oligo dt primer Thermo Fisher Search Results

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Qiagen oligo dt primers
    Oligo Dt Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 1199 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt primers/product/Qiagen
    Average 95 stars, based on 1199 article reviews
    Price from $9.99 to $1999.99
    oligo dt primers - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Millipore oligo
    Oligo, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 1223 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    Average 95 stars, based on 1223 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Thermo Fisher oligodeoxythymidylic acid primer
    Oligodeoxythymidylic Acid Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 669 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligodeoxythymidylic acid primer/product/Thermo Fisher
    Average 92 stars, based on 669 article reviews
    Price from $9.99 to $1999.99
    oligodeoxythymidylic acid primer - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    Thermo Fisher oligo
    Oligo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 26409 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Thermo Fisher
    Average 90 stars, based on 26409 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Thermo Fisher oligos
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 2907 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Thermo Fisher
    Average 90 stars, based on 2907 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Thermo Fisher oligo dt 12
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligo Dt 12, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2404 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt 12/product/Thermo Fisher
    Average 99 stars, based on 2404 article reviews
    Price from $9.99 to $1999.99
    oligo dt 12 - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Thermo Fisher oligo dt 12 18 primer
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligo Dt 12 18 Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 489 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt 12 18 primer/product/Thermo Fisher
    Average 90 stars, based on 489 article reviews
    Price from $9.99 to $1999.99
    oligo dt 12 18 primer - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Thermo Fisher oligo dt t7 primer
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligo Dt T7 Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 99 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt t7 primer/product/Thermo Fisher
    Average 91 stars, based on 99 article reviews
    Price from $9.99 to $1999.99
    oligo dt t7 primer - by Bioz Stars, 2020-02
    91/100 stars
      Buy from Supplier

    Thermo Fisher generacer oligo dt primer
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Generacer Oligo Dt Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 116 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/generacer oligo dt primer/product/Thermo Fisher
    Average 99 stars, based on 116 article reviews
    Price from $9.99 to $1999.99
    generacer oligo dt primer - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Thermo Fisher oligo dt random primers
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligo Dt Random Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt random primers/product/Thermo Fisher
    Average 93 stars, based on 94 article reviews
    Price from $9.99 to $1999.99
    oligo dt random primers - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    Thermo Fisher oligo dt t8 primer
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligo Dt T8 Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt t8 primer/product/Thermo Fisher
    Average 78 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    oligo dt t8 primer - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    Thermo Fisher oligodeoxythymidylic acid adapter primer
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligodeoxythymidylic Acid Adapter Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligodeoxythymidylic acid adapter primer/product/Thermo Fisher
    Average 78 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    oligodeoxythymidylic acid adapter primer - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    Thermo Fisher oligo dt primer dt15
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligo Dt Primer Dt15, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt primer dt15/product/Thermo Fisher
    Average 78 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    oligo dt primer dt15 - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    Thermo Fisher t7 oligo dt promoter primer
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    T7 Oligo Dt Promoter Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 82/100, based on 98 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 oligo dt promoter primer/product/Thermo Fisher
    Average 82 stars, based on 98 article reviews
    Price from $9.99 to $1999.99
    t7 oligo dt promoter primer - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    Thermo Fisher dynabeads
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Dynabeads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 13467 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dynabeads/product/Thermo Fisher
    Average 90 stars, based on 13467 article reviews
    Price from $9.99 to $1999.99
    dynabeads - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Thermo Fisher retroscript kit oligo dt primers
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Retroscript Kit Oligo Dt Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 81/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/retroscript kit oligo dt primers/product/Thermo Fisher
    Average 81 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    retroscript kit oligo dt primers - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    Thermo Fisher genechip t7 oligo dt promoter primer kit
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Genechip T7 Oligo Dt Promoter Primer Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 78 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genechip t7 oligo dt promoter primer kit/product/Thermo Fisher
    Average 87 stars, based on 78 article reviews
    Price from $9.99 to $1999.99
    genechip t7 oligo dt promoter primer kit - by Bioz Stars, 2020-02
    87/100 stars
      Buy from Supplier

