oligo Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Integrated DNA Technologies oligo synthesis oligos
    Diagram illustrating a cloning-free strategy for <t>sgRNA</t> synthesis. The sequences and purpose of each synthesized <t>oligo</t> are diagrammed to show how they function in this cloning free strategy. The components include a pair of PCR primers (black: IVT-FWD and IVT-REV), a common reverse template oligo (blue/red: IVT-Scaffold-Long), and an oligo containing a 5’ T7 promoter and a unique sgRNA sequence (green/black/blue: IVT-VAR-sgRNA). The DNA template for sgRNA synthesis is generated by a PCR reaction. The product of this reaction is a single 127 bp amplicon which should be confirmed by gel electrophoresis prior to continuing. Shown on the right is a representative DNA electrophoresis image of the PCR reaction. Subsequently, sgRNAs are synthesized by T7 in vitro transcription (IVT) and purified. Before moving forward, the quality and quantity of the newly synthesized sgRNA can be determined by submitting the sample for BioAnalyzer testing. A representative bioanalyzer trace of the IVT products is shown to the right. Recombinant Cas9 protein, purified sgRNA(s), and ssODN (optional) are assembled into RNPs in vitro by combining the components with a stabilizing buffer at 37°C for 10 minutes. The active RNP Complex is now ready for electroporation.
    Oligo Synthesis Oligos, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo synthesis oligos/product/Integrated DNA Technologies
    Average 99 stars, based on 94 article reviews
    Price from $9.99 to $1999.99
    oligo synthesis oligos - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs oligo
    Quality and reproducibility of the experiment shown in Figure 5 . ( a ) Polysome profile of HEK293T cells transfected with the indicated oligonucleotides. This experiment corresponds to the replica_1 used for RNA-seq, indicating fractions pooled as monosomes or polysomes. The bottom panel shows a western blot analysis of the resulting fractions probed with anti-eS6 antibody. ( b ) Analysis of correlation between replicas using a normalized number of reads for every <t>mRNA</t> in the monosomal and polysomal samples. ( c ) Changes in mRNA abundance between <t>oligo</t> 4 and VIC–oligo-4-transfected cells. Data are the average from two replicates. ( d ) Enrichment in KEGG pathways detected in the ‘TE down’ group of mRNAs. The p-value and enrichment factor for each term are indicated.
    Oligo, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 909 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/New England Biolabs
    Average 99 stars, based on 909 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore oligo pl
    CaRF binds DNA directly. Human CaRF was expressed in bacteria (E. Coli hCaRF) or synthesized in vitro by <t>TNT</t> (hCaRF). Rabbit reticulocyte lysate without CaRF expression was used as control. 2µL of CaRF protein or TNT control was incubated with radiolabeled CaRE1 <t>oligos</t> in the absence (-) or presence of a 50-fold molar excess of competing unlabeled wildtype (W) or mutant (M) CaRE1 probe. Unbound probe is at the bottom of the gel. Arrowhead indicates the complex between CaRF and CaRE1.
    Oligo Pl, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo pl/product/Millipore
    Average 99 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    oligo pl - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher ultrahybtm oligo
    CaRF binds DNA directly. Human CaRF was expressed in bacteria (E. Coli hCaRF) or synthesized in vitro by <t>TNT</t> (hCaRF). Rabbit reticulocyte lysate without CaRF expression was used as control. 2µL of CaRF protein or TNT control was incubated with radiolabeled CaRE1 <t>oligos</t> in the absence (-) or presence of a 50-fold molar excess of competing unlabeled wildtype (W) or mutant (M) CaRE1 probe. Unbound probe is at the bottom of the gel. Arrowhead indicates the complex between CaRF and CaRE1.
    Ultrahybtm Oligo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 75 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ultrahybtm oligo/product/Thermo Fisher
    Average 99 stars, based on 75 article reviews
    Price from $9.99 to $1999.99
    ultrahybtm oligo - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Qiagen oligo
    CaRF binds DNA directly. Human CaRF was expressed in bacteria (E. Coli hCaRF) or synthesized in vitro by <t>TNT</t> (hCaRF). Rabbit reticulocyte lysate without CaRF expression was used as control. 2µL of CaRF protein or TNT control was incubated with radiolabeled CaRE1 <t>oligos</t> in the absence (-) or presence of a 50-fold molar excess of competing unlabeled wildtype (W) or mutant (M) CaRE1 probe. Unbound probe is at the bottom of the gel. Arrowhead indicates the complex between CaRF and CaRE1.
    Oligo, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 933 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Qiagen
    Average 99 stars, based on 933 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Zymo Research oligo clean
    In vivo production of ssDNA. ( a ) Schematic for the conversion of the <t>r_oligo</t> gene to ssDNA. The r_oligo gene contains both the desired ssDNA sequence and the HTBS part, which serves as a terminator (black, ssDNA sequence; orange, A/U region; brown, PBS; purple, hairpin). ( b ) The impact of different combinations of RT expression on ssDNA production is shown. Data are shown for the production of a 205-nt ssDNA (r_oligo_205) under purification conditions preventing the removal of the HTBS (RNAse A+150 mM NaCl). The red triangle shows the predicted location of the band (note that the ladder is based on double stranded DNA). The bands are from the same gel and the image processed once, but the order changed for publication. For the full gel in its original order, see Supplementary Fig. 1 . The ssDNA sequence and reverse transcriptase sequences are added in Supplementary Tables 2 and 3 . ( c ) The expression of ssDNA after 18 h growth in the presence (+IPTG, 1 mM) and absence of IPTG (−IPTG) under conditions preserving the HTBS. To confirm that the band is ssDNA, the same sample is exposed to DNase (+IPTG/+DNase, 1 mM/4 units). ( d ) For the same system as in c , the ssDNA is treated to remove the HTBS <t>RNA</t> (RNAse and no salt). ( e ) Comparison of an in vivo produced ssDNA with commercial chemically synthesized ssDNAs. The ladder was calculated using commercial oligos of defined size run simultaneously in the gel. The ssDNA sequence is in Supplementary Table 2 . ( f ) Sequencing analysis of the in vivo produced 72-mer. The ‘prediction' is the complementary sequence of the expected ssDNA (Methods).
    Oligo Clean, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 57 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo clean/product/Zymo Research
    Average 99 stars, based on 57 article reviews
    Price from $9.99 to $1999.99
    oligo clean - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    91
    Ahram Biosystems oligo
    In vivo production of ssDNA. ( a ) Schematic for the conversion of the <t>r_oligo</t> gene to ssDNA. The r_oligo gene contains both the desired ssDNA sequence and the HTBS part, which serves as a terminator (black, ssDNA sequence; orange, A/U region; brown, PBS; purple, hairpin). ( b ) The impact of different combinations of RT expression on ssDNA production is shown. Data are shown for the production of a 205-nt ssDNA (r_oligo_205) under purification conditions preventing the removal of the HTBS (RNAse A+150 mM NaCl). The red triangle shows the predicted location of the band (note that the ladder is based on double stranded DNA). The bands are from the same gel and the image processed once, but the order changed for publication. For the full gel in its original order, see Supplementary Fig. 1 . The ssDNA sequence and reverse transcriptase sequences are added in Supplementary Tables 2 and 3 . ( c ) The expression of ssDNA after 18 h growth in the presence (+IPTG, 1 mM) and absence of IPTG (−IPTG) under conditions preserving the HTBS. To confirm that the band is ssDNA, the same sample is exposed to DNase (+IPTG/+DNase, 1 mM/4 units). ( d ) For the same system as in c , the ssDNA is treated to remove the HTBS <t>RNA</t> (RNAse and no salt). ( e ) Comparison of an in vivo produced ssDNA with commercial chemically synthesized ssDNAs. The ladder was calculated using commercial oligos of defined size run simultaneously in the gel. The ssDNA sequence is in Supplementary Table 2 . ( f ) Sequencing analysis of the in vivo produced 72-mer. The ‘prediction' is the complementary sequence of the expected ssDNA (Methods).
    Oligo, supplied by Ahram Biosystems, used in various techniques. Bioz Stars score: 91/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Ahram Biosystems
    Average 91 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    98
    Bio-Rad oligo
    In vivo production of ssDNA. ( a ) Schematic for the conversion of the <t>r_oligo</t> gene to ssDNA. The r_oligo gene contains both the desired ssDNA sequence and the HTBS part, which serves as a terminator (black, ssDNA sequence; orange, A/U region; brown, PBS; purple, hairpin). ( b ) The impact of different combinations of RT expression on ssDNA production is shown. Data are shown for the production of a 205-nt ssDNA (r_oligo_205) under purification conditions preventing the removal of the HTBS (RNAse A+150 mM NaCl). The red triangle shows the predicted location of the band (note that the ladder is based on double stranded DNA). The bands are from the same gel and the image processed once, but the order changed for publication. For the full gel in its original order, see Supplementary Fig. 1 . The ssDNA sequence and reverse transcriptase sequences are added in Supplementary Tables 2 and 3 . ( c ) The expression of ssDNA after 18 h growth in the presence (+IPTG, 1 mM) and absence of IPTG (−IPTG) under conditions preserving the HTBS. To confirm that the band is ssDNA, the same sample is exposed to DNase (+IPTG/+DNase, 1 mM/4 units). ( d ) For the same system as in c , the ssDNA is treated to remove the HTBS <t>RNA</t> (RNAse and no salt). ( e ) Comparison of an in vivo produced ssDNA with commercial chemically synthesized ssDNAs. The ladder was calculated using commercial oligos of defined size run simultaneously in the gel. The ssDNA sequence is in Supplementary Table 2 . ( f ) Sequencing analysis of the in vivo produced 72-mer. The ‘prediction' is the complementary sequence of the expected ssDNA (Methods).
    Oligo, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 476 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Bio-Rad
    Average 98 stars, based on 476 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    98/100 stars
      Buy from Supplier

    93
    Bioneer Corporation oligo
    In vivo production of ssDNA. ( a ) Schematic for the conversion of the <t>r_oligo</t> gene to ssDNA. The r_oligo gene contains both the desired ssDNA sequence and the HTBS part, which serves as a terminator (black, ssDNA sequence; orange, A/U region; brown, PBS; purple, hairpin). ( b ) The impact of different combinations of RT expression on ssDNA production is shown. Data are shown for the production of a 205-nt ssDNA (r_oligo_205) under purification conditions preventing the removal of the HTBS (RNAse A+150 mM NaCl). The red triangle shows the predicted location of the band (note that the ladder is based on double stranded DNA). The bands are from the same gel and the image processed once, but the order changed for publication. For the full gel in its original order, see Supplementary Fig. 1 . The ssDNA sequence and reverse transcriptase sequences are added in Supplementary Tables 2 and 3 . ( c ) The expression of ssDNA after 18 h growth in the presence (+IPTG, 1 mM) and absence of IPTG (−IPTG) under conditions preserving the HTBS. To confirm that the band is ssDNA, the same sample is exposed to DNase (+IPTG/+DNase, 1 mM/4 units). ( d ) For the same system as in c , the ssDNA is treated to remove the HTBS <t>RNA</t> (RNAse and no salt). ( e ) Comparison of an in vivo produced ssDNA with commercial chemically synthesized ssDNAs. The ladder was calculated using commercial oligos of defined size run simultaneously in the gel. The ssDNA sequence is in Supplementary Table 2 . ( f ) Sequencing analysis of the in vivo produced 72-mer. The ‘prediction' is the complementary sequence of the expected ssDNA (Methods).
    Oligo, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 93/100, based on 215 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Bioneer Corporation
    Average 93 stars, based on 215 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    93
    EuroClone oligo
    In vivo production of ssDNA. ( a ) Schematic for the conversion of the <t>r_oligo</t> gene to ssDNA. The r_oligo gene contains both the desired ssDNA sequence and the HTBS part, which serves as a terminator (black, ssDNA sequence; orange, A/U region; brown, PBS; purple, hairpin). ( b ) The impact of different combinations of RT expression on ssDNA production is shown. Data are shown for the production of a 205-nt ssDNA (r_oligo_205) under purification conditions preventing the removal of the HTBS (RNAse A+150 mM NaCl). The red triangle shows the predicted location of the band (note that the ladder is based on double stranded DNA). The bands are from the same gel and the image processed once, but the order changed for publication. For the full gel in its original order, see Supplementary Fig. 1 . The ssDNA sequence and reverse transcriptase sequences are added in Supplementary Tables 2 and 3 . ( c ) The expression of ssDNA after 18 h growth in the presence (+IPTG, 1 mM) and absence of IPTG (−IPTG) under conditions preserving the HTBS. To confirm that the band is ssDNA, the same sample is exposed to DNase (+IPTG/+DNase, 1 mM/4 units). ( d ) For the same system as in c , the ssDNA is treated to remove the HTBS <t>RNA</t> (RNAse and no salt). ( e ) Comparison of an in vivo produced ssDNA with commercial chemically synthesized ssDNAs. The ladder was calculated using commercial oligos of defined size run simultaneously in the gel. The ssDNA sequence is in Supplementary Table 2 . ( f ) Sequencing analysis of the in vivo produced 72-mer. The ‘prediction' is the complementary sequence of the expected ssDNA (Methods).
    Oligo, supplied by EuroClone, used in various techniques. Bioz Stars score: 93/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/EuroClone
    Average 93 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    94
    GE Healthcare oligo
    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and <t>NeutrAvidin-DNA</t> <t>oligo</t> conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113
    Oligo, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 94/100, based on 963 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/GE Healthcare
    Average 94 stars, based on 963 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    86
    Genset Corporation oligo
    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and <t>NeutrAvidin-DNA</t> <t>oligo</t> conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113
    Oligo, supplied by Genset Corporation, used in various techniques. Bioz Stars score: 86/100, based on 35 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Genset Corporation
    Average 86 stars, based on 35 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    91
    MWG-Biotech oligo
    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and <t>NeutrAvidin-DNA</t> <t>oligo</t> conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113
    Oligo, supplied by MWG-Biotech, used in various techniques. Bioz Stars score: 91/100, based on 129 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/MWG-Biotech
    Average 91 stars, based on 129 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    99
    Promega oligo
    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and <t>NeutrAvidin-DNA</t> <t>oligo</t> conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113
    Oligo, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 6945 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Promega
    Average 99 stars, based on 6945 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    oligo  (Roche)
    95
    Roche oligo
    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and <t>NeutrAvidin-DNA</t> <t>oligo</t> conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113
    Oligo, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 1737 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Roche
    Average 95 stars, based on 1737 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    90
    Stratagene oligo
    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and <t>NeutrAvidin-DNA</t> <t>oligo</t> conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113
    Oligo, supplied by Stratagene, used in various techniques. Bioz Stars score: 90/100, based on 318 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Stratagene
    Average 90 stars, based on 318 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    86
    Supertechs oligo
    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and <t>NeutrAvidin-DNA</t> <t>oligo</t> conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113
    Oligo, supplied by Supertechs, used in various techniques. Bioz Stars score: 86/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Supertechs
    Average 86 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    99
    TaKaRa oligo
    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and <t>NeutrAvidin-DNA</t> <t>oligo</t> conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113
    Oligo, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1999 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/TaKaRa
    Average 99 stars, based on 1999 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    93
    tiangen biotech co oligo
    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and <t>NeutrAvidin-DNA</t> <t>oligo</t> conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113
    Oligo, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 93/100, based on 196 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/tiangen biotech co
    Average 93 stars, based on 196 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    96
    Toyobo oligo
    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and <t>NeutrAvidin-DNA</t> <t>oligo</t> conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113
    Oligo, supplied by Toyobo, used in various techniques. Bioz Stars score: 96/100, based on 576 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Toyobo
    Average 96 stars, based on 576 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    93
    Eurofins oligo
    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and <t>NeutrAvidin-DNA</t> <t>oligo</t> conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113
    Oligo, supplied by Eurofins, used in various techniques. Bioz Stars score: 93/100, based on 97 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Eurofins
    Average 93 stars, based on 97 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    96
    Fisher Scientific oligo
    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and <t>NeutrAvidin-DNA</t> <t>oligo</t> conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113
    Oligo, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 96/100, based on 51 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Fisher Scientific
    Average 96 stars, based on 51 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    91
    Macrogen oligo
    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and <t>NeutrAvidin-DNA</t> <t>oligo</t> conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113
    Oligo, supplied by Macrogen, used in various techniques. Bioz Stars score: 91/100, based on 52 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Macrogen
    Average 91 stars, based on 52 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    92
    Microsynth oligo
    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and <t>NeutrAvidin-DNA</t> <t>oligo</t> conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113
    Oligo, supplied by Microsynth, used in various techniques. Bioz Stars score: 92/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Microsynth
    Average 92 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    94
    Sigma-Genosys oligo
    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and <t>NeutrAvidin-DNA</t> <t>oligo</t> conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113
    Oligo, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 94/100, based on 45 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Sigma-Genosys
    Average 94 stars, based on 45 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher oligo
    RT-PCR confirmation of antisense transcription. a) A graphic representation of um02794 transcription. The grey line represents the genomic sequence (middle), the blue arrow represents predicted gene structure, and the red (top) and green (bottom) arrows represent sense and anti-sense ESTs respectively. The range of the genome coordinates was included. b) Detecting antisense transcripts corresponding to um02794 via strand specific RT-PCR. In lanes 2 to 5 first strand synthesis was carried out on <t>RNA</t> of CM grown haploid cells. In lanes 6 to 9 first strand synthesis was carried out on RNA of MN grown haploid cells. First synthesis reactions of lanes 2 and 6 were prepared using sense strand specific primers; lanes 3 and 7 anti sense specific primers; lane 4 and 8 <t>oligo</t> dT and lanes 5 and 9 DEPC-treated water. Lane 10 used genomic DNA from U. maydis strain 521 and lane 11 used water a PCR template. Lane 1 and 12: Full Ranger DNA ladder.
    Oligo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 26222 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Thermo Fisher
    Average 99 stars, based on 26222 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    93
    Beijing TransGen Biotech oligo
    RT-PCR confirmation of antisense transcription. a) A graphic representation of um02794 transcription. The grey line represents the genomic sequence (middle), the blue arrow represents predicted gene structure, and the red (top) and green (bottom) arrows represent sense and anti-sense ESTs respectively. The range of the genome coordinates was included. b) Detecting antisense transcripts corresponding to um02794 via strand specific RT-PCR. In lanes 2 to 5 first strand synthesis was carried out on <t>RNA</t> of CM grown haploid cells. In lanes 6 to 9 first strand synthesis was carried out on RNA of MN grown haploid cells. First synthesis reactions of lanes 2 and 6 were prepared using sense strand specific primers; lanes 3 and 7 anti sense specific primers; lane 4 and 8 <t>oligo</t> dT and lanes 5 and 9 DEPC-treated water. Lane 10 used genomic DNA from U. maydis strain 521 and lane 11 used water a PCR template. Lane 1 and 12: Full Ranger DNA ladder.
    Oligo, supplied by Beijing TransGen Biotech, used in various techniques. Bioz Stars score: 93/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Beijing TransGen Biotech
    Average 93 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    90
    Horizon Discovery oligo
    RT-PCR confirmation of antisense transcription. a) A graphic representation of um02794 transcription. The grey line represents the genomic sequence (middle), the blue arrow represents predicted gene structure, and the red (top) and green (bottom) arrows represent sense and anti-sense ESTs respectively. The range of the genome coordinates was included. b) Detecting antisense transcripts corresponding to um02794 via strand specific RT-PCR. In lanes 2 to 5 first strand synthesis was carried out on <t>RNA</t> of CM grown haploid cells. In lanes 6 to 9 first strand synthesis was carried out on RNA of MN grown haploid cells. First synthesis reactions of lanes 2 and 6 were prepared using sense strand specific primers; lanes 3 and 7 anti sense specific primers; lane 4 and 8 <t>oligo</t> dT and lanes 5 and 9 DEPC-treated water. Lane 10 used genomic DNA from U. maydis strain 521 and lane 11 used water a PCR template. Lane 1 and 12: Full Ranger DNA ladder.
    Oligo, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 90/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Horizon Discovery
    Average 90 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    92
    iNtRON Biotechnology oligo
    RT-PCR confirmation of antisense transcription. a) A graphic representation of um02794 transcription. The grey line represents the genomic sequence (middle), the blue arrow represents predicted gene structure, and the red (top) and green (bottom) arrows represent sense and anti-sense ESTs respectively. The range of the genome coordinates was included. b) Detecting antisense transcripts corresponding to um02794 via strand specific RT-PCR. In lanes 2 to 5 first strand synthesis was carried out on <t>RNA</t> of CM grown haploid cells. In lanes 6 to 9 first strand synthesis was carried out on RNA of MN grown haploid cells. First synthesis reactions of lanes 2 and 6 were prepared using sense strand specific primers; lanes 3 and 7 anti sense specific primers; lane 4 and 8 <t>oligo</t> dT and lanes 5 and 9 DEPC-treated water. Lane 10 used genomic DNA from U. maydis strain 521 and lane 11 used water a PCR template. Lane 1 and 12: Full Ranger DNA ladder.
    Oligo, supplied by iNtRON Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 191 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/iNtRON Biotechnology
    Average 92 stars, based on 191 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    Image Search Results


