to fire in response to ramp injection is not significantly different among populations. Kruskal–Wallis test, p > 0.05.
Article Snippet: The
Techniques: Inhibition, Injection
Journal: BMC cell biology
Article Title: Phosphorylation of p68 RNA helicase by p38 MAP kinase contributes to colon cancer cells apoptosis induced by oxaliplatin.
doi: 10.1186/1471-2121-13-27
Figure Lengend Snippet: Figure 2 MAPKPhosphorylation of p68 by p38 MAPK. (A) Threonine phosphorylations of p68 in HCT116 cells that are treated with 20 μM of oxaliplatin for different times are analyzed by immunobloting the p68 that are immunoiprecipitated (IP:p68) from cell lysates using antibody against phorsphor-threonine (IB:14B3). Phosphorylation of p38 MAPK under the same treatment is analyzed by immunoblot of cell lysates using antibody against the phosphorylated p38. Immunoblot of p68 (IB:p68) in the immunoprecipitates indicate the amounts of p68 that are precipitated. Immunoblot of p38 in the cell lysate (IB:p38) indicate the cellular levels of p38, as a loading control. (B) Co-immunoprecipitation of p38 and p68 in the cell extracts of HCT116 cells with/without oxaliplatin treatment (Oxa, +/−20 μM) was analyzed by immunoblot of p68 immunoprecipitates (IP:p68) using antibody against p38 (IB:p38). Immunoblot of p68 (IB:p68) in the immunoprecipitates indicate the amounts of p68 that are precipitated. IP:IgG is the immunoprecipitation using rabbit IgG, serving as a negative control IP. (C) Phosphorylation of recombinant His-p68 or BSA, as a control, by recombinant p38 in the presence of [γ-32P]-ATP is revealed by autoradiography. The amounts of proteins used in the phosphorylation reactions are shown by coomasie blue stains (CBS). (D) Phosphorylation of p68 by exogenous expression of Flag-tagged p38 MAPK, wild type and constitutively active mutant D176A-F327L, in HCT116 cells are analyzed by immunoblotting the p68 that are immunoiprecipitated (IP:p68) from cell lysates using antibody against phorsphor-threonine (IB:14B3). Immunoblot of p68 (IB:p68) in immunoprecipitates indicate the amounts of p68 that are precipitated. Immunoblot of Flag-tag (IB:FLAG) indicate the exogenous p38 levels. Immunoblot of GAPDH (IB:GAPDH) is a loading control.
Article Snippet:
Techniques: Western Blot, Phospho-proteomics, Control, Immunoprecipitation, Negative Control, Recombinant, Autoradiography, Expressing, Mutagenesis, FLAG-tag
Journal: BMC cell biology
Article Title: Phosphorylation of p68 RNA helicase by p38 MAP kinase contributes to colon cancer cells apoptosis induced by oxaliplatin.
doi: 10.1186/1471-2121-13-27
Figure Lengend Snippet: Figure 3 Phosphorylation site(s) of p68 by p38 MAPK. (A) Prediction of potential p38 MAPK phosphorylation site(s) in the p68 reading frame and compared to the consensus p38 MAPK phosphorylation sites of several authentic p38 MAPK substrates by a web-based phosphorylation site prediction program NetPhos 2.0, (B) Phosphorylation of recombinant His-p68 and mutants with single site mutation (Upper) and double site mutations (Lower) by recombinant p38 in the presence of [γ-32P]-ATP is revealed by autoradiography. The amounts of proteins used in the phosphorylation reactions are shown by coomasie blue stains (CBS). (C) Phosphorylation of exogenously expressed HA-p68s, wild type (WT) and mutants (Single site mutation, Upper, and Double site mutations, Lower), in HCT116 cells with/without oxaliplatin treatment (Oxa, +/−) are analyzed by immunoblotting the p68 that is immunoiprecipitated (IP:p68) from cell lysates using antibody against phorsphor-theronine (IB:14B3). Immunoblot of p68 (IB:p68) in immunoprecipitates indicate the amounts of p68 that are precipitated.
