oligos Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Integrated DNA Technologies antisense oligonucleotides
    miR-4728-3p IS regulates ESR1. A. qRT-PCR analysis of ESR1 and HER2 transcripts and miR-4728-3p among a panel of 38 breast cancer tumors (19 HER2+, 19 HER2-). Calibrated Normalized Relative Quantity (CNRQ) of miR-4728-3p (left) and HER2 (right) is plotted against expression levels of ESR1. Tumors classified as HER2+ by ISH are shown in red, HER2- in grey. Expression was normalized to a panel of reference genes. For details see text and material and methods. B. Luciferase assay in BT-474 with ESR1 3′UTR constructs carrying either wild type target site of miR-4728-3p internal seed (WT) or mutated internal seed site (MUT). Firefly luciferase activity was normalized against Renilla luciferase. Reporter activity is given as % of WT in respective experiment. Repression of WT ESR1 construct by endogenous miR-4728-3p (left) is alleviated by an <t>antisense</t> oligo (AS) against endogenous miRNA (right) but not by a non-targeting control (middle). C. Western blot (left) and protein quantification (right) of ESR1 in MCF7. The two main isoforms of ESR1 (47 and 66 kDa), plotted as percentage of control signal of matching size, are down regulated upon transfection of miR-4728-3p mimics. Levels of HER2, (p)MAPK and (p)AKT remain largely unchanged. D. MCF7 cells were transfected with indicated concentrations of miR-4728-3p mimic. ESR1 levels show a concentration-dependent down-regulation that is most pronounced at highest tested concentration (25 nM). E. Western blot (left) and protein quantification (right) of ESR1 in BT474. ESR1 is up regulated when blocking endogenous miR-4728-3p with AS-oligonucleotides, while pMAPK and pAKT remain largely unchanged. F. Western blot (left) and protein quantification (right) of ESR1 in HCC1954 cells. ESR1 isoform of 47 kDa is up regulated under miR-4728-3p blocking. The main 66 kDa isoform is not detectable in this ER- cell line. Signals were quantified with ImageJ and normalized to total protein by Coomassie stain. Tubulin was used as a loading control. Asterisks denote p-values of
    Antisense Oligonucleotides, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 246 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense oligonucleotides/product/Integrated DNA Technologies
    Average 95 stars, based on 246 article reviews
    Price from $9.99 to $1999.99
    antisense oligonucleotides - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    95
    Millipore dsdna oligos
    Correlative light and electron spectroscopic imaging (LM/ESI) of SK-N-SH cells expressing LacI-tagged SC35 using fluorogold <t>dsDNA</t> <t>oligos.</t> Detection of nuclear speckles (arrow) via the Cy3 fluorophore ( A , left panel), and confirmation of gold conjugation to the dsDNA oligo through silver enhancement (A, right panel). Untransfected cells (arrowhead) contain background levels of silver deposition. Scale bar = 200 nm. ( B ) Overlay of fluorescence and low magnification ESI micrographs collected at 155 eV. With two rounds of the silver enhancement using a LM enhancement kit (B, left panel), the silver particles are visible as bright spots. The right panel is an overlay image of a nucleus containing EM-enhanced gold. Scale bar = 2 μm. An area corresponding to an IGC, as defined by a box in the left panel is analysed at high resolution, and maps of phosphorus ( C , red panel) and nitrogen (C, green panel) show the ultrastructure of the IGC region, which is low in phosphorus content and contains protein-based fibrous structures. The fluorogold oligo localization is indicated with silver-enhanced gold particles false-coloured in white. The composite map ( D , left panel) illustrates the position of the IGC relative to chromatin (Ch, yellow) and the nucleolus (Nu, yellow-green). The silver particles in the interior of the IGC are labelled with arrowheads, whereas those proximal to the neighbouring chromatin are indicated by arrows. The composite map (D, right panel) of the EM-enhanced nucleus (B, right panel) contains smaller but uniform silver particles, as indicated by the arrows and arrowheads. Scale bar = 5 μm.
    Dsdna Oligos, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dsdna oligos/product/Millipore
    Average 95 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    dsdna oligos - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    82
    Thermo Fisher oligo dt oligonucleotides
    Correlative light and electron spectroscopic imaging (LM/ESI) of SK-N-SH cells expressing LacI-tagged SC35 using fluorogold <t>dsDNA</t> <t>oligos.</t> Detection of nuclear speckles (arrow) via the Cy3 fluorophore ( A , left panel), and confirmation of gold conjugation to the dsDNA oligo through silver enhancement (A, right panel). Untransfected cells (arrowhead) contain background levels of silver deposition. Scale bar = 200 nm. ( B ) Overlay of fluorescence and low magnification ESI micrographs collected at 155 eV. With two rounds of the silver enhancement using a LM enhancement kit (B, left panel), the silver particles are visible as bright spots. The right panel is an overlay image of a nucleus containing EM-enhanced gold. Scale bar = 2 μm. An area corresponding to an IGC, as defined by a box in the left panel is analysed at high resolution, and maps of phosphorus ( C , red panel) and nitrogen (C, green panel) show the ultrastructure of the IGC region, which is low in phosphorus content and contains protein-based fibrous structures. The fluorogold oligo localization is indicated with silver-enhanced gold particles false-coloured in white. The composite map ( D , left panel) illustrates the position of the IGC relative to chromatin (Ch, yellow) and the nucleolus (Nu, yellow-green). The silver particles in the interior of the IGC are labelled with arrowheads, whereas those proximal to the neighbouring chromatin are indicated by arrows. The composite map (D, right panel) of the EM-enhanced nucleus (B, right panel) contains smaller but uniform silver particles, as indicated by the arrows and arrowheads. Scale bar = 5 μm.
    Oligo Dt Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 82/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt oligonucleotides/product/Thermo Fisher
    Average 82 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    oligo dt oligonucleotides - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    79
    Agilent technologies oligonucleotides oligos
    Correlative light and electron spectroscopic imaging (LM/ESI) of SK-N-SH cells expressing LacI-tagged SC35 using fluorogold <t>dsDNA</t> <t>oligos.</t> Detection of nuclear speckles (arrow) via the Cy3 fluorophore ( A , left panel), and confirmation of gold conjugation to the dsDNA oligo through silver enhancement (A, right panel). Untransfected cells (arrowhead) contain background levels of silver deposition. Scale bar = 200 nm. ( B ) Overlay of fluorescence and low magnification ESI micrographs collected at 155 eV. With two rounds of the silver enhancement using a LM enhancement kit (B, left panel), the silver particles are visible as bright spots. The right panel is an overlay image of a nucleus containing EM-enhanced gold. Scale bar = 2 μm. An area corresponding to an IGC, as defined by a box in the left panel is analysed at high resolution, and maps of phosphorus ( C , red panel) and nitrogen (C, green panel) show the ultrastructure of the IGC region, which is low in phosphorus content and contains protein-based fibrous structures. The fluorogold oligo localization is indicated with silver-enhanced gold particles false-coloured in white. The composite map ( D , left panel) illustrates the position of the IGC relative to chromatin (Ch, yellow) and the nucleolus (Nu, yellow-green). The silver particles in the interior of the IGC are labelled with arrowheads, whereas those proximal to the neighbouring chromatin are indicated by arrows. The composite map (D, right panel) of the EM-enhanced nucleus (B, right panel) contains smaller but uniform silver particles, as indicated by the arrows and arrowheads. Scale bar = 5 μm.
    Oligonucleotides Oligos, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 79/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotides oligos/product/Agilent technologies
    Average 79 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    oligonucleotides oligos - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    89
    Gene Tools Inc oligos
    Correlative light and electron spectroscopic imaging (LM/ESI) of SK-N-SH cells expressing LacI-tagged SC35 using fluorogold <t>dsDNA</t> <t>oligos.</t> Detection of nuclear speckles (arrow) via the Cy3 fluorophore ( A , left panel), and confirmation of gold conjugation to the dsDNA oligo through silver enhancement (A, right panel). Untransfected cells (arrowhead) contain background levels of silver deposition. Scale bar = 200 nm. ( B ) Overlay of fluorescence and low magnification ESI micrographs collected at 155 eV. With two rounds of the silver enhancement using a LM enhancement kit (B, left panel), the silver particles are visible as bright spots. The right panel is an overlay image of a nucleus containing EM-enhanced gold. Scale bar = 2 μm. An area corresponding to an IGC, as defined by a box in the left panel is analysed at high resolution, and maps of phosphorus ( C , red panel) and nitrogen (C, green panel) show the ultrastructure of the IGC region, which is low in phosphorus content and contains protein-based fibrous structures. The fluorogold oligo localization is indicated with silver-enhanced gold particles false-coloured in white. The composite map ( D , left panel) illustrates the position of the IGC relative to chromatin (Ch, yellow) and the nucleolus (Nu, yellow-green). The silver particles in the interior of the IGC are labelled with arrowheads, whereas those proximal to the neighbouring chromatin are indicated by arrows. The composite map (D, right panel) of the EM-enhanced nucleus (B, right panel) contains smaller but uniform silver particles, as indicated by the arrows and arrowheads. Scale bar = 5 μm.
    Oligos, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 89/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Gene Tools Inc
    Average 89 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    97
    Horizon Discovery oligos
    The hetatocellular carcinoma cell line SNU449 expresses high levels of ERK5 but is not dependent on MEK5-ERK5 signaling for proliferation. ( A ) Subconfluent cultures of BT474 and the liver hepatocellular carcinoma cell line SNU449 harbouring an amplification containing the ERK5 gene were maintained in 10% FBS. Cells were lysed, whole cell lysates were separated by SDS-PAGE and immunoblotted with the antibodies indicated. ( B ) Subconfluent cultures of SNU449 cells were maintained in 10% FBS then treated with increasing concentrations of BIX02189 (100 nM to 30 µM) for 24 or 48 hours, and DNA synthesis was assayed by [ 3 H]thymidine incorporation; the results are presented as an average of 3 experiments ± SD. Alternatively, cells were transfected as in Fig. 2 ( C ), 6h post-transfection cell were treated with increasing concentrations of BIX02189 (100 nM to 30 µM) for 24 hours. Cells were then lysed and firefly luciferase activity was measured and normalized to Renilla. A representative experiment of 3 is shown and values are expressed as the mean of triplicate transfections ± SD ( C ) SNU449 cells were transfected with ERK5-specific as indicated or non-silencing (control) <t>siRNA</t> <t>oligos.</t> Mock cells were left untransfected. Seventy-two hours post-transfection, ERK5 and α-tubulin abundances were determined by Western blot analysis of whole-cell extracts. ( D ) SNU449 cells were transfected as in ( C ) cell viability was determined by MTT assay. A representative experiment of 2 is shown and values are expressed as the mean of 8 values ± CoV.
    Oligos, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 97/100, based on 273 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Horizon Discovery
    Average 97 stars, based on 273 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    97
    Illumina Inc oligos
    Mapping nucleosome distributions following KSHV reactivation using mTSS-seq technique and mTSS-seq validation A. Experimental design for mapping nucleosome distributions following KSHV reactivation using our newly developed mTSS-seq technique. B. Validation of mTSS-seq using quantitative <t>PCR</t> for both on-target regions of the genome (within the sequence-capture region, two-kb region centered on a TSS) and off-target regions of the genome (not within the sequence-capture region, outside the two-region centered on a TSS). Quantitative PCR was performed for on- and off-target regions of the genome for both RHOC and ITGA4. The y-axis shows C t values. On average, C t values between the on- and off-targets of the sequence-captured libraries differ by 10.5 cycles. C. The periodic occurrence of AA/TT/AT/TA dinucleotides was calculated for all nucleosomal-sized fragments (147-148 bp) at the 0 hour time point. The x-axis represents the distance from the dyad axis. The y-axis is the frequency of AA/TT/AT/TA dinucleotides. An A/T-containing dinucleotide periodicity is seen every 10 bp at the 0 hour time point. D. Alignment of the midpoint fragments (purple) from mTSS-seq to the human genome shown in the UCSC Genome Browser ( http://genome.ucsc.edu ). Zooming in 5000X on human chromosome 2 to a six-kb window with two-kb of midpoint fragments at 0 hour time point (purple lines), along with the sequence-capture <t>oligos</t> and previously-published human-nucleosome distribution map for cell line GM18508 (red lines, (Gaffney et al., 2012)) at the TSSs of PUS10 and PEX13. The x-axis is genomic location. The y-axis is scaled reads per million.
    Oligos, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 97/100, based on 346 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Illumina Inc
    Average 97 stars, based on 346 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    88
    Kaneka Corp oligos
    Mapping nucleosome distributions following KSHV reactivation using mTSS-seq technique and mTSS-seq validation A. Experimental design for mapping nucleosome distributions following KSHV reactivation using our newly developed mTSS-seq technique. B. Validation of mTSS-seq using quantitative <t>PCR</t> for both on-target regions of the genome (within the sequence-capture region, two-kb region centered on a TSS) and off-target regions of the genome (not within the sequence-capture region, outside the two-region centered on a TSS). Quantitative PCR was performed for on- and off-target regions of the genome for both RHOC and ITGA4. The y-axis shows C t values. On average, C t values between the on- and off-targets of the sequence-captured libraries differ by 10.5 cycles. C. The periodic occurrence of AA/TT/AT/TA dinucleotides was calculated for all nucleosomal-sized fragments (147-148 bp) at the 0 hour time point. The x-axis represents the distance from the dyad axis. The y-axis is the frequency of AA/TT/AT/TA dinucleotides. An A/T-containing dinucleotide periodicity is seen every 10 bp at the 0 hour time point. D. Alignment of the midpoint fragments (purple) from mTSS-seq to the human genome shown in the UCSC Genome Browser ( http://genome.ucsc.edu ). Zooming in 5000X on human chromosome 2 to a six-kb window with two-kb of midpoint fragments at 0 hour time point (purple lines), along with the sequence-capture <t>oligos</t> and previously-published human-nucleosome distribution map for cell line GM18508 (red lines, (Gaffney et al., 2012)) at the TSSs of PUS10 and PEX13. The x-axis is genomic location. The y-axis is scaled reads per million.
    Oligos, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 88/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Kaneka Corp
    Average 88 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    88/100 stars
      Buy from Supplier