    Diagram illustrating a cloning-free strategy for sgRNA synthesis. The sequences and purpose of each synthesized oligo are diagrammed to show how they function in this cloning free strategy. The components include a pair of PCR primers (black: IVT-FWD and IVT-REV), a common reverse template oligo (blue/red: IVT-Scaffold-Long), and an oligo containing a 5’ T7 promoter and a unique sgRNA sequence (green/black/blue: IVT-VAR-sgRNA). The DNA template for sgRNA synthesis is generated by a PCR reaction. The product of this reaction is a single 127 bp amplicon which should be confirmed by gel electrophoresis prior to continuing. Shown on the right is a representative DNA electrophoresis image of the PCR reaction. Subsequently, sgRNAs are synthesized by T7 in vitro transcription (IVT) and purified. Before moving forward, the quality and quantity of the newly synthesized sgRNA can be determined by submitting the sample for BioAnalyzer testing. A representative bioanalyzer trace of the IVT products is shown to the right. Recombinant Cas9 protein, purified sgRNA(s), and ssODN (optional) are assembled into RNPs in vitro by combining the components with a stabilizing buffer at 37°C for 10 minutes. The active RNP Complex is now ready for electroporation.

    Journal: Nature protocols

    Article Title: Efficient mouse genome engineering by CRISPR-EZ (CRISPR RNP Electroporation of Zygotes) technology

    doi: 10.1038/nprot.2018.012

    Figure Lengend Snippet: Diagram illustrating a cloning-free strategy for sgRNA synthesis. The sequences and purpose of each synthesized oligo are diagrammed to show how they function in this cloning free strategy. The components include a pair of PCR primers (black: IVT-FWD and IVT-REV), a common reverse template oligo (blue/red: IVT-Scaffold-Long), and an oligo containing a 5’ T7 promoter and a unique sgRNA sequence (green/black/blue: IVT-VAR-sgRNA). The DNA template for sgRNA synthesis is generated by a PCR reaction. The product of this reaction is a single 127 bp amplicon which should be confirmed by gel electrophoresis prior to continuing. Shown on the right is a representative DNA electrophoresis image of the PCR reaction. Subsequently, sgRNAs are synthesized by T7 in vitro transcription (IVT) and purified. Before moving forward, the quality and quantity of the newly synthesized sgRNA can be determined by submitting the sample for BioAnalyzer testing. A representative bioanalyzer trace of the IVT products is shown to the right. Recombinant Cas9 protein, purified sgRNA(s), and ssODN (optional) are assembled into RNPs in vitro by combining the components with a stabilizing buffer at 37°C for 10 minutes. The active RNP Complex is now ready for electroporation.

    Article Snippet: Nuclease free water (Ambion, cat. no. AM9937, molecular biology grade) 1 M Tris-HCl pH 7.4 (Sigma, cat. no. T2663–1L, molecular biology grade) 0.5 M EDTA (Sigma, cat. no. 03690–100ML, molecular biology Grade) Oligos for sgRNA synthesis, Donor Oligo and PCR Primers for genotyping ( , Integrated DNA Technologies, custom DNA oligonucleotides)

    Techniques: Clone Assay, Synthesized, Polymerase Chain Reaction, Sequencing, Generated, Amplification, Nucleic Acid Electrophoresis, In Vitro, Purification, Recombinant, Electroporation

    Enhancement of T4 DNA ligase activity by supplemental oligonucleotides. (a) Unsuccessful 4-bp duplex reactions could be salvaged by utilizing a supplementary oligonucleotide, designed to complement the first oligonucleotide-dsDNA duplex but is unphosphorylated to prevent ligation of itself. Two hour ligation of the 4-bp reaction at 16°C supplemented with 3.33 μM of the hexamer, shows successful ligation (■) while reactions without the supplementary hexamer show no activity (◆). (b) Ligation reaction of an octamer supplemented with a second octamer in which one is used for ligation and the other is used to extend the duplex. A two hour ligation at 16°C of serial concentrations of the octamer with 3.33 μM of the supplementary octamer shows significant ligation (■) compared to reactions without the supplemental octamer (◆). (c) Unsuccessful 3-bp duplex reactions could be salvaged by utilizing a supplementary hexamer that hybridized at all six positions. A two hour ligation of the 3-bp reaction at 16°C with 3.33 μM supplementary hexamer shows successful ligation (■) while reactions without the supplementary hexamer show no activity (◆). (d) Ligation using a hexamer pair at 4°C for 16 hours shows limited improvement (■) compared to the unsupplemented (◆) control.

    Journal: BMC Research Notes

    Article Title: Efficient assembly of very short oligonucleotides using T4 DNA Ligase

    doi: 10.1186/1756-0500-3-291

    Figure Lengend Snippet: Enhancement of T4 DNA ligase activity by supplemental oligonucleotides. (a) Unsuccessful 4-bp duplex reactions could be salvaged by utilizing a supplementary oligonucleotide, designed to complement the first oligonucleotide-dsDNA duplex but is unphosphorylated to prevent ligation of itself. Two hour ligation of the 4-bp reaction at 16°C supplemented with 3.33 μM of the hexamer, shows successful ligation (■) while reactions without the supplementary hexamer show no activity (◆). (b) Ligation reaction of an octamer supplemented with a second octamer in which one is used for ligation and the other is used to extend the duplex. A two hour ligation at 16°C of serial concentrations of the octamer with 3.33 μM of the supplementary octamer shows significant ligation (■) compared to reactions without the supplemental octamer (◆). (c) Unsuccessful 3-bp duplex reactions could be salvaged by utilizing a supplementary hexamer that hybridized at all six positions. A two hour ligation of the 3-bp reaction at 16°C with 3.33 μM supplementary hexamer shows successful ligation (■) while reactions without the supplementary hexamer show no activity (◆). (d) Ligation using a hexamer pair at 4°C for 16 hours shows limited improvement (■) compared to the unsupplemented (◆) control.

    Article Snippet: Preparation of immobilized dsDNA All oligos, including those 5'-biotinylated, 3'-FAM6, and 5'-phosphorylated were synthesized by Integrated DNA Technologies (IDT Inc., IA, USA).

    Techniques: Activity Assay, Ligation

    Evaluation of minimal oligonucleotide substrate requirements for T4 DNA ligase. (a) Schematic diagram of an immobilized DNA strand used in ligation assays and DNA construction. M-270 Dynabeads (Invitrogen) are attached through a streptavidin-biotin linkage to the 5' end of a double stranded DNA. The free end is designed with a variable 5' overhang, complementary to labeled oligonucleotides used in ligation. An additional BbsI restriction site and a forward primer site are included in the case of DNA construction. (b) Increasing concentrations of 5'-phosphorylated, 3'-fluorescently labeled oligonucleotide are ligated to 5 pmoles of immobilized dsDNA with a complementary overhang. Reactions were performed for one hour at 16°C and washed with TE to remove unligated substrate. Successful ligation kinetics are observed at the 5-bp duplex length (▲), but no significant ligation occurs at lengths of 4-bp (■) or 3-bp (◆).

    Journal: BMC Research Notes

    Article Title: Efficient assembly of very short oligonucleotides using T4 DNA Ligase

    doi: 10.1186/1756-0500-3-291

    Figure Lengend Snippet: Evaluation of minimal oligonucleotide substrate requirements for T4 DNA ligase. (a) Schematic diagram of an immobilized DNA strand used in ligation assays and DNA construction. M-270 Dynabeads (Invitrogen) are attached through a streptavidin-biotin linkage to the 5' end of a double stranded DNA. The free end is designed with a variable 5' overhang, complementary to labeled oligonucleotides used in ligation. An additional BbsI restriction site and a forward primer site are included in the case of DNA construction. (b) Increasing concentrations of 5'-phosphorylated, 3'-fluorescently labeled oligonucleotide are ligated to 5 pmoles of immobilized dsDNA with a complementary overhang. Reactions were performed for one hour at 16°C and washed with TE to remove unligated substrate. Successful ligation kinetics are observed at the 5-bp duplex length (▲), but no significant ligation occurs at lengths of 4-bp (■) or 3-bp (◆).

    Article Snippet: Preparation of immobilized dsDNA All oligos, including those 5'-biotinylated, 3'-FAM6, and 5'-phosphorylated were synthesized by Integrated DNA Technologies (IDT Inc., IA, USA).

    Techniques: Ligation, Labeling

    Surface modification and characterization of Ti6Al4V plates. (a) Schematic of sequential DopaMA and PEGDMA-Oligo hydrogel coatings on Ti6Al4V substrates. (b) Water contact angle ( n = 6) of Ti6Al4V and Ti6Al4V-DopaMA. Error bars represent standard deviations, **** p ≤ 0.0001. (c) XPS scans on the Ti6Al4V surfaces before and after DopaMA immobilization. (d) Dark field optical micrographs of PEGDMA-Oligo coating on Ti6Al4V-DopaMA vs Ti6Al4V IM pins (1 mm in diameter). Magnification: 50×.

    Journal: ACS Central Science

    Article Title: Micrococcal-Nuclease-Triggered On-Demand Release of Vancomycin from Intramedullary Implant Coating Eradicates Staphylococcus aureus Infection in Mouse Femoral Canals

    doi: 10.1021/acscentsci.9b00870

    Figure Lengend Snippet: Surface modification and characterization of Ti6Al4V plates. (a) Schematic of sequential DopaMA and PEGDMA-Oligo hydrogel coatings on Ti6Al4V substrates. (b) Water contact angle ( n = 6) of Ti6Al4V and Ti6Al4V-DopaMA. Error bars represent standard deviations, **** p ≤ 0.0001. (c) XPS scans on the Ti6Al4V surfaces before and after DopaMA immobilization. (d) Dark field optical micrographs of PEGDMA-Oligo coating on Ti6Al4V-DopaMA vs Ti6Al4V IM pins (1 mm in diameter). Magnification: 50×.

    Article Snippet: Synthesis of PEGDMA-Oligo and PEGDMA-Oligo-Vanco Hydrogels We first validated the cleavage of the oligo probe (synthesized and purified by Integrated DNA Technologies) by MN (source: S. aureus strain ATCC 27735; Worthington Biochemical Corporation) prior to its conjugation with vancomycin or PEGDMA hydrogel.

    Techniques: Modification

    Complete eradication of S. aureus inoculated in the mouse femoral canal by PEGDMA-Oligo-Vanco coating. (a) IVIS images of mouse femurs injected with 40 CFU Xen-29 S. aureus and inserted with IM pins with PEGDMA-Oligo-Vanco or PEGDMA-Oligo coatings at 2, 7, 14, and 21 days. (b) Quantification of longitudinal bioluminescence signals of mouse femurs injected with 40 CFU Xen-29 S. aureus and inserted with the different hydrogel-coated pins at 2, 7, 14, and 21 days ( n = 14). (c) S. aureus recovery from 21 day explanted pins ( n = 11). Error bars represent standard deviations. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001 (two-way ANOVA for part b; Student’s t -test for part c).