Article Snippet:
Techniques: Phospho-proteomics, Recombinant, Mutagenesis, Autoradiography, Western Blot
Journal: Journal of Biological Chemistry
Article Title: Constitutively Active Homo-oligomeric Angiotensin II Type 2 Receptor Induces Cell Signaling Independent of Receptor Conformation and Ligand Stimulation
doi: 10.1074/jbc.m500639200
Figure Lengend Snippet: FIG. 1. a, AT2 receptors form homo-oligomerization and up-regulate after serum-free conditions in PC12W cells. Cell membrane was prepared under serum or serum-free conditions, subjected to SDS-gel electrophoresis under non-reducing conditions, and immunoblotted with anti-AT2 receptor antibody. 30 g of protein was used in each lane. Bmax on the AT2 receptors was also analyzed by Scatchard plot analysis. b, AT2-WT-EGFP receptor localized in the cell membrane after 24 h under serum-free conditions. EGFP- and AT2-WT-EGFP receptor-expressing CHO cell lines were grown under serum or serum-free conditions and stained with DAPI to visualize nuclear morphology as assessed by a laser scanning confocal microscope. Arrows indicate AT2-WT-EGFP receptor translocation in the cell membrane. c, AT2-WT-EGFP receptor induced apoptosis after 48 h under serum-free conditions. AT2-WT-EGFP receptor- and AT2-N127G-EGFP receptor-expressing CHO cell lines were grown under serum conditions or for up to 48 h under serum-free conditions, stained with DAPI, and imaged by a digital fluorescent microscope. d, pharmacological intervention in apoptosis mediated by AT2-WT-EGFP receptor and AT2-N127G-EGFP receptor was analyzed by treating cells under serum conditions and with or without 10 M p38 MAPK inhibitor (SB203580) and 1 M caspase-3 inhibitor (DEVD-cmk) for 48 h under serum-free conditions. Data are shown as the percentage of apoptotic cells in three independent experiments as assessed by TUNEL as described under “Experimental Procedures.” Histograms show that AT2-WT-EGFP receptor transfected CHO cells induced apoptosis under serum (A) or after 48 h serum-free conditions (B). 65% of AT2-WT-EGFP receptor transfected CHO cells showed apoptosis after 48 h of serum-free conditions. *, p 0.05 versus serum conditions. t, p 0.05 versus serum-free conditions without treatment. Data are given as mean S.E. (n 4). e, the AT2 receptor formed a homo-oligomer in the cell membrane. Cell membranes were prepared in serum-free conditions for 24 h, subjected to SDS-gel electro- phoresis after being pretreated with () or without ( ) DTT under non-reducing conditions, and immunoblotted with anti-EGFP antibody. 20 mg of protein was used in each lane. Arrows indicate the monomer and dimer species of the receptor. f, AT2-WT-EGFP receptor formed only homo-oligomer, whereas AT2-N127G-EGFP receptor formed both homo-oligomer and monomer in the cell membrane. Cell membranes were prepared in serum () or serum-free ( ) conditions for up to 48 h, subjected to SDS-gel electrophoresis under non-reducing conditions, and immunoblotted with anti-EGFP antibody. 40 g of protein was used in each lane. Arrows indicate the monomer and dimer species of the receptor. Representative immunoblots (a, d, and f) and pictures (b and c) are shown. Three independent determinations were performed, and similar results were observed (a–d and f).
Article Snippet: Materials—The following antibodies and reagents were generously provided as indicated or purchased: AT2 receptor-selective non-peptide antagonist PD123319 (Research Biochemical International) and the
Techniques: Membrane, SDS-Gel, Electrophoresis, Expressing, Staining, Microscopy, Translocation Assay, TUNEL Assay, Transfection, Western Blot
Journal: Journal of cell science
Article Title: p38δ MAPK regulates aggresome biogenesis by phosphorylating SQSTM1 in response to proteasomal stress.
doi: 10.1242/jcs.216671
Figure Lengend Snippet: Figure 1.p38 and p38 are activated by proteasome inhibition and
Article Snippet:
Techniques: Inhibition
Journal: Journal of cell science
Article Title: p38δ MAPK regulates aggresome biogenesis by phosphorylating SQSTM1 in response to proteasomal stress.
doi: 10.1242/jcs.216671
Figure Lengend Snippet: Figure 2. p38 is targeted to aggresomes during proteasome inhibition.
Article Snippet:
Techniques: Inhibition
Journal: Journal of cell science
Article Title: p38δ MAPK regulates aggresome biogenesis by phosphorylating SQSTM1 in response to proteasomal stress.
doi: 10.1242/jcs.216671
Figure Lengend Snippet: Figure 3. Proteasome inhibition induced the association of p38 with
Article Snippet:
Techniques: Inhibition
Journal: Journal of cell science
Article Title: p38δ MAPK regulates aggresome biogenesis by phosphorylating SQSTM1 in response to proteasomal stress.
doi: 10.1242/jcs.216671
Figure Lengend Snippet: Figure 4. Proteasome inhibition-activated p38 phosphorylated SQSTM1.
Article Snippet:
Techniques: Inhibition