oligos Millipore Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Millipore dsdna oligos
    Correlative light and electron spectroscopic imaging (LM/ESI) of SK-N-SH cells expressing LacI-tagged SC35 using fluorogold <t>dsDNA</t> <t>oligos.</t> Detection of nuclear speckles (arrow) via the Cy3 fluorophore ( A , left panel), and confirmation of gold conjugation to the dsDNA oligo through silver enhancement (A, right panel). Untransfected cells (arrowhead) contain background levels of silver deposition. Scale bar = 200 nm. ( B ) Overlay of fluorescence and low magnification ESI micrographs collected at 155 eV. With two rounds of the silver enhancement using a LM enhancement kit (B, left panel), the silver particles are visible as bright spots. The right panel is an overlay image of a nucleus containing EM-enhanced gold. Scale bar = 2 μm. An area corresponding to an IGC, as defined by a box in the left panel is analysed at high resolution, and maps of phosphorus ( C , red panel) and nitrogen (C, green panel) show the ultrastructure of the IGC region, which is low in phosphorus content and contains protein-based fibrous structures. The fluorogold oligo localization is indicated with silver-enhanced gold particles false-coloured in white. The composite map ( D , left panel) illustrates the position of the IGC relative to chromatin (Ch, yellow) and the nucleolus (Nu, yellow-green). The silver particles in the interior of the IGC are labelled with arrowheads, whereas those proximal to the neighbouring chromatin are indicated by arrows. The composite map (D, right panel) of the EM-enhanced nucleus (B, right panel) contains smaller but uniform silver particles, as indicated by the arrows and arrowheads. Scale bar = 5 μm.
    Dsdna Oligos, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dsdna oligos/product/Millipore
    Average 95 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    dsdna oligos - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    93
    Millipore antisense oligonucleotides
    Correlative light and electron spectroscopic imaging (LM/ESI) of SK-N-SH cells expressing LacI-tagged SC35 using fluorogold <t>dsDNA</t> <t>oligos.</t> Detection of nuclear speckles (arrow) via the Cy3 fluorophore ( A , left panel), and confirmation of gold conjugation to the dsDNA oligo through silver enhancement (A, right panel). Untransfected cells (arrowhead) contain background levels of silver deposition. Scale bar = 200 nm. ( B ) Overlay of fluorescence and low magnification ESI micrographs collected at 155 eV. With two rounds of the silver enhancement using a LM enhancement kit (B, left panel), the silver particles are visible as bright spots. The right panel is an overlay image of a nucleus containing EM-enhanced gold. Scale bar = 2 μm. An area corresponding to an IGC, as defined by a box in the left panel is analysed at high resolution, and maps of phosphorus ( C , red panel) and nitrogen (C, green panel) show the ultrastructure of the IGC region, which is low in phosphorus content and contains protein-based fibrous structures. The fluorogold oligo localization is indicated with silver-enhanced gold particles false-coloured in white. The composite map ( D , left panel) illustrates the position of the IGC relative to chromatin (Ch, yellow) and the nucleolus (Nu, yellow-green). The silver particles in the interior of the IGC are labelled with arrowheads, whereas those proximal to the neighbouring chromatin are indicated by arrows. The composite map (D, right panel) of the EM-enhanced nucleus (B, right panel) contains smaller but uniform silver particles, as indicated by the arrows and arrowheads. Scale bar = 5 μm.
    Antisense Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 143 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense oligonucleotides/product/Millipore
    Average 93 stars, based on 143 article reviews
    Price from $9.99 to $1999.99
    antisense oligonucleotides - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    77
    Millipore ribo oligonucleotides
    Correlative light and electron spectroscopic imaging (LM/ESI) of SK-N-SH cells expressing LacI-tagged SC35 using fluorogold <t>dsDNA</t> <t>oligos.</t> Detection of nuclear speckles (arrow) via the Cy3 fluorophore ( A , left panel), and confirmation of gold conjugation to the dsDNA oligo through silver enhancement (A, right panel). Untransfected cells (arrowhead) contain background levels of silver deposition. Scale bar = 200 nm. ( B ) Overlay of fluorescence and low magnification ESI micrographs collected at 155 eV. With two rounds of the silver enhancement using a LM enhancement kit (B, left panel), the silver particles are visible as bright spots. The right panel is an overlay image of a nucleus containing EM-enhanced gold. Scale bar = 2 μm. An area corresponding to an IGC, as defined by a box in the left panel is analysed at high resolution, and maps of phosphorus ( C , red panel) and nitrogen (C, green panel) show the ultrastructure of the IGC region, which is low in phosphorus content and contains protein-based fibrous structures. The fluorogold oligo localization is indicated with silver-enhanced gold particles false-coloured in white. The composite map ( D , left panel) illustrates the position of the IGC relative to chromatin (Ch, yellow) and the nucleolus (Nu, yellow-green). The silver particles in the interior of the IGC are labelled with arrowheads, whereas those proximal to the neighbouring chromatin are indicated by arrows. The composite map (D, right panel) of the EM-enhanced nucleus (B, right panel) contains smaller but uniform silver particles, as indicated by the arrows and arrowheads. Scale bar = 5 μm.
    Ribo Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 77/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ribo oligonucleotides/product/Millipore
    Average 77 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    ribo oligonucleotides - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    80
    Millipore sgrna oligonucleotides
    Pharmacological inhibition or genetic depletion of <t>JAK2</t> in MHH-CALL4 B-ALL cells induces an anti-proliferative response and not apoptosis. ( A ) CellTrace violet (CTV)-stained MHH-CALL4 cells were treated with vehicle (dimethylsulfoxide [DMSO]; black) or 1000 nM ruxolitinib (red). Cells were serially passaged for up to 8 d and subjected to assessment of their proliferative capacity by flow cytometry every 2 d. Drugs were replenished to the indicated concentration every 2 d. Data are representative of n = 3 performed in duplicate. ( B ) MHH-CALL4 cells were transduced with constitutive (pLMS-GFP) retroviral vectors harboring shRNAs targeting JAK2 (sh JAK2 .209 or sh JAK2 .2826) or scrambled (sh SCR ). Immunoblotting was performed against the indicated targets using lysates from shRNA + cells (GFP + ) at day 5 after transduction. Tubulin served as loading control. ( C ) Gene set enrichment analysis (GSEA) from 3′RNA sequencing (3′RNA-seq) analysis demonstrates negative enrichment of the indicated JAK/STAT gene set in MHH-CALL4-pLMS-sh JAK2 .209 cells relative to MHH-CALL4-pLMS-sh SCR cells at day 5 after transduction. (NES) Normalized enrichment score; (FDR) false discovery rate. ( D , E ) Transduced and nontransduced populations from B were passaged in vitro for 19 d. ( D ) The percentage of Annexin V + /GFP + cells was assessed by flow cytometry (individual bars represent days 5, 8, 9, 12, 14, 16, and 19 after transduction). ( E ) The percentage of shRNA + cells (GFP + ) was assessed by flow cytometry, and data were normalized to day 5. ( F ) Immunoblotting against the indicated target was performed against MHH–CALL4–Cas9 cells transduced with lentiviral vector (FgH1tUTG-GFP) expressing single guide RNAs (sgRNAs) targeting JAK2 (sh JAK2 .9901 or sh JAK2 .9903) at day 6 after <t>sgRNA</t> induction. β-Actin served as loading control. ( G ) Transduced populations from F were assessed for percentage Annexin V/DAPI positivity by flow cytometry at the indicated time points. ( H ) Transduced and nontransduced populations from F were passaged in vitro for 16 d. The percentage of sgRNA + cells (GFP + ) was assessed by flow cytometry (individual bars represent days 3, 5, 7, 9, 12, 14, and 16 after sgRNA induction). ( I ) MHH-CALL4 cells were transduced with pLMS-sh JAK2 .209 or pLMS-sh SCR . At day 14 after transduction, cell cycle analysis was performed by flow cytometric analysis of BrdU incorporation versus DNA content (7-AAD). Error bars in D , E , G , and I represent SEM ( n = 2); error bars in H represent SEM ( n = 3). (**) P
    Sgrna Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 80/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgrna oligonucleotides/product/Millipore
    Average 80 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    sgrna oligonucleotides - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    82
    Millipore wellred oligonucleotides
    Pharmacological inhibition or genetic depletion of <t>JAK2</t> in MHH-CALL4 B-ALL cells induces an anti-proliferative response and not apoptosis. ( A ) CellTrace violet (CTV)-stained MHH-CALL4 cells were treated with vehicle (dimethylsulfoxide [DMSO]; black) or 1000 nM ruxolitinib (red). Cells were serially passaged for up to 8 d and subjected to assessment of their proliferative capacity by flow cytometry every 2 d. Drugs were replenished to the indicated concentration every 2 d. Data are representative of n = 3 performed in duplicate. ( B ) MHH-CALL4 cells were transduced with constitutive (pLMS-GFP) retroviral vectors harboring shRNAs targeting JAK2 (sh JAK2 .209 or sh JAK2 .2826) or scrambled (sh SCR ). Immunoblotting was performed against the indicated targets using lysates from shRNA + cells (GFP + ) at day 5 after transduction. Tubulin served as loading control. ( C ) Gene set enrichment analysis (GSEA) from 3′RNA sequencing (3′RNA-seq) analysis demonstrates negative enrichment of the indicated JAK/STAT gene set in MHH-CALL4-pLMS-sh JAK2 .209 cells relative to MHH-CALL4-pLMS-sh SCR cells at day 5 after transduction. (NES) Normalized enrichment score; (FDR) false discovery rate. ( D , E ) Transduced and nontransduced populations from B were passaged in vitro for 19 d. ( D ) The percentage of Annexin V + /GFP + cells was assessed by flow cytometry (individual bars represent days 5, 8, 9, 12, 14, 16, and 19 after transduction). ( E ) The percentage of shRNA + cells (GFP + ) was assessed by flow cytometry, and data were normalized to day 5. ( F ) Immunoblotting against the indicated target was performed against MHH–CALL4–Cas9 cells transduced with lentiviral vector (FgH1tUTG-GFP) expressing single guide RNAs (sgRNAs) targeting JAK2 (sh JAK2 .9901 or sh JAK2 .9903) at day 6 after <t>sgRNA</t> induction. β-Actin served as loading control. ( G ) Transduced populations from F were assessed for percentage Annexin V/DAPI positivity by flow cytometry at the indicated time points. ( H ) Transduced and nontransduced populations from F were passaged in vitro for 16 d. The percentage of sgRNA + cells (GFP + ) was assessed by flow cytometry (individual bars represent days 3, 5, 7, 9, 12, 14, and 16 after sgRNA induction). ( I ) MHH-CALL4 cells were transduced with pLMS-sh JAK2 .209 or pLMS-sh SCR . At day 14 after transduction, cell cycle analysis was performed by flow cytometric analysis of BrdU incorporation versus DNA content (7-AAD). Error bars in D , E , G , and I represent SEM ( n = 2); error bars in H represent SEM ( n = 3). (**) P
    Wellred Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 82/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wellred oligonucleotides/product/Millipore
    Average 82 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    wellred oligonucleotides - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    92
    Millipore primer oligonucleotides
    Pharmacological inhibition or genetic depletion of <t>JAK2</t> in MHH-CALL4 B-ALL cells induces an anti-proliferative response and not apoptosis. ( A ) CellTrace violet (CTV)-stained MHH-CALL4 cells were treated with vehicle (dimethylsulfoxide [DMSO]; black) or 1000 nM ruxolitinib (red). Cells were serially passaged for up to 8 d and subjected to assessment of their proliferative capacity by flow cytometry every 2 d. Drugs were replenished to the indicated concentration every 2 d. Data are representative of n = 3 performed in duplicate. ( B ) MHH-CALL4 cells were transduced with constitutive (pLMS-GFP) retroviral vectors harboring shRNAs targeting JAK2 (sh JAK2 .209 or sh JAK2 .2826) or scrambled (sh SCR ). Immunoblotting was performed against the indicated targets using lysates from shRNA + cells (GFP + ) at day 5 after transduction. Tubulin served as loading control. ( C ) Gene set enrichment analysis (GSEA) from 3′RNA sequencing (3′RNA-seq) analysis demonstrates negative enrichment of the indicated JAK/STAT gene set in MHH-CALL4-pLMS-sh JAK2 .209 cells relative to MHH-CALL4-pLMS-sh SCR cells at day 5 after transduction. (NES) Normalized enrichment score; (FDR) false discovery rate. ( D , E ) Transduced and nontransduced populations from B were passaged in vitro for 19 d. ( D ) The percentage of Annexin V + /GFP + cells was assessed by flow cytometry (individual bars represent days 5, 8, 9, 12, 14, 16, and 19 after transduction). ( E ) The percentage of shRNA + cells (GFP + ) was assessed by flow cytometry, and data were normalized to day 5. ( F ) Immunoblotting against the indicated target was performed against MHH–CALL4–Cas9 cells transduced with lentiviral vector (FgH1tUTG-GFP) expressing single guide RNAs (sgRNAs) targeting JAK2 (sh JAK2 .9901 or sh JAK2 .9903) at day 6 after <t>sgRNA</t> induction. β-Actin served as loading control. ( G ) Transduced populations from F were assessed for percentage Annexin V/DAPI positivity by flow cytometry at the indicated time points. ( H ) Transduced and nontransduced populations from F were passaged in vitro for 16 d. The percentage of sgRNA + cells (GFP + ) was assessed by flow cytometry (individual bars represent days 3, 5, 7, 9, 12, 14, and 16 after sgRNA induction). ( I ) MHH-CALL4 cells were transduced with pLMS-sh JAK2 .209 or pLMS-sh SCR . At day 14 after transduction, cell cycle analysis was performed by flow cytometric analysis of BrdU incorporation versus DNA content (7-AAD). Error bars in D , E , G , and I represent SEM ( n = 2); error bars in H represent SEM ( n = 3). (**) P
    Primer Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 69 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer oligonucleotides/product/Millipore
    Average 92 stars, based on 69 article reviews
    Price from $9.99 to $1999.99
    primer oligonucleotides - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    77
    Millipore mutagenic oligonucleotides
    Pharmacological inhibition or genetic depletion of <t>JAK2</t> in MHH-CALL4 B-ALL cells induces an anti-proliferative response and not apoptosis. ( A ) CellTrace violet (CTV)-stained MHH-CALL4 cells were treated with vehicle (dimethylsulfoxide [DMSO]; black) or 1000 nM ruxolitinib (red). Cells were serially passaged for up to 8 d and subjected to assessment of their proliferative capacity by flow cytometry every 2 d. Drugs were replenished to the indicated concentration every 2 d. Data are representative of n = 3 performed in duplicate. ( B ) MHH-CALL4 cells were transduced with constitutive (pLMS-GFP) retroviral vectors harboring shRNAs targeting JAK2 (sh JAK2 .209 or sh JAK2 .2826) or scrambled (sh SCR ). Immunoblotting was performed against the indicated targets using lysates from shRNA + cells (GFP + ) at day 5 after transduction. Tubulin served as loading control. ( C ) Gene set enrichment analysis (GSEA) from 3′RNA sequencing (3′RNA-seq) analysis demonstrates negative enrichment of the indicated JAK/STAT gene set in MHH-CALL4-pLMS-sh JAK2 .209 cells relative to MHH-CALL4-pLMS-sh SCR cells at day 5 after transduction. (NES) Normalized enrichment score; (FDR) false discovery rate. ( D , E ) Transduced and nontransduced populations from B were passaged in vitro for 19 d. ( D ) The percentage of Annexin V + /GFP + cells was assessed by flow cytometry (individual bars represent days 5, 8, 9, 12, 14, 16, and 19 after transduction). ( E ) The percentage of shRNA + cells (GFP + ) was assessed by flow cytometry, and data were normalized to day 5. ( F ) Immunoblotting against the indicated target was performed against MHH–CALL4–Cas9 cells transduced with lentiviral vector (FgH1tUTG-GFP) expressing single guide RNAs (sgRNAs) targeting JAK2 (sh JAK2 .9901 or sh JAK2 .9903) at day 6 after <t>sgRNA</t> induction. β-Actin served as loading control. ( G ) Transduced populations from F were assessed for percentage Annexin V/DAPI positivity by flow cytometry at the indicated time points. ( H ) Transduced and nontransduced populations from F were passaged in vitro for 16 d. The percentage of sgRNA + cells (GFP + ) was assessed by flow cytometry (individual bars represent days 3, 5, 7, 9, 12, 14, and 16 after sgRNA induction). ( I ) MHH-CALL4 cells were transduced with pLMS-sh JAK2 .209 or pLMS-sh SCR . At day 14 after transduction, cell cycle analysis was performed by flow cytometric analysis of BrdU incorporation versus DNA content (7-AAD). Error bars in D , E , G , and I represent SEM ( n = 2); error bars in H represent SEM ( n = 3). (**) P
    Mutagenic Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 77/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mutagenic oligonucleotides/product/Millipore
    Average 77 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    mutagenic oligonucleotides - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    83
    Millipore n15 oligonucleotides
    Pharmacological inhibition or genetic depletion of <t>JAK2</t> in MHH-CALL4 B-ALL cells induces an anti-proliferative response and not apoptosis. ( A ) CellTrace violet (CTV)-stained MHH-CALL4 cells were treated with vehicle (dimethylsulfoxide [DMSO]; black) or 1000 nM ruxolitinib (red). Cells were serially passaged for up to 8 d and subjected to assessment of their proliferative capacity by flow cytometry every 2 d. Drugs were replenished to the indicated concentration every 2 d. Data are representative of n = 3 performed in duplicate. ( B ) MHH-CALL4 cells were transduced with constitutive (pLMS-GFP) retroviral vectors harboring shRNAs targeting JAK2 (sh JAK2 .209 or sh JAK2 .2826) or scrambled (sh SCR ). Immunoblotting was performed against the indicated targets using lysates from shRNA + cells (GFP + ) at day 5 after transduction. Tubulin served as loading control. ( C ) Gene set enrichment analysis (GSEA) from 3′RNA sequencing (3′RNA-seq) analysis demonstrates negative enrichment of the indicated JAK/STAT gene set in MHH-CALL4-pLMS-sh JAK2 .209 cells relative to MHH-CALL4-pLMS-sh SCR cells at day 5 after transduction. (NES) Normalized enrichment score; (FDR) false discovery rate. ( D , E ) Transduced and nontransduced populations from B were passaged in vitro for 19 d. ( D ) The percentage of Annexin V + /GFP + cells was assessed by flow cytometry (individual bars represent days 5, 8, 9, 12, 14, 16, and 19 after transduction). ( E ) The percentage of shRNA + cells (GFP + ) was assessed by flow cytometry, and data were normalized to day 5. ( F ) Immunoblotting against the indicated target was performed against MHH–CALL4–Cas9 cells transduced with lentiviral vector (FgH1tUTG-GFP) expressing single guide RNAs (sgRNAs) targeting JAK2 (sh JAK2 .9901 or sh JAK2 .9903) at day 6 after <t>sgRNA</t> induction. β-Actin served as loading control. ( G ) Transduced populations from F were assessed for percentage Annexin V/DAPI positivity by flow cytometry at the indicated time points. ( H ) Transduced and nontransduced populations from F were passaged in vitro for 16 d. The percentage of sgRNA + cells (GFP + ) was assessed by flow cytometry (individual bars represent days 3, 5, 7, 9, 12, 14, and 16 after sgRNA induction). ( I ) MHH-CALL4 cells were transduced with pLMS-sh JAK2 .209 or pLMS-sh SCR . At day 14 after transduction, cell cycle analysis was performed by flow cytometric analysis of BrdU incorporation versus DNA content (7-AAD). Error bars in D , E , G , and I represent SEM ( n = 2); error bars in H represent SEM ( n = 3). (**) P
    N15 Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 83/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/n15 oligonucleotides/product/Millipore
    Average 83 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    n15 oligonucleotides - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    78
    Millipore thiolated oligonucleotides
    Pharmacological inhibition or genetic depletion of <t>JAK2</t> in MHH-CALL4 B-ALL cells induces an anti-proliferative response and not apoptosis. ( A ) CellTrace violet (CTV)-stained MHH-CALL4 cells were treated with vehicle (dimethylsulfoxide [DMSO]; black) or 1000 nM ruxolitinib (red). Cells were serially passaged for up to 8 d and subjected to assessment of their proliferative capacity by flow cytometry every 2 d. Drugs were replenished to the indicated concentration every 2 d. Data are representative of n = 3 performed in duplicate. ( B ) MHH-CALL4 cells were transduced with constitutive (pLMS-GFP) retroviral vectors harboring shRNAs targeting JAK2 (sh JAK2 .209 or sh JAK2 .2826) or scrambled (sh SCR ). Immunoblotting was performed against the indicated targets using lysates from shRNA + cells (GFP + ) at day 5 after transduction. Tubulin served as loading control. ( C ) Gene set enrichment analysis (GSEA) from 3′RNA sequencing (3′RNA-seq) analysis demonstrates negative enrichment of the indicated JAK/STAT gene set in MHH-CALL4-pLMS-sh JAK2 .209 cells relative to MHH-CALL4-pLMS-sh SCR cells at day 5 after transduction. (NES) Normalized enrichment score; (FDR) false discovery rate. ( D , E ) Transduced and nontransduced populations from B were passaged in vitro for 19 d. ( D ) The percentage of Annexin V + /GFP + cells was assessed by flow cytometry (individual bars represent days 5, 8, 9, 12, 14, 16, and 19 after transduction). ( E ) The percentage of shRNA + cells (GFP + ) was assessed by flow cytometry, and data were normalized to day 5. ( F ) Immunoblotting against the indicated target was performed against MHH–CALL4–Cas9 cells transduced with lentiviral vector (FgH1tUTG-GFP) expressing single guide RNAs (sgRNAs) targeting JAK2 (sh JAK2 .9901 or sh JAK2 .9903) at day 6 after <t>sgRNA</t> induction. β-Actin served as loading control. ( G ) Transduced populations from F were assessed for percentage Annexin V/DAPI positivity by flow cytometry at the indicated time points. ( H ) Transduced and nontransduced populations from F were passaged in vitro for 16 d. The percentage of sgRNA + cells (GFP + ) was assessed by flow cytometry (individual bars represent days 3, 5, 7, 9, 12, 14, and 16 after sgRNA induction). ( I ) MHH-CALL4 cells were transduced with pLMS-sh JAK2 .209 or pLMS-sh SCR . At day 14 after transduction, cell cycle analysis was performed by flow cytometric analysis of BrdU incorporation versus DNA content (7-AAD). Error bars in D , E , G , and I represent SEM ( n = 2); error bars in H represent SEM ( n = 3). (**) P
    Thiolated Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 78/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/thiolated oligonucleotides/product/Millipore
    Average 78 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    thiolated oligonucleotides - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    78
    Millipore fluorescent oligonucleotides
    Pharmacological inhibition or genetic depletion of <t>JAK2</t> in MHH-CALL4 B-ALL cells induces an anti-proliferative response and not apoptosis. ( A ) CellTrace violet (CTV)-stained MHH-CALL4 cells were treated with vehicle (dimethylsulfoxide [DMSO]; black) or 1000 nM ruxolitinib (red). Cells were serially passaged for up to 8 d and subjected to assessment of their proliferative capacity by flow cytometry every 2 d. Drugs were replenished to the indicated concentration every 2 d. Data are representative of n = 3 performed in duplicate. ( B ) MHH-CALL4 cells were transduced with constitutive (pLMS-GFP) retroviral vectors harboring shRNAs targeting JAK2 (sh JAK2 .209 or sh JAK2 .2826) or scrambled (sh SCR ). Immunoblotting was performed against the indicated targets using lysates from shRNA + cells (GFP + ) at day 5 after transduction. Tubulin served as loading control. ( C ) Gene set enrichment analysis (GSEA) from 3′RNA sequencing (3′RNA-seq) analysis demonstrates negative enrichment of the indicated JAK/STAT gene set in MHH-CALL4-pLMS-sh JAK2 .209 cells relative to MHH-CALL4-pLMS-sh SCR cells at day 5 after transduction. (NES) Normalized enrichment score; (FDR) false discovery rate. ( D , E ) Transduced and nontransduced populations from B were passaged in vitro for 19 d. ( D ) The percentage of Annexin V + /GFP + cells was assessed by flow cytometry (individual bars represent days 5, 8, 9, 12, 14, 16, and 19 after transduction). ( E ) The percentage of shRNA + cells (GFP + ) was assessed by flow cytometry, and data were normalized to day 5. ( F ) Immunoblotting against the indicated target was performed against MHH–CALL4–Cas9 cells transduced with lentiviral vector (FgH1tUTG-GFP) expressing single guide RNAs (sgRNAs) targeting JAK2 (sh JAK2 .9901 or sh JAK2 .9903) at day 6 after <t>sgRNA</t> induction. β-Actin served as loading control. ( G ) Transduced populations from F were assessed for percentage Annexin V/DAPI positivity by flow cytometry at the indicated time points. ( H ) Transduced and nontransduced populations from F were passaged in vitro for 16 d. The percentage of sgRNA + cells (GFP + ) was assessed by flow cytometry (individual bars represent days 3, 5, 7, 9, 12, 14, and 16 after sgRNA induction). ( I ) MHH-CALL4 cells were transduced with pLMS-sh JAK2 .209 or pLMS-sh SCR . At day 14 after transduction, cell cycle analysis was performed by flow cytometric analysis of BrdU incorporation versus DNA content (7-AAD). Error bars in D , E , G , and I represent SEM ( n = 2); error bars in H represent SEM ( n = 3). (**) P
    Fluorescent Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 78/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorescent oligonucleotides/product/Millipore
    Average 78 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    fluorescent oligonucleotides - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    87
    Millipore oligonucleotides targeting atg9a
    Accumulation of ubiquitin, SQSTM1 and NBR1 in <t>atg9a</t> -CKO mouse brains. (A) Immunofluorescence for SQSTM1, ubiquitin and NBR1 in neurons of DCN in atg9a -CKO mice at P15. White arrows indicate colocalization of positive signals for these proteins. Scale bars: 20 μm. (B) Electron micrographs of a DCN neuron in an atg9a -CKO mouse brain at P15. The square in the upper panel is enlarged in the lower panel. Asterisks in both figures indicate an ubiquitin aggregate that is encircled by ER. Scale bars: 1 μm. (C) Immunostaining of ubiquitin, SQSTM1 and NBR1 in the cerebrum cortexes of floxed control, atg7 -CKO and atg9a -CKO mice at 2 and 4 wk of age. Scale bar: 20 µm. (D) Western blot analyses of ubiquitin, SQSTM1, NBR1, ATG7, ATG9A, and MAP1LC3A/B in brain lysates from floxed control, atg7 -CKO and atg9a -CKO mice at 2 and 4 wk of age. Immunostaining for actin is used for an internal control. (E) Quantification of each protein band of SQSTM1 and NBR1. Results are expressed as mean ± SEM. * P
    Oligonucleotides Targeting Atg9a, supplied by Millipore, used in various techniques. Bioz Stars score: 87/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotides targeting atg9a/product/Millipore
    Average 87 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    oligonucleotides targeting atg9a - by Bioz Stars, 2020-02
    87/100 stars
      Buy from Supplier