    Journal: ACS Central Science

    Article Title: Micrococcal-Nuclease-Triggered On-Demand Release of Vancomycin from Intramedullary Implant Coating Eradicates Staphylococcus aureus Infection in Mouse Femoral Canals

    doi: 10.1021/acscentsci.9b00870

    Figure Lengend Snippet: Complete eradication of S. aureus inoculated in the mouse femoral canal by PEGDMA-Oligo-Vanco coating. (a) IVIS images of mouse femurs injected with 40 CFU Xen-29 S. aureus and inserted with IM pins with PEGDMA-Oligo-Vanco or PEGDMA-Oligo coatings at 2, 7, 14, and 21 days. (b) Quantification of longitudinal bioluminescence signals of mouse femurs injected with 40 CFU Xen-29 S. aureus and inserted with the different hydrogel-coated pins at 2, 7, 14, and 21 days ( n = 14). (c) S. aureus recovery from 21 day explanted pins ( n = 11). Error bars represent standard deviations. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001 (two-way ANOVA for part b; Student’s t -test for part c).

    Article Snippet: Synthesis of PEGDMA-Oligo and PEGDMA-Oligo-Vanco Hydrogels We first validated the cleavage of the oligo probe (synthesized and purified by Integrated DNA Technologies) by MN (source: S. aureus strain ATCC 27735; Worthington Biochemical Corporation) prior to its conjugation with vancomycin or PEGDMA hydrogel.

    Techniques: Injection

    Prevention of the development of osteomyelitis in mouse femoral canal inoculated with S. aureus by PEGDMA-Oligo-Vanco coating. (a) 3D μCT axial images of the distal femoral region 21 days after the insertion of Ti6Al4V IM pins (pins excluded during contouring) with different hydrogel coatings, with or without the inoculation of 40-CFU Xen-29 S. aureus . (b) Quantification of femoral BVF, BMD, and C. Th. of infected and uninfected femurs 21 days after the insertion of Ti6Al4V IM pins with PEGDMA-Oligo-Vanco or PEGDMA-Oligo coatings. n = 11–14. Error bars represent standard deviations. * p ≤ 0.05, ** p ≤ 0.01 as compared to the PEGDMA-Oligo control coating + S. aureus group (one-way ANOVA). (c) H E, ALP (blue)/TRAP (red), and Gram staining (bacteria stain blue) of explanted femurs in the infected group with PEGDMA-Oligo-Vanco coating or PEGDMA-Oligo control coating at 21 days postoperation. Dashed lines outline the cortical bone; BM = bone marrow; BM* = infected bone marrow; arrowheads indicate regions of enhanced ALP/TRAP activities; higher magnification views of the regions within the blue and red boxes are shown in the bottom row. Scale bars = 500 μm (top and middle rows) or 100 μm (bottom row).

    Journal: ACS Central Science

    Article Title: Micrococcal-Nuclease-Triggered On-Demand Release of Vancomycin from Intramedullary Implant Coating Eradicates Staphylococcus aureus Infection in Mouse Femoral Canals

    doi: 10.1021/acscentsci.9b00870

    Figure Lengend Snippet: Prevention of the development of osteomyelitis in mouse femoral canal inoculated with S. aureus by PEGDMA-Oligo-Vanco coating. (a) 3D μCT axial images of the distal femoral region 21 days after the insertion of Ti6Al4V IM pins (pins excluded during contouring) with different hydrogel coatings, with or without the inoculation of 40-CFU Xen-29 S. aureus . (b) Quantification of femoral BVF, BMD, and C. Th. of infected and uninfected femurs 21 days after the insertion of Ti6Al4V IM pins with PEGDMA-Oligo-Vanco or PEGDMA-Oligo coatings. n = 11–14. Error bars represent standard deviations. * p ≤ 0.05, ** p ≤ 0.01 as compared to the PEGDMA-Oligo control coating + S. aureus group (one-way ANOVA). (c) H E, ALP (blue)/TRAP (red), and Gram staining (bacteria stain blue) of explanted femurs in the infected group with PEGDMA-Oligo-Vanco coating or PEGDMA-Oligo control coating at 21 days postoperation. Dashed lines outline the cortical bone; BM = bone marrow; BM* = infected bone marrow; arrowheads indicate regions of enhanced ALP/TRAP activities; higher magnification views of the regions within the blue and red boxes are shown in the bottom row. Scale bars = 500 μm (top and middle rows) or 100 μm (bottom row).

    Article Snippet: Synthesis of PEGDMA-Oligo and PEGDMA-Oligo-Vanco Hydrogels We first validated the cleavage of the oligo probe (synthesized and purified by Integrated DNA Technologies) by MN (source: S. aureus strain ATCC 27735; Worthington Biochemical Corporation) prior to its conjugation with vancomycin or PEGDMA hydrogel.

    Techniques: Infection, ALP Assay, Staining

    Depiction of the PEGDMA-Oligo-Vanco hydrogel network and MN-triggered vancomycin release. (a) Oligonucleotide (Oligo) sequence modified with bifunctional end groups. (b) PEGDMA-Oligo hydrogel formation. (c) PEGDMA-Oligo-Vanco hydrogel formation and MN-triggered vancomycin release.

    Journal: ACS Central Science

    Article Title: Micrococcal-Nuclease-Triggered On-Demand Release of Vancomycin from Intramedullary Implant Coating Eradicates Staphylococcus aureus Infection in Mouse Femoral Canals

    doi: 10.1021/acscentsci.9b00870

    Figure Lengend Snippet: Depiction of the PEGDMA-Oligo-Vanco hydrogel network and MN-triggered vancomycin release. (a) Oligonucleotide (Oligo) sequence modified with bifunctional end groups. (b) PEGDMA-Oligo hydrogel formation. (c) PEGDMA-Oligo-Vanco hydrogel formation and MN-triggered vancomycin release.

    Article Snippet: Synthesis of PEGDMA-Oligo and PEGDMA-Oligo-Vanco Hydrogels We first validated the cleavage of the oligo probe (synthesized and purified by Integrated DNA Technologies) by MN (source: S. aureus strain ATCC 27735; Worthington Biochemical Corporation) prior to its conjugation with vancomycin or PEGDMA hydrogel.

    Techniques: Sequencing, Modification

    MN-triggered oligo cleavage and the antibacterial activities of PEGDMA-Oligo-Vanco hydrogel in vitro . (a) GPC traces of intact oligo (black) and oligo upon treatment with MN with (blue) and without (red) Ca 2+ . (b) Cumulative vancomycin (Vanco) release from PEGDMA-Oligo-Vanco hydrogel incubated with (black and blue) and without (red) MN. Differences at all given time points were significant ( p ≤ 0.0001). (c) Total bacterial counts after 24 and 48 h of Xen-29 S. aureus culture in LB media containing PEGDMA-Oligo-Vanco, washed PEGDMA-Oligo/Vanco, or PEGDMA-Oligo hydrogels ( n = 3; inset, corresponding IVIS image of the PEGDMA-Oligo-Vanco and PEGDMA-Oligo hydrogels retrieved after 48 h in S. aureus culture). (d) Photograph (left) and IVIS image (right) of an LB agar plate of Xen-29 S. aureus culture 24 h after placement of PEGDMA-Oligo-Vanco and PEGDMA-Oligo hydrogel discs ( n = 2 shown) over the agar plate. Error bars represent standard deviations. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001 (two-way ANOVA).

    Journal: ACS Central Science

    Article Title: Micrococcal-Nuclease-Triggered On-Demand Release of Vancomycin from Intramedullary Implant Coating Eradicates Staphylococcus aureus Infection in Mouse Femoral Canals

    doi: 10.1021/acscentsci.9b00870

    Figure Lengend Snippet: MN-triggered oligo cleavage and the antibacterial activities of PEGDMA-Oligo-Vanco hydrogel in vitro . (a) GPC traces of intact oligo (black) and oligo upon treatment with MN with (blue) and without (red) Ca 2+ . (b) Cumulative vancomycin (Vanco) release from PEGDMA-Oligo-Vanco hydrogel incubated with (black and blue) and without (red) MN. Differences at all given time points were significant ( p ≤ 0.0001). (c) Total bacterial counts after 24 and 48 h of Xen-29 S. aureus culture in LB media containing PEGDMA-Oligo-Vanco, washed PEGDMA-Oligo/Vanco, or PEGDMA-Oligo hydrogels ( n = 3; inset, corresponding IVIS image of the PEGDMA-Oligo-Vanco and PEGDMA-Oligo hydrogels retrieved after 48 h in S. aureus culture). (d) Photograph (left) and IVIS image (right) of an LB agar plate of Xen-29 S. aureus culture 24 h after placement of PEGDMA-Oligo-Vanco and PEGDMA-Oligo hydrogel discs ( n = 2 shown) over the agar plate. Error bars represent standard deviations. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001 (two-way ANOVA).

    Article Snippet: Synthesis of PEGDMA-Oligo and PEGDMA-Oligo-Vanco Hydrogels We first validated the cleavage of the oligo probe (synthesized and purified by Integrated DNA Technologies) by MN (source: S. aureus strain ATCC 27735; Worthington Biochemical Corporation) prior to its conjugation with vancomycin or PEGDMA hydrogel.

    Techniques: In Vitro, Gel Permeation Chromatography, Incubation

    Nucleoprotein filament dynamics on low sequence complexity ssDNA curtains. (A) Sequences of the two ssDNA oligonucleotides used for rolling circle replication. (B) Schematic of rolling circle replication (RCR) reaction. T4 DNA ligase ligates the template oligo to form a contiguous template strand. Next, phi29 DNA polymerase catalyzes the synthesis of long ssDNA molecules. (C) Agarose gel of several time points along the RCR synthesis reaction. The primer oligonucleotide was 32 P labeled on the 5 ′ -terminus phosphate ( gold star ). (D) Wide-field image of a microfabricated barrier set with double-tethered ssDNA curtains coated with RPA-TagRFP ( magenta ). Arrows and circles denote chromium barriers and pedestals, respectively. (E) Illustration and kymograph showing a single ssDNA molecule coated with ATTO488-RAD51(C319S) ( green ) replaced by RPA-TagRFP ( magenta ). Yellow dashed line denotes the injection of RPA–TagRFP into the flowcell. Buffer controls indicate when the buffer flow was toggled off and on to show that the florescent proteins retract to the Cr barriers simultaneously with the ssDNA molecule. This indicates that RAD51 and RPA are on the ssDNA molecule. Panel A: Adapted from Lee, K. S., Marciel, A. B., Kozlov, A. G., Schroeder, C. M., Lohman, T. M., Ha, T. (2014). Ultrafast redistribution of E. coli SSB along long single-stranded DNA via intersegment transfer. Journal of Molecular Biology, 426 , 2413 – 2421.

    Journal: Methods in enzymology

    Article Title: Next-Generation DNA Curtains for Single-Molecule Studies of Homologous Recombination

    doi: 10.1016/bs.mie.2017.03.011

    Figure Lengend Snippet: Nucleoprotein filament dynamics on low sequence complexity ssDNA curtains. (A) Sequences of the two ssDNA oligonucleotides used for rolling circle replication. (B) Schematic of rolling circle replication (RCR) reaction. T4 DNA ligase ligates the template oligo to form a contiguous template strand. Next, phi29 DNA polymerase catalyzes the synthesis of long ssDNA molecules. (C) Agarose gel of several time points along the RCR synthesis reaction. The primer oligonucleotide was 32 P labeled on the 5 ′ -terminus phosphate ( gold star ). (D) Wide-field image of a microfabricated barrier set with double-tethered ssDNA curtains coated with RPA-TagRFP ( magenta ). Arrows and circles denote chromium barriers and pedestals, respectively. (E) Illustration and kymograph showing a single ssDNA molecule coated with ATTO488-RAD51(C319S) ( green ) replaced by RPA-TagRFP ( magenta ). Yellow dashed line denotes the injection of RPA–TagRFP into the flowcell. Buffer controls indicate when the buffer flow was toggled off and on to show that the florescent proteins retract to the Cr barriers simultaneously with the ssDNA molecule. This indicates that RAD51 and RPA are on the ssDNA molecule. Panel A: Adapted from Lee, K. S., Marciel, A. B., Kozlov, A. G., Schroeder, C. M., Lohman, T. M., Ha, T. (2014). Ultrafast redistribution of E. coli SSB along long single-stranded DNA via intersegment transfer. Journal of Molecular Biology, 426 , 2413 – 2421.

    Article Snippet: TE buffer: 10m M Tris–HCl [pH 8.0]; 0.1m M EDTA RAD51 buffer: 40m M Tris–HCl [pH 8.0]; 1m M MgCl2 ; 5m M CaCl2 ; 100m M KCl; 1m M DTT; 1m M ATP; 0.2 mgmL−1 BSA; 1m M Trolox (Sigma-Aldrich); 1.0% glucose (w/v); 500units catalase (Sigma-Aldrich); 70units glucose oxidase (Sigma-Aldrich) 10× T4 DNA ligase reaction buffer (B0202S; NEB) T4 DNA ligase (M0202; NEB) Primer oligo (/Biosg/TC TCC TCC TTC T—HPLC purified; Integrated DNA Technologies) Template oligo (/5Phos/AG GAG AAA AAG AAA AAA AGA AAA GAA GG—PAGE purified; Integrated DNA Technologies) Nuclease-free water BSA, Molecular Biology Grade (B9000S; NEB) Thermocycler (Mastercycler pro S; Eppendorf ) 10× phi29 DNA polymerase reaction buffer (B0269S; NEB) phi29 DNA polymerase (homemade 5 μ M stock) Deoxynucleotide (dNTP) solution set (N0446S; NEB)

    Techniques: Sequencing, Agarose Gel Electrophoresis, Labeling, Recombinase Polymerase Amplification, Injection, Flow Cytometry

    lapsyn is expressed in glia. a The schematic shows the lapsyn genomic locus, the lapsyn ZG1 deletion, and Mi{MIC}lapsyn MI01316 and PBac{SAstopDsRed} LL00906 insertions. pA polyadenylation site, SA splicing acceptor site. To generate lapsyn 2xHA-CR13.1 , two C-terminal HA epitope tags were inserted into the endogenous locus following a Cas9-induced DSB and HDR with a single-stranded oligo donor nucleotide ( ssODN ) containing flanking 50-nt homology arms. b For whole animal rescue experiments of lapsyn ZG1 embryonic lethality, UAS-lapsyn was expressed in neurons ( elav C155 -Gal4 , blue bars , 224 recovered first instar (1L) larvae of 1210 embryos) or in glia ( repo-Gal4 , green bars , 529 recovered 1L larvae of 2380 embryos). GFP-negative rescue flies were compared to controls carrying CyO Dfd-YFP balancer chromosomes, corresponding to all other surviving progeny (heterozygous, or heterozygous and overexpressing lapsyn , light blue and green bars ). Rescue of viability of 1L larvae ( left panel ) is shown as percentage of expected progeny. Rescue of viability of third instar (3L) larvae, early and late pupae and adults is shown as percentage of surviving progeny in “rescue” and “control” populations followed from the 1L stage onwards. Histograms show data points as means ± standard deviation error bars ( n = 3 independent experiments). Unpaired, two-tailed Student’s t- test assuming normality but unequal standard deviation (1L: P = 0.879; 3L: P = 0.1027, P = 0.6796; early pupae: P = 0.006, P = 0.9369; late pupae: P = 0.0042, P = 0.9921; adult: P = 0.0047, P = 0.8668). NS not significant, ** P

    Journal: Nature Communications

    Article Title: Lapsyn controls branch extension and positioning of astrocyte-like glia in the Drosophila optic lobe

    doi: 10.1038/s41467-017-00384-z

    Figure Lengend Snippet: lapsyn is expressed in glia. a The schematic shows the lapsyn genomic locus, the lapsyn ZG1 deletion, and Mi{MIC}lapsyn MI01316 and PBac{SAstopDsRed} LL00906 insertions. pA polyadenylation site, SA splicing acceptor site. To generate lapsyn 2xHA-CR13.1 , two C-terminal HA epitope tags were inserted into the endogenous locus following a Cas9-induced DSB and HDR with a single-stranded oligo donor nucleotide ( ssODN ) containing flanking 50-nt homology arms. b For whole animal rescue experiments of lapsyn ZG1 embryonic lethality, UAS-lapsyn was expressed in neurons ( elav C155 -Gal4 , blue bars , 224 recovered first instar (1L) larvae of 1210 embryos) or in glia ( repo-Gal4 , green bars , 529 recovered 1L larvae of 2380 embryos). GFP-negative rescue flies were compared to controls carrying CyO Dfd-YFP balancer chromosomes, corresponding to all other surviving progeny (heterozygous, or heterozygous and overexpressing lapsyn , light blue and green bars ). Rescue of viability of 1L larvae ( left panel ) is shown as percentage of expected progeny. Rescue of viability of third instar (3L) larvae, early and late pupae and adults is shown as percentage of surviving progeny in “rescue” and “control” populations followed from the 1L stage onwards. Histograms show data points as means ± standard deviation error bars ( n = 3 independent experiments). Unpaired, two-tailed Student’s t- test assuming normality but unequal standard deviation (1L: P = 0.879; 3L: P = 0.1027, P = 0.6796; early pupae: P = 0.006, P = 0.9369; late pupae: P = 0.0042, P = 0.9921; adult: P = 0.0047, P = 0.8668). NS not significant, ** P

    Article Snippet: A single-stranded oligo donor nucleotide (ssODN, 169-nt) that contained two 50-nt homology arms flanking the sequences of two HA epitope tags separated by a GGGS spacer, was synthesized by IDT (Integrated DNA Technologies): 5′-ACAACCGTCAGCCGGAGGACGAGCCTCTGCACTGTGATATTGCCCGAAAATACCCATACGACGTCCCTGACTATGCGGGAGGTGGGAGTTATCCCTATGATG TGCCCGATTACGCTTAGCACTTTAGTTAGTTAATTAGTTGCTTAGTTAGTTAGTTAGTCTTAGGTGC-3′.

