oligos Geneworks Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    GeneWorks antisense oligonucleotides
    Antisense Oligonucleotides, supplied by GeneWorks, used in various techniques. Bioz Stars score: 94/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense oligonucleotides/product/GeneWorks
    Average 94 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    antisense oligonucleotides - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    89
    GeneWorks geneworks tgctgttgacagtgagcgcaagggtgttcctcttatctaatagtgaagccacagatgtattagataagaggaacacccttttgcctactgcctcgga
    Geneworks Tgctgttgacagtgagcgcaagggtgttcctcttatctaatagtgaagccacagatgtattagataagaggaacacccttttgcctactgcctcgga, supplied by GeneWorks, used in various techniques. Bioz Stars score: 89/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/geneworks tgctgttgacagtgagcgcaagggtgttcctcttatctaatagtgaagccacagatgtattagataagaggaacacccttttgcctactgcctcgga/product/GeneWorks
    Average 89 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    geneworks tgctgttgacagtgagcgcaagggtgttcctcttatctaatagtgaagccacagatgtattagataagaggaacacccttttgcctactgcctcgga - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    91
    GeneWorks nonmethylated cytosine guanosine oligonucleotides
    Nonmethylated Cytosine Guanosine Oligonucleotides, supplied by GeneWorks, used in various techniques. Bioz Stars score: 91/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nonmethylated cytosine guanosine oligonucleotides/product/GeneWorks
    Average 91 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    nonmethylated cytosine guanosine oligonucleotides - by Bioz Stars, 2020-02
    91/100 stars
      Buy from Supplier

    94
    GeneWorks single stranded oligonucleotides
    Single Stranded Oligonucleotides, supplied by GeneWorks, used in various techniques. Bioz Stars score: 94/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single stranded oligonucleotides/product/GeneWorks
    Average 94 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    single stranded oligonucleotides - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    77
    GeneWorks methylated oligonucleotides
    Methylated Oligonucleotides, supplied by GeneWorks, used in various techniques. Bioz Stars score: 77/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/methylated oligonucleotides/product/GeneWorks
    Average 77 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    methylated oligonucleotides - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    90
    GeneWorks random hexamer oligonucleotides
    Random Hexamer Oligonucleotides, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/random hexamer oligonucleotides/product/GeneWorks
    Average 90 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    random hexamer oligonucleotides - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    92
    GeneWorks oligo dt18
    Oligo Dt18, supplied by GeneWorks, used in various techniques. Bioz Stars score: 92/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt18/product/GeneWorks
    Average 92 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    oligo dt18 - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    76
    GeneWorks high pressure liquid chromatography purified oligonucleotides
    High Pressure Liquid Chromatography Purified Oligonucleotides, supplied by GeneWorks, used in various techniques. Bioz Stars score: 76/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high pressure liquid chromatography purified oligonucleotides/product/GeneWorks
    Average 76 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    high pressure liquid chromatography purified oligonucleotides - by Bioz Stars, 2020-02
    76/100 stars
      Buy from Supplier