    96
    Ribobio oligos
    Dum functions to promote muscle cell differentiation. (A) Knockdown of Dum by <t>siRNA</t> <t>oligos</t> in C2C12 cells decreased the expression of Dum during a 4-day differentiation course. (B) The indicated myogenic genes, myogenin , MyHC and troponin were downregulated
    Oligos, supplied by Ribobio, used in various techniques. Bioz Stars score: 96/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Ribobio
    Average 96 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    77
    Qiagen validated oligonucleotides oligos
    Dum functions to promote muscle cell differentiation. (A) Knockdown of Dum by <t>siRNA</t> <t>oligos</t> in C2C12 cells decreased the expression of Dum during a 4-day differentiation course. (B) The indicated myogenic genes, myogenin , MyHC and troponin were downregulated
    Validated Oligonucleotides Oligos, supplied by Qiagen, used in various techniques. Bioz Stars score: 77/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/validated oligonucleotides oligos/product/Qiagen
    Average 77 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    validated oligonucleotides oligos - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    81
    Shanghai GenePharma nonspecific oligonucleotides oligos
    Dum functions to promote muscle cell differentiation. (A) Knockdown of Dum by <t>siRNA</t> <t>oligos</t> in C2C12 cells decreased the expression of Dum during a 4-day differentiation course. (B) The indicated myogenic genes, myogenin , MyHC and troponin were downregulated
    Nonspecific Oligonucleotides Oligos, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 81/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nonspecific oligonucleotides oligos/product/Shanghai GenePharma
    Average 81 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    nonspecific oligonucleotides oligos - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    97
    Promega oligos
    Dum functions to promote muscle cell differentiation. (A) Knockdown of Dum by <t>siRNA</t> <t>oligos</t> in C2C12 cells decreased the expression of Dum during a 4-day differentiation course. (B) The indicated myogenic genes, myogenin , MyHC and troponin were downregulated
    Oligos, supplied by Promega, used in various techniques. Bioz Stars score: 97/100, based on 398 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Promega
    Average 97 stars, based on 398 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    96
    Santa Cruz Biotechnology oligos
    Factors forming complex with MRE-c′ oligo belong to <t>NFI</t> family of proteins. Whole cell extract (10 μg) from HepG2 cells (lane 1) was incubated with 0.1–0.2 ng of 32 P-labeled MRE-c′ oligo at 4°C under optimum binding conditions and subjected to electrophoresis on polyacrylamide (6% acrylamide) gel. (A) To identify the proteins forming the complexes, the extract was preincubated with either of the following unlabeled <t>oligos:</t> (a) 100- or 200-fold molar excess of MRE-c′ (lanes 2 and 3), (b) MRE-c′ mutant (lanes 4 and 5), (c) 50- or 100-fold molar excess of NFI consensus oligo (lanes 6 and 7), or (d) NFI mutant (lanes 8 and 9) along with 0.5 μg of poly(dI-dC) as nonspecific competitor. (B) The extract was also preincubated separately with l μl of normal rabbit serum (lane 2) or anti-NFI antisera (lane 3) for 30 min on ice prior to addition of the labeled probe. The arrow indicates the position of the supershifted complex.
    Oligos, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 58 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Santa Cruz Biotechnology
    Average 96 stars, based on 58 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    97
    Eurofins oligos
    Factors forming complex with MRE-c′ oligo belong to <t>NFI</t> family of proteins. Whole cell extract (10 μg) from HepG2 cells (lane 1) was incubated with 0.1–0.2 ng of 32 P-labeled MRE-c′ oligo at 4°C under optimum binding conditions and subjected to electrophoresis on polyacrylamide (6% acrylamide) gel. (A) To identify the proteins forming the complexes, the extract was preincubated with either of the following unlabeled <t>oligos:</t> (a) 100- or 200-fold molar excess of MRE-c′ (lanes 2 and 3), (b) MRE-c′ mutant (lanes 4 and 5), (c) 50- or 100-fold molar excess of NFI consensus oligo (lanes 6 and 7), or (d) NFI mutant (lanes 8 and 9) along with 0.5 μg of poly(dI-dC) as nonspecific competitor. (B) The extract was also preincubated separately with l μl of normal rabbit serum (lane 2) or anti-NFI antisera (lane 3) for 30 min on ice prior to addition of the labeled probe. The arrow indicates the position of the supershifted complex.
    Oligos, supplied by Eurofins, used in various techniques. Bioz Stars score: 97/100, based on 157 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Eurofins
    Average 97 stars, based on 157 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    96
    Macrogen oligos
    Factors forming complex with MRE-c′ oligo belong to <t>NFI</t> family of proteins. Whole cell extract (10 μg) from HepG2 cells (lane 1) was incubated with 0.1–0.2 ng of 32 P-labeled MRE-c′ oligo at 4°C under optimum binding conditions and subjected to electrophoresis on polyacrylamide (6% acrylamide) gel. (A) To identify the proteins forming the complexes, the extract was preincubated with either of the following unlabeled <t>oligos:</t> (a) 100- or 200-fold molar excess of MRE-c′ (lanes 2 and 3), (b) MRE-c′ mutant (lanes 4 and 5), (c) 50- or 100-fold molar excess of NFI consensus oligo (lanes 6 and 7), or (d) NFI mutant (lanes 8 and 9) along with 0.5 μg of poly(dI-dC) as nonspecific competitor. (B) The extract was also preincubated separately with l μl of normal rabbit serum (lane 2) or anti-NFI antisera (lane 3) for 30 min on ice prior to addition of the labeled probe. The arrow indicates the position of the supershifted complex.
    Oligos, supplied by Macrogen, used in various techniques. Bioz Stars score: 96/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Macrogen
    Average 96 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    88
    Sigma-Genosys oligos
    Factors forming complex with MRE-c′ oligo belong to <t>NFI</t> family of proteins. Whole cell extract (10 μg) from HepG2 cells (lane 1) was incubated with 0.1–0.2 ng of 32 P-labeled MRE-c′ oligo at 4°C under optimum binding conditions and subjected to electrophoresis on polyacrylamide (6% acrylamide) gel. (A) To identify the proteins forming the complexes, the extract was preincubated with either of the following unlabeled <t>oligos:</t> (a) 100- or 200-fold molar excess of MRE-c′ (lanes 2 and 3), (b) MRE-c′ mutant (lanes 4 and 5), (c) 50- or 100-fold molar excess of NFI consensus oligo (lanes 6 and 7), or (d) NFI mutant (lanes 8 and 9) along with 0.5 μg of poly(dI-dC) as nonspecific competitor. (B) The extract was also preincubated separately with l μl of normal rabbit serum (lane 2) or anti-NFI antisera (lane 3) for 30 min on ice prior to addition of the labeled probe. The arrow indicates the position of the supershifted complex.
    Oligos, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 88/100, based on 71 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Sigma-Genosys
    Average 88 stars, based on 71 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    88/100 stars
      Buy from Supplier