    Techniques: Standard Deviation, Two Tailed Test

    EMSA of DNA-binding activities in the 180-bp Lhcb 1 promoter region (−367 to −188 bp) represented sequentially by Oligo 1 to 6, as well as the competition of the binding activities by specific (unlabeled oligo) and nonspecific DNA fragments. Protein samples were extracted from HL- and LL-acclimated culture and fractionated by a single step with 50% (NH 4 ) 2 SO 4 . All binding reactions contained 1 μ g of poly(dI.dC).poly(dI.dC). SS DNA, Sonicated salmon sperm DNA fragments.

    Journal: Plant Physiology

    Article Title: Plastid Regulation of Lhcb1 Transcription in the Chlorophyte Alga Dunaliella tertiolecta 1

    doi: 10.1104/pp.104.038919

    Figure Lengend Snippet: EMSA of DNA-binding activities in the 180-bp Lhcb 1 promoter region (−367 to −188 bp) represented sequentially by Oligo 1 to 6, as well as the competition of the binding activities by specific (unlabeled oligo) and nonspecific DNA fragments. Protein samples were extracted from HL- and LL-acclimated culture and fractionated by a single step with 50% (NH 4 ) 2 SO 4 . All binding reactions contained 1 μ g of poly(dI.dC).poly(dI.dC). SS DNA, Sonicated salmon sperm DNA fragments.

    Article Snippet: Primers and oligo DNA were synthesized and purified by Integrated DNA Technologies (Coralville, IA).

    Techniques: Binding Assay, Sonication

    Schematic presentation of the tentative multiple and repetitive binding sites in D. tertiolecta Lhcb1 180-bp promoter region (from −367 to −188 bp relative to the starting codon). Six oligo DNA were constructed within the promoter and used as unlabeled competitors or labeled probes in EMSA.

    Journal: Plant Physiology

    Article Title: Plastid Regulation of Lhcb1 Transcription in the Chlorophyte Alga Dunaliella tertiolecta 1

    doi: 10.1104/pp.104.038919

    Figure Lengend Snippet: Schematic presentation of the tentative multiple and repetitive binding sites in D. tertiolecta Lhcb1 180-bp promoter region (from −367 to −188 bp relative to the starting codon). Six oligo DNA were constructed within the promoter and used as unlabeled competitors or labeled probes in EMSA.

    Article Snippet: Primers and oligo DNA were synthesized and purified by Integrated DNA Technologies (Coralville, IA).

    Techniques: Binding Assay, Construct, Labeling

    Scheme of in vitro ligation selection and sequencing library preparation. For each ligase selected library, an equal amount of 4 random RNA oligos containing a constant region (solid line), a randomized region (wavy line) and a known 3′-nt were combined to make a random oligo pool and used as substrates in a ligation reaction with pre-adenylated SR1 DNA adapter using a specific T4 RNA ligase. The ligated products were reverse transcribed and amplified to introduce the required primer regions for Ion Torrent sequencing. To determine the sequence content of the random RNA oligo pool, each of the four RNA oligos was sequenced independently. First, the oligos were poly A tailed for the random RNA oligo U, C and G or poly C tailed for the random RNA oligo A using poly(A) polymerase. The tailed RNA oligos were then reverse transcribed using primers complementary to the polymer tails ( Supplementary Table S1 ). The cDNA libraries were amplified and processed in the same manner as the ligase selected libraries described above.

    Journal: Nucleic Acids Research

    Article Title: Structural bias in T4 RNA ligase-mediated 3?-adapter ligation

    doi: 10.1093/nar/gkr1263

    Figure Lengend Snippet: Scheme of in vitro ligation selection and sequencing library preparation. For each ligase selected library, an equal amount of 4 random RNA oligos containing a constant region (solid line), a randomized region (wavy line) and a known 3′-nt were combined to make a random oligo pool and used as substrates in a ligation reaction with pre-adenylated SR1 DNA adapter using a specific T4 RNA ligase. The ligated products were reverse transcribed and amplified to introduce the required primer regions for Ion Torrent sequencing. To determine the sequence content of the random RNA oligo pool, each of the four RNA oligos was sequenced independently. First, the oligos were poly A tailed for the random RNA oligo U, C and G or poly C tailed for the random RNA oligo A using poly(A) polymerase. The tailed RNA oligos were then reverse transcribed using primers complementary to the polymer tails ( Supplementary Table S1 ). The cDNA libraries were amplified and processed in the same manner as the ligase selected libraries described above.

    Article Snippet: Adenylation of DNA oligos The DNA adapters were synthesized by Integrated DNA Technologies (Iowa, USA) with a phosphorylated 5′-end and a blocking amino group at the 3′-end.

    Techniques: In Vitro, Ligation, Selection, Sequencing, Amplification, Introduce

    Quality and reproducibility of the experiment shown in Figure 5 . ( a ) Polysome profile of HEK293T cells transfected with the indicated oligonucleotides. This experiment corresponds to the replica_1 used for RNA-seq, indicating fractions pooled as monosomes or polysomes. The bottom panel shows a western blot analysis of the resulting fractions probed with anti-eS6 antibody. ( b ) Analysis of correlation between replicas using a normalized number of reads for every mRNA in the monosomal and polysomal samples. ( c ) Changes in mRNA abundance between oligo 4 and VIC–oligo-4-transfected cells. Data are the average from two replicates. ( d ) Enrichment in KEGG pathways detected in the ‘TE down’ group of mRNAs. The p-value and enrichment factor for each term are indicated.

    Journal: eLife

    Article Title: An mRNA-binding channel in the ES6S region of the translation 48S-PIC promotes RNA unwinding and scanning

    doi: 10.7554/eLife.48246

    Figure Lengend Snippet: Quality and reproducibility of the experiment shown in Figure 5 . ( a ) Polysome profile of HEK293T cells transfected with the indicated oligonucleotides. This experiment corresponds to the replica_1 used for RNA-seq, indicating fractions pooled as monosomes or polysomes. The bottom panel shows a western blot analysis of the resulting fractions probed with anti-eS6 antibody. ( b ) Analysis of correlation between replicas using a normalized number of reads for every mRNA in the monosomal and polysomal samples. ( c ) Changes in mRNA abundance between oligo 4 and VIC–oligo-4-transfected cells. Data are the average from two replicates. ( d ) Enrichment in KEGG pathways detected in the ‘TE down’ group of mRNAs. The p-value and enrichment factor for each term are indicated.

    Article Snippet: After UV crosslinking at 360 nm, the WRF was denatured in 500 μl buffer D (Tris-HCl 30 mM [pH 7.5], 0.5 M LiCl, 0.5% LiDS, 0.5 mM EDTA and 1 mM DTT) and poly(A)+ mRNA was captured with oligo(dT) magnetic beads (NEB) under denaturing conditions.

    Techniques: Transfection, RNA Sequencing Assay, Western Blot

    Effect of VIC–oligo 4 on protein crosslinking in 48S complexes assembled with unstructured or SV-DLP n27 mRNAs. The amount of [ 32 P]-mRNA bound to WRF is indicated (upper panel), showing the pattern of protein crosslinking with the indicated mRNAs in the absence and presence of VIC–oligo 4. The unresolved eIF3g and eIF4A bands are shown (lower panel).

    Journal: eLife

    Article Title: An mRNA-binding channel in the ES6S region of the translation 48S-PIC promotes RNA unwinding and scanning

    doi: 10.7554/eLife.48246

    Figure Lengend Snippet: Effect of VIC–oligo 4 on protein crosslinking in 48S complexes assembled with unstructured or SV-DLP n27 mRNAs. The amount of [ 32 P]-mRNA bound to WRF is indicated (upper panel), showing the pattern of protein crosslinking with the indicated mRNAs in the absence and presence of VIC–oligo 4. The unresolved eIF3g and eIF4A bands are shown (lower panel).

    Article Snippet: After UV crosslinking at 360 nm, the WRF was denatured in 500 μl buffer D (Tris-HCl 30 mM [pH 7.5], 0.5 M LiCl, 0.5% LiDS, 0.5 mM EDTA and 1 mM DTT) and poly(A)+ mRNA was captured with oligo(dT) magnetic beads (NEB) under denaturing conditions.

    Techniques:

    mRNA threading into the ES6S region slows down scanning but makes it more processive. ( a ) Effect of FITC-oligo 4 on the translation of Luc mRNAs with different 5′ UTRs in RRL. Translation mixtures were incubated for 90 min, which represented the endpoint measurement because no further increase in luc activity was detected. Data are represented as the mean ± SD from at least three independent experiments. ( b ) Luc activity accumulation in continuously recording experiments programmed with the indicated mRNAs. Measurements were taken every 3 min: gray line, no oligo; black line, +FITC–oligo 4. Hipp was added to the indicated samples at a concentration of 2 μM (dashed line). ( c ) Estimates of full translation time (FTT) for 5′ UTR G-less and 5′ UTR-SL20 mRNAs, and the effect of FITC–oligo 4 and hipp on FTT. Data from panel (B) were processed as described before ( Vassilenko et al., 2011 ). The determined FTT values were: 5′ UTR G-less = 9.53 min; 5′ UTR G-less+FITC–oligo 4 = 7.89 min; 5′ UTR-SL20 = 17.57 min; 5′ UTR-SL20+FITC–oligo 4 = 17.56 min; 5′ UTR-SL20+hipp = 19.44 min. ( d ) Synergistic inhibitory effect of VIC–oligo 4 and hipp on translation of 5′UTR SL30-Luc and 5′ UTR G4-1-Luc mRNAs in RRL. Translation mixtures were preincubated with 6 μM of VIC–oligo 4 and with increasing concentrations of hipp for 5 min. Then, mRNAs were added and measurements were taken 90 min later; the calculated combination index (CI) for each mRNA is indicated.

    Journal: eLife

    Article Title: An mRNA-binding channel in the ES6S region of the translation 48S-PIC promotes RNA unwinding and scanning

    doi: 10.7554/eLife.48246

    Figure Lengend Snippet: mRNA threading into the ES6S region slows down scanning but makes it more processive. ( a ) Effect of FITC-oligo 4 on the translation of Luc mRNAs with different 5′ UTRs in RRL. Translation mixtures were incubated for 90 min, which represented the endpoint measurement because no further increase in luc activity was detected. Data are represented as the mean ± SD from at least three independent experiments. ( b ) Luc activity accumulation in continuously recording experiments programmed with the indicated mRNAs. Measurements were taken every 3 min: gray line, no oligo; black line, +FITC–oligo 4. Hipp was added to the indicated samples at a concentration of 2 μM (dashed line). ( c ) Estimates of full translation time (FTT) for 5′ UTR G-less and 5′ UTR-SL20 mRNAs, and the effect of FITC–oligo 4 and hipp on FTT. Data from panel (B) were processed as described before ( Vassilenko et al., 2011 ). The determined FTT values were: 5′ UTR G-less = 9.53 min; 5′ UTR G-less+FITC–oligo 4 = 7.89 min; 5′ UTR-SL20 = 17.57 min; 5′ UTR-SL20+FITC–oligo 4 = 17.56 min; 5′ UTR-SL20+hipp = 19.44 min. ( d ) Synergistic inhibitory effect of VIC–oligo 4 and hipp on translation of 5′UTR SL30-Luc and 5′ UTR G4-1-Luc mRNAs in RRL. Translation mixtures were preincubated with 6 μM of VIC–oligo 4 and with increasing concentrations of hipp for 5 min. Then, mRNAs were added and measurements were taken 90 min later; the calculated combination index (CI) for each mRNA is indicated.

    Article Snippet: After UV crosslinking at 360 nm, the WRF was denatured in 500 μl buffer D (Tris-HCl 30 mM [pH 7.5], 0.5 M LiCl, 0.5% LiDS, 0.5 mM EDTA and 1 mM DTT) and poly(A)+ mRNA was captured with oligo(dT) magnetic beads (NEB) under denaturing conditions.

    Techniques: Incubation, Activity Assay, Concentration Assay

    Effect of 5' UTR length of luc mRNAs on the sensitivity to VIC-oligo 4-mediated translational block. ( a ) Effect of 5′ UTR length on cap-dependent translation ofluc mRNAs in the presence of VIC-oligo 4. Data are the mean of two independent experiments performed in MEF cells as described in Figure 4a . ( b ) Comparative analysis of the effect of oligo 4, VIC–oligo C and VIC–oligo 4 on the translation of the indicated mRNAs. Data are the mean ± SD from at least four independent experiments in MEF cells. ( c ) Effect of VIC–oligo 4 on the translation of poliovirus (PV) mRNA. HeLa cells were transfected with the indicated oligonucleotides, and infected 12 hr later with PV1 (Mahoney strain) at a multiplicity of infection (MOI) of 10 pfu/cell. The cultures were metabolically labeled with [ 35 S]-Met at 6 hr post-infection and analyzed as described in the Materials and methods; SYPRO staining was included as the loading control.

    Journal: eLife

    Article Title: An mRNA-binding channel in the ES6S region of the translation 48S-PIC promotes RNA unwinding and scanning

    doi: 10.7554/eLife.48246

    Figure Lengend Snippet: Effect of 5' UTR length of luc mRNAs on the sensitivity to VIC-oligo 4-mediated translational block. ( a ) Effect of 5′ UTR length on cap-dependent translation ofluc mRNAs in the presence of VIC-oligo 4. Data are the mean of two independent experiments performed in MEF cells as described in Figure 4a . ( b ) Comparative analysis of the effect of oligo 4, VIC–oligo C and VIC–oligo 4 on the translation of the indicated mRNAs. Data are the mean ± SD from at least four independent experiments in MEF cells. ( c ) Effect of VIC–oligo 4 on the translation of poliovirus (PV) mRNA. HeLa cells were transfected with the indicated oligonucleotides, and infected 12 hr later with PV1 (Mahoney strain) at a multiplicity of infection (MOI) of 10 pfu/cell. The cultures were metabolically labeled with [ 35 S]-Met at 6 hr post-infection and analyzed as described in the Materials and methods; SYPRO staining was included as the loading control.

    Article Snippet: After UV crosslinking at 360 nm, the WRF was denatured in 500 μl buffer D (Tris-HCl 30 mM [pH 7.5], 0.5 M LiCl, 0.5% LiDS, 0.5 mM EDTA and 1 mM DTT) and poly(A)+ mRNA was captured with oligo(dT) magnetic beads (NEB) under denaturing conditions.

    Techniques: Blocking Assay, Transfection, Infection, Metabolic Labelling, Labeling, Staining

    CaRF binds DNA directly. Human CaRF was expressed in bacteria (E. Coli hCaRF) or synthesized in vitro by TNT (hCaRF). Rabbit reticulocyte lysate without CaRF expression was used as control. 2µL of CaRF protein or TNT control was incubated with radiolabeled CaRE1 oligos in the absence (-) or presence of a 50-fold molar excess of competing unlabeled wildtype (W) or mutant (M) CaRE1 probe. Unbound probe is at the bottom of the gel. Arrowhead indicates the complex between CaRF and CaRE1.