    Thermo Fisher mrna transcription oligo dt primers
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Mrna Transcription Oligo Dt Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mrna transcription oligo dt primers/product/Thermo Fisher
    Average 86 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    mrna transcription oligo dt primers - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    Thermo Fisher oligo dt primed reverse transcriptase
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligo Dt Primed Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt primed reverse transcriptase/product/Thermo Fisher
    Average 78 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    oligo dt primed reverse transcriptase - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    Thermo Fisher oligo dt 15 primer solution
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligo Dt 15 Primer Solution, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt 15 primer solution/product/Thermo Fisher
    Average 79 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    oligo dt 15 primer solution - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    Thermo Fisher oligo dt primed mumlv reverse trascriptase
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligo Dt Primed Mumlv Reverse Trascriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt primed mumlv reverse trascriptase/product/Thermo Fisher
    Average 86 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    oligo dt primed mumlv reverse trascriptase - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    Thermo Fisher oligo dt primers 12
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligo Dt Primers 12, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt primers 12/product/Thermo Fisher
    Average 79 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    oligo dt primers 12 - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    Thermo Fisher oligo dt 10 primer
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligo Dt 10 Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 81/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt 10 primer/product/Thermo Fisher
    Average 81 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    oligo dt 10 primer - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    Thermo Fisher oligo dt t12 t18 primers
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligo Dt T12 T18 Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt t12 t18 primers/product/Thermo Fisher
    Average 89 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    oligo dt t12 t18 primers - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    Thermo Fisher oligo dt 3sites adaptor primer
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligo Dt 3sites Adaptor Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt 3sites adaptor primer/product/Thermo Fisher
    Average 77 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    oligo dt 3sites adaptor primer - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    Thermo Fisher oligo dt priming region 5 ggccagtgaattgtaatacgactcactatagggaggcgg dt 24
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligo Dt Priming Region 5 Ggccagtgaattgtaatacgactcactatagggaggcgg Dt 24, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt priming region 5 ggccagtgaattgtaatacgactcactatagggaggcgg dt 24/product/Thermo Fisher
    Average 79 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    oligo dt priming region 5 ggccagtgaattgtaatacgactcactatagggaggcgg dt 24 - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    Thermo Fisher oligo dt primed cdna
    BAX knockdown by <t>siRNA</t> mimics promotes tumor growth in vivo. siNC and siBAX <t>oligos</t> were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p
    Oligo Dt Primed Cdna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 615 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt primed cdna/product/Thermo Fisher
    Average 99 stars, based on 615 article reviews
    Price from $9.99 to $1999.99
    oligo dt primed cdna - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results

    BAX knockdown by siRNA mimics promotes tumor growth in vivo. siNC and siBAX oligos were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p

    Journal: International Journal of Molecular Sciences

    Article Title: Loss of BAX by miR-365 Promotes Cutaneous Squamous Cell Carcinoma Progression by Suppressing Apoptosis

    doi: 10.3390/ijms18061157

    Figure Lengend Snippet: BAX knockdown by siRNA mimics promotes tumor growth in vivo. siNC and siBAX oligos were injected into A431 cell xenografts every three days. ( A ) Loss of BAX promotes subcutaneous tumor growth in a mouse xenograft model. Tumor volumes (mm 3 ) were plotted according to days. Tumor volume statistical data represent the average of three independent experiments ± s.d., respectively; ( B ) the mice were sacrificed at the end of the experiment and images taken along with the dissected tumors from three representative mice are shown. White arrows indicate the siNC-treated xenografts, while black arrows indicate siBAX-treated xenografts; ( C ) the expression of BAX was measured in the dissected tumors by qRT-PCR. qRT-PCR statistical data represent the average of three independent experiments ± s.d. Expression folds are shown with respect to NC where normalized copy numbers were set to 1; ( D ) the protein expression of BAX was detected in xenografts after siBAX treatment by Western blot; ( E ) histopathology analysis (IHC staining) of BAX on tumor sections. The quantification was done by counting positively-stained cells from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm; ( F ) TUNEL assay of apoptosis on tumor sections after BAX depletion. The quantification was done by counting positively-stained signals from 20 randomly-chosen fields from a total of five sections per tumor. Magnification, 400×, Scale bars, 50 µm. ** p

    Article Snippet: Oligos were prepared by pre-incubating 3 nM siRNA per mouse with Lipofectamine 2000 (Life Technologies) for 15 min; injections were made using a final volume of 50 µL in serum free DMEM (Life Technologies).

    Techniques: In Vivo, Injection, Mouse Assay, Expressing, Quantitative RT-PCR, Western Blot, Histopathology, Immunohistochemistry, Staining, TUNEL Assay