    93
    Millipore dna oligonucleotides
    Analysis of the capability of Sen1 variants to terminate transcription in vitro . ( A ) Scheme of an in vitro transcription termination assay. A schematic of a ternary EC based on previous biochemical and structural analyses ( 47 , 48 ) is shown on the top. Promoter-independent assembly of ECs is performed using a 9 nt <t>RNA:DNA</t> hybrid that occupies the RNAPII catalytic center. Ternary ECs are attached to streptavidin beads via the 5΄ biotin of the non-template strand allowing subsequent separation of bead-associated (B) and supernatant (S) fractions. The RNA is fluorescently labeled with FAM at the 5΄-end. The transcription template contains a G-less cassette followed by a G-stretch in the non-template strand. After adding an ATP, UTP, CTP mix, the RNAPII transcribes until it encounters the G-rich sequence. Sen1 provokes dissociation of ECs paused at the G-rich stretch and therefore the release of RNAPII and associated transcripts to the supernatant. ( B ) Denaturing <t>PAGE</t> analysis of RNAs from a representative IVTer assay in the absence and in the presence of Sen1 proteins. ( C ) Quantification of the fraction of transcripts released from ECs stalled at the G-stretch as a measure of the termination efficiency. Values represent the average and standard deviation of three independent experiments. The p-value associated with a t -test (p) is indicated.
    Dna Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 483 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna oligonucleotides/product/Millipore
    Average 93 stars, based on 483 article reviews
    Price from $9.99 to $1999.99
    dna oligonucleotides - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    77
    Millipore non sts oligonucleotides
    Analysis of the capability of Sen1 variants to terminate transcription in vitro . ( A ) Scheme of an in vitro transcription termination assay. A schematic of a ternary EC based on previous biochemical and structural analyses ( 47 , 48 ) is shown on the top. Promoter-independent assembly of ECs is performed using a 9 nt <t>RNA:DNA</t> hybrid that occupies the RNAPII catalytic center. Ternary ECs are attached to streptavidin beads via the 5΄ biotin of the non-template strand allowing subsequent separation of bead-associated (B) and supernatant (S) fractions. The RNA is fluorescently labeled with FAM at the 5΄-end. The transcription template contains a G-less cassette followed by a G-stretch in the non-template strand. After adding an ATP, UTP, CTP mix, the RNAPII transcribes until it encounters the G-rich sequence. Sen1 provokes dissociation of ECs paused at the G-rich stretch and therefore the release of RNAPII and associated transcripts to the supernatant. ( B ) Denaturing <t>PAGE</t> analysis of RNAs from a representative IVTer assay in the absence and in the presence of Sen1 proteins. ( C ) Quantification of the fraction of transcripts released from ECs stalled at the G-stretch as a measure of the termination efficiency. Values represent the average and standard deviation of three independent experiments. The p-value associated with a t -test (p) is indicated.
    Non Sts Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 77/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/non sts oligonucleotides/product/Millipore
    Average 77 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    non sts oligonucleotides - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    82
    Millipore grna oligonucleotides
    Functional characterization and modeling of the arm segment region targeted by class II <t>NT5C2</t> mutations. ( A and B ) Graphical representation of mutations selected for in murine leukemic cells infected with a <t>gRNA</t> targeting H405 ( A ) or I416 ( B ) after treatment with vehicle or 2 μM 6-MP. ( C ) Modeling analysis of the top 20 preferred conformations of the flexible arm segment in the inactive and allosterically activated NT5C2. ( D ) A close up view of the proposed interaction between Asp407 and Lys361 causing disruption of the alpha helix stabilizing Asp459 – Lys361 interaction. ( E ) Western blot showing specificity of antibodies generated against the tip region of the arm domain for NT5C2 (left) and in vitro nucleotidase assays of purified wild-type NT5C2 recombinant protein incubated with two unique arm segment antibodies or the arm segment peptide in the presence of increasing doses of ATP (right). Data in E is shown as mean ± s.d. p values were calculated using two-tailed Student’s t- .
    Grna Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 82/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/grna oligonucleotides/product/Millipore
    Average 82 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    grna oligonucleotides - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    78
    Millipore 20 mer oligonucleotides
    Functional characterization and modeling of the arm segment region targeted by class II <t>NT5C2</t> mutations. ( A and B ) Graphical representation of mutations selected for in murine leukemic cells infected with a <t>gRNA</t> targeting H405 ( A ) or I416 ( B ) after treatment with vehicle or 2 μM 6-MP. ( C ) Modeling analysis of the top 20 preferred conformations of the flexible arm segment in the inactive and allosterically activated NT5C2. ( D ) A close up view of the proposed interaction between Asp407 and Lys361 causing disruption of the alpha helix stabilizing Asp459 – Lys361 interaction. ( E ) Western blot showing specificity of antibodies generated against the tip region of the arm domain for NT5C2 (left) and in vitro nucleotidase assays of purified wild-type NT5C2 recombinant protein incubated with two unique arm segment antibodies or the arm segment peptide in the presence of increasing doses of ATP (right). Data in E is shown as mean ± s.d. p values were calculated using two-tailed Student’s t- .
    20 Mer Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 78/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/20 mer oligonucleotides/product/Millipore
    Average 78 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    20 mer oligonucleotides - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    75
    Millipore gapdh oligonucleotides
    Effect of PDTC, calphostin C, and chelerythrine chloride on myotrophin-induced protein synthesis and gene expression in neonatal rat cardiomyocytes. (A) Neonatal myocytes were pretreated with myotrophin antibody (Myo-Ab), 100 μM PDTC, 1 μM of calphostin C, and 10 μM chelerythrine chloride for 60 min and then treated with myotrophin for 24 h in the presence of [ 3 H]leucine. Cells were lysed and incorporation of [ 3 H]leucine into myocytes was measured as described in the text. Data shows the means (±SEM) of three different sets of results. P values compared with control or unstimulated cells. (B) Samples from control and myotrophin-treated neonatal myocytes were treated with or without 100 μM PDTC and 1 μM of calphostin C. Total RNA (20 μg) was hybridized separately with [ 32 P]dATP-labeled c-myc , <t>ANF,</t> or <t>GAPDH</t> oligo probes.
    Gapdh Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 75/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gapdh oligonucleotides/product/Millipore
    Average 75 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    gapdh oligonucleotides - by Bioz Stars, 2020-02
    75/100 stars
      Buy from Supplier