    Journal: PLoS ONE

    Article Title: Genome-Wide Identification of Calcium-Response Factor (CaRF) Binding Sites Predicts a Role in Regulation of Neuronal Signaling Pathways

    doi: 10.1371/journal.pone.0010870

    Figure Lengend Snippet: CaRF binds DNA directly. Human CaRF was expressed in bacteria (E. Coli hCaRF) or synthesized in vitro by TNT (hCaRF). Rabbit reticulocyte lysate without CaRF expression was used as control. 2µL of CaRF protein or TNT control was incubated with radiolabeled CaRE1 oligos in the absence (-) or presence of a 50-fold molar excess of competing unlabeled wildtype (W) or mutant (M) CaRE1 probe. Unbound probe is at the bottom of the gel. Arrowhead indicates the complex between CaRF and CaRE1.

    Article Snippet: Oligos were incubated with TNT hCaRF or a control TNT master mix and immunoprecipitated with the M2 anti-FLAG epitope antibody (Sigma, St. Louis, MO).

    Techniques: Synthesized, In Vitro, Expressing, Incubation, Mutagenesis

    Identification of a consensus CaRF binding element. hCaRF synthesized by TNT (hCaRF) or control rabbit reticulocyte without CaRF (control) was used to coprecipitate oligonucleotides from a library of random 16mers. a) After four rounds of enrichment and amplification, the final pulldown from each sample was radiolabeled and mixed with hCaRF for evaluation by EMSA. Equal amounts of radiolabeled oligos are present in each pool (gray arrowhead), however a CaRF binding band is retarded only from the pool that was isolated by coprecipitation with hCaRF (black arrowhead). b) WebLogo ( http://weblogo.berkeley.edu/ ) representation of the cCaRE consensus motif derived from the 62 sequences in Table S3 . The position of the bases is indicated along the bottom from 1–16, and the height of the letters indicates the enrichment of that base at each position. If all four bases were equally likely to be present at any position, no base is indicated. c) Alignment of the cCaRE and CaRE1 motifs. Black indicates bases that are conserved between the elements, and gray shows bases that vary. Y = C/T, S = C/G, and N = any base. d) Comparison of the affinity of CaRF for CaRE1 and cCaRE. A constant amount of hCaRF was bound to radiolabeled CaRE1 (B) or cCaRE (C) probes and the relative affinity of the interactions were assessed by competition EMSA upon the addition of a 150, 100, or 50-fold molar excess of unlabeled CaRE1 probe. The band retarded upon CaRF binding is indicated by the arrowhead.

    Journal: PLoS ONE

    Article Title: Genome-Wide Identification of Calcium-Response Factor (CaRF) Binding Sites Predicts a Role in Regulation of Neuronal Signaling Pathways

    doi: 10.1371/journal.pone.0010870

    Figure Lengend Snippet: Identification of a consensus CaRF binding element. hCaRF synthesized by TNT (hCaRF) or control rabbit reticulocyte without CaRF (control) was used to coprecipitate oligonucleotides from a library of random 16mers. a) After four rounds of enrichment and amplification, the final pulldown from each sample was radiolabeled and mixed with hCaRF for evaluation by EMSA. Equal amounts of radiolabeled oligos are present in each pool (gray arrowhead), however a CaRF binding band is retarded only from the pool that was isolated by coprecipitation with hCaRF (black arrowhead). b) WebLogo ( http://weblogo.berkeley.edu/ ) representation of the cCaRE consensus motif derived from the 62 sequences in Table S3 . The position of the bases is indicated along the bottom from 1–16, and the height of the letters indicates the enrichment of that base at each position. If all four bases were equally likely to be present at any position, no base is indicated. c) Alignment of the cCaRE and CaRE1 motifs. Black indicates bases that are conserved between the elements, and gray shows bases that vary. Y = C/T, S = C/G, and N = any base. d) Comparison of the affinity of CaRF for CaRE1 and cCaRE. A constant amount of hCaRF was bound to radiolabeled CaRE1 (B) or cCaRE (C) probes and the relative affinity of the interactions were assessed by competition EMSA upon the addition of a 150, 100, or 50-fold molar excess of unlabeled CaRE1 probe. The band retarded upon CaRF binding is indicated by the arrowhead.

    Article Snippet: Oligos were incubated with TNT hCaRF or a control TNT master mix and immunoprecipitated with the M2 anti-FLAG epitope antibody (Sigma, St. Louis, MO).

    Techniques: Binding Assay, Synthesized, Amplification, Isolation, Derivative Assay

    Complex gangliosides are required for correct CD18 recruitment to lipid microdomains. (A) Lipid microdomains were isolated from WT and B4galnt1 −/− mice Mφs. Fractions from sucrose gradients were probed with peroxidase-conjugated antibodies to CD14 or to CD18 (Becton Dickinson). Peroxidase-labeled CtxB (Sigma) was used to detect GM1. (B) Densitometric analysis of fractions corresponding to lipids microdomains was performed using ImageJ and the relative values from one experiment are presented. Experiments were performed three times with similar results (*p

    Journal: Cellular microbiology

    Article Title: Host membrane glycosphingolipids and lipid microdomains facilitate Histoplasma capsulatum internalization by macrophages.

    doi: 10.1111/cmi.12976

    Figure Lengend Snippet: Complex gangliosides are required for correct CD18 recruitment to lipid microdomains. (A) Lipid microdomains were isolated from WT and B4galnt1 −/− mice Mφs. Fractions from sucrose gradients were probed with peroxidase-conjugated antibodies to CD14 or to CD18 (Becton Dickinson). Peroxidase-labeled CtxB (Sigma) was used to detect GM1. (B) Densitometric analysis of fractions corresponding to lipids microdomains was performed using ImageJ and the relative values from one experiment are presented. Experiments were performed three times with similar results (*p

    Article Snippet: GM1-oligosaccharides (oligo-GM1) were generated by treatment of GM1 with a specific ceramide glycanase (Calbiochem) ( ).

    Techniques: Isolation, Mouse Assay, Labeling

    T22‐ GFP ‐H6‐FdU prevents metastasis in the M5 patient‐derived model in a CXCR 4‐dependent manner T22‐GFP‐H6‐FdU prevents metastases in the CXCR4 + patient‐derived M5 model by potently reducing the total and mean number of liver, lung, and peritoneal Mets, as recorded in H E‐stained histology sections at the end of treatment, in comparison with free oligo‐FdU or Buffer treatment. In contrast, the number of LN Mets is not reduced after T22‐GFP‐H6‐FdU or free oligo‐FdU administration ( N = 6 mice per Buffer group; N = 7 mice per free oligo‐FdU group; and N = 8 mice per T22‐GFP‐H6‐FdU group; 3 samples/mouse). Data expressed as mean ± s.e.m. Comparison of metastatic foci number by site between groups: (B: Buffer; F: free oligo‐FdU; T‐F: T22‐GFP‐H6‐FdU). P ‐values for statistical differences: T‐F vs. B: * P = 0.006 for LN Mets; * P = 0.001 for LV Mets; * P = 0.003 for LG Mets; * P = 0.001 for PTN Mets (green lines), F vs. B: * P = 0.015 for PTN Mets (red line), T‐F vs. F: * P = 0.001 for LV Mets, * P = 0.022 for PTN Mets (black line). Mann–Whitney U ‐test. See Table 1 for the recording of the percent of metastasis‐free mice (mice with undetectable metastases at the end of treatment, and therefore with an absence of CXCR4 + tumor cells) after T22‐GFP‐H6‐FdU treatment. Also, Table 1 describes the reduction in mean foci number and foci size in metastasis‐positive mice after T22‐GFP‐H6‐FdU treatment, as compared to Buffer or free oligo‐FdU. T22‐GFP‐H6‐FdU induces a higher reduction in CXCR4 + cancer cell fraction (CXCR4 + CCF) in liver, lung, and peritoneal metastatic tissue, at the end of treatment, than free oligo‐FdU, as measured by anti‐CXCR4 IHC. In contrast, T22‐GFP‐H6‐FdU or free oligo‐FdU does not reduce the CXCR4 + CCF in LN Mets or primary tumor tissue after therapy ( N = 6 mice per Buffer group; N = 7 mice per free oligo‐FdU group; and N = 8 mice per T22‐GFP‐H6‐FdU group; 3 samples/mouse). Data expressed as mean ± s.e.m. Comparison of remaining CXCR4 + CCF by site between groups: (B: Buffer; F: free oligo‐FdU; T‐F: T22‐GFP‐H6‐FdU). P ‐values for statistical differences: T‐F vs. B: * P = 0.012 for LV Mets, * P = 0.027 for LG Mets; * P = 0.038 for PTN Mets (green lines), T‐F vs. F: * P = 0.013 for LV Mets (black line). Mann–Whitney U ‐test. Representative CXCR4 IHC images of the reduction in CXCR4 + CCF induced by T22‐GFP‐H6‐FdU (or its absence in free oligo‐FdU mice) at the end of treatment, in the M5 patient‐derived CRC model, which quantitation is reported in panel (B). In the M5 model, the highest reduction in foci number and size occurs in liver metastases, which show the highest reduction in CXCR4 + CCF. Note the correlation between the reduction in CXCR4 + CCF induced by T22‐GFP‐H6‐FdU and its antimetastatic effect at each site, measured as number of liver, lung, or peritoneal Mets (Table 1 ) in the M5 metastatic CRC models [as it happens in the SW1417 model ( Appendix Fig S8 )]. Note in both Table 1 and Appendix Table S1 that 83% of mice in the T22‐GFP‐H6‐FdU group remained free of liver, lung, or peritoneal metastases at the end of treatment in the SW1417 CRC model, whereas in the M5 CRC model these parameters were in the 38–63% range. Scale bar, 100 μm. Asterisks, tumor tissue; N, normal tissue; LN, lymphatic metastasis.

    Journal: EMBO Molecular Medicine

    Article Title: Selective depletion of metastatic stem cells as therapy for human colorectal cancer

    doi: 10.15252/emmm.201708772

    Figure Lengend Snippet: T22‐ GFP ‐H6‐FdU prevents metastasis in the M5 patient‐derived model in a CXCR 4‐dependent manner T22‐GFP‐H6‐FdU prevents metastases in the CXCR4 + patient‐derived M5 model by potently reducing the total and mean number of liver, lung, and peritoneal Mets, as recorded in H E‐stained histology sections at the end of treatment, in comparison with free oligo‐FdU or Buffer treatment. In contrast, the number of LN Mets is not reduced after T22‐GFP‐H6‐FdU or free oligo‐FdU administration ( N = 6 mice per Buffer group; N = 7 mice per free oligo‐FdU group; and N = 8 mice per T22‐GFP‐H6‐FdU group; 3 samples/mouse). Data expressed as mean ± s.e.m. Comparison of metastatic foci number by site between groups: (B: Buffer; F: free oligo‐FdU; T‐F: T22‐GFP‐H6‐FdU). P ‐values for statistical differences: T‐F vs. B: * P = 0.006 for LN Mets; * P = 0.001 for LV Mets; * P = 0.003 for LG Mets; * P = 0.001 for PTN Mets (green lines), F vs. B: * P = 0.015 for PTN Mets (red line), T‐F vs. F: * P = 0.001 for LV Mets, * P = 0.022 for PTN Mets (black line). Mann–Whitney U ‐test. See Table 1 for the recording of the percent of metastasis‐free mice (mice with undetectable metastases at the end of treatment, and therefore with an absence of CXCR4 + tumor cells) after T22‐GFP‐H6‐FdU treatment. Also, Table 1 describes the reduction in mean foci number and foci size in metastasis‐positive mice after T22‐GFP‐H6‐FdU treatment, as compared to Buffer or free oligo‐FdU. T22‐GFP‐H6‐FdU induces a higher reduction in CXCR4 + cancer cell fraction (CXCR4 + CCF) in liver, lung, and peritoneal metastatic tissue, at the end of treatment, than free oligo‐FdU, as measured by anti‐CXCR4 IHC. In contrast, T22‐GFP‐H6‐FdU or free oligo‐FdU does not reduce the CXCR4 + CCF in LN Mets or primary tumor tissue after therapy ( N = 6 mice per Buffer group; N = 7 mice per free oligo‐FdU group; and N = 8 mice per T22‐GFP‐H6‐FdU group; 3 samples/mouse). Data expressed as mean ± s.e.m. Comparison of remaining CXCR4 + CCF by site between groups: (B: Buffer; F: free oligo‐FdU; T‐F: T22‐GFP‐H6‐FdU). P ‐values for statistical differences: T‐F vs. B: * P = 0.012 for LV Mets, * P = 0.027 for LG Mets; * P = 0.038 for PTN Mets (green lines), T‐F vs. F: * P = 0.013 for LV Mets (black line). Mann–Whitney U ‐test. Representative CXCR4 IHC images of the reduction in CXCR4 + CCF induced by T22‐GFP‐H6‐FdU (or its absence in free oligo‐FdU mice) at the end of treatment, in the M5 patient‐derived CRC model, which quantitation is reported in panel (B). In the M5 model, the highest reduction in foci number and size occurs in liver metastases, which show the highest reduction in CXCR4 + CCF. Note the correlation between the reduction in CXCR4 + CCF induced by T22‐GFP‐H6‐FdU and its antimetastatic effect at each site, measured as number of liver, lung, or peritoneal Mets (Table 1 ) in the M5 metastatic CRC models [as it happens in the SW1417 model ( Appendix Fig S8 )]. Note in both Table 1 and Appendix Table S1 that 83% of mice in the T22‐GFP‐H6‐FdU group remained free of liver, lung, or peritoneal metastases at the end of treatment in the SW1417 CRC model, whereas in the M5 CRC model these parameters were in the 38–63% range. Scale bar, 100 μm. Asterisks, tumor tissue; N, normal tissue; LN, lymphatic metastasis.

    Article Snippet: The nanoconjugate was synthesized by covalent binding of the targeting vector and oligo‐FdU, a pentameric oligonucleotide of Floxuridine (5‐Fluoro‐2′‐deoxyuridine; Sigma‐Aldrich Chemie GmbH, Steinheim, Germany), both functionalized before their conjugation.

    Techniques: Derivative Assay, Staining, Mouse Assay, MANN-WHITNEY, Immunohistochemistry, Quantitation Assay

    T22‐ GFP ‐H6‐FdU‐induced reduction in tumor re‐initiation capacity and blockade of tumor emboli intravasation in the CXCR 4 + patient‐derived M5 model Reduction in the number of formed spheroids (white arrows, optical microscope) generated by 1 × 10 6 disaggregated cells (cultured in stem cell‐conditioned media and low‐adhesion plates) obtained from CXCR4 + M5 subcutaneous tumors, 24 h after 100 μg T22‐GFP‐H6‐FdU intravenous doses, for 2 consecutive days, as compared to Buffer‐treated or free oligo‐FdU‐treated mice (mean ± s.e.m., N = 8; 2 mice/group; 4 plates/mouse). Scale bar, 100 μm. Comparison of spheroid formation between groups: (B: Buffer; F: free oligo‐FdU; T‐F: T22‐GFP‐H6‐FdU). P ‐values for statistical differences: T‐F vs. B, ** P = 0.001 (green line, Panel B); F vs. B, * P = 0.012 (red line); T‐F vs. F, ** P = 0.001 (black line). Mann–Whitney U ‐test. Reduction in tumor re‐initiation capacity after subcutaneous inoculation of 5 × 10 6 cells in NSG mice ( N = 4 tumors/group) derived from disaggregated tumor cells obtained from SC tumors 10 days after administration of 100 μg T22‐GFP‐H6‐FdU intravenous doses, for 2 consecutive days, as compared to free oligo‐FdU‐treated or Buffer‐treated mice. Recording of the number and size of positive tumors (black arrows, N = 4; 2 mice/group, 2 injection points/mouse). (E) Representative images of tumor emboli intravasation determined by microscopic analyses of H E‐stained tumor sections ( N = 5/group). (F) T22‐GFP‐H6‐FdU‐induced reduction in the number of intravasated tumor emboli (black arrows) in peri‐tumoral vessels of the M5‐orthotopic primary tumor (E: optical images; F: emboli number quantitation) and reduction in CXCR4 expression in these emboli (G), treated 7 days after tumor cell implantation with 100 μg T22‐GFP‐H6‐FdU intravenous doses, for 2 consecutive days, as compared to Buffer‐treated or free oligo‐FdU‐treated mice. Tumor emboli counting in 10 high‐power field at 200× magnification in H E‐stained sections from each tumor (mean ± s.e.m., N = 5/group). Comparison of tumor emboli number between groups: (B: Buffer; F: free oligo‐FdU; T‐F: T22‐GFP‐H6‐FdU). P ‐values for statistical differences: T‐F vs. B, * P = 0.038 (green line), T‐F vs. F, * P = 0.016 (black line). Scale bar, 100 μm. (G) CXCR4 expression per tumor emboli determined by using anti‐CXCR4 IHC and calculating H‐score (multiplying percent of CXCR4 + cells out of total cell number in the emboli area by their staining intensity, scoring each from 0 to 3 (where 3 is the maximal intensity) per tumor emboli area (mean ± s.e.m., N = 5 mice/group). Comparison of CXCR4 H‐score between groups: (B: Buffer; T‐F: T22‐GFP‐H6‐FdU). P ‐values for statistical differences: T‐F vs. B at * P = 0.027 (green line). Mann–Whitney U ‐test.