    96
    Evrogen oligos
    Factors forming complex with MRE-c′ oligo belong to <t>NFI</t> family of proteins. Whole cell extract (10 μg) from HepG2 cells (lane 1) was incubated with 0.1–0.2 ng of 32 P-labeled MRE-c′ oligo at 4°C under optimum binding conditions and subjected to electrophoresis on polyacrylamide (6% acrylamide) gel. (A) To identify the proteins forming the complexes, the extract was preincubated with either of the following unlabeled <t>oligos:</t> (a) 100- or 200-fold molar excess of MRE-c′ (lanes 2 and 3), (b) MRE-c′ mutant (lanes 4 and 5), (c) 50- or 100-fold molar excess of NFI consensus oligo (lanes 6 and 7), or (d) NFI mutant (lanes 8 and 9) along with 0.5 μg of poly(dI-dC) as nonspecific competitor. (B) The extract was also preincubated separately with l μl of normal rabbit serum (lane 2) or anti-NFI antisera (lane 3) for 30 min on ice prior to addition of the labeled probe. The arrow indicates the position of the supershifted complex.
    Oligos, supplied by Evrogen, used in various techniques. Bioz Stars score: 96/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Evrogen
    Average 96 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    89
    Midland Certified Reagent oligos
    Factors forming complex with MRE-c′ oligo belong to <t>NFI</t> family of proteins. Whole cell extract (10 μg) from HepG2 cells (lane 1) was incubated with 0.1–0.2 ng of 32 P-labeled MRE-c′ oligo at 4°C under optimum binding conditions and subjected to electrophoresis on polyacrylamide (6% acrylamide) gel. (A) To identify the proteins forming the complexes, the extract was preincubated with either of the following unlabeled <t>oligos:</t> (a) 100- or 200-fold molar excess of MRE-c′ (lanes 2 and 3), (b) MRE-c′ mutant (lanes 4 and 5), (c) 50- or 100-fold molar excess of NFI consensus oligo (lanes 6 and 7), or (d) NFI mutant (lanes 8 and 9) along with 0.5 μg of poly(dI-dC) as nonspecific competitor. (B) The extract was also preincubated separately with l μl of normal rabbit serum (lane 2) or anti-NFI antisera (lane 3) for 30 min on ice prior to addition of the labeled probe. The arrow indicates the position of the supershifted complex.
    Oligos, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 89/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Midland Certified Reagent
    Average 89 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    96
    TriLink oligos
    Factors forming complex with MRE-c′ oligo belong to <t>NFI</t> family of proteins. Whole cell extract (10 μg) from HepG2 cells (lane 1) was incubated with 0.1–0.2 ng of 32 P-labeled MRE-c′ oligo at 4°C under optimum binding conditions and subjected to electrophoresis on polyacrylamide (6% acrylamide) gel. (A) To identify the proteins forming the complexes, the extract was preincubated with either of the following unlabeled <t>oligos:</t> (a) 100- or 200-fold molar excess of MRE-c′ (lanes 2 and 3), (b) MRE-c′ mutant (lanes 4 and 5), (c) 50- or 100-fold molar excess of NFI consensus oligo (lanes 6 and 7), or (d) NFI mutant (lanes 8 and 9) along with 0.5 μg of poly(dI-dC) as nonspecific competitor. (B) The extract was also preincubated separately with l μl of normal rabbit serum (lane 2) or anti-NFI antisera (lane 3) for 30 min on ice prior to addition of the labeled probe. The arrow indicates the position of the supershifted complex.
    Oligos, supplied by TriLink, used in various techniques. Bioz Stars score: 96/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/TriLink
    Average 96 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    96
    Cosmo Genetech Co oligos
    Factors forming complex with MRE-c′ oligo belong to <t>NFI</t> family of proteins. Whole cell extract (10 μg) from HepG2 cells (lane 1) was incubated with 0.1–0.2 ng of 32 P-labeled MRE-c′ oligo at 4°C under optimum binding conditions and subjected to electrophoresis on polyacrylamide (6% acrylamide) gel. (A) To identify the proteins forming the complexes, the extract was preincubated with either of the following unlabeled <t>oligos:</t> (a) 100- or 200-fold molar excess of MRE-c′ (lanes 2 and 3), (b) MRE-c′ mutant (lanes 4 and 5), (c) 50- or 100-fold molar excess of NFI consensus oligo (lanes 6 and 7), or (d) NFI mutant (lanes 8 and 9) along with 0.5 μg of poly(dI-dC) as nonspecific competitor. (B) The extract was also preincubated separately with l μl of normal rabbit serum (lane 2) or anti-NFI antisera (lane 3) for 30 min on ice prior to addition of the labeled probe. The arrow indicates the position of the supershifted complex.
    Oligos, supplied by Cosmo Genetech Co, used in various techniques. Bioz Stars score: 96/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Cosmo Genetech Co
    Average 96 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    96
    GenScript oligos
    Factors forming complex with MRE-c′ oligo belong to <t>NFI</t> family of proteins. Whole cell extract (10 μg) from HepG2 cells (lane 1) was incubated with 0.1–0.2 ng of 32 P-labeled MRE-c′ oligo at 4°C under optimum binding conditions and subjected to electrophoresis on polyacrylamide (6% acrylamide) gel. (A) To identify the proteins forming the complexes, the extract was preincubated with either of the following unlabeled <t>oligos:</t> (a) 100- or 200-fold molar excess of MRE-c′ (lanes 2 and 3), (b) MRE-c′ mutant (lanes 4 and 5), (c) 50- or 100-fold molar excess of NFI consensus oligo (lanes 6 and 7), or (d) NFI mutant (lanes 8 and 9) along with 0.5 μg of poly(dI-dC) as nonspecific competitor. (B) The extract was also preincubated separately with l μl of normal rabbit serum (lane 2) or anti-NFI antisera (lane 3) for 30 min on ice prior to addition of the labeled probe. The arrow indicates the position of the supershifted complex.
    Oligos, supplied by GenScript, used in various techniques. Bioz Stars score: 96/100, based on 68 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/GenScript
    Average 96 stars, based on 68 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    92
    Integrated DNA Technologies trugrade oligonucleotides
    Factors forming complex with MRE-c′ oligo belong to <t>NFI</t> family of proteins. Whole cell extract (10 μg) from HepG2 cells (lane 1) was incubated with 0.1–0.2 ng of 32 P-labeled MRE-c′ oligo at 4°C under optimum binding conditions and subjected to electrophoresis on polyacrylamide (6% acrylamide) gel. (A) To identify the proteins forming the complexes, the extract was preincubated with either of the following unlabeled <t>oligos:</t> (a) 100- or 200-fold molar excess of MRE-c′ (lanes 2 and 3), (b) MRE-c′ mutant (lanes 4 and 5), (c) 50- or 100-fold molar excess of NFI consensus oligo (lanes 6 and 7), or (d) NFI mutant (lanes 8 and 9) along with 0.5 μg of poly(dI-dC) as nonspecific competitor. (B) The extract was also preincubated separately with l μl of normal rabbit serum (lane 2) or anti-NFI antisera (lane 3) for 30 min on ice prior to addition of the labeled probe. The arrow indicates the position of the supershifted complex.
    Trugrade Oligonucleotides, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 92/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trugrade oligonucleotides/product/Integrated DNA Technologies
    Average 92 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    trugrade oligonucleotides - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    95
    Integrated DNA Technologies ultramer oligonucleotides
    Endpoint fluorescence scatter plot containing 4 in-run controls and 40 clinical specimens. Control reactions using <t>Ultramer</t> oligonucleotides for wild type (Wt) (A), A2058G (B), and A2059G (C) are shown. (D) No template control. The gray box indicates
    Ultramer Oligonucleotides, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 71 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ultramer oligonucleotides/product/Integrated DNA Technologies
    Average 95 stars, based on 71 article reviews
    Price from $9.99 to $1999.99
    ultramer oligonucleotides - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    77
    Thermo Fisher reagents rnai oligonucleotides oligo
    RacGAP1 is required for pseudopod extension and invasion. (A) A2780 cells were transfected with control or RacGAP1-specific SMARTpool <t>oligonucleotides,</t> seeded onto CDMs, and stimulated with cRGDfV as indicated. Images were captured every 10 min using a 20× objective lens. Representative images are shown. Bar, 50 µm. (B) Pseudopod length ( n > 400/condition) was measured for all moving cells within the 20th frame. (C) A2780 cells were transfected as in A and seeded into inverted invasion assays after 16 h in the presence or absence of FN and cRGDfV as indicated. The yellow line indicates the level of invasion under control conditions. (D) A2780 cells stably expressing GFP or FLAG-RacGAP1 WT were transfected with control or RacGAP <t>RNAi</t> oligo #6, treated as in C, and seeded into inverted invasion assays in the presence of cRGDfV and FN. (E) MDA-MB-231 cells were transfected as in A and seeded into inverted invasion assays in the presence of FN. (F) H1299 cells stably expressing mutant p53 (273H) or control vector (VEC) were transfected as in A and seeded into inverted invasion assays in the presence of FN. Data represent means ± SEM from at least three independent experiments. *, P
    Reagents Rnai Oligonucleotides Oligo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reagents rnai oligonucleotides oligo/product/Thermo Fisher
    Average 77 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    reagents rnai oligonucleotides oligo - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    76
    Thermo Fisher oligonucleotide duplexes oligonucleotides
    RacGAP1 is required for pseudopod extension and invasion. (A) A2780 cells were transfected with control or RacGAP1-specific SMARTpool <t>oligonucleotides,</t> seeded onto CDMs, and stimulated with cRGDfV as indicated. Images were captured every 10 min using a 20× objective lens. Representative images are shown. Bar, 50 µm. (B) Pseudopod length ( n > 400/condition) was measured for all moving cells within the 20th frame. (C) A2780 cells were transfected as in A and seeded into inverted invasion assays after 16 h in the presence or absence of FN and cRGDfV as indicated. The yellow line indicates the level of invasion under control conditions. (D) A2780 cells stably expressing GFP or FLAG-RacGAP1 WT were transfected with control or RacGAP <t>RNAi</t> oligo #6, treated as in C, and seeded into inverted invasion assays in the presence of cRGDfV and FN. (E) MDA-MB-231 cells were transfected as in A and seeded into inverted invasion assays in the presence of FN. (F) H1299 cells stably expressing mutant p53 (273H) or control vector (VEC) were transfected as in A and seeded into inverted invasion assays in the presence of FN. Data represent means ± SEM from at least three independent experiments. *, P
    Oligonucleotide Duplexes Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 76/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotide duplexes oligonucleotides/product/Thermo Fisher
    Average 76 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    oligonucleotide duplexes oligonucleotides - by Bioz Stars, 2020-02
    76/100 stars
      Buy from Supplier