    79
    Millipore oligonucleotides cas9f4gibson cas9r4gibson
    Effect of PDTC, calphostin C, and chelerythrine chloride on myotrophin-induced protein synthesis and gene expression in neonatal rat cardiomyocytes. (A) Neonatal myocytes were pretreated with myotrophin antibody (Myo-Ab), 100 μM PDTC, 1 μM of calphostin C, and 10 μM chelerythrine chloride for 60 min and then treated with myotrophin for 24 h in the presence of [ 3 H]leucine. Cells were lysed and incorporation of [ 3 H]leucine into myocytes was measured as described in the text. Data shows the means (±SEM) of three different sets of results. P values compared with control or unstimulated cells. (B) Samples from control and myotrophin-treated neonatal myocytes were treated with or without 100 μM PDTC and 1 μM of calphostin C. Total RNA (20 μg) was hybridized separately with [ 32 P]dATP-labeled c-myc , <t>ANF,</t> or <t>GAPDH</t> oligo probes.
    Oligonucleotides Cas9f4gibson Cas9r4gibson, supplied by Millipore, used in various techniques. Bioz Stars score: 79/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotides cas9f4gibson cas9r4gibson/product/Millipore
    Average 79 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    oligonucleotides cas9f4gibson cas9r4gibson - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    93
    Millipore rna oligonucleotides
    Effect of PDTC, calphostin C, and chelerythrine chloride on myotrophin-induced protein synthesis and gene expression in neonatal rat cardiomyocytes. (A) Neonatal myocytes were pretreated with myotrophin antibody (Myo-Ab), 100 μM PDTC, 1 μM of calphostin C, and 10 μM chelerythrine chloride for 60 min and then treated with myotrophin for 24 h in the presence of [ 3 H]leucine. Cells were lysed and incorporation of [ 3 H]leucine into myocytes was measured as described in the text. Data shows the means (±SEM) of three different sets of results. P values compared with control or unstimulated cells. (B) Samples from control and myotrophin-treated neonatal myocytes were treated with or without 100 μM PDTC and 1 μM of calphostin C. Total RNA (20 μg) was hybridized separately with [ 32 P]dATP-labeled c-myc , <t>ANF,</t> or <t>GAPDH</t> oligo probes.
    Rna Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 168 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna oligonucleotides/product/Millipore
    Average 93 stars, based on 168 article reviews
    Price from $9.99 to $1999.99
    rna oligonucleotides - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    89
    Millipore single stranded oligonucleotides
    Effect of PDTC, calphostin C, and chelerythrine chloride on myotrophin-induced protein synthesis and gene expression in neonatal rat cardiomyocytes. (A) Neonatal myocytes were pretreated with myotrophin antibody (Myo-Ab), 100 μM PDTC, 1 μM of calphostin C, and 10 μM chelerythrine chloride for 60 min and then treated with myotrophin for 24 h in the presence of [ 3 H]leucine. Cells were lysed and incorporation of [ 3 H]leucine into myocytes was measured as described in the text. Data shows the means (±SEM) of three different sets of results. P values compared with control or unstimulated cells. (B) Samples from control and myotrophin-treated neonatal myocytes were treated with or without 100 μM PDTC and 1 μM of calphostin C. Total RNA (20 μg) was hybridized separately with [ 32 P]dATP-labeled c-myc , <t>ANF,</t> or <t>GAPDH</t> oligo probes.
    Single Stranded Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 89/100, based on 56 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single stranded oligonucleotides/product/Millipore
    Average 89 stars, based on 56 article reviews
    Price from $9.99 to $1999.99
    single stranded oligonucleotides - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    78
    Millipore 70 meric oligonucleotides
    Effect of PDTC, calphostin C, and chelerythrine chloride on myotrophin-induced protein synthesis and gene expression in neonatal rat cardiomyocytes. (A) Neonatal myocytes were pretreated with myotrophin antibody (Myo-Ab), 100 μM PDTC, 1 μM of calphostin C, and 10 μM chelerythrine chloride for 60 min and then treated with myotrophin for 24 h in the presence of [ 3 H]leucine. Cells were lysed and incorporation of [ 3 H]leucine into myocytes was measured as described in the text. Data shows the means (±SEM) of three different sets of results. P values compared with control or unstimulated cells. (B) Samples from control and myotrophin-treated neonatal myocytes were treated with or without 100 μM PDTC and 1 μM of calphostin C. Total RNA (20 μg) was hybridized separately with [ 32 P]dATP-labeled c-myc , <t>ANF,</t> or <t>GAPDH</t> oligo probes.
    70 Meric Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 78/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/70 meric oligonucleotides/product/Millipore
    Average 78 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    70 meric oligonucleotides - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    81
    Millipore cpg oligonucleotides
    Effect of PDTC, calphostin C, and chelerythrine chloride on myotrophin-induced protein synthesis and gene expression in neonatal rat cardiomyocytes. (A) Neonatal myocytes were pretreated with myotrophin antibody (Myo-Ab), 100 μM PDTC, 1 μM of calphostin C, and 10 μM chelerythrine chloride for 60 min and then treated with myotrophin for 24 h in the presence of [ 3 H]leucine. Cells were lysed and incorporation of [ 3 H]leucine into myocytes was measured as described in the text. Data shows the means (±SEM) of three different sets of results. P values compared with control or unstimulated cells. (B) Samples from control and myotrophin-treated neonatal myocytes were treated with or without 100 μM PDTC and 1 μM of calphostin C. Total RNA (20 μg) was hybridized separately with [ 32 P]dATP-labeled c-myc , <t>ANF,</t> or <t>GAPDH</t> oligo probes.
    Cpg Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 81/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cpg oligonucleotides/product/Millipore
    Average 81 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    cpg oligonucleotides - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    91
    Millipore biotinylated oligonucleotides
    Effect of PDTC, calphostin C, and chelerythrine chloride on myotrophin-induced protein synthesis and gene expression in neonatal rat cardiomyocytes. (A) Neonatal myocytes were pretreated with myotrophin antibody (Myo-Ab), 100 μM PDTC, 1 μM of calphostin C, and 10 μM chelerythrine chloride for 60 min and then treated with myotrophin for 24 h in the presence of [ 3 H]leucine. Cells were lysed and incorporation of [ 3 H]leucine into myocytes was measured as described in the text. Data shows the means (±SEM) of three different sets of results. P values compared with control or unstimulated cells. (B) Samples from control and myotrophin-treated neonatal myocytes were treated with or without 100 μM PDTC and 1 μM of calphostin C. Total RNA (20 μg) was hybridized separately with [ 32 P]dATP-labeled c-myc , <t>ANF,</t> or <t>GAPDH</t> oligo probes.
    Biotinylated Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 91/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/biotinylated oligonucleotides/product/Millipore
    Average 91 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    biotinylated oligonucleotides - by Bioz Stars, 2020-02
    91/100 stars
      Buy from Supplier