    Journal: EMBO Molecular Medicine

    Article Title: Selective depletion of metastatic stem cells as therapy for human colorectal cancer

    doi: 10.15252/emmm.201708772

    Figure Lengend Snippet: T22‐ GFP ‐H6‐FdU‐induced reduction in tumor re‐initiation capacity and blockade of tumor emboli intravasation in the CXCR 4 + patient‐derived M5 model Reduction in the number of formed spheroids (white arrows, optical microscope) generated by 1 × 10 6 disaggregated cells (cultured in stem cell‐conditioned media and low‐adhesion plates) obtained from CXCR4 + M5 subcutaneous tumors, 24 h after 100 μg T22‐GFP‐H6‐FdU intravenous doses, for 2 consecutive days, as compared to Buffer‐treated or free oligo‐FdU‐treated mice (mean ± s.e.m., N = 8; 2 mice/group; 4 plates/mouse). Scale bar, 100 μm. Comparison of spheroid formation between groups: (B: Buffer; F: free oligo‐FdU; T‐F: T22‐GFP‐H6‐FdU). P ‐values for statistical differences: T‐F vs. B, ** P = 0.001 (green line, Panel B); F vs. B, * P = 0.012 (red line); T‐F vs. F, ** P = 0.001 (black line). Mann–Whitney U ‐test. Reduction in tumor re‐initiation capacity after subcutaneous inoculation of 5 × 10 6 cells in NSG mice ( N = 4 tumors/group) derived from disaggregated tumor cells obtained from SC tumors 10 days after administration of 100 μg T22‐GFP‐H6‐FdU intravenous doses, for 2 consecutive days, as compared to free oligo‐FdU‐treated or Buffer‐treated mice. Recording of the number and size of positive tumors (black arrows, N = 4; 2 mice/group, 2 injection points/mouse). (E) Representative images of tumor emboli intravasation determined by microscopic analyses of H E‐stained tumor sections ( N = 5/group). (F) T22‐GFP‐H6‐FdU‐induced reduction in the number of intravasated tumor emboli (black arrows) in peri‐tumoral vessels of the M5‐orthotopic primary tumor (E: optical images; F: emboli number quantitation) and reduction in CXCR4 expression in these emboli (G), treated 7 days after tumor cell implantation with 100 μg T22‐GFP‐H6‐FdU intravenous doses, for 2 consecutive days, as compared to Buffer‐treated or free oligo‐FdU‐treated mice. Tumor emboli counting in 10 high‐power field at 200× magnification in H E‐stained sections from each tumor (mean ± s.e.m., N = 5/group). Comparison of tumor emboli number between groups: (B: Buffer; F: free oligo‐FdU; T‐F: T22‐GFP‐H6‐FdU). P ‐values for statistical differences: T‐F vs. B, * P = 0.038 (green line), T‐F vs. F, * P = 0.016 (black line). Scale bar, 100 μm. (G) CXCR4 expression per tumor emboli determined by using anti‐CXCR4 IHC and calculating H‐score (multiplying percent of CXCR4 + cells out of total cell number in the emboli area by their staining intensity, scoring each from 0 to 3 (where 3 is the maximal intensity) per tumor emboli area (mean ± s.e.m., N = 5 mice/group). Comparison of CXCR4 H‐score between groups: (B: Buffer; T‐F: T22‐GFP‐H6‐FdU). P ‐values for statistical differences: T‐F vs. B at * P = 0.027 (green line). Mann–Whitney U ‐test.

    Article Snippet: The nanoconjugate was synthesized by covalent binding of the targeting vector and oligo‐FdU, a pentameric oligonucleotide of Floxuridine (5‐Fluoro‐2′‐deoxyuridine; Sigma‐Aldrich Chemie GmbH, Steinheim, Germany), both functionalized before their conjugation.

    Techniques: Derivative Assay, Microscopy, Generated, Cell Culture, Mouse Assay, MANN-WHITNEY, Injection, Staining, Quantitation Assay, Expressing, Immunohistochemistry

    T22‐ GFP ‐H6‐FdU‐induced depletion of CXCR 4‐overexpressing cancer cells in tumor tissue Representative images of CXCR4 overexpression in subcutaneous tumor tissue, showing similar CXCR4 levels among compared groups ( N = 5/group; Buffer, T22‐GFP‐H6‐FdU, T22‐GFP‐H6, and free oligo‐FdU) before treatment (upper panels). Representative images of DNA double‐strand break induction and caspase‐3 activation (measured with anti‐γ‐H2AX or anticleaved caspase‐3 by IHC) 5 h post‐administration (middle panels). Apoptotic induction (Hoechst staining, 24 h post‐administration, lower panels). Note the higher number of cells positive for DSBs, caspase‐3 activation, and apoptosis induction in the T22‐GFP‐H6‐FdU as compared to free oligo‐FdU. Black or white arrows indicate dead cells. Scale bar, 50 μm. Quantitation of the number of cells containing DSBs or active caspase‐3 in IHC‐stained tumor sections 5 h post‐treatment and the number of condensated or disaggregated nuclei (by Hoechst staining) 24 h post‐treatment in tumor sections of 10 high‐power fields (400× magnification) using the Cell∧D software ( N = 50; 10 tumor fields/mice; 5 mice/group). Data expressed as mean ± s.e.m. Parameter comparison between groups: (B: Buffer; T: T22‐GFP‐H6; F: free oligo‐FdU; T‐F: T22‐GFP‐H6‐FdU). P ‐values for statistical differences: γ‐H2AX staining quantitation: B vs. T, # P = 0.001; B vs. F, # P = 0.000; B vs. T‐F, # P = 0.000; T vs. T‐F, ** P = 0.001; F vs. T‐F, * P = 0.02. Cleaved caspase‐3 quantitation: B vs. F, * P = 0.034; B vs. T‐F, ** P = 0.009; T vs. T‐F, ** P = 0.003; F vs. T‐F, * P = 0.012. Hoechst staining quantitation: B vs. F, ** P = 0.01; B vs. T‐F, ** P = 0.001; T vs. T‐F, ** P = 0.000; F vs. T‐F, * P = 0.032. Mann Whitney U ‐test.

    Journal: EMBO Molecular Medicine

    Article Title: Selective depletion of metastatic stem cells as therapy for human colorectal cancer

    doi: 10.15252/emmm.201708772

    Figure Lengend Snippet: T22‐ GFP ‐H6‐FdU‐induced depletion of CXCR 4‐overexpressing cancer cells in tumor tissue Representative images of CXCR4 overexpression in subcutaneous tumor tissue, showing similar CXCR4 levels among compared groups ( N = 5/group; Buffer, T22‐GFP‐H6‐FdU, T22‐GFP‐H6, and free oligo‐FdU) before treatment (upper panels). Representative images of DNA double‐strand break induction and caspase‐3 activation (measured with anti‐γ‐H2AX or anticleaved caspase‐3 by IHC) 5 h post‐administration (middle panels). Apoptotic induction (Hoechst staining, 24 h post‐administration, lower panels). Note the higher number of cells positive for DSBs, caspase‐3 activation, and apoptosis induction in the T22‐GFP‐H6‐FdU as compared to free oligo‐FdU. Black or white arrows indicate dead cells. Scale bar, 50 μm. Quantitation of the number of cells containing DSBs or active caspase‐3 in IHC‐stained tumor sections 5 h post‐treatment and the number of condensated or disaggregated nuclei (by Hoechst staining) 24 h post‐treatment in tumor sections of 10 high‐power fields (400× magnification) using the Cell∧D software ( N = 50; 10 tumor fields/mice; 5 mice/group). Data expressed as mean ± s.e.m. Parameter comparison between groups: (B: Buffer; T: T22‐GFP‐H6; F: free oligo‐FdU; T‐F: T22‐GFP‐H6‐FdU). P ‐values for statistical differences: γ‐H2AX staining quantitation: B vs. T, # P = 0.001; B vs. F, # P = 0.000; B vs. T‐F, # P = 0.000; T vs. T‐F, ** P = 0.001; F vs. T‐F, * P = 0.02. Cleaved caspase‐3 quantitation: B vs. F, * P = 0.034; B vs. T‐F, ** P = 0.009; T vs. T‐F, ** P = 0.003; F vs. T‐F, * P = 0.012. Hoechst staining quantitation: B vs. F, ** P = 0.01; B vs. T‐F, ** P = 0.001; T vs. T‐F, ** P = 0.000; F vs. T‐F, * P = 0.032. Mann Whitney U ‐test.

    Article Snippet: The nanoconjugate was synthesized by covalent binding of the targeting vector and oligo‐FdU, a pentameric oligonucleotide of Floxuridine (5‐Fluoro‐2′‐deoxyuridine; Sigma‐Aldrich Chemie GmbH, Steinheim, Germany), both functionalized before their conjugation.

    Techniques: Over Expression, Activation Assay, Immunohistochemistry, Staining, Quantitation Assay, Software, Mouse Assay, MANN-WHITNEY

    T22‐ GFP ‐H6‐FdU‐induced depletion of CXCR 4‐overexpressing cancer cells in tumor tissue leading to reduced spheroid formation capacity T22‐GFP‐H6‐FdU depletes CXCR4 + cancer cells from SW1417 CRC tumor tissue after a 100 μg single‐dose administration. Note the reduction in CXCR4 + cell fraction in the tumor 24 h after injection, their almost complete elimination at 48 h, and the re‐emergence of CXCR4 + cells 72 h post‐administration, using anti‐CXCR4 IHC. In contrast, the CXCR4 + cancer cell fraction (CXCR4 + CCF) in tumor tissue remains constant along time after free oligo‐FdU treatment. The 3‐day time‐lapse for CXCR4 + tumor cell re‐appearance defines the dosage interval used in a repeated dose schedule of nanoconjugate administration in the experiments to evaluate its antimetastatic effect ( N = 5: 5 mice/group; 1 samples/mouse). Scale bar, 50 μm. Data expressed as mean ± s.e.m. CXCR4 H‐score comparison for T22‐GFP‐H6‐FdU(T‐F)‐treated tumors among time points (green line, panel A). P ‐values for statistical differences: T‐F Basal vs. T‐F 24 h, * P = 0.038; T‐F Basal vs. T‐F 48 h, ** P = 0.001; T‐F Basal vs. T‐F 72 h, ** P = 0.003; T‐F 24 h vs. T‐F 48 h, * P = 0.033. CXCR4 H‐score comparison between T22‐GFP‐H6‐FdU (T‐F) and free oligo‐FdU (F) (black line, panel A). P ‐values for statistical differences: T‐F vs. F at 48 h, ** P = 0.001; T‐F vs. F at 72 h, * P = 0.034). Mann–Whitney U ‐test. Significant reduction in the number of spheroid formed (C, optical microscope) and their bioluminescence emission (D, IVIS Spectrum 200), generated by 1 × 10 6 disaggregated cells (cultured in stem cell‐conditioned media and low‐adhesion plates), obtained from CXCR4 + luciferase + SW1417 subcutaneous tumors, 24 h after 100 μg T22‐GFP‐H6‐FdU intravenous doses, for 2 consecutive days, as compared to Buffer‐treated or free oligo‐FdU‐treated mice. (D) Quantitation of the bioluminescent signal (BLI) expressed as average radiant intensity, obtained using the IVIS spectrum 200 equipment ( N = 2 plates/group). Data expressed as mean ± s.e.m. Comparison of emitted BLI between groups: (B: Buffer; F: free oligo‐FdU; T‐F: T22‐GFP‐H6‐FdU). P ‐values for statistical differences: T‐F vs. B, ** P = 0.001 (green line, panel D); F vs. B, * P = 0.011 (red line); T‐F vs. F at * P = 0.02 (black line, panel D). Mann–Whitney U ‐test.

    Journal: EMBO Molecular Medicine

    Article Title: Selective depletion of metastatic stem cells as therapy for human colorectal cancer

    doi: 10.15252/emmm.201708772

    Figure Lengend Snippet: T22‐ GFP ‐H6‐FdU‐induced depletion of CXCR 4‐overexpressing cancer cells in tumor tissue leading to reduced spheroid formation capacity T22‐GFP‐H6‐FdU depletes CXCR4 + cancer cells from SW1417 CRC tumor tissue after a 100 μg single‐dose administration. Note the reduction in CXCR4 + cell fraction in the tumor 24 h after injection, their almost complete elimination at 48 h, and the re‐emergence of CXCR4 + cells 72 h post‐administration, using anti‐CXCR4 IHC. In contrast, the CXCR4 + cancer cell fraction (CXCR4 + CCF) in tumor tissue remains constant along time after free oligo‐FdU treatment. The 3‐day time‐lapse for CXCR4 + tumor cell re‐appearance defines the dosage interval used in a repeated dose schedule of nanoconjugate administration in the experiments to evaluate its antimetastatic effect ( N = 5: 5 mice/group; 1 samples/mouse). Scale bar, 50 μm. Data expressed as mean ± s.e.m. CXCR4 H‐score comparison for T22‐GFP‐H6‐FdU(T‐F)‐treated tumors among time points (green line, panel A). P ‐values for statistical differences: T‐F Basal vs. T‐F 24 h, * P = 0.038; T‐F Basal vs. T‐F 48 h, ** P = 0.001; T‐F Basal vs. T‐F 72 h, ** P = 0.003; T‐F 24 h vs. T‐F 48 h, * P = 0.033. CXCR4 H‐score comparison between T22‐GFP‐H6‐FdU (T‐F) and free oligo‐FdU (F) (black line, panel A). P ‐values for statistical differences: T‐F vs. F at 48 h, ** P = 0.001; T‐F vs. F at 72 h, * P = 0.034). Mann–Whitney U ‐test. Significant reduction in the number of spheroid formed (C, optical microscope) and their bioluminescence emission (D, IVIS Spectrum 200), generated by 1 × 10 6 disaggregated cells (cultured in stem cell‐conditioned media and low‐adhesion plates), obtained from CXCR4 + luciferase + SW1417 subcutaneous tumors, 24 h after 100 μg T22‐GFP‐H6‐FdU intravenous doses, for 2 consecutive days, as compared to Buffer‐treated or free oligo‐FdU‐treated mice. (D) Quantitation of the bioluminescent signal (BLI) expressed as average radiant intensity, obtained using the IVIS spectrum 200 equipment ( N = 2 plates/group). Data expressed as mean ± s.e.m. Comparison of emitted BLI between groups: (B: Buffer; F: free oligo‐FdU; T‐F: T22‐GFP‐H6‐FdU). P ‐values for statistical differences: T‐F vs. B, ** P = 0.001 (green line, panel D); F vs. B, * P = 0.011 (red line); T‐F vs. F at * P = 0.02 (black line, panel D). Mann–Whitney U ‐test.