    95
    Integrated DNA Technologies rna oligos
    RacGAP1 is required for pseudopod extension and invasion. (A) A2780 cells were transfected with control or RacGAP1-specific SMARTpool <t>oligonucleotides,</t> seeded onto CDMs, and stimulated with cRGDfV as indicated. Images were captured every 10 min using a 20× objective lens. Representative images are shown. Bar, 50 µm. (B) Pseudopod length ( n > 400/condition) was measured for all moving cells within the 20th frame. (C) A2780 cells were transfected as in A and seeded into inverted invasion assays after 16 h in the presence or absence of FN and cRGDfV as indicated. The yellow line indicates the level of invasion under control conditions. (D) A2780 cells stably expressing GFP or FLAG-RacGAP1 WT were transfected with control or RacGAP <t>RNAi</t> oligo #6, treated as in C, and seeded into inverted invasion assays in the presence of cRGDfV and FN. (E) MDA-MB-231 cells were transfected as in A and seeded into inverted invasion assays in the presence of FN. (F) H1299 cells stably expressing mutant p53 (273H) or control vector (VEC) were transfected as in A and seeded into inverted invasion assays in the presence of FN. Data represent means ± SEM from at least three independent experiments. *, P
    Rna Oligos, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 129 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna oligos/product/Integrated DNA Technologies
    Average 95 stars, based on 129 article reviews
    Price from $9.99 to $1999.99
    rna oligos - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    77
    Becton Dickinson oligonucleotides smart oligo vi
    RacGAP1 is required for pseudopod extension and invasion. (A) A2780 cells were transfected with control or RacGAP1-specific SMARTpool <t>oligonucleotides,</t> seeded onto CDMs, and stimulated with cRGDfV as indicated. Images were captured every 10 min using a 20× objective lens. Representative images are shown. Bar, 50 µm. (B) Pseudopod length ( n > 400/condition) was measured for all moving cells within the 20th frame. (C) A2780 cells were transfected as in A and seeded into inverted invasion assays after 16 h in the presence or absence of FN and cRGDfV as indicated. The yellow line indicates the level of invasion under control conditions. (D) A2780 cells stably expressing GFP or FLAG-RacGAP1 WT were transfected with control or RacGAP <t>RNAi</t> oligo #6, treated as in C, and seeded into inverted invasion assays in the presence of cRGDfV and FN. (E) MDA-MB-231 cells were transfected as in A and seeded into inverted invasion assays in the presence of FN. (F) H1299 cells stably expressing mutant p53 (273H) or control vector (VEC) were transfected as in A and seeded into inverted invasion assays in the presence of FN. Data represent means ± SEM from at least three independent experiments. *, P
    Oligonucleotides Smart Oligo Vi, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 77/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotides smart oligo vi/product/Becton Dickinson
    Average 77 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    oligonucleotides smart oligo vi - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    77
    Kaneka Corp control gap oligonucleotides oligos
    RacGAP1 is required for pseudopod extension and invasion. (A) A2780 cells were transfected with control or RacGAP1-specific SMARTpool <t>oligonucleotides,</t> seeded onto CDMs, and stimulated with cRGDfV as indicated. Images were captured every 10 min using a 20× objective lens. Representative images are shown. Bar, 50 µm. (B) Pseudopod length ( n > 400/condition) was measured for all moving cells within the 20th frame. (C) A2780 cells were transfected as in A and seeded into inverted invasion assays after 16 h in the presence or absence of FN and cRGDfV as indicated. The yellow line indicates the level of invasion under control conditions. (D) A2780 cells stably expressing GFP or FLAG-RacGAP1 WT were transfected with control or RacGAP <t>RNAi</t> oligo #6, treated as in C, and seeded into inverted invasion assays in the presence of cRGDfV and FN. (E) MDA-MB-231 cells were transfected as in A and seeded into inverted invasion assays in the presence of FN. (F) H1299 cells stably expressing mutant p53 (273H) or control vector (VEC) were transfected as in A and seeded into inverted invasion assays in the presence of FN. Data represent means ± SEM from at least three independent experiments. *, P
    Control Gap Oligonucleotides Oligos, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 77/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control gap oligonucleotides oligos/product/Kaneka Corp
    Average 77 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    control gap oligonucleotides oligos - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    90
    Thermo Fisher dna oligonucleotides
    Extension from PPT62 at a nick followed by the M-MuLV <t>RNA.</t> 5′ end-labeled PPT62 without a downstream oligonucleotide (none) (lanes 1, 4, 7, 10, 13, and 16 to 19) or with downstream MLVnick (lanes 2, 5, 8, 11, 14, and 20 to 23) or MLVnickD (lanes 3, 6, 9, 12, 15, and 24 to 27) was annealed to template 2. Extensions were carried out with T7 <t>DNA</t> polymerase (T7; lanes 4 to 6), T4 DNA polymerase (T4; lanes 7 to 9), RTΔH (lanes 10 to 12), wild-type reverse transcriptase (wt RT; lanes 13 to 15) or H − RT (lanes 17 to 19, 21 to 23, and 25 to 27) for the indicated times. Substrates incubated without enzyme are shown in lanes 1 to 3, 16, 20, and 24. The products were analyzed in a 20% sequencing gel and visualized using a PhosphorImager. A schematic of the nicked substrate II tested is shown at top, and the positions of unextended PPT62 and the full-length extension product are indicated on the right.
    Dna Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1062 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna oligonucleotides/product/Thermo Fisher
    Average 90 stars, based on 1062 article reviews
    Price from $9.99 to $1999.99
    dna oligonucleotides - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    78
    Qiagen p120 oligonucleotides oligos
    Cleavage of Glis2 induced by coexpression of <t>p120.</t> (A) Cleavage of Glis2. Left and middle, FLAG-Glis2 was expressed in HEK293 and COS-1 cells with or without coexpression of HA-p120. Lysates were examined by Western blotting with anti-FLAG antibody. Right, COS-1 cells expressing FLAG-Glis2 and HA-p120, or untransfected, were examined by Western blotting with anti-Glis2 antibody. The minor size difference of the bands between two lanes is due to FLAG-tag of exogenous Glis2 and/or different species (monkey and mouse) of Glis2. It should be noted that the smaller amount of lysate was loaded in the left lane (1/20 of the right lane) because of much higher expression level of exogenous Glis2 than that of endogenous Glis2. (B) Expression of Src increases the p120-induced cleavage of Glis2. Lysates of HEK293 cells expressing FLAG-Glis2, HA-p120, and Src were examined by Western blotting with anti-FLAG antibody. Asterisk indicates the position of a potential intermediate proteolytic product. (C) p120 binds to Glis2 ΔC. Lysates of HEK293 cells expressing FLAG-Glis2, HA-p120, and Src were immunoprecipitated using anti-HA antibody, followed by Western blotting with anti-FLAG and anti-HA antibodies. (A–C) The arrow and arrowhead indicate the positions of full-length Glis2 and its cleavage product Glis2 ΔC, respectively. (D) Effect of p120 RNAi on Glis2. COS-1 cells were transiently transfected with two different p120 RNAi <t>oligos</t> directed against sequences present in all splicing variants of simian p120 or a control nonsilencing oligo. After 96 h, cell lysates were examined by Western blotting using anti-p120, anti-Glis2, and anti-MAPK antibodies. The band intensities were analyzed by densitometry. The arrows and arrowhead indicate the positions of full-length Glis2 and the 40-kDa product, respectively. The double band for the endogenous full-length protein (arrows) may be due to alternative splicing or protein degradation, which is sometimes observed.
    P120 Oligonucleotides Oligos, supplied by Qiagen, used in various techniques. Bioz Stars score: 78/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p120 oligonucleotides oligos/product/Qiagen
    Average 78 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    p120 oligonucleotides oligos - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    Image Search Results


    miR-4728-3p IS regulates ESR1. A. qRT-PCR analysis of ESR1 and HER2 transcripts and miR-4728-3p among a panel of 38 breast cancer tumors (19 HER2+, 19 HER2-). Calibrated Normalized Relative Quantity (CNRQ) of miR-4728-3p (left) and HER2 (right) is plotted against expression levels of ESR1. Tumors classified as HER2+ by ISH are shown in red, HER2- in grey. Expression was normalized to a panel of reference genes. For details see text and material and methods. B. Luciferase assay in BT-474 with ESR1 3′UTR constructs carrying either wild type target site of miR-4728-3p internal seed (WT) or mutated internal seed site (MUT). Firefly luciferase activity was normalized against Renilla luciferase. Reporter activity is given as % of WT in respective experiment. Repression of WT ESR1 construct by endogenous miR-4728-3p (left) is alleviated by an antisense oligo (AS) against endogenous miRNA (right) but not by a non-targeting control (middle). C. Western blot (left) and protein quantification (right) of ESR1 in MCF7. The two main isoforms of ESR1 (47 and 66 kDa), plotted as percentage of control signal of matching size, are down regulated upon transfection of miR-4728-3p mimics. Levels of HER2, (p)MAPK and (p)AKT remain largely unchanged. D. MCF7 cells were transfected with indicated concentrations of miR-4728-3p mimic. ESR1 levels show a concentration-dependent down-regulation that is most pronounced at highest tested concentration (25 nM). E. Western blot (left) and protein quantification (right) of ESR1 in BT474. ESR1 is up regulated when blocking endogenous miR-4728-3p with AS-oligonucleotides, while pMAPK and pAKT remain largely unchanged. F. Western blot (left) and protein quantification (right) of ESR1 in HCC1954 cells. ESR1 isoform of 47 kDa is up regulated under miR-4728-3p blocking. The main 66 kDa isoform is not detectable in this ER- cell line. Signals were quantified with ImageJ and normalized to total protein by Coomassie stain. Tubulin was used as a loading control. Asterisks denote p-values of

    Journal: PLoS ONE

    Article Title: The HER2-Encoded miR-4728-3p Regulates ESR1 through a Non-Canonical Internal Seed Interaction

    doi: 10.1371/journal.pone.0097200

    Figure Lengend Snippet: miR-4728-3p IS regulates ESR1. A. qRT-PCR analysis of ESR1 and HER2 transcripts and miR-4728-3p among a panel of 38 breast cancer tumors (19 HER2+, 19 HER2-). Calibrated Normalized Relative Quantity (CNRQ) of miR-4728-3p (left) and HER2 (right) is plotted against expression levels of ESR1. Tumors classified as HER2+ by ISH are shown in red, HER2- in grey. Expression was normalized to a panel of reference genes. For details see text and material and methods. B. Luciferase assay in BT-474 with ESR1 3′UTR constructs carrying either wild type target site of miR-4728-3p internal seed (WT) or mutated internal seed site (MUT). Firefly luciferase activity was normalized against Renilla luciferase. Reporter activity is given as % of WT in respective experiment. Repression of WT ESR1 construct by endogenous miR-4728-3p (left) is alleviated by an antisense oligo (AS) against endogenous miRNA (right) but not by a non-targeting control (middle). C. Western blot (left) and protein quantification (right) of ESR1 in MCF7. The two main isoforms of ESR1 (47 and 66 kDa), plotted as percentage of control signal of matching size, are down regulated upon transfection of miR-4728-3p mimics. Levels of HER2, (p)MAPK and (p)AKT remain largely unchanged. D. MCF7 cells were transfected with indicated concentrations of miR-4728-3p mimic. ESR1 levels show a concentration-dependent down-regulation that is most pronounced at highest tested concentration (25 nM). E. Western blot (left) and protein quantification (right) of ESR1 in BT474. ESR1 is up regulated when blocking endogenous miR-4728-3p with AS-oligonucleotides, while pMAPK and pAKT remain largely unchanged. F. Western blot (left) and protein quantification (right) of ESR1 in HCC1954 cells. ESR1 isoform of 47 kDa is up regulated under miR-4728-3p blocking. The main 66 kDa isoform is not detectable in this ER- cell line. Signals were quantified with ImageJ and normalized to total protein by Coomassie stain. Tubulin was used as a loading control. Asterisks denote p-values of

    Article Snippet: Antisense oligonucleotides contained 2′ O-methyl modifications and were from IDT DNA Technologies.

    Techniques: Quantitative RT-PCR, Expressing, In Situ Hybridization, Luciferase, Construct, Activity Assay, Western Blot, Transfection, Concentration Assay, Blocking Assay, Staining

    Correlative light and electron spectroscopic imaging (LM/ESI) of SK-N-SH cells expressing LacI-tagged SC35 using fluorogold dsDNA oligos. Detection of nuclear speckles (arrow) via the Cy3 fluorophore ( A , left panel), and confirmation of gold conjugation to the dsDNA oligo through silver enhancement (A, right panel). Untransfected cells (arrowhead) contain background levels of silver deposition. Scale bar = 200 nm. ( B ) Overlay of fluorescence and low magnification ESI micrographs collected at 155 eV. With two rounds of the silver enhancement using a LM enhancement kit (B, left panel), the silver particles are visible as bright spots. The right panel is an overlay image of a nucleus containing EM-enhanced gold. Scale bar = 2 μm. An area corresponding to an IGC, as defined by a box in the left panel is analysed at high resolution, and maps of phosphorus ( C , red panel) and nitrogen (C, green panel) show the ultrastructure of the IGC region, which is low in phosphorus content and contains protein-based fibrous structures. The fluorogold oligo localization is indicated with silver-enhanced gold particles false-coloured in white. The composite map ( D , left panel) illustrates the position of the IGC relative to chromatin (Ch, yellow) and the nucleolus (Nu, yellow-green). The silver particles in the interior of the IGC are labelled with arrowheads, whereas those proximal to the neighbouring chromatin are indicated by arrows. The composite map (D, right panel) of the EM-enhanced nucleus (B, right panel) contains smaller but uniform silver particles, as indicated by the arrows and arrowheads. Scale bar = 5 μm.

    Journal: Nucleic Acids Research

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides

    doi: 10.1093/nar/gnh164

    Figure Lengend Snippet: Correlative light and electron spectroscopic imaging (LM/ESI) of SK-N-SH cells expressing LacI-tagged SC35 using fluorogold dsDNA oligos. Detection of nuclear speckles (arrow) via the Cy3 fluorophore ( A , left panel), and confirmation of gold conjugation to the dsDNA oligo through silver enhancement (A, right panel). Untransfected cells (arrowhead) contain background levels of silver deposition. Scale bar = 200 nm. ( B ) Overlay of fluorescence and low magnification ESI micrographs collected at 155 eV. With two rounds of the silver enhancement using a LM enhancement kit (B, left panel), the silver particles are visible as bright spots. The right panel is an overlay image of a nucleus containing EM-enhanced gold. Scale bar = 2 μm. An area corresponding to an IGC, as defined by a box in the left panel is analysed at high resolution, and maps of phosphorus ( C , red panel) and nitrogen (C, green panel) show the ultrastructure of the IGC region, which is low in phosphorus content and contains protein-based fibrous structures. The fluorogold oligo localization is indicated with silver-enhanced gold particles false-coloured in white. The composite map ( D , left panel) illustrates the position of the IGC relative to chromatin (Ch, yellow) and the nucleolus (Nu, yellow-green). The silver particles in the interior of the IGC are labelled with arrowheads, whereas those proximal to the neighbouring chromatin are indicated by arrows. The composite map (D, right panel) of the EM-enhanced nucleus (B, right panel) contains smaller but uniform silver particles, as indicated by the arrows and arrowheads. Scale bar = 5 μm.