    95
    Horizon Discovery sirna oligonucleotides
    Effect of PDTC, calphostin C, and chelerythrine chloride on myotrophin-induced protein synthesis and gene expression in neonatal rat cardiomyocytes. (A) Neonatal myocytes were pretreated with myotrophin antibody (Myo-Ab), 100 μM PDTC, 1 μM of calphostin C, and 10 μM chelerythrine chloride for 60 min and then treated with myotrophin for 24 h in the presence of [ 3 H]leucine. Cells were lysed and incorporation of [ 3 H]leucine into myocytes was measured as described in the text. Data shows the means (±SEM) of three different sets of results. P values compared with control or unstimulated cells. (B) Samples from control and myotrophin-treated neonatal myocytes were treated with or without 100 μM PDTC and 1 μM of calphostin C. Total RNA (20 μg) was hybridized separately with [ 32 P]dATP-labeled c-myc , <t>ANF,</t> or <t>GAPDH</t> oligo probes.
    Sirna Oligonucleotides, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 95/100, based on 1016 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna oligonucleotides/product/Horizon Discovery
    Average 95 stars, based on 1016 article reviews
    Price from $9.99 to $1999.99
    sirna oligonucleotides - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    76
    Millipore helicase substrates oligonucleotides
    Purification and analysis of full-length human UPF1 (hUPF1). ( A ) Cartoon of the hUPF1 protein (CH, cysteine–histidine rich domain; SQ, serine–glutamine rich domain; I, II and VI, position of conserved ATP ase motifs). The substitution K498A was made in motif I (Walker A box) to create the ATP ase deficient mutant ( 13 ). ( B ) Superdex S200 gel filtration fractions analysed by SDS-PAGE (hUPF1 123 KDa) and their 5΄–3΄ strand unwinding activity (substrate 5΄d(T) 55 ds20). hUPF1 peak elution volume was 12.4 ml, between the BSA (66 KDa) and ferritin (440 KDa) markers. ( C ) <t>Helicase</t> activity (0.2 nM substrate 5΄d(T) 55 ds20, top strand labeled as shown in (B), 4–40 nM hUPF1) was not observed for variant K498A or for wild-type hUPF1 (WT) without ATP. Boil is the thermally denatured substrate. ( D ) hUPF1 displaced a 20 base oligonucleotide from a substrate with a 5΄ poly d(T) 55 but not a 3΄ poly d(T) 55 (substrate ds20d(T) 55 3΄) overhang (10–40 nM hUPF1, 0.2 nM substrate, bottom strand labeled), n = 3 experimental repeats, mean and standard deviation.
    Helicase Substrates Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 76/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/helicase substrates oligonucleotides/product/Millipore
    Average 76 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    helicase substrates oligonucleotides - by Bioz Stars, 2020-02
    76/100 stars
      Buy from Supplier

    78
    Millipore millipore oligonucleotide synthesizer
    Purification and analysis of full-length human UPF1 (hUPF1). ( A ) Cartoon of the hUPF1 protein (CH, cysteine–histidine rich domain; SQ, serine–glutamine rich domain; I, II and VI, position of conserved ATP ase motifs). The substitution K498A was made in motif I (Walker A box) to create the ATP ase deficient mutant ( 13 ). ( B ) Superdex S200 gel filtration fractions analysed by SDS-PAGE (hUPF1 123 KDa) and their 5΄–3΄ strand unwinding activity (substrate 5΄d(T) 55 ds20). hUPF1 peak elution volume was 12.4 ml, between the BSA (66 KDa) and ferritin (440 KDa) markers. ( C ) <t>Helicase</t> activity (0.2 nM substrate 5΄d(T) 55 ds20, top strand labeled as shown in (B), 4–40 nM hUPF1) was not observed for variant K498A or for wild-type hUPF1 (WT) without ATP. Boil is the thermally denatured substrate. ( D ) hUPF1 displaced a 20 base oligonucleotide from a substrate with a 5΄ poly d(T) 55 but not a 3΄ poly d(T) 55 (substrate ds20d(T) 55 3΄) overhang (10–40 nM hUPF1, 0.2 nM substrate, bottom strand labeled), n = 3 experimental repeats, mean and standard deviation.
    Millipore Oligonucleotide Synthesizer, supplied by Millipore, used in various techniques. Bioz Stars score: 78/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/millipore oligonucleotide synthesizer/product/Millipore
    Average 78 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    millipore oligonucleotide synthesizer - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    81
    Millipore mir 10b oligonucleotides
    Purification and analysis of full-length human UPF1 (hUPF1). ( A ) Cartoon of the hUPF1 protein (CH, cysteine–histidine rich domain; SQ, serine–glutamine rich domain; I, II and VI, position of conserved ATP ase motifs). The substitution K498A was made in motif I (Walker A box) to create the ATP ase deficient mutant ( 13 ). ( B ) Superdex S200 gel filtration fractions analysed by SDS-PAGE (hUPF1 123 KDa) and their 5΄–3΄ strand unwinding activity (substrate 5΄d(T) 55 ds20). hUPF1 peak elution volume was 12.4 ml, between the BSA (66 KDa) and ferritin (440 KDa) markers. ( C ) <t>Helicase</t> activity (0.2 nM substrate 5΄d(T) 55 ds20, top strand labeled as shown in (B), 4–40 nM hUPF1) was not observed for variant K498A or for wild-type hUPF1 (WT) without ATP. Boil is the thermally denatured substrate. ( D ) hUPF1 displaced a 20 base oligonucleotide from a substrate with a 5΄ poly d(T) 55 but not a 3΄ poly d(T) 55 (substrate ds20d(T) 55 3΄) overhang (10–40 nM hUPF1, 0.2 nM substrate, bottom strand labeled), n = 3 experimental repeats, mean and standard deviation.
    Mir 10b Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 81/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mir 10b oligonucleotides/product/Millipore
    Average 81 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    mir 10b oligonucleotides - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    90
    Millipore tmem16f specific oligonucleotides
    <t>TMEM16F</t> is required for annexin A2 and A5 cell surface localisation. (A) TMEM16F-knockout (KO) cells have severely reduced annexin A2 and A5 on their surface. Wild-type (WT), matched controls and TMEM-knockout HeLa cells were incubated in versene (EDTA solution) or not (SFM) for 10 min at 37°C before the eluate was collected and analysed for annexin A2 and A5 by western blotting. A representative western blot is shown ( n =4). (B) Expression of mCherry–mTMEM16F rescues lipid movement in TMEM16F-knockout cells. Wild-type and TMEM16F-knockout HeLa cells alone or expressing mCherry–mTMEM16F were treated with ionomycin and analysed for recombinant annexin-A5–Cy5 binding by flow cytometry. A representative experiment is shown ( n =3). (C) Expression of mCherry–mTMEM16F rescues annexin A2 and A5 expression at the cell surface. Annexin A2 and A5 on the cell surface were evaluated through treatment with EDTA and western blotting as described in A. A representative experiment is shown ( n =4). A quantification of cell surface annexin A2 in HeLa transfected or not with mTMEM16F is presented (fold change measured as band intensity [transfected(eluate/lysate)/untransfected(eluate/lysate)]) Results are mean±s.e.m. from n =5 biological replicates; * P
    Tmem16f Specific Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tmem16f specific oligonucleotides/product/Millipore
    Average 90 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    tmem16f specific oligonucleotides - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    78
    Millipore byotinilated dna oligonucleotides
    <t>TMEM16F</t> is required for annexin A2 and A5 cell surface localisation. (A) TMEM16F-knockout (KO) cells have severely reduced annexin A2 and A5 on their surface. Wild-type (WT), matched controls and TMEM-knockout HeLa cells were incubated in versene (EDTA solution) or not (SFM) for 10 min at 37°C before the eluate was collected and analysed for annexin A2 and A5 by western blotting. A representative western blot is shown ( n =4). (B) Expression of mCherry–mTMEM16F rescues lipid movement in TMEM16F-knockout cells. Wild-type and TMEM16F-knockout HeLa cells alone or expressing mCherry–mTMEM16F were treated with ionomycin and analysed for recombinant annexin-A5–Cy5 binding by flow cytometry. A representative experiment is shown ( n =3). (C) Expression of mCherry–mTMEM16F rescues annexin A2 and A5 expression at the cell surface. Annexin A2 and A5 on the cell surface were evaluated through treatment with EDTA and western blotting as described in A. A representative experiment is shown ( n =4). A quantification of cell surface annexin A2 in HeLa transfected or not with mTMEM16F is presented (fold change measured as band intensity [transfected(eluate/lysate)/untransfected(eluate/lysate)]) Results are mean±s.e.m. from n =5 biological replicates; * P
    Byotinilated Dna Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 78/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/byotinilated dna oligonucleotides/product/Millipore
    Average 78 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    byotinilated dna oligonucleotides - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    78
    Millipore isd single strand oligonucleotides
    <t>TMEM16F</t> is required for annexin A2 and A5 cell surface localisation. (A) TMEM16F-knockout (KO) cells have severely reduced annexin A2 and A5 on their surface. Wild-type (WT), matched controls and TMEM-knockout HeLa cells were incubated in versene (EDTA solution) or not (SFM) for 10 min at 37°C before the eluate was collected and analysed for annexin A2 and A5 by western blotting. A representative western blot is shown ( n =4). (B) Expression of mCherry–mTMEM16F rescues lipid movement in TMEM16F-knockout cells. Wild-type and TMEM16F-knockout HeLa cells alone or expressing mCherry–mTMEM16F were treated with ionomycin and analysed for recombinant annexin-A5–Cy5 binding by flow cytometry. A representative experiment is shown ( n =3). (C) Expression of mCherry–mTMEM16F rescues annexin A2 and A5 expression at the cell surface. Annexin A2 and A5 on the cell surface were evaluated through treatment with EDTA and western blotting as described in A. A representative experiment is shown ( n =4). A quantification of cell surface annexin A2 in HeLa transfected or not with mTMEM16F is presented (fold change measured as band intensity [transfected(eluate/lysate)/untransfected(eluate/lysate)]) Results are mean±s.e.m. from n =5 biological replicates; * P
    Isd Single Strand Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 78/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/isd single strand oligonucleotides/product/Millipore
    Average 78 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    isd single strand oligonucleotides - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    78
    Millipore fluorescently labeled oligonucleotides
    <t>TMEM16F</t> is required for annexin A2 and A5 cell surface localisation. (A) TMEM16F-knockout (KO) cells have severely reduced annexin A2 and A5 on their surface. Wild-type (WT), matched controls and TMEM-knockout HeLa cells were incubated in versene (EDTA solution) or not (SFM) for 10 min at 37°C before the eluate was collected and analysed for annexin A2 and A5 by western blotting. A representative western blot is shown ( n =4). (B) Expression of mCherry–mTMEM16F rescues lipid movement in TMEM16F-knockout cells. Wild-type and TMEM16F-knockout HeLa cells alone or expressing mCherry–mTMEM16F were treated with ionomycin and analysed for recombinant annexin-A5–Cy5 binding by flow cytometry. A representative experiment is shown ( n =3). (C) Expression of mCherry–mTMEM16F rescues annexin A2 and A5 expression at the cell surface. Annexin A2 and A5 on the cell surface were evaluated through treatment with EDTA and western blotting as described in A. A representative experiment is shown ( n =4). A quantification of cell surface annexin A2 in HeLa transfected or not with mTMEM16F is presented (fold change measured as band intensity [transfected(eluate/lysate)/untransfected(eluate/lysate)]) Results are mean±s.e.m. from n =5 biological replicates; * P
    Fluorescently Labeled Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 78/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorescently labeled oligonucleotides/product/Millipore
    Average 78 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    fluorescently labeled oligonucleotides - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    86
    Millipore dna manipulation oligonucleotides
    <t>TMEM16F</t> is required for annexin A2 and A5 cell surface localisation. (A) TMEM16F-knockout (KO) cells have severely reduced annexin A2 and A5 on their surface. Wild-type (WT), matched controls and TMEM-knockout HeLa cells were incubated in versene (EDTA solution) or not (SFM) for 10 min at 37°C before the eluate was collected and analysed for annexin A2 and A5 by western blotting. A representative western blot is shown ( n =4). (B) Expression of mCherry–mTMEM16F rescues lipid movement in TMEM16F-knockout cells. Wild-type and TMEM16F-knockout HeLa cells alone or expressing mCherry–mTMEM16F were treated with ionomycin and analysed for recombinant annexin-A5–Cy5 binding by flow cytometry. A representative experiment is shown ( n =3). (C) Expression of mCherry–mTMEM16F rescues annexin A2 and A5 expression at the cell surface. Annexin A2 and A5 on the cell surface were evaluated through treatment with EDTA and western blotting as described in A. A representative experiment is shown ( n =4). A quantification of cell surface annexin A2 in HeLa transfected or not with mTMEM16F is presented (fold change measured as band intensity [transfected(eluate/lysate)/untransfected(eluate/lysate)]) Results are mean±s.e.m. from n =5 biological replicates; * P
    Dna Manipulation Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 86/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna manipulation oligonucleotides/product/Millipore
    Average 86 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    dna manipulation oligonucleotides - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    Image Search Results


    Correlative light and electron spectroscopic imaging (LM/ESI) of SK-N-SH cells expressing LacI-tagged SC35 using fluorogold dsDNA oligos. Detection of nuclear speckles (arrow) via the Cy3 fluorophore ( A , left panel), and confirmation of gold conjugation to the dsDNA oligo through silver enhancement (A, right panel). Untransfected cells (arrowhead) contain background levels of silver deposition. Scale bar = 200 nm. ( B ) Overlay of fluorescence and low magnification ESI micrographs collected at 155 eV. With two rounds of the silver enhancement using a LM enhancement kit (B, left panel), the silver particles are visible as bright spots. The right panel is an overlay image of a nucleus containing EM-enhanced gold. Scale bar = 2 μm. An area corresponding to an IGC, as defined by a box in the left panel is analysed at high resolution, and maps of phosphorus ( C , red panel) and nitrogen (C, green panel) show the ultrastructure of the IGC region, which is low in phosphorus content and contains protein-based fibrous structures. The fluorogold oligo localization is indicated with silver-enhanced gold particles false-coloured in white. The composite map ( D , left panel) illustrates the position of the IGC relative to chromatin (Ch, yellow) and the nucleolus (Nu, yellow-green). The silver particles in the interior of the IGC are labelled with arrowheads, whereas those proximal to the neighbouring chromatin are indicated by arrows. The composite map (D, right panel) of the EM-enhanced nucleus (B, right panel) contains smaller but uniform silver particles, as indicated by the arrows and arrowheads. Scale bar = 5 μm.