    Article Snippet: The nanoconjugate was synthesized by covalent binding of the targeting vector and oligo‐FdU, a pentameric oligonucleotide of Floxuridine (5‐Fluoro‐2′‐deoxyuridine; Sigma‐Aldrich Chemie GmbH, Steinheim, Germany), both functionalized before their conjugation.

    Techniques: Injection, Immunohistochemistry, Mouse Assay, MANN-WHITNEY, Microscopy, Generated, Cell Culture, Luciferase, Quantitation Assay

    T22‐ GFP ‐H6‐FdU nanoconjugate synthesis and selective internalization and killing of CXCR 4 + CRC cells in vitro The nanoconjugate contains a fusion protein [T22‐GFP‐H6—composed of the peptide T22 as a CXCR4 ligand, a green fluorescent protein and a histidine tail—bound to the payload drug (Unzueta et al , 2012a )]. Three to four pentameric oligonucleotides (approximately 20 molecules) of the antitumor drug 5‐Fluoro‐2′‐deoxyuridine (FdU), named oligo‐FdU, are conjugated to the T22‐GFP‐H6 targeting vector using a linker. T22‐GFP‐H6‐FdU chemical synthesis: T22‐GFP‐H6 is first covalently bound to the 6‐Maleimidohexanoic acid N‐hydroxysuccinimide ester linker through its amino groups in the external lysines (Hermanson, 2013 ). The thiol‐functionalized oligo‐FdU (oligo‐(FdU)5‐SH; see Appendix Fig S1 ) is then reacted with T22‐GFP‐H6 functionalized with maleimide (Michael reaction). High and constitutive expression of CXCR4 in the membrane of SW1417 CRC cells as measured by flow cytometry. Lack of human SDF‐1α release from cultured SW1417 CRC cells, as measured by ELISA, whereas human control 1BR3.G fibroblasts express high SDF‐1α levels, after 48 or 72 h of growth in culture (mean ± s.e.m., N = 2 experiment in duplicate). Nanoconjugate internalization in CXCR4‐overexpressing (CXCR4 + ) SW1417 CRC cells after 1‐h exposure at 1 μM, as measured by fluorescence emission using flow cytometry (mean ± s.e.m., N = 3 experiments in duplicate). Significant difference at ** P = 0.002 between the T22‐GFP‐H6‐FdU and the T22‐GFP‐H6‐FdU + AMD3100 groups, Mann–Whitney U ‐test. Intracellular trafficking of T22‐GFP‐H6‐FdU in CXCR4 + SW1417 cells by confocal microscopy after exposure at 1 μM for 24 h. The green staining corresponds to GFP‐containing nanoconjugates, and the red staining corresponds to plasma cell membranes stained with a red dye (CellMask™), whereas cell nucleus was stained in blue with Hoechst. The insets show detail of the intracellular localization of nanostructured, fluorescent entities, in an isosurface representation within a three‐dimensional volumetric x‐y‐z data field. Linearized T22‐GFP‐H6‐FdU dose–response trend line representation compared with unconjugated free oligo‐FdU exposure. Antitumor effect was measured as CXCR4 + SW1417 cell viability by MTT after 72‐h exposure as the described concentrations (mean ± s.e.m., N = 3 experiments in duplicate). Reduction in cell viability determined by optical microscope images of SW1417 cells exposed to 1 μM T22‐GFP‐H6‐FdU for 72 h, as compared to T22‐GFP‐H6 or free oligo‐FdU ( N = 3 experiments in duplicate; Scale bar, 100 μm).

    Journal: EMBO Molecular Medicine

    Article Title: Selective depletion of metastatic stem cells as therapy for human colorectal cancer

    doi: 10.15252/emmm.201708772

    Figure Lengend Snippet: T22‐ GFP ‐H6‐FdU nanoconjugate synthesis and selective internalization and killing of CXCR 4 + CRC cells in vitro The nanoconjugate contains a fusion protein [T22‐GFP‐H6—composed of the peptide T22 as a CXCR4 ligand, a green fluorescent protein and a histidine tail—bound to the payload drug (Unzueta et al , 2012a )]. Three to four pentameric oligonucleotides (approximately 20 molecules) of the antitumor drug 5‐Fluoro‐2′‐deoxyuridine (FdU), named oligo‐FdU, are conjugated to the T22‐GFP‐H6 targeting vector using a linker. T22‐GFP‐H6‐FdU chemical synthesis: T22‐GFP‐H6 is first covalently bound to the 6‐Maleimidohexanoic acid N‐hydroxysuccinimide ester linker through its amino groups in the external lysines (Hermanson, 2013 ). The thiol‐functionalized oligo‐FdU (oligo‐(FdU)5‐SH; see Appendix Fig S1 ) is then reacted with T22‐GFP‐H6 functionalized with maleimide (Michael reaction). High and constitutive expression of CXCR4 in the membrane of SW1417 CRC cells as measured by flow cytometry. Lack of human SDF‐1α release from cultured SW1417 CRC cells, as measured by ELISA, whereas human control 1BR3.G fibroblasts express high SDF‐1α levels, after 48 or 72 h of growth in culture (mean ± s.e.m., N = 2 experiment in duplicate). Nanoconjugate internalization in CXCR4‐overexpressing (CXCR4 + ) SW1417 CRC cells after 1‐h exposure at 1 μM, as measured by fluorescence emission using flow cytometry (mean ± s.e.m., N = 3 experiments in duplicate). Significant difference at ** P = 0.002 between the T22‐GFP‐H6‐FdU and the T22‐GFP‐H6‐FdU + AMD3100 groups, Mann–Whitney U ‐test. Intracellular trafficking of T22‐GFP‐H6‐FdU in CXCR4 + SW1417 cells by confocal microscopy after exposure at 1 μM for 24 h. The green staining corresponds to GFP‐containing nanoconjugates, and the red staining corresponds to plasma cell membranes stained with a red dye (CellMask™), whereas cell nucleus was stained in blue with Hoechst. The insets show detail of the intracellular localization of nanostructured, fluorescent entities, in an isosurface representation within a three‐dimensional volumetric x‐y‐z data field. Linearized T22‐GFP‐H6‐FdU dose–response trend line representation compared with unconjugated free oligo‐FdU exposure. Antitumor effect was measured as CXCR4 + SW1417 cell viability by MTT after 72‐h exposure as the described concentrations (mean ± s.e.m., N = 3 experiments in duplicate). Reduction in cell viability determined by optical microscope images of SW1417 cells exposed to 1 μM T22‐GFP‐H6‐FdU for 72 h, as compared to T22‐GFP‐H6 or free oligo‐FdU ( N = 3 experiments in duplicate; Scale bar, 100 μm).

    Article Snippet: The nanoconjugate was synthesized by covalent binding of the targeting vector and oligo‐FdU, a pentameric oligonucleotide of Floxuridine (5‐Fluoro‐2′‐deoxyuridine; Sigma‐Aldrich Chemie GmbH, Steinheim, Germany), both functionalized before their conjugation.

    Techniques: In Vitro, Plasmid Preparation, Expressing, Flow Cytometry, Cytometry, Cell Culture, Enzyme-linked Immunosorbent Assay, Fluorescence, MANN-WHITNEY, Confocal Microscopy, Staining, MTT Assay, Microscopy

    Selective biodistribution and receptor‐dependent uptake of T22‐ GFP ‐H6‐FdU in CXCR 4 + cells in vivo Approach to achieve targeted drug delivery and selective killing of metastatic stem cells: CXCR4‐nanoconjugate interaction triggers CXCR4‐mediated internalization in MetSCs, in primary tumors and metastatic foci, followed by FdU release to the cytosol and diffusion to the nucleus to induce double‐strand breaks leading to selective killing of CXCR4 + cells. Selective T22‐GFP‐H6‐FdU nanoconjugate biodistribution in subcutaneous CXCR4 + SW1417 CRC tumor tissue 5 h after a 100 μg single intravenous dose, as measured by fluorescence emission using IVIS Spectrum 200 ( N = 5/group). Biodistribution is similar to that achieved by the T22‐GFP‐H6 targeting vector and undetectable after Buffer or free oligo‐FdU treatment ( N = 5 mice/group). Co‐localization (yellow merged) of the T22‐GFP‐H6‐FdU (green) and the CXCR4 receptor (red) and release of T22‐GFP‐H6‐FdU into the cytosol in CXCR4 + tumor cells 5 h after a 100 μg dose of nanoconjugate, as measured by dual anti‐GFP/anti‐CXCR4 immunofluorescence (IF). DAPI (blue nuclear staining). Fluorescence emission was measured in the green and red channels using the ImageJ software and expressed as mean area (A) ± s.e.m (μm 2 ) ( N = 10, 2 tumor fields × 5 mice; 200×). Note the significant ( P = 0.003) increase in the area occupied by the green dots (nanoconjugate released to the cell cytosol) in T22‐GFP‐H6‐FdU‐treated tumors, compared to free oligo‐FdU‐treated control tissues. Scale bar, 50 μm. Administration of the CXCR4 antagonist AMD3100 completely blocks T22‐GFP‐H6‐FdU tumor biodistribution, as measured by fluorescence emission. Fluorescence is not detected in Buffer or free oligo‐FdU controls ( N = 5 tumor fields/group). The uptake of T22‐GFP‐H6‐FdU observed in CXCR4 + SW1417 tumor tissues is almost completely blocked by prior AMD3100 administration, as quantified using the anti‐GFP IHC H‐score (mean ± s.e.m., N = 5 tumor fields/group). Comparison of T22‐GFP‐H6 uptake between groups: (B: Buffer; F: free oligo‐FdU; T‐F: T22‐GFP‐H6‐FdU; T‐F+A: T22‐GFP‐H6‐FdU+AMD3100). P ‐values for statistical differences B vs. T‐F, ** P = 0.000; F vs. T‐F, ** P = 0.000; T‐F vs. TFA, ** P = 0.004. Mann–Whitney U ‐test. Representative images of T22‐GFP‐H6‐FdU uptake and AMD3100 competition by anti‐GFP immunostaining, which quantitation is reported in panel (E). Scale bar, 50 μm.

    Journal: EMBO Molecular Medicine

    Article Title: Selective depletion of metastatic stem cells as therapy for human colorectal cancer

    doi: 10.15252/emmm.201708772

    Figure Lengend Snippet: Selective biodistribution and receptor‐dependent uptake of T22‐ GFP ‐H6‐FdU in CXCR 4 + cells in vivo Approach to achieve targeted drug delivery and selective killing of metastatic stem cells: CXCR4‐nanoconjugate interaction triggers CXCR4‐mediated internalization in MetSCs, in primary tumors and metastatic foci, followed by FdU release to the cytosol and diffusion to the nucleus to induce double‐strand breaks leading to selective killing of CXCR4 + cells. Selective T22‐GFP‐H6‐FdU nanoconjugate biodistribution in subcutaneous CXCR4 + SW1417 CRC tumor tissue 5 h after a 100 μg single intravenous dose, as measured by fluorescence emission using IVIS Spectrum 200 ( N = 5/group). Biodistribution is similar to that achieved by the T22‐GFP‐H6 targeting vector and undetectable after Buffer or free oligo‐FdU treatment ( N = 5 mice/group). Co‐localization (yellow merged) of the T22‐GFP‐H6‐FdU (green) and the CXCR4 receptor (red) and release of T22‐GFP‐H6‐FdU into the cytosol in CXCR4 + tumor cells 5 h after a 100 μg dose of nanoconjugate, as measured by dual anti‐GFP/anti‐CXCR4 immunofluorescence (IF). DAPI (blue nuclear staining). Fluorescence emission was measured in the green and red channels using the ImageJ software and expressed as mean area (A) ± s.e.m (μm 2 ) ( N = 10, 2 tumor fields × 5 mice; 200×). Note the significant ( P = 0.003) increase in the area occupied by the green dots (nanoconjugate released to the cell cytosol) in T22‐GFP‐H6‐FdU‐treated tumors, compared to free oligo‐FdU‐treated control tissues. Scale bar, 50 μm. Administration of the CXCR4 antagonist AMD3100 completely blocks T22‐GFP‐H6‐FdU tumor biodistribution, as measured by fluorescence emission. Fluorescence is not detected in Buffer or free oligo‐FdU controls ( N = 5 tumor fields/group). The uptake of T22‐GFP‐H6‐FdU observed in CXCR4 + SW1417 tumor tissues is almost completely blocked by prior AMD3100 administration, as quantified using the anti‐GFP IHC H‐score (mean ± s.e.m., N = 5 tumor fields/group). Comparison of T22‐GFP‐H6 uptake between groups: (B: Buffer; F: free oligo‐FdU; T‐F: T22‐GFP‐H6‐FdU; T‐F+A: T22‐GFP‐H6‐FdU+AMD3100). P ‐values for statistical differences B vs. T‐F, ** P = 0.000; F vs. T‐F, ** P = 0.000; T‐F vs. TFA, ** P = 0.004. Mann–Whitney U ‐test. Representative images of T22‐GFP‐H6‐FdU uptake and AMD3100 competition by anti‐GFP immunostaining, which quantitation is reported in panel (E). Scale bar, 50 μm.

    Article Snippet: The nanoconjugate was synthesized by covalent binding of the targeting vector and oligo‐FdU, a pentameric oligonucleotide of Floxuridine (5‐Fluoro‐2′‐deoxyuridine; Sigma‐Aldrich Chemie GmbH, Steinheim, Germany), both functionalized before their conjugation.

    Techniques: In Vivo, Diffusion-based Assay, Fluorescence, Plasmid Preparation, Mouse Assay, Immunofluorescence, Staining, Software, Immunohistochemistry, MANN-WHITNEY, Immunostaining, Quantitation Assay

    Negligible T22‐ GFP ‐H6‐FdU biodistribution or toxicity on non‐tumor tissues Undetectable T22‐GFP‐H6‐FdU emitted fluorescence in normal tissues, except for a transient accumulation 5 h after a 100 μg dose in the liver, which disappears at 24 h. Liver emitted fluorescence is transient and significantly lower than the one registered in tumor tissue. Tumor/Liver ratio = 7.5 (see tumor intensity in Fig 2 B, which was registered in the same experiment; N = 5 mice/group). Scale bar, 1 cm. Color key, radiant efficiency units. Representative images depicting the level of DNA double‐strand break (DSB) induction in histologically normal bone marrow 5 h after treatment, as measured by anti‐γ‐H2AX, which is higher in free oligo‐FdU‐treated mice than in T22‐GFP‐H6‐FdU ( P = 0.047). Low level of cells containing DSBs in histologically normal kidney after T22‐GFP‐H6‐FdU or free oligo‐FdU treatment, a finding occurring in all normal tissues analyzed ( N = 50, 5 mice/group; 10 fields/mouse). Scale bar, 100 μm. Representative images showing lack of histopathological alterations in H E‐stained tissue or apoptotic induction in H E‐stained samples of CXCR4 + (bone marrow) and CXCR4 − (brain, kidney, liver, lung, and heart) normal tissues 24 h after the administration of a 100 μg dose of T22‐GFP‐H6‐FdU or an equimolecular dose of free oligo‐FdU ( N = 5/group). Note that the transient nanoconjugate distribution to liver or the DNA damage induced in bone marrow does not lead to cytotoxicity on these non‐tumor tissues ( N = 50, 5 mice/group; 10 fields/mouse). Scale bar, 100 μm. Lack of differences in body weight among groups registered along time in the SW1417‐derived CCR model and the regression of metastases protocol (mean ± s.e.m., N = 10 mice/group). Lack of differences in body mouse weight among groups registered along time in the SW1417 cell line‐derived model and the prevention of metastasis protocol [mean ± s.e.m., Buffer ( N = 11; free oligo‐FdU ( N = 12), T22‐GFP‐H6‐FdU ( N = 12)]. Lack of differences in body mouse weight among groups registered along time in the M5 patient‐derived model and the prevention of metastasis protocol [mean ± s.e.m., Buffer ( N = 6); free oligo‐FdU ( N = 17); T22‐GFP‐H6‐FdU ( N = 8)].