    Article Snippet: For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma).

    Techniques: Imaging, Expressing, Conjugation Assay, Fluorescence

    Isolation of LacI-tagged SC35 from human SK-N-SH cells using dsDNA oligonucleotides. Total cellular lysates and isolated protein (PI) lysates were prepared from SK-N-SH cells transiently expressing LacI or LacI-tagged SC35. The protein isolation of LacI and LacI-tagged SC35 from PI-lysates was carried out using streptavidin beads pre-incubated with biotinylated dsDNA oligo specific for LacI (O-Sym). Western analysis of total cellular lysate (1), PI lysate (2), protein isolated by dsDNA oligos (oligo-PI) (3), and mock oligo-PI (4) from LacI–SC35 expressing cells, or PI lysate were generated from LacI expressing cells. Proteins were detected using either anti-Flag ( A ) or anti-SR protein (mAb 104) ( B ) antibodies. In addition, a Coomassie stained SDS–PAGE gel is shown as a qualitative comparison of dsDNA oligo PI versus immunopreciptiation (IP) using an anti-Flag antibody ( C ). In panel C: lane M, protein molecular weight marker; lane 1, 40 μg of total lysate; lane 2, oligo-PI; lane 3, Mock oligo-PI; and lane 4, anti-Flag IP. The asterisk marks the position of co-purifying immunoglobulin (i.e. heavy chain is shown) in the Flag-IP. The black arrows indicate the position of LacI–SC35 in panels B,C. Approximately 250–500 μg or 500–1000 μg of total protein lysate was used for western or Coomassie SDS–PAGE analysis, respectively.

    Journal: Nucleic Acids Research

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides

    doi: 10.1093/nar/gnh164

    Figure Lengend Snippet: Isolation of LacI-tagged SC35 from human SK-N-SH cells using dsDNA oligonucleotides. Total cellular lysates and isolated protein (PI) lysates were prepared from SK-N-SH cells transiently expressing LacI or LacI-tagged SC35. The protein isolation of LacI and LacI-tagged SC35 from PI-lysates was carried out using streptavidin beads pre-incubated with biotinylated dsDNA oligo specific for LacI (O-Sym). Western analysis of total cellular lysate (1), PI lysate (2), protein isolated by dsDNA oligos (oligo-PI) (3), and mock oligo-PI (4) from LacI–SC35 expressing cells, or PI lysate were generated from LacI expressing cells. Proteins were detected using either anti-Flag ( A ) or anti-SR protein (mAb 104) ( B ) antibodies. In addition, a Coomassie stained SDS–PAGE gel is shown as a qualitative comparison of dsDNA oligo PI versus immunopreciptiation (IP) using an anti-Flag antibody ( C ). In panel C: lane M, protein molecular weight marker; lane 1, 40 μg of total lysate; lane 2, oligo-PI; lane 3, Mock oligo-PI; and lane 4, anti-Flag IP. The asterisk marks the position of co-purifying immunoglobulin (i.e. heavy chain is shown) in the Flag-IP. The black arrows indicate the position of LacI–SC35 in panels B,C. Approximately 250–500 μg or 500–1000 μg of total protein lysate was used for western or Coomassie SDS–PAGE analysis, respectively.

    Article Snippet: For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma).

    Techniques: Isolation, Expressing, Incubation, Western Blot, Generated, Staining, SDS Page, Molecular Weight, Marker

    In situ detection and isolation of proteins using dsDNA oligonucleotides. ( A ) Detection of proteins in situ using dsDNA oligos. Cells grown on slides are fixed and hybridized with fluorescently labelled dsDNA oligos (red or green) that can detect the presence of proteins fused to either LacI (1) or TetR (2). The fluorescent dsDNA oligos corresponding to the operator sequences for LacI or TetR (green or red, respectively) bind each bacterial fusion protein specifically without cross hybridizing resulting in the sub-nuclear localization of the tagged proteins by light microscopy. ( B ) Isolation and detection of proteins in vitro using dsDNA oligos. Streptavidin-sepharose beads (S) are sequentially incubated with biotinylated dsDNA oligos representing the operator sequences for LacI followed by incubation with a cell lysate containing LacI fused to a protein of interest (1). After binding the beads are washed and the resulting purified LacI-fusion protein can be observed by SDS–PAGE. M, marker, IN, input lysate, PI, isolated protein.

    Journal: Nucleic Acids Research

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides

    doi: 10.1093/nar/gnh164

    Figure Lengend Snippet: In situ detection and isolation of proteins using dsDNA oligonucleotides. ( A ) Detection of proteins in situ using dsDNA oligos. Cells grown on slides are fixed and hybridized with fluorescently labelled dsDNA oligos (red or green) that can detect the presence of proteins fused to either LacI (1) or TetR (2). The fluorescent dsDNA oligos corresponding to the operator sequences for LacI or TetR (green or red, respectively) bind each bacterial fusion protein specifically without cross hybridizing resulting in the sub-nuclear localization of the tagged proteins by light microscopy. ( B ) Isolation and detection of proteins in vitro using dsDNA oligos. Streptavidin-sepharose beads (S) are sequentially incubated with biotinylated dsDNA oligos representing the operator sequences for LacI followed by incubation with a cell lysate containing LacI fused to a protein of interest (1). After binding the beads are washed and the resulting purified LacI-fusion protein can be observed by SDS–PAGE. M, marker, IN, input lysate, PI, isolated protein.

    Article Snippet: For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma).

    Techniques: In Situ, Isolation, Light Microscopy, In Vitro, Incubation, Binding Assay, Purification, SDS Page, Marker

    In situ localization of SC35 and PML in human SK-N-SH cells using dsDNA oligonucleotides. ( A ) Localization of the LacI-tagged SC35 in paraformaldehyde fixed cells transfected with pGD-Flag-Lac-SC35 using the anti-Flag antibody M2 (Flag, red) or ( B ) with a Cy3-labelled dsDNA oligo (O-Sym, red) specific for LacI. PRP4 kinase was also localized as an endogenous marker for splicing speckles by antibody detection (PRP4K, green). Positive co-localization between PRP4K and LacI-tagged SC35 is demonstrated by a yellow signal in the merged images. The localization of the LacI–SC35 fusion protein was observed only in transfected cells (see B, O-Sym) and showed complete co-localization with PRP4 kinase (PRP4K, green) in nuclear speckles. ( C ) Localization of the TetR-tagged PML in paraformaldehyde fixed cells transfected with pGD-HA-TET-PML using the anti-HA (HA, red) or ( D ) with a Cy5-labelled dsDNA oligo (TET-O, red) specific for TetR. Endogenous PML was also localized as a marker for PML nuclear bodies antibody detection (PML, green). Positive co-localization between PML and TetR-tagged PML is demonstrated by a yellow signal in the merged images. The localization of the TetR–PML fusion protein was observed only in transfected cells (see C, TET-O) and showed complete co-localization with PML (PML, green) in PML nuclear bodies. ( E ) Multiple detection and localization of LacI–SC35 and TetR–PML in cells transfected with pGD-HA-TET-PML and pGD-Flag-Lac338-Sc35. Localization of LacI–SC35 and TetR–PML was accomplished using Cy3-labelled O-Sym or Cy5-labelled TET-O dsDNA oligos, respectively. TetR–PML and LacI–SC35 do not co-localize [separate red and green signals (respectively) in merged image], thus demonstrating the utility of dsDNA oligos for the multiplex detection of proteins in situ . DNA was counterstained with DAPI (blue in merged images). Scale bars = 5 μm.

    Journal: Nucleic Acids Research

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides

    doi: 10.1093/nar/gnh164

    Figure Lengend Snippet: In situ localization of SC35 and PML in human SK-N-SH cells using dsDNA oligonucleotides. ( A ) Localization of the LacI-tagged SC35 in paraformaldehyde fixed cells transfected with pGD-Flag-Lac-SC35 using the anti-Flag antibody M2 (Flag, red) or ( B ) with a Cy3-labelled dsDNA oligo (O-Sym, red) specific for LacI. PRP4 kinase was also localized as an endogenous marker for splicing speckles by antibody detection (PRP4K, green). Positive co-localization between PRP4K and LacI-tagged SC35 is demonstrated by a yellow signal in the merged images. The localization of the LacI–SC35 fusion protein was observed only in transfected cells (see B, O-Sym) and showed complete co-localization with PRP4 kinase (PRP4K, green) in nuclear speckles. ( C ) Localization of the TetR-tagged PML in paraformaldehyde fixed cells transfected with pGD-HA-TET-PML using the anti-HA (HA, red) or ( D ) with a Cy5-labelled dsDNA oligo (TET-O, red) specific for TetR. Endogenous PML was also localized as a marker for PML nuclear bodies antibody detection (PML, green). Positive co-localization between PML and TetR-tagged PML is demonstrated by a yellow signal in the merged images. The localization of the TetR–PML fusion protein was observed only in transfected cells (see C, TET-O) and showed complete co-localization with PML (PML, green) in PML nuclear bodies. ( E ) Multiple detection and localization of LacI–SC35 and TetR–PML in cells transfected with pGD-HA-TET-PML and pGD-Flag-Lac338-Sc35. Localization of LacI–SC35 and TetR–PML was accomplished using Cy3-labelled O-Sym or Cy5-labelled TET-O dsDNA oligos, respectively. TetR–PML and LacI–SC35 do not co-localize [separate red and green signals (respectively) in merged image], thus demonstrating the utility of dsDNA oligos for the multiplex detection of proteins in situ . DNA was counterstained with DAPI (blue in merged images). Scale bars = 5 μm.

    Article Snippet: For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma).

    Techniques: In Situ, Transfection, Marker, Multiplex Assay

    The hetatocellular carcinoma cell line SNU449 expresses high levels of ERK5 but is not dependent on MEK5-ERK5 signaling for proliferation. ( A ) Subconfluent cultures of BT474 and the liver hepatocellular carcinoma cell line SNU449 harbouring an amplification containing the ERK5 gene were maintained in 10% FBS. Cells were lysed, whole cell lysates were separated by SDS-PAGE and immunoblotted with the antibodies indicated. ( B ) Subconfluent cultures of SNU449 cells were maintained in 10% FBS then treated with increasing concentrations of BIX02189 (100 nM to 30 µM) for 24 or 48 hours, and DNA synthesis was assayed by [ 3 H]thymidine incorporation; the results are presented as an average of 3 experiments ± SD. Alternatively, cells were transfected as in Fig. 2 ( C ), 6h post-transfection cell were treated with increasing concentrations of BIX02189 (100 nM to 30 µM) for 24 hours. Cells were then lysed and firefly luciferase activity was measured and normalized to Renilla. A representative experiment of 3 is shown and values are expressed as the mean of triplicate transfections ± SD ( C ) SNU449 cells were transfected with ERK5-specific as indicated or non-silencing (control) siRNA oligos. Mock cells were left untransfected. Seventy-two hours post-transfection, ERK5 and α-tubulin abundances were determined by Western blot analysis of whole-cell extracts. ( D ) SNU449 cells were transfected as in ( C ) cell viability was determined by MTT assay. A representative experiment of 2 is shown and values are expressed as the mean of 8 values ± CoV.