    Journal: Nucleic Acids Research

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides

    doi: 10.1093/nar/gnh164

    Figure Lengend Snippet: Correlative light and electron spectroscopic imaging (LM/ESI) of SK-N-SH cells expressing LacI-tagged SC35 using fluorogold dsDNA oligos. Detection of nuclear speckles (arrow) via the Cy3 fluorophore ( A , left panel), and confirmation of gold conjugation to the dsDNA oligo through silver enhancement (A, right panel). Untransfected cells (arrowhead) contain background levels of silver deposition. Scale bar = 200 nm. ( B ) Overlay of fluorescence and low magnification ESI micrographs collected at 155 eV. With two rounds of the silver enhancement using a LM enhancement kit (B, left panel), the silver particles are visible as bright spots. The right panel is an overlay image of a nucleus containing EM-enhanced gold. Scale bar = 2 μm. An area corresponding to an IGC, as defined by a box in the left panel is analysed at high resolution, and maps of phosphorus ( C , red panel) and nitrogen (C, green panel) show the ultrastructure of the IGC region, which is low in phosphorus content and contains protein-based fibrous structures. The fluorogold oligo localization is indicated with silver-enhanced gold particles false-coloured in white. The composite map ( D , left panel) illustrates the position of the IGC relative to chromatin (Ch, yellow) and the nucleolus (Nu, yellow-green). The silver particles in the interior of the IGC are labelled with arrowheads, whereas those proximal to the neighbouring chromatin are indicated by arrows. The composite map (D, right panel) of the EM-enhanced nucleus (B, right panel) contains smaller but uniform silver particles, as indicated by the arrows and arrowheads. Scale bar = 5 μm.

    Article Snippet: For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma).

    Techniques: Imaging, Expressing, Conjugation Assay, Fluorescence

    Isolation of LacI-tagged SC35 from human SK-N-SH cells using dsDNA oligonucleotides. Total cellular lysates and isolated protein (PI) lysates were prepared from SK-N-SH cells transiently expressing LacI or LacI-tagged SC35. The protein isolation of LacI and LacI-tagged SC35 from PI-lysates was carried out using streptavidin beads pre-incubated with biotinylated dsDNA oligo specific for LacI (O-Sym). Western analysis of total cellular lysate (1), PI lysate (2), protein isolated by dsDNA oligos (oligo-PI) (3), and mock oligo-PI (4) from LacI–SC35 expressing cells, or PI lysate were generated from LacI expressing cells. Proteins were detected using either anti-Flag ( A ) or anti-SR protein (mAb 104) ( B ) antibodies. In addition, a Coomassie stained SDS–PAGE gel is shown as a qualitative comparison of dsDNA oligo PI versus immunopreciptiation (IP) using an anti-Flag antibody ( C ). In panel C: lane M, protein molecular weight marker; lane 1, 40 μg of total lysate; lane 2, oligo-PI; lane 3, Mock oligo-PI; and lane 4, anti-Flag IP. The asterisk marks the position of co-purifying immunoglobulin (i.e. heavy chain is shown) in the Flag-IP. The black arrows indicate the position of LacI–SC35 in panels B,C. Approximately 250–500 μg or 500–1000 μg of total protein lysate was used for western or Coomassie SDS–PAGE analysis, respectively.

    Journal: Nucleic Acids Research

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides

    doi: 10.1093/nar/gnh164

    Figure Lengend Snippet: Isolation of LacI-tagged SC35 from human SK-N-SH cells using dsDNA oligonucleotides. Total cellular lysates and isolated protein (PI) lysates were prepared from SK-N-SH cells transiently expressing LacI or LacI-tagged SC35. The protein isolation of LacI and LacI-tagged SC35 from PI-lysates was carried out using streptavidin beads pre-incubated with biotinylated dsDNA oligo specific for LacI (O-Sym). Western analysis of total cellular lysate (1), PI lysate (2), protein isolated by dsDNA oligos (oligo-PI) (3), and mock oligo-PI (4) from LacI–SC35 expressing cells, or PI lysate were generated from LacI expressing cells. Proteins were detected using either anti-Flag ( A ) or anti-SR protein (mAb 104) ( B ) antibodies. In addition, a Coomassie stained SDS–PAGE gel is shown as a qualitative comparison of dsDNA oligo PI versus immunopreciptiation (IP) using an anti-Flag antibody ( C ). In panel C: lane M, protein molecular weight marker; lane 1, 40 μg of total lysate; lane 2, oligo-PI; lane 3, Mock oligo-PI; and lane 4, anti-Flag IP. The asterisk marks the position of co-purifying immunoglobulin (i.e. heavy chain is shown) in the Flag-IP. The black arrows indicate the position of LacI–SC35 in panels B,C. Approximately 250–500 μg or 500–1000 μg of total protein lysate was used for western or Coomassie SDS–PAGE analysis, respectively.

    Article Snippet: For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma).

    Techniques: Isolation, Expressing, Incubation, Western Blot, Generated, Staining, SDS Page, Molecular Weight, Marker

    In situ detection and isolation of proteins using dsDNA oligonucleotides. ( A ) Detection of proteins in situ using dsDNA oligos. Cells grown on slides are fixed and hybridized with fluorescently labelled dsDNA oligos (red or green) that can detect the presence of proteins fused to either LacI (1) or TetR (2). The fluorescent dsDNA oligos corresponding to the operator sequences for LacI or TetR (green or red, respectively) bind each bacterial fusion protein specifically without cross hybridizing resulting in the sub-nuclear localization of the tagged proteins by light microscopy. ( B ) Isolation and detection of proteins in vitro using dsDNA oligos. Streptavidin-sepharose beads (S) are sequentially incubated with biotinylated dsDNA oligos representing the operator sequences for LacI followed by incubation with a cell lysate containing LacI fused to a protein of interest (1). After binding the beads are washed and the resulting purified LacI-fusion protein can be observed by SDS–PAGE. M, marker, IN, input lysate, PI, isolated protein.

    Journal: Nucleic Acids Research

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides

    doi: 10.1093/nar/gnh164

    Figure Lengend Snippet: In situ detection and isolation of proteins using dsDNA oligonucleotides. ( A ) Detection of proteins in situ using dsDNA oligos. Cells grown on slides are fixed and hybridized with fluorescently labelled dsDNA oligos (red or green) that can detect the presence of proteins fused to either LacI (1) or TetR (2). The fluorescent dsDNA oligos corresponding to the operator sequences for LacI or TetR (green or red, respectively) bind each bacterial fusion protein specifically without cross hybridizing resulting in the sub-nuclear localization of the tagged proteins by light microscopy. ( B ) Isolation and detection of proteins in vitro using dsDNA oligos. Streptavidin-sepharose beads (S) are sequentially incubated with biotinylated dsDNA oligos representing the operator sequences for LacI followed by incubation with a cell lysate containing LacI fused to a protein of interest (1). After binding the beads are washed and the resulting purified LacI-fusion protein can be observed by SDS–PAGE. M, marker, IN, input lysate, PI, isolated protein.

    Article Snippet: For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma).

    Techniques: In Situ, Isolation, Light Microscopy, In Vitro, Incubation, Binding Assay, Purification, SDS Page, Marker

    In situ localization of SC35 and PML in human SK-N-SH cells using dsDNA oligonucleotides. ( A ) Localization of the LacI-tagged SC35 in paraformaldehyde fixed cells transfected with pGD-Flag-Lac-SC35 using the anti-Flag antibody M2 (Flag, red) or ( B ) with a Cy3-labelled dsDNA oligo (O-Sym, red) specific for LacI. PRP4 kinase was also localized as an endogenous marker for splicing speckles by antibody detection (PRP4K, green). Positive co-localization between PRP4K and LacI-tagged SC35 is demonstrated by a yellow signal in the merged images. The localization of the LacI–SC35 fusion protein was observed only in transfected cells (see B, O-Sym) and showed complete co-localization with PRP4 kinase (PRP4K, green) in nuclear speckles. ( C ) Localization of the TetR-tagged PML in paraformaldehyde fixed cells transfected with pGD-HA-TET-PML using the anti-HA (HA, red) or ( D ) with a Cy5-labelled dsDNA oligo (TET-O, red) specific for TetR. Endogenous PML was also localized as a marker for PML nuclear bodies antibody detection (PML, green). Positive co-localization between PML and TetR-tagged PML is demonstrated by a yellow signal in the merged images. The localization of the TetR–PML fusion protein was observed only in transfected cells (see C, TET-O) and showed complete co-localization with PML (PML, green) in PML nuclear bodies. ( E ) Multiple detection and localization of LacI–SC35 and TetR–PML in cells transfected with pGD-HA-TET-PML and pGD-Flag-Lac338-Sc35. Localization of LacI–SC35 and TetR–PML was accomplished using Cy3-labelled O-Sym or Cy5-labelled TET-O dsDNA oligos, respectively. TetR–PML and LacI–SC35 do not co-localize [separate red and green signals (respectively) in merged image], thus demonstrating the utility of dsDNA oligos for the multiplex detection of proteins in situ . DNA was counterstained with DAPI (blue in merged images). Scale bars = 5 μm.

    Journal: Nucleic Acids Research

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides

    doi: 10.1093/nar/gnh164

    Figure Lengend Snippet: In situ localization of SC35 and PML in human SK-N-SH cells using dsDNA oligonucleotides. ( A ) Localization of the LacI-tagged SC35 in paraformaldehyde fixed cells transfected with pGD-Flag-Lac-SC35 using the anti-Flag antibody M2 (Flag, red) or ( B ) with a Cy3-labelled dsDNA oligo (O-Sym, red) specific for LacI. PRP4 kinase was also localized as an endogenous marker for splicing speckles by antibody detection (PRP4K, green). Positive co-localization between PRP4K and LacI-tagged SC35 is demonstrated by a yellow signal in the merged images. The localization of the LacI–SC35 fusion protein was observed only in transfected cells (see B, O-Sym) and showed complete co-localization with PRP4 kinase (PRP4K, green) in nuclear speckles. ( C ) Localization of the TetR-tagged PML in paraformaldehyde fixed cells transfected with pGD-HA-TET-PML using the anti-HA (HA, red) or ( D ) with a Cy5-labelled dsDNA oligo (TET-O, red) specific for TetR. Endogenous PML was also localized as a marker for PML nuclear bodies antibody detection (PML, green). Positive co-localization between PML and TetR-tagged PML is demonstrated by a yellow signal in the merged images. The localization of the TetR–PML fusion protein was observed only in transfected cells (see C, TET-O) and showed complete co-localization with PML (PML, green) in PML nuclear bodies. ( E ) Multiple detection and localization of LacI–SC35 and TetR–PML in cells transfected with pGD-HA-TET-PML and pGD-Flag-Lac338-Sc35. Localization of LacI–SC35 and TetR–PML was accomplished using Cy3-labelled O-Sym or Cy5-labelled TET-O dsDNA oligos, respectively. TetR–PML and LacI–SC35 do not co-localize [separate red and green signals (respectively) in merged image], thus demonstrating the utility of dsDNA oligos for the multiplex detection of proteins in situ . DNA was counterstained with DAPI (blue in merged images). Scale bars = 5 μm.

    Article Snippet: For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma).

    Techniques: In Situ, Transfection, Marker, Multiplex Assay

    Pharmacological inhibition or genetic depletion of JAK2 in MHH-CALL4 B-ALL cells induces an anti-proliferative response and not apoptosis. ( A ) CellTrace violet (CTV)-stained MHH-CALL4 cells were treated with vehicle (dimethylsulfoxide [DMSO]; black) or 1000 nM ruxolitinib (red). Cells were serially passaged for up to 8 d and subjected to assessment of their proliferative capacity by flow cytometry every 2 d. Drugs were replenished to the indicated concentration every 2 d. Data are representative of n = 3 performed in duplicate. ( B ) MHH-CALL4 cells were transduced with constitutive (pLMS-GFP) retroviral vectors harboring shRNAs targeting JAK2 (sh JAK2 .209 or sh JAK2 .2826) or scrambled (sh SCR ). Immunoblotting was performed against the indicated targets using lysates from shRNA + cells (GFP + ) at day 5 after transduction. Tubulin served as loading control. ( C ) Gene set enrichment analysis (GSEA) from 3′RNA sequencing (3′RNA-seq) analysis demonstrates negative enrichment of the indicated JAK/STAT gene set in MHH-CALL4-pLMS-sh JAK2 .209 cells relative to MHH-CALL4-pLMS-sh SCR cells at day 5 after transduction. (NES) Normalized enrichment score; (FDR) false discovery rate. ( D , E ) Transduced and nontransduced populations from B were passaged in vitro for 19 d. ( D ) The percentage of Annexin V + /GFP + cells was assessed by flow cytometry (individual bars represent days 5, 8, 9, 12, 14, 16, and 19 after transduction). ( E ) The percentage of shRNA + cells (GFP + ) was assessed by flow cytometry, and data were normalized to day 5. ( F ) Immunoblotting against the indicated target was performed against MHH–CALL4–Cas9 cells transduced with lentiviral vector (FgH1tUTG-GFP) expressing single guide RNAs (sgRNAs) targeting JAK2 (sh JAK2 .9901 or sh JAK2 .9903) at day 6 after sgRNA induction. β-Actin served as loading control. ( G ) Transduced populations from F were assessed for percentage Annexin V/DAPI positivity by flow cytometry at the indicated time points. ( H ) Transduced and nontransduced populations from F were passaged in vitro for 16 d. The percentage of sgRNA + cells (GFP + ) was assessed by flow cytometry (individual bars represent days 3, 5, 7, 9, 12, 14, and 16 after sgRNA induction). ( I ) MHH-CALL4 cells were transduced with pLMS-sh JAK2 .209 or pLMS-sh SCR . At day 14 after transduction, cell cycle analysis was performed by flow cytometric analysis of BrdU incorporation versus DNA content (7-AAD). Error bars in D , E , G , and I represent SEM ( n = 2); error bars in H represent SEM ( n = 3). (**) P

