negative control dna Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Integrated DNA Technologies negative control crrna tracrrna
    Negative Control Crrna Tracrrna, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control crrna tracrrna/product/Integrated DNA Technologies
    Average 95 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    negative control crrna tracrrna - by Bioz Stars, 2020-08
    95/100 stars
      Buy from Supplier

    94
    Zymo Research igg negative control dna
    Igg Negative Control Dna, supplied by Zymo Research, used in various techniques. Bioz Stars score: 94/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igg negative control dna/product/Zymo Research
    Average 94 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    igg negative control dna - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    99
    Millipore negative control dna
    Mutations within the hexa- and octamotifs recognized by <t>PPBP</t> abolish polyhedrin promoter activity. (A) Constructs carrying the unmutated and mutated polyhedrin promoters are depicted. The sequencing gels showing the mutations are on the left. (B) Transient luciferase expression measured 60 h p.i. in a luminometer. Equal amounts of plasmid <t>DNA</t> constructs were transfected into the insect cells.
    Negative Control Dna, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 616 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control dna/product/Millipore
    Average 99 stars, based on 616 article reviews
    Price from $9.99 to $1999.99
    negative control dna - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    92
    ATUM negative control dna
    Mutations within the hexa- and octamotifs recognized by <t>PPBP</t> abolish polyhedrin promoter activity. (A) Constructs carrying the unmutated and mutated polyhedrin promoters are depicted. The sequencing gels showing the mutations are on the left. (B) Transient luciferase expression measured 60 h p.i. in a luminometer. Equal amounts of plasmid <t>DNA</t> constructs were transfected into the insect cells.
    Negative Control Dna, supplied by ATUM, used in various techniques. Bioz Stars score: 92/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control dna/product/ATUM
    Average 92 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    negative control dna - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    GenePharma Company negative control dnas
    Mutations within the hexa- and octamotifs recognized by <t>PPBP</t> abolish polyhedrin promoter activity. (A) Constructs carrying the unmutated and mutated polyhedrin promoters are depicted. The sequencing gels showing the mutations are on the left. (B) Transient luciferase expression measured 60 h p.i. in a luminometer. Equal amounts of plasmid <t>DNA</t> constructs were transfected into the insect cells.
    Negative Control Dnas, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 92/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control dnas/product/GenePharma Company
    Average 92 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    negative control dnas - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    99
    Qiagen negative control
    Mutations within the hexa- and octamotifs recognized by <t>PPBP</t> abolish polyhedrin promoter activity. (A) Constructs carrying the unmutated and mutated polyhedrin promoters are depicted. The sequencing gels showing the mutations are on the left. (B) Transient luciferase expression measured 60 h p.i. in a luminometer. Equal amounts of plasmid <t>DNA</t> constructs were transfected into the insect cells.
    Negative Control, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 834 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control/product/Qiagen
    Average 99 stars, based on 834 article reviews
    Price from $9.99 to $1999.99
    negative control - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    91
    InvivoGen cpg dna negative control
    In the initial two experiments with bovine chondrocytes, HMGB1 synergized with IL-1 β on upregulating metalloproteinase production while MTDs (fMLF and <t>CpG</t> <t>DNA)</t> or HMGB1 alone showed little effect. Cells were harvested from cartilage in bovine stifle joints and cultured for 1 week. Passage 1 cells were treated with MTDs, HMGB1, and/or IL-1 β . After 24 hrs, culture medium was collected, dialyzed, and concentrated. The expression of MMPs in each medium sample was determined with Western blotting. U. C. = untreated control; CpG = CpG-rich DNA; CpG N. C. = CpG-rich DNA negative control.
    Cpg Dna Negative Control, supplied by InvivoGen, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cpg dna negative control/product/InvivoGen
    Average 91 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    cpg dna negative control - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    99
    Millipore dna content
    Relative gene expression of matrix-related target genes and <t>DNA,</t> <t>glycosaminoglycan</t> (GAG), and collagen content in intervertebral discs (IVDs) injected with rhBMP-7. A . GAG/DNA and collagen/DNA did not significantly differ between the treatments. GAG/DNA in the nucleus pulposus (NP) (open bars) was significantly higher than in the annulus fibrosus (AF) (filled bars). B . Relative gene expression of collagen type 2 alpha 1 ( COL2A1 ) and collagen type 1 alpha 1 ( COL1A1 ) did not significantly differ between treatments. Gene expression levels of COL2A1 were significantly higher in the NP than in the AF, whereas the expression levels of COL1A1 were significantly lower in the NP than in the AF. GAG/DNA and collagen/DNA are expressed as mean ± SD, and COL2A1 and COL1A1 as relative expression ± SD. **Indicates a significant difference at a 99% confidence interval (CI).
    Dna Content, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 2301 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna content/product/Millipore
    Average 99 stars, based on 2301 article reviews
    Price from $9.99 to $1999.99
    dna content - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    88
    Agilent technologies negative control plasmid dna
    Relative gene expression of matrix-related target genes and <t>DNA,</t> <t>glycosaminoglycan</t> (GAG), and collagen content in intervertebral discs (IVDs) injected with rhBMP-7. A . GAG/DNA and collagen/DNA did not significantly differ between the treatments. GAG/DNA in the nucleus pulposus (NP) (open bars) was significantly higher than in the annulus fibrosus (AF) (filled bars). B . Relative gene expression of collagen type 2 alpha 1 ( COL2A1 ) and collagen type 1 alpha 1 ( COL1A1 ) did not significantly differ between treatments. Gene expression levels of COL2A1 were significantly higher in the NP than in the AF, whereas the expression levels of COL1A1 were significantly lower in the NP than in the AF. GAG/DNA and collagen/DNA are expressed as mean ± SD, and COL2A1 and COL1A1 as relative expression ± SD. **Indicates a significant difference at a 99% confidence interval (CI).
    Negative Control Plasmid Dna, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 88/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control plasmid dna/product/Agilent technologies
    Average 88 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    negative control plasmid dna - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    Image Search Results