    Journal: Cell Cycle

    Article Title: Tumor cells with KRAS or BRAF mutations or ERK5/MAPK7 amplification are not addicted to ERK5 activity for cell proliferation

    doi: 10.1080/15384101.2015.1120915

    Figure Lengend Snippet: The hetatocellular carcinoma cell line SNU449 expresses high levels of ERK5 but is not dependent on MEK5-ERK5 signaling for proliferation. ( A ) Subconfluent cultures of BT474 and the liver hepatocellular carcinoma cell line SNU449 harbouring an amplification containing the ERK5 gene were maintained in 10% FBS. Cells were lysed, whole cell lysates were separated by SDS-PAGE and immunoblotted with the antibodies indicated. ( B ) Subconfluent cultures of SNU449 cells were maintained in 10% FBS then treated with increasing concentrations of BIX02189 (100 nM to 30 µM) for 24 or 48 hours, and DNA synthesis was assayed by [ 3 H]thymidine incorporation; the results are presented as an average of 3 experiments ± SD. Alternatively, cells were transfected as in Fig. 2 ( C ), 6h post-transfection cell were treated with increasing concentrations of BIX02189 (100 nM to 30 µM) for 24 hours. Cells were then lysed and firefly luciferase activity was measured and normalized to Renilla. A representative experiment of 3 is shown and values are expressed as the mean of triplicate transfections ± SD ( C ) SNU449 cells were transfected with ERK5-specific as indicated or non-silencing (control) siRNA oligos. Mock cells were left untransfected. Seventy-two hours post-transfection, ERK5 and α-tubulin abundances were determined by Western blot analysis of whole-cell extracts. ( D ) SNU449 cells were transfected as in ( C ) cell viability was determined by MTT assay. A representative experiment of 2 is shown and values are expressed as the mean of 8 values ± CoV.

    Article Snippet: siRNA sequences and RNAi For transient RNAi, the following oligos were used: siERK5 1, GACCCACCUUUCAGCCUUA; siERK5 2, GGAUGGCCAGGCAGAUUCA; and siN.S. (non-silencing) as described by Roberts et al ; ERK5 Euro, GGUGUUGGCUUUGACCUGGAGGAAU; ERK5 Dharma 2 (J-003513–09); ERK5 Dharma 3 (J-003513-08); Dharma control 1 (D-001810-01-20) from Dharmacon; control stealth (46-2002) from Invitrogen.

    Techniques: Amplification, SDS Page, DNA Synthesis, Transfection, Luciferase, Activity Assay, Western Blot, MTT Assay

    siRNA mediated knockdown of ERK5 in colorectal cancer cells does not inhibit cell proliferation. ( A ) HCT116 cells were transfected with ERK5-specific (siERK5 1 and 2) or non-silencing (N.S.) siRNA oligos. Mock cells were left untransfected. Forty-eight hours post-transfection, DNA synthesis was assayed by [ 3 H]thymidine incorporation; the results are presented as an average of 3 experiments ± SD ( B ) HCT116 cells were transfected as in (A) ERK5 and ERK1 abundances were determined by Western blot analysis of whole-cell extracts.

    Journal: Cell Cycle

    Article Title: Tumor cells with KRAS or BRAF mutations or ERK5/MAPK7 amplification are not addicted to ERK5 activity for cell proliferation

    doi: 10.1080/15384101.2015.1120915

    Figure Lengend Snippet: siRNA mediated knockdown of ERK5 in colorectal cancer cells does not inhibit cell proliferation. ( A ) HCT116 cells were transfected with ERK5-specific (siERK5 1 and 2) or non-silencing (N.S.) siRNA oligos. Mock cells were left untransfected. Forty-eight hours post-transfection, DNA synthesis was assayed by [ 3 H]thymidine incorporation; the results are presented as an average of 3 experiments ± SD ( B ) HCT116 cells were transfected as in (A) ERK5 and ERK1 abundances were determined by Western blot analysis of whole-cell extracts.

    Article Snippet: siRNA sequences and RNAi For transient RNAi, the following oligos were used: siERK5 1, GACCCACCUUUCAGCCUUA; siERK5 2, GGAUGGCCAGGCAGAUUCA; and siN.S. (non-silencing) as described by Roberts et al ; ERK5 Euro, GGUGUUGGCUUUGACCUGGAGGAAU; ERK5 Dharma 2 (J-003513–09); ERK5 Dharma 3 (J-003513-08); Dharma control 1 (D-001810-01-20) from Dharmacon; control stealth (46-2002) from Invitrogen.

    Techniques: Transfection, DNA Synthesis, Western Blot

    Mapping nucleosome distributions following KSHV reactivation using mTSS-seq technique and mTSS-seq validation A. Experimental design for mapping nucleosome distributions following KSHV reactivation using our newly developed mTSS-seq technique. B. Validation of mTSS-seq using quantitative PCR for both on-target regions of the genome (within the sequence-capture region, two-kb region centered on a TSS) and off-target regions of the genome (not within the sequence-capture region, outside the two-region centered on a TSS). Quantitative PCR was performed for on- and off-target regions of the genome for both RHOC and ITGA4. The y-axis shows C t values. On average, C t values between the on- and off-targets of the sequence-captured libraries differ by 10.5 cycles. C. The periodic occurrence of AA/TT/AT/TA dinucleotides was calculated for all nucleosomal-sized fragments (147-148 bp) at the 0 hour time point. The x-axis represents the distance from the dyad axis. The y-axis is the frequency of AA/TT/AT/TA dinucleotides. An A/T-containing dinucleotide periodicity is seen every 10 bp at the 0 hour time point. D. Alignment of the midpoint fragments (purple) from mTSS-seq to the human genome shown in the UCSC Genome Browser ( http://genome.ucsc.edu ). Zooming in 5000X on human chromosome 2 to a six-kb window with two-kb of midpoint fragments at 0 hour time point (purple lines), along with the sequence-capture oligos and previously-published human-nucleosome distribution map for cell line GM18508 (red lines, (Gaffney et al., 2012)) at the TSSs of PUS10 and PEX13. The x-axis is genomic location. The y-axis is scaled reads per million.

    Journal: Oncotarget

    Article Title: Hierarchical regulation of the genome: global changes in nucleosome organization potentiate genome response

    doi: 10.18632/oncotarget.6841

    Figure Lengend Snippet: Mapping nucleosome distributions following KSHV reactivation using mTSS-seq technique and mTSS-seq validation A. Experimental design for mapping nucleosome distributions following KSHV reactivation using our newly developed mTSS-seq technique. B. Validation of mTSS-seq using quantitative PCR for both on-target regions of the genome (within the sequence-capture region, two-kb region centered on a TSS) and off-target regions of the genome (not within the sequence-capture region, outside the two-region centered on a TSS). Quantitative PCR was performed for on- and off-target regions of the genome for both RHOC and ITGA4. The y-axis shows C t values. On average, C t values between the on- and off-targets of the sequence-captured libraries differ by 10.5 cycles. C. The periodic occurrence of AA/TT/AT/TA dinucleotides was calculated for all nucleosomal-sized fragments (147-148 bp) at the 0 hour time point. The x-axis represents the distance from the dyad axis. The y-axis is the frequency of AA/TT/AT/TA dinucleotides. An A/T-containing dinucleotide periodicity is seen every 10 bp at the 0 hour time point. D. Alignment of the midpoint fragments (purple) from mTSS-seq to the human genome shown in the UCSC Genome Browser ( http://genome.ucsc.edu ). Zooming in 5000X on human chromosome 2 to a six-kb window with two-kb of midpoint fragments at 0 hour time point (purple lines), along with the sequence-capture oligos and previously-published human-nucleosome distribution map for cell line GM18508 (red lines, (Gaffney et al., 2012)) at the TSSs of PUS10 and PEX13. The x-axis is genomic location. The y-axis is scaled reads per million.

    Article Snippet: The universal and indexed sequences were added by PCR using 23 ul of adaptor-ligated DNA fragments, NEBNext High Fidelity 2X PCR Master Mix, index primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina, and Universal PCR Primers provided in NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina.

    Techniques: Real-time Polymerase Chain Reaction, Sequencing

    Dum functions to promote muscle cell differentiation. (A) Knockdown of Dum by siRNA oligos in C2C12 cells decreased the expression of Dum during a 4-day differentiation course. (B) The indicated myogenic genes, myogenin , MyHC and troponin were downregulated

    Journal: Cell Research

    Article Title: LncRNA Dum interacts with Dnmts to regulate Dppa2 expression during myogenic differentiation and muscle regeneration

    doi: 10.1038/cr.2015.21

    Figure Lengend Snippet: Dum functions to promote muscle cell differentiation. (A) Knockdown of Dum by siRNA oligos in C2C12 cells decreased the expression of Dum during a 4-day differentiation course. (B) The indicated myogenic genes, myogenin , MyHC and troponin were downregulated

    Article Snippet: The 19-nucleotide siRNA duplexes against mouse MyoD coding region (siRNA, 5′-GCCUGAGCAAAGUGAAUGA-3′) or coding region (siRNA, 5′-CAGCAGACGACUUCUAUGA-3′), Dum coding region (siRNA, 5′-GAATGAUCGUCCCAUGUUA-3′) or coding region (siRNA, 5′-GAAAGAGAAUCCAAGGUAA-3′) or coding region (siRNA, 5′-GAGAGAAACUGGUAGAUAU-3′), Dppa2 coding region (siRNA, 5′-GCAGAUGCCUGUCUUACAA-3′) or coding region (siRNA, 5′-CGGAGACACUCCUAUUCUA-3′), Rad21 coding region (siRNA 5′-GCAGCUUAUAAUGCCAUUA-3′) or coding region (siRNA, 5′-CCAGUACAAAGAUGACAAU-3′) or coding region (siRNA, 5′-GCGGUAUAUUAGAUGACAA-3′), NIPBL coding region (siRNA, 5′-GCAGAUGCCUGUCUUACAA-3′) or coding region (siRNA, 5′-GCAUCCGAGUCUAAUGUUU-3′) or coding region (siRNA, 5′-GCACCAAUGCUCGGAACAA-3′) and scrambled oligos were obtained from Ribobio.

    Techniques: Cell Differentiation, Expressing

    Dum knockdown in vivo impaired the injury-induced muscle regeneration. (A) Injection scheme for siNC or si Dum oligos into CTX-injured muscles. n = 4 mice for each group. (B) Dum siRNA injection into CTX-injured muscles decreased the levels of the indicated

    Journal: Cell Research

    Article Title: LncRNA Dum interacts with Dnmts to regulate Dppa2 expression during myogenic differentiation and muscle regeneration

    doi: 10.1038/cr.2015.21

    Figure Lengend Snippet: Dum knockdown in vivo impaired the injury-induced muscle regeneration. (A) Injection scheme for siNC or si Dum oligos into CTX-injured muscles. n = 4 mice for each group. (B) Dum siRNA injection into CTX-injured muscles decreased the levels of the indicated

    Article Snippet: The 19-nucleotide siRNA duplexes against mouse MyoD coding region (siRNA, 5′-GCCUGAGCAAAGUGAAUGA-3′) or coding region (siRNA, 5′-CAGCAGACGACUUCUAUGA-3′), Dum coding region (siRNA, 5′-GAATGAUCGUCCCAUGUUA-3′) or coding region (siRNA, 5′-GAAAGAGAAUCCAAGGUAA-3′) or coding region (siRNA, 5′-GAGAGAAACUGGUAGAUAU-3′), Dppa2 coding region (siRNA, 5′-GCAGAUGCCUGUCUUACAA-3′) or coding region (siRNA, 5′-CGGAGACACUCCUAUUCUA-3′), Rad21 coding region (siRNA 5′-GCAGCUUAUAAUGCCAUUA-3′) or coding region (siRNA, 5′-CCAGUACAAAGAUGACAAU-3′) or coding region (siRNA, 5′-GCGGUAUAUUAGAUGACAA-3′), NIPBL coding region (siRNA, 5′-GCAGAUGCCUGUCUUACAA-3′) or coding region (siRNA, 5′-GCAUCCGAGUCUAAUGUUU-3′) or coding region (siRNA, 5′-GCACCAAUGCUCGGAACAA-3′) and scrambled oligos were obtained from Ribobio.