    Journal: Genes & Development

    Article Title: JAK2 is dispensable for maintenance of JAK2 mutant B-cell acute lymphoblastic leukemias

    doi: 10.1101/gad.307504.117

    Figure Lengend Snippet: Pharmacological inhibition or genetic depletion of JAK2 in MHH-CALL4 B-ALL cells induces an anti-proliferative response and not apoptosis. ( A ) CellTrace violet (CTV)-stained MHH-CALL4 cells were treated with vehicle (dimethylsulfoxide [DMSO]; black) or 1000 nM ruxolitinib (red). Cells were serially passaged for up to 8 d and subjected to assessment of their proliferative capacity by flow cytometry every 2 d. Drugs were replenished to the indicated concentration every 2 d. Data are representative of n = 3 performed in duplicate. ( B ) MHH-CALL4 cells were transduced with constitutive (pLMS-GFP) retroviral vectors harboring shRNAs targeting JAK2 (sh JAK2 .209 or sh JAK2 .2826) or scrambled (sh SCR ). Immunoblotting was performed against the indicated targets using lysates from shRNA + cells (GFP + ) at day 5 after transduction. Tubulin served as loading control. ( C ) Gene set enrichment analysis (GSEA) from 3′RNA sequencing (3′RNA-seq) analysis demonstrates negative enrichment of the indicated JAK/STAT gene set in MHH-CALL4-pLMS-sh JAK2 .209 cells relative to MHH-CALL4-pLMS-sh SCR cells at day 5 after transduction. (NES) Normalized enrichment score; (FDR) false discovery rate. ( D , E ) Transduced and nontransduced populations from B were passaged in vitro for 19 d. ( D ) The percentage of Annexin V + /GFP + cells was assessed by flow cytometry (individual bars represent days 5, 8, 9, 12, 14, 16, and 19 after transduction). ( E ) The percentage of shRNA + cells (GFP + ) was assessed by flow cytometry, and data were normalized to day 5. ( F ) Immunoblotting against the indicated target was performed against MHH–CALL4–Cas9 cells transduced with lentiviral vector (FgH1tUTG-GFP) expressing single guide RNAs (sgRNAs) targeting JAK2 (sh JAK2 .9901 or sh JAK2 .9903) at day 6 after sgRNA induction. β-Actin served as loading control. ( G ) Transduced populations from F were assessed for percentage Annexin V/DAPI positivity by flow cytometry at the indicated time points. ( H ) Transduced and nontransduced populations from F were passaged in vitro for 16 d. The percentage of sgRNA + cells (GFP + ) was assessed by flow cytometry (individual bars represent days 3, 5, 7, 9, 12, 14, and 16 after sgRNA induction). ( I ) MHH-CALL4 cells were transduced with pLMS-sh JAK2 .209 or pLMS-sh SCR . At day 14 after transduction, cell cycle analysis was performed by flow cytometric analysis of BrdU incorporation versus DNA content (7-AAD). Error bars in D , E , G , and I represent SEM ( n = 2); error bars in H represent SEM ( n = 3). (**) P

    Article Snippet: sgRNA oligonucleotides (Sigma-Aldrich) targeting JAK2 were annealed and cloned into lentiviral expression vector FgH1tUTG (Addgene, 70183; a gift from M. Herold) for inducible sgRNA expression (see the for sgRNA sequences).

    Techniques: Inhibition, Staining, Flow Cytometry, Cytometry, Concentration Assay, Transduction, shRNA, RNA Sequencing Assay, In Vitro, Plasmid Preparation, Expressing, Cell Cycle Assay, BrdU Incorporation Assay

    Accumulation of ubiquitin, SQSTM1 and NBR1 in atg9a -CKO mouse brains. (A) Immunofluorescence for SQSTM1, ubiquitin and NBR1 in neurons of DCN in atg9a -CKO mice at P15. White arrows indicate colocalization of positive signals for these proteins. Scale bars: 20 μm. (B) Electron micrographs of a DCN neuron in an atg9a -CKO mouse brain at P15. The square in the upper panel is enlarged in the lower panel. Asterisks in both figures indicate an ubiquitin aggregate that is encircled by ER. Scale bars: 1 μm. (C) Immunostaining of ubiquitin, SQSTM1 and NBR1 in the cerebrum cortexes of floxed control, atg7 -CKO and atg9a -CKO mice at 2 and 4 wk of age. Scale bar: 20 µm. (D) Western blot analyses of ubiquitin, SQSTM1, NBR1, ATG7, ATG9A, and MAP1LC3A/B in brain lysates from floxed control, atg7 -CKO and atg9a -CKO mice at 2 and 4 wk of age. Immunostaining for actin is used for an internal control. (E) Quantification of each protein band of SQSTM1 and NBR1. Results are expressed as mean ± SEM. * P

    Journal: Autophagy

    Article Title: Atg9a deficiency causes axon-specific lesions including neuronal circuit dysgenesis

    doi: 10.1080/15548627.2017.1314897

    Figure Lengend Snippet: Accumulation of ubiquitin, SQSTM1 and NBR1 in atg9a -CKO mouse brains. (A) Immunofluorescence for SQSTM1, ubiquitin and NBR1 in neurons of DCN in atg9a -CKO mice at P15. White arrows indicate colocalization of positive signals for these proteins. Scale bars: 20 μm. (B) Electron micrographs of a DCN neuron in an atg9a -CKO mouse brain at P15. The square in the upper panel is enlarged in the lower panel. Asterisks in both figures indicate an ubiquitin aggregate that is encircled by ER. Scale bars: 1 μm. (C) Immunostaining of ubiquitin, SQSTM1 and NBR1 in the cerebrum cortexes of floxed control, atg7 -CKO and atg9a -CKO mice at 2 and 4 wk of age. Scale bar: 20 µm. (D) Western blot analyses of ubiquitin, SQSTM1, NBR1, ATG7, ATG9A, and MAP1LC3A/B in brain lysates from floxed control, atg7 -CKO and atg9a -CKO mice at 2 and 4 wk of age. Immunostaining for actin is used for an internal control. (E) Quantification of each protein band of SQSTM1 and NBR1. Results are expressed as mean ± SEM. * P

    Article Snippet: Briefly, PCNs and MEFs were transfected with nontargeting unlabeled si-RNA (Mission si-RNA Universal Negative Control; Sigma, SIC-001) or oligonucleotides targeting Atg9a (Sigma, Mm Atg9a 2192 [#1], 2194 [#2] and 2195 [#3]) using Lipofectamine RNAi-MAX™ (Invitrogen, 13778–150) according to the manufacturer's instructions.

    Techniques: Immunofluorescence, Mouse Assay, Immunostaining, Western Blot

    Impaired neurite extension of primary cultured cortical neurons. (A) Representative pictures of primary cultured cortical neurons obtained from control littermates of each knockout mouse embryo (control), atg9a -, atg7 - and atg16l1 -conventional KO mouse embryos at E14.5. Each PCN was transfected with a GFP expression vector at 1 DIV and observed at 3 DIV. (B) Profiles of extending axons of PCNs obtained from each of control littermate embryos and atg9a -KO mouse embryos at E14.5. Each PCN was transfected with a GFP expression vector at 3 DIV and observed at 7 DIV. Scale bar: 50 μm. (C) Quantification of the longest neurites of PCNs in A. Results are expressed as mean ± SEM n = 20 to 74 neurons of each. * P

    Journal: Autophagy

    Article Title: Atg9a deficiency causes axon-specific lesions including neuronal circuit dysgenesis

    doi: 10.1080/15548627.2017.1314897

    Figure Lengend Snippet: Impaired neurite extension of primary cultured cortical neurons. (A) Representative pictures of primary cultured cortical neurons obtained from control littermates of each knockout mouse embryo (control), atg9a -, atg7 - and atg16l1 -conventional KO mouse embryos at E14.5. Each PCN was transfected with a GFP expression vector at 1 DIV and observed at 3 DIV. (B) Profiles of extending axons of PCNs obtained from each of control littermate embryos and atg9a -KO mouse embryos at E14.5. Each PCN was transfected with a GFP expression vector at 3 DIV and observed at 7 DIV. Scale bar: 50 μm. (C) Quantification of the longest neurites of PCNs in A. Results are expressed as mean ± SEM n = 20 to 74 neurons of each. * P

    Article Snippet: Briefly, PCNs and MEFs were transfected with nontargeting unlabeled si-RNA (Mission si-RNA Universal Negative Control; Sigma, SIC-001) or oligonucleotides targeting Atg9a (Sigma, Mm Atg9a 2192 [#1], 2194 [#2] and 2195 [#3]) using Lipofectamine RNAi-MAX™ (Invitrogen, 13778–150) according to the manufacturer's instructions.

    Techniques: Cell Culture, Knock-Out, Transfection, Expressing, Plasmid Preparation

    Dysgenesis of the corpus callosum and anterior commissures. (A, B) Diffusion tensor tractography of the corpus callosum (CC; red), anterior commissures (AC; green) and posterior commissures (PC; blue) in floxed control (A) and atg9a -CKO (B) mouse brains at P21. Sagittal direction (left) and coronal direction (right). (C to F) Intact and dysgenetic figures of the corpus callosum (C, D) and anterior commissures (E, F) from floxed control and atg9a -CKO mice at P28. HE staining (C, E) and immunofluorescent staining of myelin basic protein and phosphorylated neurofilaments (NF) (D, F). Black and white broken lines indicate the respective nerve fibers. LV, lateral ventricle; 3V, third ventricle. Scale bar: 200 μm.

    Journal: Autophagy

    Article Title: Atg9a deficiency causes axon-specific lesions including neuronal circuit dysgenesis

    doi: 10.1080/15548627.2017.1314897

    Figure Lengend Snippet: Dysgenesis of the corpus callosum and anterior commissures. (A, B) Diffusion tensor tractography of the corpus callosum (CC; red), anterior commissures (AC; green) and posterior commissures (PC; blue) in floxed control (A) and atg9a -CKO (B) mouse brains at P21. Sagittal direction (left) and coronal direction (right). (C to F) Intact and dysgenetic figures of the corpus callosum (C, D) and anterior commissures (E, F) from floxed control and atg9a -CKO mice at P28. HE staining (C, E) and immunofluorescent staining of myelin basic protein and phosphorylated neurofilaments (NF) (D, F). Black and white broken lines indicate the respective nerve fibers. LV, lateral ventricle; 3V, third ventricle. Scale bar: 200 μm.

    Article Snippet: Briefly, PCNs and MEFs were transfected with nontargeting unlabeled si-RNA (Mission si-RNA Universal Negative Control; Sigma, SIC-001) or oligonucleotides targeting Atg9a (Sigma, Mm Atg9a 2192 [#1], 2194 [#2] and 2195 [#3]) using Lipofectamine RNAi-MAX™ (Invitrogen, 13778–150) according to the manufacturer's instructions.

    Techniques: Diffusion-based Assay, Mouse Assay, Staining

    Generation and phenotypes of mice with atg9a conditional KO specific for CNS tissue. (A) Schematic representation of wild-type, flox and mutant alleles of Atg9a gene. The green triangles denote loxP sequences. (B) PCR analyses of genomic DNA extracted from wild-type, Atg9a F/+ and Atg9a F/F mice tails. (C) The survival curve of atg9a -CKO ( Atg9a F/F : Nes-Cre ), atg7 -CKO ( Atg7 F/F : Nes-Cre ) and floxed control mice (littermates for atg9a -CKO mice and those for atg7 -CKO mice without Cre recombinase expression) after the Kaplan-Meier method. The numbers of mice used were 45 for littermate floxed control and 15 for atg9a -CKO mice. (D) Representative pictures of floxed control ( Atg9a F/+ Cre-/-) (larger one) and atg9a -CKO (smaller one) mice at P15 (left). Changes in body weight of atg9a -CKO mice and their floxed control littermate mice until 4 wk after birth. Results are expressed as mean ± SEM (n ≥ 5, at each postnatal d after birth) (right). Statistical analyses were performed using the Student t test. (E) A comparison of body weight between floxed control, atg7 -CKO and atg9a -CKO mice at 2 wk after birth. Results are expressed as mean ± SEM (n ≥ 8, at each postnatal d after birth). Statistical analyses were performed using one-way analysis of variance (ANOVA) followed by the Tukey-Kramer post hoc test. (F) Normal (floxed control) and abnormal limb-clasping reflexes in floxed control and atg9a -CKO mice at P28. (G) A rotarod performance test. The bar graph shows the length of time that atg9a -CKO (white bar) and floxed control (black bar) mice could stay on the rotating rod. Results are expressed as mean ± SEM n = 6 in floxed control and 3 in atg9a -CKO mice at P21. ** P

    Journal: Autophagy

    Article Title: Atg9a deficiency causes axon-specific lesions including neuronal circuit dysgenesis

    doi: 10.1080/15548627.2017.1314897

    Figure Lengend Snippet: Generation and phenotypes of mice with atg9a conditional KO specific for CNS tissue. (A) Schematic representation of wild-type, flox and mutant alleles of Atg9a gene. The green triangles denote loxP sequences. (B) PCR analyses of genomic DNA extracted from wild-type, Atg9a F/+ and Atg9a F/F mice tails. (C) The survival curve of atg9a -CKO ( Atg9a F/F : Nes-Cre ), atg7 -CKO ( Atg7 F/F : Nes-Cre ) and floxed control mice (littermates for atg9a -CKO mice and those for atg7 -CKO mice without Cre recombinase expression) after the Kaplan-Meier method. The numbers of mice used were 45 for littermate floxed control and 15 for atg9a -CKO mice. (D) Representative pictures of floxed control ( Atg9a F/+ Cre-/-) (larger one) and atg9a -CKO (smaller one) mice at P15 (left). Changes in body weight of atg9a -CKO mice and their floxed control littermate mice until 4 wk after birth. Results are expressed as mean ± SEM (n ≥ 5, at each postnatal d after birth) (right). Statistical analyses were performed using the Student t test. (E) A comparison of body weight between floxed control, atg7 -CKO and atg9a -CKO mice at 2 wk after birth. Results are expressed as mean ± SEM (n ≥ 8, at each postnatal d after birth). Statistical analyses were performed using one-way analysis of variance (ANOVA) followed by the Tukey-Kramer post hoc test. (F) Normal (floxed control) and abnormal limb-clasping reflexes in floxed control and atg9a -CKO mice at P28. (G) A rotarod performance test. The bar graph shows the length of time that atg9a -CKO (white bar) and floxed control (black bar) mice could stay on the rotating rod. Results are expressed as mean ± SEM n = 6 in floxed control and 3 in atg9a -CKO mice at P21. ** P

    Article Snippet: Briefly, PCNs and MEFs were transfected with nontargeting unlabeled si-RNA (Mission si-RNA Universal Negative Control; Sigma, SIC-001) or oligonucleotides targeting Atg9a (Sigma, Mm Atg9a 2192 [#1], 2194 [#2] and 2195 [#3]) using Lipofectamine RNAi-MAX™ (Invitrogen, 13778–150) according to the manufacturer's instructions.