    Journal: EMBO Molecular Medicine

    Article Title: Selective depletion of metastatic stem cells as therapy for human colorectal cancer

    doi: 10.15252/emmm.201708772

    Figure Lengend Snippet: Negligible T22‐ GFP ‐H6‐FdU biodistribution or toxicity on non‐tumor tissues Undetectable T22‐GFP‐H6‐FdU emitted fluorescence in normal tissues, except for a transient accumulation 5 h after a 100 μg dose in the liver, which disappears at 24 h. Liver emitted fluorescence is transient and significantly lower than the one registered in tumor tissue. Tumor/Liver ratio = 7.5 (see tumor intensity in Fig 2 B, which was registered in the same experiment; N = 5 mice/group). Scale bar, 1 cm. Color key, radiant efficiency units. Representative images depicting the level of DNA double‐strand break (DSB) induction in histologically normal bone marrow 5 h after treatment, as measured by anti‐γ‐H2AX, which is higher in free oligo‐FdU‐treated mice than in T22‐GFP‐H6‐FdU ( P = 0.047). Low level of cells containing DSBs in histologically normal kidney after T22‐GFP‐H6‐FdU or free oligo‐FdU treatment, a finding occurring in all normal tissues analyzed ( N = 50, 5 mice/group; 10 fields/mouse). Scale bar, 100 μm. Representative images showing lack of histopathological alterations in H E‐stained tissue or apoptotic induction in H E‐stained samples of CXCR4 + (bone marrow) and CXCR4 − (brain, kidney, liver, lung, and heart) normal tissues 24 h after the administration of a 100 μg dose of T22‐GFP‐H6‐FdU or an equimolecular dose of free oligo‐FdU ( N = 5/group). Note that the transient nanoconjugate distribution to liver or the DNA damage induced in bone marrow does not lead to cytotoxicity on these non‐tumor tissues ( N = 50, 5 mice/group; 10 fields/mouse). Scale bar, 100 μm. Lack of differences in body weight among groups registered along time in the SW1417‐derived CCR model and the regression of metastases protocol (mean ± s.e.m., N = 10 mice/group). Lack of differences in body mouse weight among groups registered along time in the SW1417 cell line‐derived model and the prevention of metastasis protocol [mean ± s.e.m., Buffer ( N = 11; free oligo‐FdU ( N = 12), T22‐GFP‐H6‐FdU ( N = 12)]. Lack of differences in body mouse weight among groups registered along time in the M5 patient‐derived model and the prevention of metastasis protocol [mean ± s.e.m., Buffer ( N = 6); free oligo‐FdU ( N = 17); T22‐GFP‐H6‐FdU ( N = 8)].

    Article Snippet: The nanoconjugate was synthesized by covalent binding of the targeting vector and oligo‐FdU, a pentameric oligonucleotide of Floxuridine (5‐Fluoro‐2′‐deoxyuridine; Sigma‐Aldrich Chemie GmbH, Steinheim, Germany), both functionalized before their conjugation.

    Techniques: Fluorescence, Mouse Assay, Staining, Derivative Assay

    Hybrid HAC formation in HT1080 cells. (a) Representative FISH images of clones containing a HAC (left) and an array integration in an endogenous chromosome (right). (b, c) Screening of blasticidin-resistant clones by FISH. Diagrams represent the frequency of metaphases with HACs (black bars) and array integrations (gray bars) ( N = 25) in HT1080 cells without (b) and with (c) CENP-A overexpression. (d) Frequency of HAC-containing clones with (CENP-A OE) and without (CENP-A WT) transient CENP-A overexpression during HAC formation. Only clones with a minimum of 10% metaphases containing HACs were considered as positive (10 vs 33%). (e) Representative two-color oligo-FISH images showing different hybrid HACs (clone 20.CA.07-top and 20.CA.24-bottom) containing tetO (red) and lacOgal4 (green) domains. Images were captured at optimized exposure times to clearly distinguish both signals in either clone (for signal intensity comparison between clones, see Figure S2 ). (f) Representative image of an HT1080 cell containing HAC clone 20.CA.24 and expressing both lacI-GFP (green) and tetR-mCherry (red) fusion proteins. Merged image (right panel) represents the overlay of GFP, mCherry, and DAPI channels. (g) Frequency of HAC-containing metaphases in the indicated clones containing HACs in the presence of blasticidin and after 30 days after blasticidin washout. The HAC loss rate is indicated in red. (h) Representative immunofluorescence images on metaphase spreads of HAC clone 20.CA.24 and stained with the indicated antibodies. Scale bars = 10 μm.

    Journal: ACS Synthetic Biology

    Article Title: Generation of a Synthetic Human Chromosome with Two Centromeric Domains for Advanced Epigenetic Engineering Studies

    doi: 10.1021/acssynbio.8b00018

    Figure Lengend Snippet: Hybrid HAC formation in HT1080 cells. (a) Representative FISH images of clones containing a HAC (left) and an array integration in an endogenous chromosome (right). (b, c) Screening of blasticidin-resistant clones by FISH. Diagrams represent the frequency of metaphases with HACs (black bars) and array integrations (gray bars) ( N = 25) in HT1080 cells without (b) and with (c) CENP-A overexpression. (d) Frequency of HAC-containing clones with (CENP-A OE) and without (CENP-A WT) transient CENP-A overexpression during HAC formation. Only clones with a minimum of 10% metaphases containing HACs were considered as positive (10 vs 33%). (e) Representative two-color oligo-FISH images showing different hybrid HACs (clone 20.CA.07-top and 20.CA.24-bottom) containing tetO (red) and lacOgal4 (green) domains. Images were captured at optimized exposure times to clearly distinguish both signals in either clone (for signal intensity comparison between clones, see Figure S2 ). (f) Representative image of an HT1080 cell containing HAC clone 20.CA.24 and expressing both lacI-GFP (green) and tetR-mCherry (red) fusion proteins. Merged image (right panel) represents the overlay of GFP, mCherry, and DAPI channels. (g) Frequency of HAC-containing metaphases in the indicated clones containing HACs in the presence of blasticidin and after 30 days after blasticidin washout. The HAC loss rate is indicated in red. (h) Representative immunofluorescence images on metaphase spreads of HAC clone 20.CA.24 and stained with the indicated antibodies. Scale bars = 10 μm.

    Article Snippet: For oligo-FISH experiments, oligonucleotides recognizing the tetO sequence (5′- ACTAGCAGCAGAGCTCTCCCTATCAGTGATAGAGACTAG-3′) labeled with Digoxigenin, and oligonucleotides recognizing both lacO (5′- CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′- TCGACGGAGGACAGTCCTCCG-3′) sequences labeled with Biotin were synthesized (Sigma).

    Techniques: HAC Assay, Fluorescence In Situ Hybridization, Clone Assay, Over Expression, Expressing, Immunofluorescence, Staining

    In vivo production of ssDNA. ( a ) Schematic for the conversion of the r_oligo gene to ssDNA. The r_oligo gene contains both the desired ssDNA sequence and the HTBS part, which serves as a terminator (black, ssDNA sequence; orange, A/U region; brown, PBS; purple, hairpin). ( b ) The impact of different combinations of RT expression on ssDNA production is shown. Data are shown for the production of a 205-nt ssDNA (r_oligo_205) under purification conditions preventing the removal of the HTBS (RNAse A+150 mM NaCl). The red triangle shows the predicted location of the band (note that the ladder is based on double stranded DNA). The bands are from the same gel and the image processed once, but the order changed for publication. For the full gel in its original order, see Supplementary Fig. 1 . The ssDNA sequence and reverse transcriptase sequences are added in Supplementary Tables 2 and 3 . ( c ) The expression of ssDNA after 18 h growth in the presence (+IPTG, 1 mM) and absence of IPTG (−IPTG) under conditions preserving the HTBS. To confirm that the band is ssDNA, the same sample is exposed to DNase (+IPTG/+DNase, 1 mM/4 units). ( d ) For the same system as in c , the ssDNA is treated to remove the HTBS RNA (RNAse and no salt). ( e ) Comparison of an in vivo produced ssDNA with commercial chemically synthesized ssDNAs. The ladder was calculated using commercial oligos of defined size run simultaneously in the gel. The ssDNA sequence is in Supplementary Table 2 . ( f ) Sequencing analysis of the in vivo produced 72-mer. The ‘prediction' is the complementary sequence of the expected ssDNA (Methods).

    Journal: Nature Communications

    Article Title: Genetic encoding of DNA nanostructures and their self-assembly in living bacteria

    doi: 10.1038/ncomms11179

    Figure Lengend Snippet: In vivo production of ssDNA. ( a ) Schematic for the conversion of the r_oligo gene to ssDNA. The r_oligo gene contains both the desired ssDNA sequence and the HTBS part, which serves as a terminator (black, ssDNA sequence; orange, A/U region; brown, PBS; purple, hairpin). ( b ) The impact of different combinations of RT expression on ssDNA production is shown. Data are shown for the production of a 205-nt ssDNA (r_oligo_205) under purification conditions preventing the removal of the HTBS (RNAse A+150 mM NaCl). The red triangle shows the predicted location of the band (note that the ladder is based on double stranded DNA). The bands are from the same gel and the image processed once, but the order changed for publication. For the full gel in its original order, see Supplementary Fig. 1 . The ssDNA sequence and reverse transcriptase sequences are added in Supplementary Tables 2 and 3 . ( c ) The expression of ssDNA after 18 h growth in the presence (+IPTG, 1 mM) and absence of IPTG (−IPTG) under conditions preserving the HTBS. To confirm that the band is ssDNA, the same sample is exposed to DNase (+IPTG/+DNase, 1 mM/4 units). ( d ) For the same system as in c , the ssDNA is treated to remove the HTBS RNA (RNAse and no salt). ( e ) Comparison of an in vivo produced ssDNA with commercial chemically synthesized ssDNAs. The ladder was calculated using commercial oligos of defined size run simultaneously in the gel. The ssDNA sequence is in Supplementary Table 2 . ( f ) Sequencing analysis of the in vivo produced 72-mer. The ‘prediction' is the complementary sequence of the expected ssDNA (Methods).

    Article Snippet: After RNA degradation, the solutions were cleaned and concentrated using oligo clean and concentrator kit (ZYMO Research Corp., D4061 ZYMO).

    Techniques: In Vivo, Sequencing, Expressing, Purification, Preserving, Produced, Synthesized

    SNPs-seq data analysis and BAB score distribution. a Size distribution of SNPs-seq libraries. Test samples show 150–500 bp length while input samples show ~160 bp. b Mapping of allele-specific read counts. Percentage of mapped read count is ~60% for test samples and ~95% for input controls. c Correlation between technical replicates. Mapped read counts were first transformed to log2 values, and then plotted along x (replicate 1) and y (replicate 2) axis. d Association of read count with GC content. Low GC content is significantly associated with low read count. e Association of read counts with delta G value. More thermostability of oligo duplex (lower delta G ) contributes to higher read counts in SNPs-seq library. f Association of read counts with nucleotides at 5′ end. The nucleotides A, T, AA, AT, TA, or TT at 5′ end have the lowest read counts among all tested oligos. The upper, middle, and lower bounds of boxes represent the 75th, 50th, and 25th percentile of the values, respectively. The whiskers represent 95th to 5th percentile. g Overall distribution of BAB scores among the 374 tested candidate SNPs. The red line represents BAB scores in ETH group while the blue dots represent the corresponding BAB scores from the DHT group

    Journal: Nature Communications

    Article Title: High-throughput screening of prostate cancer risk loci by single nucleotide polymorphisms sequencing

    doi: 10.1038/s41467-018-04451-x

    Figure Lengend Snippet: SNPs-seq data analysis and BAB score distribution. a Size distribution of SNPs-seq libraries. Test samples show 150–500 bp length while input samples show ~160 bp. b Mapping of allele-specific read counts. Percentage of mapped read count is ~60% for test samples and ~95% for input controls. c Correlation between technical replicates. Mapped read counts were first transformed to log2 values, and then plotted along x (replicate 1) and y (replicate 2) axis. d Association of read count with GC content. Low GC content is significantly associated with low read count. e Association of read counts with delta G value. More thermostability of oligo duplex (lower delta G ) contributes to higher read counts in SNPs-seq library. f Association of read counts with nucleotides at 5′ end. The nucleotides A, T, AA, AT, TA, or TT at 5′ end have the lowest read counts among all tested oligos. The upper, middle, and lower bounds of boxes represent the 75th, 50th, and 25th percentile of the values, respectively. The whiskers represent 95th to 5th percentile. g Overall distribution of BAB scores among the 374 tested candidate SNPs. The red line represents BAB scores in ETH group while the blue dots represent the corresponding BAB scores from the DHT group

    Article Snippet: After extensive washing (×6 times), the protein-bound ds-oligos were eluted in 1× Column Elution Buffer and further purified using Oligo Clean & Concentrator (Zymo Research, Irvine, CA, U.S.A.).

    Techniques: Transformation Assay

    (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and NeutrAvidin-DNA oligo conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113

    Journal: Biomaterials

    Article Title: Nucleic Acid-Mediated Intracellular Protein Delivery by Lipid-like Nanoparticles

    doi: 10.1016/j.biomaterials.2014.04.014

    Figure Lengend Snippet: (a) Polyacrylamide gel electrophoresis (PAGE) of free (F) DNA oligos and NeutrAvidin-DNA oligo conjugates prepared at various molar ratios of oligo:DNA (1:1, 2:1, and 4:1). (b) SDS-PAGE of naked nAv protein (P), naked nAv-oligo conjugate (C), C14-113

    Article Snippet: For oligo conjugation to NeutrAvidin (nAv), 5’-biotin-PEG4 -functionalized oligo (37.2 µM, MW = 13.46 kDa) was incubated with fluorescently labeled nAv (18.6 µM, MW = 60 kDa) in a final volume of 0.75 ml PBS for 1 h at RT and used without purification. nAv was pre-labeled with either Cy5.5 mono-reactive NHS ester (GE Healthcare) or AF 488 carboxylic acid, succinimidyl ester, (Life Technologies) using the manufacturers’ instructions and was purified prior to conjugation using a Zeba Spin desalting column (40 K MWCO) equilibrated with PBS.

    Techniques: Polyacrylamide Gel Electrophoresis, SDS Page

    RT-PCR confirmation of antisense transcription. a) A graphic representation of um02794 transcription. The grey line represents the genomic sequence (middle), the blue arrow represents predicted gene structure, and the red (top) and green (bottom) arrows represent sense and anti-sense ESTs respectively. The range of the genome coordinates was included. b) Detecting antisense transcripts corresponding to um02794 via strand specific RT-PCR. In lanes 2 to 5 first strand synthesis was carried out on RNA of CM grown haploid cells. In lanes 6 to 9 first strand synthesis was carried out on RNA of MN grown haploid cells. First synthesis reactions of lanes 2 and 6 were prepared using sense strand specific primers; lanes 3 and 7 anti sense specific primers; lane 4 and 8 oligo dT and lanes 5 and 9 DEPC-treated water. Lane 10 used genomic DNA from U. maydis strain 521 and lane 11 used water a PCR template. Lane 1 and 12: Full Ranger DNA ladder.

    Journal: BMC Genomics

    Article Title: Gene discovery and transcript analyses in the corn smut pathogen Ustilago maydis: expressed sequence tag and genome sequence comparison

    doi: 10.1186/1471-2164-8-334

    Figure Lengend Snippet: RT-PCR confirmation of antisense transcription. a) A graphic representation of um02794 transcription. The grey line represents the genomic sequence (middle), the blue arrow represents predicted gene structure, and the red (top) and green (bottom) arrows represent sense and anti-sense ESTs respectively. The range of the genome coordinates was included. b) Detecting antisense transcripts corresponding to um02794 via strand specific RT-PCR. In lanes 2 to 5 first strand synthesis was carried out on RNA of CM grown haploid cells. In lanes 6 to 9 first strand synthesis was carried out on RNA of MN grown haploid cells. First synthesis reactions of lanes 2 and 6 were prepared using sense strand specific primers; lanes 3 and 7 anti sense specific primers; lane 4 and 8 oligo dT and lanes 5 and 9 DEPC-treated water. Lane 10 used genomic DNA from U. maydis strain 521 and lane 11 used water a PCR template. Lane 1 and 12: Full Ranger DNA ladder.

    Article Snippet: Reverse transcription was carried out on 5 μg of DNaseI treated RNA using Superscript III (Invitrogen) and oligo (dT)12–18 primers (Invitrogen).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Sequencing, Polymerase Chain Reaction