    Techniques: In Vivo, Injection, Mouse Assay

    Factors forming complex with MRE-c′ oligo belong to NFI family of proteins. Whole cell extract (10 μg) from HepG2 cells (lane 1) was incubated with 0.1–0.2 ng of 32 P-labeled MRE-c′ oligo at 4°C under optimum binding conditions and subjected to electrophoresis on polyacrylamide (6% acrylamide) gel. (A) To identify the proteins forming the complexes, the extract was preincubated with either of the following unlabeled oligos: (a) 100- or 200-fold molar excess of MRE-c′ (lanes 2 and 3), (b) MRE-c′ mutant (lanes 4 and 5), (c) 50- or 100-fold molar excess of NFI consensus oligo (lanes 6 and 7), or (d) NFI mutant (lanes 8 and 9) along with 0.5 μg of poly(dI-dC) as nonspecific competitor. (B) The extract was also preincubated separately with l μl of normal rabbit serum (lane 2) or anti-NFI antisera (lane 3) for 30 min on ice prior to addition of the labeled probe. The arrow indicates the position of the supershifted complex.

    Journal: Gene Expression

    Article Title: Downregulation of Constitutive and Heavy Metal-Induced Metallothionein-I Expression by Nuclear Factor I

    doi:

    Figure Lengend Snippet: Factors forming complex with MRE-c′ oligo belong to NFI family of proteins. Whole cell extract (10 μg) from HepG2 cells (lane 1) was incubated with 0.1–0.2 ng of 32 P-labeled MRE-c′ oligo at 4°C under optimum binding conditions and subjected to electrophoresis on polyacrylamide (6% acrylamide) gel. (A) To identify the proteins forming the complexes, the extract was preincubated with either of the following unlabeled oligos: (a) 100- or 200-fold molar excess of MRE-c′ (lanes 2 and 3), (b) MRE-c′ mutant (lanes 4 and 5), (c) 50- or 100-fold molar excess of NFI consensus oligo (lanes 6 and 7), or (d) NFI mutant (lanes 8 and 9) along with 0.5 μg of poly(dI-dC) as nonspecific competitor. (B) The extract was also preincubated separately with l μl of normal rabbit serum (lane 2) or anti-NFI antisera (lane 3) for 30 min on ice prior to addition of the labeled probe. The arrow indicates the position of the supershifted complex.

    Article Snippet: The NFI consensus and the mutated oligos are from Santa Cruz Biotechnology Inc. (Santa Cruz, CA).

    Techniques: Incubation, Labeling, Binding Assay, Electrophoresis, Acrylamide Gel Assay, Mutagenesis

    Endpoint fluorescence scatter plot containing 4 in-run controls and 40 clinical specimens. Control reactions using Ultramer oligonucleotides for wild type (Wt) (A), A2058G (B), and A2059G (C) are shown. (D) No template control. The gray box indicates

    Journal: Journal of Clinical Microbiology

    Article Title: A 5′ Nuclease Genotyping Assay for Identification of Macrolide-Resistant Mycoplasma genitalium in Clinical Specimens

    doi: 10.1128/JCM.00012-16

    Figure Lengend Snippet: Endpoint fluorescence scatter plot containing 4 in-run controls and 40 clinical specimens. Control reactions using Ultramer oligonucleotides for wild type (Wt) (A), A2058G (B), and A2059G (C) are shown. (D) No template control. The gray box indicates

    Article Snippet: As in-run controls, synthesized Ultramer oligonucleotides (Integrated DNA Technologies, Leuven, Belgium) comprising the entire PCR product were used.

    Techniques: Fluorescence

    Nucleotide sequences of the in-run controls used for the 5′ nuclease genotyping assay. The nucleotide sequences of wild-type Ultramer oligonucleotide (Wt) and Ultramer oligonucleotides containing the two most frequent macrolide resistance mutations,

    Journal: Journal of Clinical Microbiology

    Article Title: A 5′ Nuclease Genotyping Assay for Identification of Macrolide-Resistant Mycoplasma genitalium in Clinical Specimens

    doi: 10.1128/JCM.00012-16

    Figure Lengend Snippet: Nucleotide sequences of the in-run controls used for the 5′ nuclease genotyping assay. The nucleotide sequences of wild-type Ultramer oligonucleotide (Wt) and Ultramer oligonucleotides containing the two most frequent macrolide resistance mutations,

    Article Snippet: As in-run controls, synthesized Ultramer oligonucleotides (Integrated DNA Technologies, Leuven, Belgium) comprising the entire PCR product were used.

    Techniques: Genotyping Assay

    RacGAP1 is required for pseudopod extension and invasion. (A) A2780 cells were transfected with control or RacGAP1-specific SMARTpool oligonucleotides, seeded onto CDMs, and stimulated with cRGDfV as indicated. Images were captured every 10 min using a 20× objective lens. Representative images are shown. Bar, 50 µm. (B) Pseudopod length ( n > 400/condition) was measured for all moving cells within the 20th frame. (C) A2780 cells were transfected as in A and seeded into inverted invasion assays after 16 h in the presence or absence of FN and cRGDfV as indicated. The yellow line indicates the level of invasion under control conditions. (D) A2780 cells stably expressing GFP or FLAG-RacGAP1 WT were transfected with control or RacGAP RNAi oligo #6, treated as in C, and seeded into inverted invasion assays in the presence of cRGDfV and FN. (E) MDA-MB-231 cells were transfected as in A and seeded into inverted invasion assays in the presence of FN. (F) H1299 cells stably expressing mutant p53 (273H) or control vector (VEC) were transfected as in A and seeded into inverted invasion assays in the presence of FN. Data represent means ± SEM from at least three independent experiments. *, P

    Journal: The Journal of Cell Biology

    Article Title: RCP-driven ?5?1 recycling suppresses Rac and promotes RhoA activity via the RacGAP1-IQGAP1 complex

    doi: 10.1083/jcb.201302041

    Figure Lengend Snippet: RacGAP1 is required for pseudopod extension and invasion. (A) A2780 cells were transfected with control or RacGAP1-specific SMARTpool oligonucleotides, seeded onto CDMs, and stimulated with cRGDfV as indicated. Images were captured every 10 min using a 20× objective lens. Representative images are shown. Bar, 50 µm. (B) Pseudopod length ( n > 400/condition) was measured for all moving cells within the 20th frame. (C) A2780 cells were transfected as in A and seeded into inverted invasion assays after 16 h in the presence or absence of FN and cRGDfV as indicated. The yellow line indicates the level of invasion under control conditions. (D) A2780 cells stably expressing GFP or FLAG-RacGAP1 WT were transfected with control or RacGAP RNAi oligo #6, treated as in C, and seeded into inverted invasion assays in the presence of cRGDfV and FN. (E) MDA-MB-231 cells were transfected as in A and seeded into inverted invasion assays in the presence of FN. (F) H1299 cells stably expressing mutant p53 (273H) or control vector (VEC) were transfected as in A and seeded into inverted invasion assays in the presence of FN. Data represent means ± SEM from at least three independent experiments. *, P

    Article Snippet: Plasmids and reagents RNAi oligonucleotides (oligo) were purchased from Thermo Fisher Scientific as follows: ON-TARGETplus nontargeting siRNA (single oligo or pool as appropriate); IQGAP1 #1 (5′-GAACGUGGCUUAUGAGUAC-3′); IQGAP1 #2 (J-004694-08); RacGAP1 (SMARTpool, oligo 6, 5′-GCGAAGUGCUCUGGAUGUU-3′; and oligo 8, 5′-GAAGUCACAUCUGCCUGUU-3′); Rac1 (SMARTpool or Rac1 #1, 5′-CGGCACCACUGUCCCAACA-3′); RhoA (SMARTpool or RhoA #1, 5′-AUGGAAAGCAGGUAGAGUU-3′); and RCP (J-015968-10). shRNA vectors for PKB/Akt isoforms were prepared using mU6Pro and the following sequences: Akt1 #1, 5′-GCTACTTCCTCCTCAAGAA-3′; Akt1 #2, 5′-CGAGTTTGAGTACCTGAAG-3′; Akt2 #1, 5′-CGTGGTGAATACATCAAGA-3′; and Akt2# 2, 5′-TCTGTCATCAAAGAAGGCT-3′.

    Techniques: Transfection, Stable Transfection, Expressing, Multiple Displacement Amplification, Mutagenesis, Plasmid Preparation

    Integrin trafficking suppresses Rac activity and activates RhoA through the RacGAP1–IQGAP1 complex. (A) A2780 cells were subjected to control or RacGAP1 oligo #6 RNAi and allowed to recover for 24 h. Cells were then transfected with Raichu-Rac or Raichu-RhoA as indicated and seeded onto CDM. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C ; n ≥ 15/condition). (B) A2780 cells were subjected to control or IQGAP1 oligo #1 RNAi and allowed to recover for 24 h. Cells were then transfected with Raichu-Rac or Raichu-RhoA as indicated and seeded onto the CDM. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C ; n ≥ 8/condition). (C) A2780 cells stably expressing RacGAP1 WT , RacGAP1 249A , or RacGAP1 249D were transfected with Raichu-Rac and seeded onto CDMs. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C) . Representative images are shown ( n ≥ 8/condition). (D) A2780 cells stably expressing RacGAP1 WT , RacGAP1 249A , or RacGAP1 249D were transfected with Raichu-RhoA and seeded onto CDMs. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C) . Representative images are shown ( n ≥ 4/condition). Zoomed insets correspond to areas indicated by dotted ROIs. Yellow lines represent the baseline activity as determined by an inactive mutant of the probe. Data represent means ± SEM from at least three independent experiments. *, P

    Journal: The Journal of Cell Biology

    Article Title: RCP-driven ?5?1 recycling suppresses Rac and promotes RhoA activity via the RacGAP1-IQGAP1 complex

    doi: 10.1083/jcb.201302041

    Figure Lengend Snippet: Integrin trafficking suppresses Rac activity and activates RhoA through the RacGAP1–IQGAP1 complex. (A) A2780 cells were subjected to control or RacGAP1 oligo #6 RNAi and allowed to recover for 24 h. Cells were then transfected with Raichu-Rac or Raichu-RhoA as indicated and seeded onto CDM. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C ; n ≥ 15/condition). (B) A2780 cells were subjected to control or IQGAP1 oligo #1 RNAi and allowed to recover for 24 h. Cells were then transfected with Raichu-Rac or Raichu-RhoA as indicated and seeded onto the CDM. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C ; n ≥ 8/condition). (C) A2780 cells stably expressing RacGAP1 WT , RacGAP1 249A , or RacGAP1 249D were transfected with Raichu-Rac and seeded onto CDMs. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C) . Representative images are shown ( n ≥ 8/condition). (D) A2780 cells stably expressing RacGAP1 WT , RacGAP1 249A , or RacGAP1 249D were transfected with Raichu-RhoA and seeded onto CDMs. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C) . Representative images are shown ( n ≥ 4/condition). Zoomed insets correspond to areas indicated by dotted ROIs. Yellow lines represent the baseline activity as determined by an inactive mutant of the probe. Data represent means ± SEM from at least three independent experiments. *, P

    Article Snippet: Plasmids and reagents RNAi oligonucleotides (oligo) were purchased from Thermo Fisher Scientific as follows: ON-TARGETplus nontargeting siRNA (single oligo or pool as appropriate); IQGAP1 #1 (5′-GAACGUGGCUUAUGAGUAC-3′); IQGAP1 #2 (J-004694-08); RacGAP1 (SMARTpool, oligo 6, 5′-GCGAAGUGCUCUGGAUGUU-3′; and oligo 8, 5′-GAAGUCACAUCUGCCUGUU-3′); Rac1 (SMARTpool or Rac1 #1, 5′-CGGCACCACUGUCCCAACA-3′); RhoA (SMARTpool or RhoA #1, 5′-AUGGAAAGCAGGUAGAGUU-3′); and RCP (J-015968-10). shRNA vectors for PKB/Akt isoforms were prepared using mU6Pro and the following sequences: Akt1 #1, 5′-GCTACTTCCTCCTCAAGAA-3′; Akt1 #2, 5′-CGAGTTTGAGTACCTGAAG-3′; Akt2 #1, 5′-CGTGGTGAATACATCAAGA-3′; and Akt2# 2, 5′-TCTGTCATCAAAGAAGGCT-3′.