    Techniques: Mouse Assay, Mutagenesis, Polymerase Chain Reaction, Expressing

    Morphological changes in Purkinje cell axons and their terminals. (A) The bar graph shows the lengths of the contacting zones of the axon terminals of Purkinje cells with DCN neurons in floxed control and atg9a -CKO mice at P15 and P28. Results are expressed as mean ± SEM. (n = 10 to 15 axon terminals of each). ** P

    Journal: Autophagy

    Article Title: Atg9a deficiency causes axon-specific lesions including neuronal circuit dysgenesis

    doi: 10.1080/15548627.2017.1314897

    Figure Lengend Snippet: Morphological changes in Purkinje cell axons and their terminals. (A) The bar graph shows the lengths of the contacting zones of the axon terminals of Purkinje cells with DCN neurons in floxed control and atg9a -CKO mice at P15 and P28. Results are expressed as mean ± SEM. (n = 10 to 15 axon terminals of each). ** P

    Article Snippet: Briefly, PCNs and MEFs were transfected with nontargeting unlabeled si-RNA (Mission si-RNA Universal Negative Control; Sigma, SIC-001) or oligonucleotides targeting Atg9a (Sigma, Mm Atg9a 2192 [#1], 2194 [#2] and 2195 [#3]) using Lipofectamine RNAi-MAX™ (Invitrogen, 13778–150) according to the manufacturer's instructions.

    Techniques: Mouse Assay

    Dysgenesis of the corpus callosum and anterior commissures in the developing brains. (A to C) Developing corpus callosum (CC) of a floxed control brain and Probst bundles (Pb) of an atg9a -CKO brain at E18. HE (A) and immunofluorescent staining of phosphorylated neurofilaments (NF) (B) and GFAP-positive astroglial cells and AIF1/IBA1-positive microglial cells (C). LV indicates lateral ventricle, and Pb indicates Probst bundle. (D) Developing anterior commissures (AC) of a floxed control brain and no crossing nerve fibers in the respective region of an atg9a -CKO brain at E18. 3V, third ventricle. (E) Hematoxylin-eosin staining images of developing cerebral cortexes in floxed control and atg9a -CKO brains at E18. Scale bars: 200 μm (A, B, D) and 50 μm (C, E).

    Journal: Autophagy

    Article Title: Atg9a deficiency causes axon-specific lesions including neuronal circuit dysgenesis

    doi: 10.1080/15548627.2017.1314897

    Figure Lengend Snippet: Dysgenesis of the corpus callosum and anterior commissures in the developing brains. (A to C) Developing corpus callosum (CC) of a floxed control brain and Probst bundles (Pb) of an atg9a -CKO brain at E18. HE (A) and immunofluorescent staining of phosphorylated neurofilaments (NF) (B) and GFAP-positive astroglial cells and AIF1/IBA1-positive microglial cells (C). LV indicates lateral ventricle, and Pb indicates Probst bundle. (D) Developing anterior commissures (AC) of a floxed control brain and no crossing nerve fibers in the respective region of an atg9a -CKO brain at E18. 3V, third ventricle. (E) Hematoxylin-eosin staining images of developing cerebral cortexes in floxed control and atg9a -CKO brains at E18. Scale bars: 200 μm (A, B, D) and 50 μm (C, E).

    Article Snippet: Briefly, PCNs and MEFs were transfected with nontargeting unlabeled si-RNA (Mission si-RNA Universal Negative Control; Sigma, SIC-001) or oligonucleotides targeting Atg9a (Sigma, Mm Atg9a 2192 [#1], 2194 [#2] and 2195 [#3]) using Lipofectamine RNAi-MAX™ (Invitrogen, 13778–150) according to the manufacturer's instructions.

    Techniques: Staining

    Analysis of the capability of Sen1 variants to terminate transcription in vitro . ( A ) Scheme of an in vitro transcription termination assay. A schematic of a ternary EC based on previous biochemical and structural analyses ( 47 , 48 ) is shown on the top. Promoter-independent assembly of ECs is performed using a 9 nt RNA:DNA hybrid that occupies the RNAPII catalytic center. Ternary ECs are attached to streptavidin beads via the 5΄ biotin of the non-template strand allowing subsequent separation of bead-associated (B) and supernatant (S) fractions. The RNA is fluorescently labeled with FAM at the 5΄-end. The transcription template contains a G-less cassette followed by a G-stretch in the non-template strand. After adding an ATP, UTP, CTP mix, the RNAPII transcribes until it encounters the G-rich sequence. Sen1 provokes dissociation of ECs paused at the G-rich stretch and therefore the release of RNAPII and associated transcripts to the supernatant. ( B ) Denaturing PAGE analysis of RNAs from a representative IVTer assay in the absence and in the presence of Sen1 proteins. ( C ) Quantification of the fraction of transcripts released from ECs stalled at the G-stretch as a measure of the termination efficiency. Values represent the average and standard deviation of three independent experiments. The p-value associated with a t -test (p) is indicated.

    Journal: Nucleic Acids Research

    Article Title: Biochemical characterization of the helicase Sen1 provides new insights into the mechanisms of non-coding transcription termination

    doi: 10.1093/nar/gkw1230

    Figure Lengend Snippet: Analysis of the capability of Sen1 variants to terminate transcription in vitro . ( A ) Scheme of an in vitro transcription termination assay. A schematic of a ternary EC based on previous biochemical and structural analyses ( 47 , 48 ) is shown on the top. Promoter-independent assembly of ECs is performed using a 9 nt RNA:DNA hybrid that occupies the RNAPII catalytic center. Ternary ECs are attached to streptavidin beads via the 5΄ biotin of the non-template strand allowing subsequent separation of bead-associated (B) and supernatant (S) fractions. The RNA is fluorescently labeled with FAM at the 5΄-end. The transcription template contains a G-less cassette followed by a G-stretch in the non-template strand. After adding an ATP, UTP, CTP mix, the RNAPII transcribes until it encounters the G-rich sequence. Sen1 provokes dissociation of ECs paused at the G-rich stretch and therefore the release of RNAPII and associated transcripts to the supernatant. ( B ) Denaturing PAGE analysis of RNAs from a representative IVTer assay in the absence and in the presence of Sen1 proteins. ( C ) Quantification of the fraction of transcripts released from ECs stalled at the G-stretch as a measure of the termination efficiency. Values represent the average and standard deviation of three independent experiments. The p-value associated with a t -test (p) is indicated.

    Article Snippet: The DNA oligonucleotides were purchased from Sigma and PAGE-purified before use.

    Techniques: In Vitro, Labeling, Sequencing, Polyacrylamide Gel Electrophoresis, Standard Deviation

    Functional characterization and modeling of the arm segment region targeted by class II NT5C2 mutations. ( A and B ) Graphical representation of mutations selected for in murine leukemic cells infected with a gRNA targeting H405 ( A ) or I416 ( B ) after treatment with vehicle or 2 μM 6-MP. ( C ) Modeling analysis of the top 20 preferred conformations of the flexible arm segment in the inactive and allosterically activated NT5C2. ( D ) A close up view of the proposed interaction between Asp407 and Lys361 causing disruption of the alpha helix stabilizing Asp459 – Lys361 interaction. ( E ) Western blot showing specificity of antibodies generated against the tip region of the arm domain for NT5C2 (left) and in vitro nucleotidase assays of purified wild-type NT5C2 recombinant protein incubated with two unique arm segment antibodies or the arm segment peptide in the presence of increasing doses of ATP (right). Data in E is shown as mean ± s.d. p values were calculated using two-tailed Student’s t- .

    Journal: Cancer cell

    Article Title: Structure and mechanisms of NT5C2 mutations driving thiopurine resistance in relapsed lymphoblastic leukemia

    doi: 10.1016/j.ccell.2018.06.003

    Figure Lengend Snippet: Functional characterization and modeling of the arm segment region targeted by class II NT5C2 mutations. ( A and B ) Graphical representation of mutations selected for in murine leukemic cells infected with a gRNA targeting H405 ( A ) or I416 ( B ) after treatment with vehicle or 2 μM 6-MP. ( C ) Modeling analysis of the top 20 preferred conformations of the flexible arm segment in the inactive and allosterically activated NT5C2. ( D ) A close up view of the proposed interaction between Asp407 and Lys361 causing disruption of the alpha helix stabilizing Asp459 – Lys361 interaction. ( E ) Western blot showing specificity of antibodies generated against the tip region of the arm domain for NT5C2 (left) and in vitro nucleotidase assays of purified wild-type NT5C2 recombinant protein incubated with two unique arm segment antibodies or the arm segment peptide in the presence of increasing doses of ATP (right). Data in E is shown as mean ± s.d. p values were calculated using two-tailed Student’s t- .

    Article Snippet: We generated lentiviral vectors expressing CAS9 and gRNAs targeting the arm segment of mouse Nt5c2 by cloning the corresponding gRNA oligonucleotides (Sigma-Aldrich) into pL-CRISPR.efs.gfp as reported ( ).

    Techniques: Functional Assay, Infection, Western Blot, Generated, In Vitro, Purification, Recombinant, Incubation, Two Tailed Test

    Effect of PDTC, calphostin C, and chelerythrine chloride on myotrophin-induced protein synthesis and gene expression in neonatal rat cardiomyocytes. (A) Neonatal myocytes were pretreated with myotrophin antibody (Myo-Ab), 100 μM PDTC, 1 μM of calphostin C, and 10 μM chelerythrine chloride for 60 min and then treated with myotrophin for 24 h in the presence of [ 3 H]leucine. Cells were lysed and incorporation of [ 3 H]leucine into myocytes was measured as described in the text. Data shows the means (±SEM) of three different sets of results. P values compared with control or unstimulated cells. (B) Samples from control and myotrophin-treated neonatal myocytes were treated with or without 100 μM PDTC and 1 μM of calphostin C. Total RNA (20 μg) was hybridized separately with [ 32 P]dATP-labeled c-myc , ANF, or GAPDH oligo probes.

    Journal: The Journal of Cell Biology

    Article Title: Activation of nuclear factor-?B is necessary for myotrophin-induced cardiac hypertrophy

    doi: 10.1083/jcb.200207149

    Figure Lengend Snippet: Effect of PDTC, calphostin C, and chelerythrine chloride on myotrophin-induced protein synthesis and gene expression in neonatal rat cardiomyocytes. (A) Neonatal myocytes were pretreated with myotrophin antibody (Myo-Ab), 100 μM PDTC, 1 μM of calphostin C, and 10 μM chelerythrine chloride for 60 min and then treated with myotrophin for 24 h in the presence of [ 3 H]leucine. Cells were lysed and incorporation of [ 3 H]leucine into myocytes was measured as described in the text. Data shows the means (±SEM) of three different sets of results. P values compared with control or unstimulated cells. (B) Samples from control and myotrophin-treated neonatal myocytes were treated with or without 100 μM PDTC and 1 μM of calphostin C. Total RNA (20 μg) was hybridized separately with [ 32 P]dATP-labeled c-myc , ANF, or GAPDH oligo probes.

    Article Snippet: ANF, c-myc , and GAPDH oligonucleotides were purchased from Oncogene Research Products.

    Techniques: Expressing, Labeling

    Purification and analysis of full-length human UPF1 (hUPF1). ( A ) Cartoon of the hUPF1 protein (CH, cysteine–histidine rich domain; SQ, serine–glutamine rich domain; I, II and VI, position of conserved ATP ase motifs). The substitution K498A was made in motif I (Walker A box) to create the ATP ase deficient mutant ( 13 ). ( B ) Superdex S200 gel filtration fractions analysed by SDS-PAGE (hUPF1 123 KDa) and their 5΄–3΄ strand unwinding activity (substrate 5΄d(T) 55 ds20). hUPF1 peak elution volume was 12.4 ml, between the BSA (66 KDa) and ferritin (440 KDa) markers. ( C ) Helicase activity (0.2 nM substrate 5΄d(T) 55 ds20, top strand labeled as shown in (B), 4–40 nM hUPF1) was not observed for variant K498A or for wild-type hUPF1 (WT) without ATP. Boil is the thermally denatured substrate. ( D ) hUPF1 displaced a 20 base oligonucleotide from a substrate with a 5΄ poly d(T) 55 but not a 3΄ poly d(T) 55 (substrate ds20d(T) 55 3΄) overhang (10–40 nM hUPF1, 0.2 nM substrate, bottom strand labeled), n = 3 experimental repeats, mean and standard deviation.