    93
    GeneWorks oligo dt
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Oligo Dt, supplied by GeneWorks, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt/product/GeneWorks
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    oligo dt - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    99
    GeneWorks oligonucleotide primers
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Oligonucleotide Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 99/100, based on 49 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotide primers/product/GeneWorks
    Average 99 stars, based on 49 article reviews
    Price from $9.99 to $1999.99
    oligonucleotide primers - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    97
    GeneWorks oligo
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Oligo, supplied by GeneWorks, used in various techniques. Bioz Stars score: 97/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/GeneWorks
    Average 97 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    92
    GeneWorks oligonucleotide sequences
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Oligonucleotide Sequences, supplied by GeneWorks, used in various techniques. Bioz Stars score: 92/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotide sequences/product/GeneWorks
    Average 92 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    oligonucleotide sequences - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    81
    GeneWorks cpg oligonucleotide 2395
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Cpg Oligonucleotide 2395, supplied by GeneWorks, used in various techniques. Bioz Stars score: 81/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cpg oligonucleotide 2395/product/GeneWorks
    Average 81 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    cpg oligonucleotide 2395 - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    95
    GeneWorks oligo dt primer
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Oligo Dt Primer, supplied by GeneWorks, used in various techniques. Bioz Stars score: 95/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt primer/product/GeneWorks
    Average 95 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    oligo dt primer - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    80
    GeneWorks control oligonucleotide
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Control Oligonucleotide, supplied by GeneWorks, used in various techniques. Bioz Stars score: 80/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control oligonucleotide/product/GeneWorks
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    control oligonucleotide - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    81
    GeneWorks tlr agonists cpg oligonucleotide 1585
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Tlr Agonists Cpg Oligonucleotide 1585, supplied by GeneWorks, used in various techniques. Bioz Stars score: 81/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tlr agonists cpg oligonucleotide 1585/product/GeneWorks
    Average 81 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    tlr agonists cpg oligonucleotide 1585 - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    99
    GeneWorks oligonucleotide cpg 1668
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Oligonucleotide Cpg 1668, supplied by GeneWorks, used in various techniques. Bioz Stars score: 99/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotide cpg 1668/product/GeneWorks
    Average 99 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    oligonucleotide cpg 1668 - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    79
    GeneWorks biotinylated oligonucleotide dt35
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Biotinylated Oligonucleotide Dt35, supplied by GeneWorks, used in various techniques. Bioz Stars score: 79/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/biotinylated oligonucleotide dt35/product/GeneWorks
    Average 79 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    biotinylated oligonucleotide dt35 - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    79
    GeneWorks complementary cy5 modified target oligonucleotide
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Complementary Cy5 Modified Target Oligonucleotide, supplied by GeneWorks, used in various techniques. Bioz Stars score: 79/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/complementary cy5 modified target oligonucleotide/product/GeneWorks
    Average 79 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    complementary cy5 modified target oligonucleotide - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    79
    GeneWorks hplc purified oligonucleotide 5 d
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Hplc Purified Oligonucleotide 5 D, supplied by GeneWorks, used in various techniques. Bioz Stars score: 79/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hplc purified oligonucleotide 5 d/product/GeneWorks
    Average 79 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    hplc purified oligonucleotide 5 d - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    78
    GeneWorks hplc purified oligonucleotide 5 atat g tacatat 3 i
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Hplc Purified Oligonucleotide 5 Atat G Tacatat 3 I, supplied by GeneWorks, used in various techniques. Bioz Stars score: 78/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hplc purified oligonucleotide 5 atat g tacatat 3 i/product/GeneWorks
    Average 78 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    hplc purified oligonucleotide 5 atat g tacatat 3 i - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    86
    GeneWorks electrophoresis mobility shift assay emsa oligonucleotide primers
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Electrophoresis Mobility Shift Assay Emsa Oligonucleotide Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 86/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/electrophoresis mobility shift assay emsa oligonucleotide primers/product/GeneWorks
    Average 86 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    electrophoresis mobility shift assay emsa oligonucleotide primers - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    98
    GeneWorks cy3
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Cy3, supplied by GeneWorks, used in various techniques. Bioz Stars score: 98/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cy3/product/GeneWorks
    Average 98 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    cy3 - by Bioz Stars, 2020-02
    98/100 stars
      Buy from Supplier

    94
    GeneWorks site directed mutagenesis
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Site Directed Mutagenesis, supplied by GeneWorks, used in various techniques. Bioz Stars score: 94/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/site directed mutagenesis/product/GeneWorks
    Average 94 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    site directed mutagenesis - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    78
    GeneWorks cpg motif cpg
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Cpg Motif Cpg, supplied by GeneWorks, used in various techniques. Bioz Stars score: 78/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cpg motif cpg/product/GeneWorks
    Average 78 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    cpg motif cpg - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    93
    GeneWorks dna sequence analysis
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Dna Sequence Analysis, supplied by GeneWorks, used in various techniques. Bioz Stars score: 93/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna sequence analysis/product/GeneWorks
    Average 93 stars, based on 32 article reviews
    Price from $9.99 to $1999.99
    dna sequence analysis - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    87
    GeneWorks synthetic 84 mer
    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the <t>PCR</t> reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and <t>oligo-dT</t> primers is shaded.
    Synthetic 84 Mer, supplied by GeneWorks, used in various techniques. Bioz Stars score: 87/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/synthetic 84 mer/product/GeneWorks
    Average 87 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    synthetic 84 mer - by Bioz Stars, 2020-02
    87/100 stars
      Buy from Supplier

    Image Search Results


    ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the PCR reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and oligo-dT primers is shaded.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Biosynthesis and insecticidal properties of plant cyclotides: The cyclic knotted proteins from Oldenlandia affinis

    doi: 10.1073/pnas.191366898

    Figure Lengend Snippet: ( A ) Schematic representation of kalata B1 showing the cyclic cystine knot, the amino acid sequence in single letter code, and the regions used for oligonucleotide primer design (shaded). ( B ) The primers used in the PCR reactions. I represents inosine, Y represents C or T, and R represents A, C, T, or G. The introduced restriction enzyme sites are in italics. ( C ) Amino acid sequence of the protein encoded by the Oak1 clone. The sequence corresponding to the PCR product obtained with the Kal2 and oligo-dT primers is shaded.

    Article Snippet: Single-stranded cDNA was prepared from leaf RNA and amplified by the PCR by using one of two degenerate primers and oligo-dT (GeneWorks, Adelaide, Australia).

    Techniques: Sequencing, Polymerase Chain Reaction