    Techniques: Activity Assay, Transfection, Stable Transfection, Expressing, Mutagenesis

    Extension from PPT62 at a nick followed by the M-MuLV RNA. 5′ end-labeled PPT62 without a downstream oligonucleotide (none) (lanes 1, 4, 7, 10, 13, and 16 to 19) or with downstream MLVnick (lanes 2, 5, 8, 11, 14, and 20 to 23) or MLVnickD (lanes 3, 6, 9, 12, 15, and 24 to 27) was annealed to template 2. Extensions were carried out with T7 DNA polymerase (T7; lanes 4 to 6), T4 DNA polymerase (T4; lanes 7 to 9), RTΔH (lanes 10 to 12), wild-type reverse transcriptase (wt RT; lanes 13 to 15) or H − RT (lanes 17 to 19, 21 to 23, and 25 to 27) for the indicated times. Substrates incubated without enzyme are shown in lanes 1 to 3, 16, 20, and 24. The products were analyzed in a 20% sequencing gel and visualized using a PhosphorImager. A schematic of the nicked substrate II tested is shown at top, and the positions of unextended PPT62 and the full-length extension product are indicated on the right.

    Journal: Journal of Virology

    Article Title: Specific Cleavages by RNase H Facilitate Initiation of Plus-Strand RNA Synthesis by Moloney Murine Leukemia Virus

    doi: 10.1128/JVI.77.9.5275-5285.2003

    Figure Lengend Snippet: Extension from PPT62 at a nick followed by the M-MuLV RNA. 5′ end-labeled PPT62 without a downstream oligonucleotide (none) (lanes 1, 4, 7, 10, 13, and 16 to 19) or with downstream MLVnick (lanes 2, 5, 8, 11, 14, and 20 to 23) or MLVnickD (lanes 3, 6, 9, 12, 15, and 24 to 27) was annealed to template 2. Extensions were carried out with T7 DNA polymerase (T7; lanes 4 to 6), T4 DNA polymerase (T4; lanes 7 to 9), RTΔH (lanes 10 to 12), wild-type reverse transcriptase (wt RT; lanes 13 to 15) or H − RT (lanes 17 to 19, 21 to 23, and 25 to 27) for the indicated times. Substrates incubated without enzyme are shown in lanes 1 to 3, 16, 20, and 24. The products were analyzed in a 20% sequencing gel and visualized using a PhosphorImager. A schematic of the nicked substrate II tested is shown at top, and the positions of unextended PPT62 and the full-length extension product are indicated on the right.

    Article Snippet: RNA oligonucleotides were obtained from Oligos Etc., DNA oligonucleotides were purchased from Invitrogen, and all oligonucleotides were gel purified prior to use.

    Techniques: Labeling, Incubation, Sequencing

    Model hybrid substrates with RNAs and oligonucleotides used in extension and cleavage analyses. (A) General structures of model hybrid substrates I to IV. Template strands are shown as thin lines with their 5′ and 3′ ends indicated. Oligonucleotides or RNAs annealed to template strands are shown as arrows originating at the 3′ ends. When applicable, positions of RNAs or oligonucleotides are described as upstream or downstream relative to the PPT primer cleavage site (indicated by vertical dashed line), which is based upon the plus-strand origin found within the PPT of the M-MuLV genome. Substrate I contains a 62-nt plus-strand primer (PPT62) with a 3′ end at position −1. Substrate II contains a downstream DNA or RNA oligonucleotide abutting the 3′ end of PPT62 and creating a nick. In substrate III, the 5′-end position of the downstream oligonucleotide creates a gap of 2, 5, or 12 bases from the 3′ end of PPT62. Substrate IV contains a 79-nt MLV RNA, which is a continuous RNA without a gap or nick. (B) The names and sequences of RNAs and oligonucleotides annealed to the template strands are shown relative to the −1 and +1 positions that border the plus-strand origin. The downstream oligonucleotides derived from the M-MuLV sequence are termed MLV, while the downstream oligonucleotide derived from an unrelated sequence is referred to as HET (for heterologous). The PPT sequence for the 79-nt MLV RNA is underlined. Sequences not derived from the M-MuLV genome are boxed. With the exception of the deoxyribonucleotide MLVnickD, all sequences are ribonucleotides.

    Journal: Journal of Virology

    Article Title: Specific Cleavages by RNase H Facilitate Initiation of Plus-Strand RNA Synthesis by Moloney Murine Leukemia Virus

    doi: 10.1128/JVI.77.9.5275-5285.2003

    Figure Lengend Snippet: Model hybrid substrates with RNAs and oligonucleotides used in extension and cleavage analyses. (A) General structures of model hybrid substrates I to IV. Template strands are shown as thin lines with their 5′ and 3′ ends indicated. Oligonucleotides or RNAs annealed to template strands are shown as arrows originating at the 3′ ends. When applicable, positions of RNAs or oligonucleotides are described as upstream or downstream relative to the PPT primer cleavage site (indicated by vertical dashed line), which is based upon the plus-strand origin found within the PPT of the M-MuLV genome. Substrate I contains a 62-nt plus-strand primer (PPT62) with a 3′ end at position −1. Substrate II contains a downstream DNA or RNA oligonucleotide abutting the 3′ end of PPT62 and creating a nick. In substrate III, the 5′-end position of the downstream oligonucleotide creates a gap of 2, 5, or 12 bases from the 3′ end of PPT62. Substrate IV contains a 79-nt MLV RNA, which is a continuous RNA without a gap or nick. (B) The names and sequences of RNAs and oligonucleotides annealed to the template strands are shown relative to the −1 and +1 positions that border the plus-strand origin. The downstream oligonucleotides derived from the M-MuLV sequence are termed MLV, while the downstream oligonucleotide derived from an unrelated sequence is referred to as HET (for heterologous). The PPT sequence for the 79-nt MLV RNA is underlined. Sequences not derived from the M-MuLV genome are boxed. With the exception of the deoxyribonucleotide MLVnickD, all sequences are ribonucleotides.

    Article Snippet: RNA oligonucleotides were obtained from Oligos Etc., DNA oligonucleotides were purchased from Invitrogen, and all oligonucleotides were gel purified prior to use.

    Techniques: Derivative Assay, Sequencing

    Model for initiation of M-MuLV plus-strand RNA synthesis. In the diagram, plus-strand RNA is represented by thick gray lines, minus-strand DNA is represented by thin black arrows pointing to the left, nascent plus-strand DNA is represented by thick black arrows, and the PPT is boxed. RNase H cleavage sites are denoted by vertical arrows, and several specific sites are indicated. The model is described in the Discussion.

    Journal: Journal of Virology

    Article Title: Specific Cleavages by RNase H Facilitate Initiation of Plus-Strand RNA Synthesis by Moloney Murine Leukemia Virus

    doi: 10.1128/JVI.77.9.5275-5285.2003

    Figure Lengend Snippet: Model for initiation of M-MuLV plus-strand RNA synthesis. In the diagram, plus-strand RNA is represented by thick gray lines, minus-strand DNA is represented by thin black arrows pointing to the left, nascent plus-strand DNA is represented by thick black arrows, and the PPT is boxed. RNase H cleavage sites are denoted by vertical arrows, and several specific sites are indicated. The model is described in the Discussion.

    Article Snippet: RNA oligonucleotides were obtained from Oligos Etc., DNA oligonucleotides were purchased from Invitrogen, and all oligonucleotides were gel purified prior to use.

    Techniques:

    Cleavage of Glis2 induced by coexpression of p120. (A) Cleavage of Glis2. Left and middle, FLAG-Glis2 was expressed in HEK293 and COS-1 cells with or without coexpression of HA-p120. Lysates were examined by Western blotting with anti-FLAG antibody. Right, COS-1 cells expressing FLAG-Glis2 and HA-p120, or untransfected, were examined by Western blotting with anti-Glis2 antibody. The minor size difference of the bands between two lanes is due to FLAG-tag of exogenous Glis2 and/or different species (monkey and mouse) of Glis2. It should be noted that the smaller amount of lysate was loaded in the left lane (1/20 of the right lane) because of much higher expression level of exogenous Glis2 than that of endogenous Glis2. (B) Expression of Src increases the p120-induced cleavage of Glis2. Lysates of HEK293 cells expressing FLAG-Glis2, HA-p120, and Src were examined by Western blotting with anti-FLAG antibody. Asterisk indicates the position of a potential intermediate proteolytic product. (C) p120 binds to Glis2 ΔC. Lysates of HEK293 cells expressing FLAG-Glis2, HA-p120, and Src were immunoprecipitated using anti-HA antibody, followed by Western blotting with anti-FLAG and anti-HA antibodies. (A–C) The arrow and arrowhead indicate the positions of full-length Glis2 and its cleavage product Glis2 ΔC, respectively. (D) Effect of p120 RNAi on Glis2. COS-1 cells were transiently transfected with two different p120 RNAi oligos directed against sequences present in all splicing variants of simian p120 or a control nonsilencing oligo. After 96 h, cell lysates were examined by Western blotting using anti-p120, anti-Glis2, and anti-MAPK antibodies. The band intensities were analyzed by densitometry. The arrows and arrowhead indicate the positions of full-length Glis2 and the 40-kDa product, respectively. The double band for the endogenous full-length protein (arrows) may be due to alternative splicing or protein degradation, which is sometimes observed.

    Journal: Molecular Biology of the Cell

    Article Title:

    doi: 10.1091/mbc.E06-10-0941

    Figure Lengend Snippet: Cleavage of Glis2 induced by coexpression of p120. (A) Cleavage of Glis2. Left and middle, FLAG-Glis2 was expressed in HEK293 and COS-1 cells with or without coexpression of HA-p120. Lysates were examined by Western blotting with anti-FLAG antibody. Right, COS-1 cells expressing FLAG-Glis2 and HA-p120, or untransfected, were examined by Western blotting with anti-Glis2 antibody. The minor size difference of the bands between two lanes is due to FLAG-tag of exogenous Glis2 and/or different species (monkey and mouse) of Glis2. It should be noted that the smaller amount of lysate was loaded in the left lane (1/20 of the right lane) because of much higher expression level of exogenous Glis2 than that of endogenous Glis2. (B) Expression of Src increases the p120-induced cleavage of Glis2. Lysates of HEK293 cells expressing FLAG-Glis2, HA-p120, and Src were examined by Western blotting with anti-FLAG antibody. Asterisk indicates the position of a potential intermediate proteolytic product. (C) p120 binds to Glis2 ΔC. Lysates of HEK293 cells expressing FLAG-Glis2, HA-p120, and Src were immunoprecipitated using anti-HA antibody, followed by Western blotting with anti-FLAG and anti-HA antibodies. (A–C) The arrow and arrowhead indicate the positions of full-length Glis2 and its cleavage product Glis2 ΔC, respectively. (D) Effect of p120 RNAi on Glis2. COS-1 cells were transiently transfected with two different p120 RNAi oligos directed against sequences present in all splicing variants of simian p120 or a control nonsilencing oligo. After 96 h, cell lysates were examined by Western blotting using anti-p120, anti-Glis2, and anti-MAPK antibodies. The band intensities were analyzed by densitometry. The arrows and arrowhead indicate the positions of full-length Glis2 and the 40-kDa product, respectively. The double band for the endogenous full-length protein (arrows) may be due to alternative splicing or protein degradation, which is sometimes observed.

    Article Snippet: p120 oligonucleotides (oligos) were purchased from QIAGEN and transiently transfected into COS-1 cells by using Hi-PerFect reagent.

    Techniques: Western Blot, Expressing, FLAG-tag, Immunoprecipitation, Transfection