    Journal: Nucleic Acids Research

    Article Title: DNA substrate recognition and processing by the full-length human UPF1 helicase

    doi: 10.1093/nar/gkx478

    Figure Lengend Snippet: Purification and analysis of full-length human UPF1 (hUPF1). ( A ) Cartoon of the hUPF1 protein (CH, cysteine–histidine rich domain; SQ, serine–glutamine rich domain; I, II and VI, position of conserved ATP ase motifs). The substitution K498A was made in motif I (Walker A box) to create the ATP ase deficient mutant ( 13 ). ( B ) Superdex S200 gel filtration fractions analysed by SDS-PAGE (hUPF1 123 KDa) and their 5΄–3΄ strand unwinding activity (substrate 5΄d(T) 55 ds20). hUPF1 peak elution volume was 12.4 ml, between the BSA (66 KDa) and ferritin (440 KDa) markers. ( C ) Helicase activity (0.2 nM substrate 5΄d(T) 55 ds20, top strand labeled as shown in (B), 4–40 nM hUPF1) was not observed for variant K498A or for wild-type hUPF1 (WT) without ATP. Boil is the thermally denatured substrate. ( D ) hUPF1 displaced a 20 base oligonucleotide from a substrate with a 5΄ poly d(T) 55 but not a 3΄ poly d(T) 55 (substrate ds20d(T) 55 3΄) overhang (10–40 nM hUPF1, 0.2 nM substrate, bottom strand labeled), n = 3 experimental repeats, mean and standard deviation.

    Article Snippet: Helicase substrates Oligonucleotides were purchased from Sigma Aldrich.

    Techniques: Purification, Mutagenesis, Filtration, SDS Page, Activity Assay, Labeling, Variant Assay, Standard Deviation

    hUPF1 unwinds triplex DNA. ( A ) Methylation protection of the triplex substrates without (TripT0) or with d(T) 55 3΄ or 5΄ extensions to the triplex forming oligonucleotide (Trip3΄T55 and Trip5΄T55). The top strand of the duplex/partially triplex sequence was 32 P-end labeled. ( B ) Helicase assays, 10–40 nM hUPF1 or variant K498A (KA-UPF1), 0.2 nM 32 P-end labeled substrate (5΄ end, top strand of parent duplex). Duplex DNA and substrate TripT0 (no ssDNA component) were not unwound. Trip5΄T55 was resolved with an efficiency approaching that of substrate 5΄d(T) 55 ds20 (run in parallel but not shown in (B)). Substrate Trip3΄T55 was also resolved by hUPF1 at ∼70% efficiency compared to substrate Trip5΄T55. All substrates were analysed in parallel, n = 3 experimental repeats, mean and standard deviation shown in the graph.

    Journal: Nucleic Acids Research

    Article Title: DNA substrate recognition and processing by the full-length human UPF1 helicase

    doi: 10.1093/nar/gkx478

    Figure Lengend Snippet: hUPF1 unwinds triplex DNA. ( A ) Methylation protection of the triplex substrates without (TripT0) or with d(T) 55 3΄ or 5΄ extensions to the triplex forming oligonucleotide (Trip3΄T55 and Trip5΄T55). The top strand of the duplex/partially triplex sequence was 32 P-end labeled. ( B ) Helicase assays, 10–40 nM hUPF1 or variant K498A (KA-UPF1), 0.2 nM 32 P-end labeled substrate (5΄ end, top strand of parent duplex). Duplex DNA and substrate TripT0 (no ssDNA component) were not unwound. Trip5΄T55 was resolved with an efficiency approaching that of substrate 5΄d(T) 55 ds20 (run in parallel but not shown in (B)). Substrate Trip3΄T55 was also resolved by hUPF1 at ∼70% efficiency compared to substrate Trip5΄T55. All substrates were analysed in parallel, n = 3 experimental repeats, mean and standard deviation shown in the graph.

    Article Snippet: Helicase substrates Oligonucleotides were purchased from Sigma Aldrich.

    Techniques: Methylation, Sequencing, Labeling, Variant Assay, Standard Deviation

    Unwinding of duplex DNA and RNA:DNA hybrids. ( A ) Tracking strands were 50 or 33 base 5΄ poly (A) or d(A) extension, preceded by 3 G residues (see note in materials and methods and Supplementary Figure S1 ). For simplicity these substrates are referred to as RNA (A) 50 , RNA (A) 33 , DNA d(A) 50 and DNA d(A) 33 . Compared to 5΄d(T) 55 ds20, substrates with 5΄ poly d(A) tails were poor helicase substrates (∼20 fold less efficient at 10 nM UPF1 for substrates with comparable tail lengths) and RNA:DNA hybrids showed intermediate levels of unwinding (∼40% unwinding efficiency for substrates with similar tail lengths). ( B ) Substrates (20 bp duplex as in (A)) with 5΄ 55 base extension of the corresponding RNA or DNA heteropolymer sequence compared to substrate 5΄d(T) 55 ds20 in helicase assays. All reactions contained 0.2 nM substrate and 10, 20 or 40 nM hUPF1, n = 3 experimental repeats, mean and standard deviation.

    Journal: Nucleic Acids Research

    Article Title: DNA substrate recognition and processing by the full-length human UPF1 helicase

    doi: 10.1093/nar/gkx478

    Figure Lengend Snippet: Unwinding of duplex DNA and RNA:DNA hybrids. ( A ) Tracking strands were 50 or 33 base 5΄ poly (A) or d(A) extension, preceded by 3 G residues (see note in materials and methods and Supplementary Figure S1 ). For simplicity these substrates are referred to as RNA (A) 50 , RNA (A) 33 , DNA d(A) 50 and DNA d(A) 33 . Compared to 5΄d(T) 55 ds20, substrates with 5΄ poly d(A) tails were poor helicase substrates (∼20 fold less efficient at 10 nM UPF1 for substrates with comparable tail lengths) and RNA:DNA hybrids showed intermediate levels of unwinding (∼40% unwinding efficiency for substrates with similar tail lengths). ( B ) Substrates (20 bp duplex as in (A)) with 5΄ 55 base extension of the corresponding RNA or DNA heteropolymer sequence compared to substrate 5΄d(T) 55 ds20 in helicase assays. All reactions contained 0.2 nM substrate and 10, 20 or 40 nM hUPF1, n = 3 experimental repeats, mean and standard deviation.

    Article Snippet: Helicase substrates Oligonucleotides were purchased from Sigma Aldrich.

    Techniques: Sequencing, Standard Deviation

    TMEM16F is required for annexin A2 and A5 cell surface localisation. (A) TMEM16F-knockout (KO) cells have severely reduced annexin A2 and A5 on their surface. Wild-type (WT), matched controls and TMEM-knockout HeLa cells were incubated in versene (EDTA solution) or not (SFM) for 10 min at 37°C before the eluate was collected and analysed for annexin A2 and A5 by western blotting. A representative western blot is shown ( n =4). (B) Expression of mCherry–mTMEM16F rescues lipid movement in TMEM16F-knockout cells. Wild-type and TMEM16F-knockout HeLa cells alone or expressing mCherry–mTMEM16F were treated with ionomycin and analysed for recombinant annexin-A5–Cy5 binding by flow cytometry. A representative experiment is shown ( n =3). (C) Expression of mCherry–mTMEM16F rescues annexin A2 and A5 expression at the cell surface. Annexin A2 and A5 on the cell surface were evaluated through treatment with EDTA and western blotting as described in A. A representative experiment is shown ( n =4). A quantification of cell surface annexin A2 in HeLa transfected or not with mTMEM16F is presented (fold change measured as band intensity [transfected(eluate/lysate)/untransfected(eluate/lysate)]) Results are mean±s.e.m. from n =5 biological replicates; * P

    Journal: Journal of Cell Science

    Article Title: Transbilayer phospholipid movement facilitates the translocation of annexin across membranes

    doi: 10.1242/jcs.217034

    Figure Lengend Snippet: TMEM16F is required for annexin A2 and A5 cell surface localisation. (A) TMEM16F-knockout (KO) cells have severely reduced annexin A2 and A5 on their surface. Wild-type (WT), matched controls and TMEM-knockout HeLa cells were incubated in versene (EDTA solution) or not (SFM) for 10 min at 37°C before the eluate was collected and analysed for annexin A2 and A5 by western blotting. A representative western blot is shown ( n =4). (B) Expression of mCherry–mTMEM16F rescues lipid movement in TMEM16F-knockout cells. Wild-type and TMEM16F-knockout HeLa cells alone or expressing mCherry–mTMEM16F were treated with ionomycin and analysed for recombinant annexin-A5–Cy5 binding by flow cytometry. A representative experiment is shown ( n =3). (C) Expression of mCherry–mTMEM16F rescues annexin A2 and A5 expression at the cell surface. Annexin A2 and A5 on the cell surface were evaluated through treatment with EDTA and western blotting as described in A. A representative experiment is shown ( n =4). A quantification of cell surface annexin A2 in HeLa transfected or not with mTMEM16F is presented (fold change measured as band intensity [transfected(eluate/lysate)/untransfected(eluate/lysate)]) Results are mean±s.e.m. from n =5 biological replicates; * P

    Article Snippet: TMEM16F-specific oligonucleotides (Sigma-Aldrich; ) were designed ,and top and bottom strands were annealed, and then cloned into the Cas9 expression vector pSpCas9(BB)-2A-Puro (PX459) (Addgene plasmid #48139) as previously described ( ).

    Techniques: Knock-Out, Incubation, Western Blot, Expressing, Recombinant, Binding Assay, Flow Cytometry, Cytometry, Transfection

    TMEM16F regulates lipid movement in HeLa cells. (A) TMEM16F-knockout (KO) cells do not externalise PS in response to ionomycin stimulation. Wild-type (WT), matched controls and TMEM16F-knockout cells were treated with ionomycin for 10 min at 37°C in the presence of recombinant annexin-A5–Cy5 and PI. Recombinant annexin-A5–Cy5 binding and PI accumulation were analysed by flow cytometry. Representative histograms of recombinant annexin-A5–Cy5 binding to live cells are shown ( n =4). A quantification of the geometric mean±s.d. fluorescence intensity of annexin-A5–Cy5 binding from four separate experiments are shown. * P

    Journal: Journal of Cell Science

    Article Title: Transbilayer phospholipid movement facilitates the translocation of annexin across membranes

    doi: 10.1242/jcs.217034

    Figure Lengend Snippet: TMEM16F regulates lipid movement in HeLa cells. (A) TMEM16F-knockout (KO) cells do not externalise PS in response to ionomycin stimulation. Wild-type (WT), matched controls and TMEM16F-knockout cells were treated with ionomycin for 10 min at 37°C in the presence of recombinant annexin-A5–Cy5 and PI. Recombinant annexin-A5–Cy5 binding and PI accumulation were analysed by flow cytometry. Representative histograms of recombinant annexin-A5–Cy5 binding to live cells are shown ( n =4). A quantification of the geometric mean±s.d. fluorescence intensity of annexin-A5–Cy5 binding from four separate experiments are shown. * P

    Article Snippet: TMEM16F-specific oligonucleotides (Sigma-Aldrich; ) were designed ,and top and bottom strands were annealed, and then cloned into the Cas9 expression vector pSpCas9(BB)-2A-Puro (PX459) (Addgene plasmid #48139) as previously described ( ).

    Techniques: Knock-Out, Recombinant, Binding Assay, Flow Cytometry, Cytometry, Fluorescence

    Cinnamycin restores annexin A2 and A5 cell surface localisation in TMEM16F-deficient cells. (A) Cinnamycin externalises PS in TMEM16F-knockout (KO) cells. Wild-type (WT), matched controls and TMEM16F-knockout cells were treated with cinnamycin for 50 min at 37°C, recombinant annexin-A5–Cy5 and PI were then added and incubated for a further 10 min at 37°C. Recombinant annexin-A5–Cy5 binding and PI accumulation were analysed by flow cytometry. Representative histograms of recombinant annexin-A5–Cy5 binding to live cells are shown ( n =3). The geometric mean±s.d. fluorescence intensity of annexin A5-Cy5 binding to live cells are shown from three separate experiments. ** P

    Journal: Journal of Cell Science

    Article Title: Transbilayer phospholipid movement facilitates the translocation of annexin across membranes

    doi: 10.1242/jcs.217034

    Figure Lengend Snippet: Cinnamycin restores annexin A2 and A5 cell surface localisation in TMEM16F-deficient cells. (A) Cinnamycin externalises PS in TMEM16F-knockout (KO) cells. Wild-type (WT), matched controls and TMEM16F-knockout cells were treated with cinnamycin for 50 min at 37°C, recombinant annexin-A5–Cy5 and PI were then added and incubated for a further 10 min at 37°C. Recombinant annexin-A5–Cy5 binding and PI accumulation were analysed by flow cytometry. Representative histograms of recombinant annexin-A5–Cy5 binding to live cells are shown ( n =3). The geometric mean±s.d. fluorescence intensity of annexin A5-Cy5 binding to live cells are shown from three separate experiments. ** P

    Article Snippet: TMEM16F-specific oligonucleotides (Sigma-Aldrich; ) were designed ,and top and bottom strands were annealed, and then cloned into the Cas9 expression vector pSpCas9(BB)-2A-Puro (PX459) (Addgene plasmid #48139) as previously described ( ).

    Techniques: Knock-Out, Recombinant, Incubation, Binding Assay, Flow Cytometry, Cytometry, Fluorescence