    Mutations within the hexa- and octamotifs recognized by PPBP abolish polyhedrin promoter activity. (A) Constructs carrying the unmutated and mutated polyhedrin promoters are depicted. The sequencing gels showing the mutations are on the left. (B) Transient luciferase expression measured 60 h p.i. in a luminometer. Equal amounts of plasmid DNA constructs were transfected into the insect cells.

    Journal: Journal of Virology

    Article Title: The Host Factor Polyhedrin Promoter Binding Protein (PPBP) Is Involved in Transcription from the Baculovirus Polyhedrin Gene Promoter

    doi:

    Figure Lengend Snippet: Mutations within the hexa- and octamotifs recognized by PPBP abolish polyhedrin promoter activity. (A) Constructs carrying the unmutated and mutated polyhedrin promoters are depicted. The sequencing gels showing the mutations are on the left. (B) Transient luciferase expression measured 60 h p.i. in a luminometer. Equal amounts of plasmid DNA constructs were transfected into the insect cells.

    Article Snippet: For determination of the DNA major and minor groove binding activities of PPBP, 1 ng of 5′-end-labeled oligonucleotide was preincubated with different concentrations of actinomycin D or distamycin A (Sigma, St. Louis, Mo.) or Hoechst 33258 or methyl green (Polysciences Inc., Warrington, Pa.) for 30 min at room temperature in a 10-μl reaction volume, followed by a 15-min incubation at room temperature with 1 μg of crude insect cell nuclear extract.

    Techniques: Activity Assay, Construct, Sequencing, Luciferase, Expressing, Plasmid Preparation, Transfection

    ) was transcribed in the presence of 60 μg of AcNPV-infected Sf 21 cell nuclear extract (NE) (lane 2) collected 36 h p.i. Lane 3 shows the transcription reaction carried out after sequestering PPBP with 30 ng of polh B domain. Lane 4 shows the transcription reaction after first specifically mopping out PPBP from the reaction mixture with 30 ng of polh B domain and then replenishing it with 60 μg of fresh nuclear extract. Lane 1 is the reaction carried out in the absence of template DNA.

    Journal: Journal of Virology

    Article Title: The Host Factor Polyhedrin Promoter Binding Protein (PPBP) Is Involved in Transcription from the Baculovirus Polyhedrin Gene Promoter

    doi:

    Figure Lengend Snippet: ) was transcribed in the presence of 60 μg of AcNPV-infected Sf 21 cell nuclear extract (NE) (lane 2) collected 36 h p.i. Lane 3 shows the transcription reaction carried out after sequestering PPBP with 30 ng of polh B domain. Lane 4 shows the transcription reaction after first specifically mopping out PPBP from the reaction mixture with 30 ng of polh B domain and then replenishing it with 60 μg of fresh nuclear extract. Lane 1 is the reaction carried out in the absence of template DNA.

    Article Snippet: For determination of the DNA major and minor groove binding activities of PPBP, 1 ng of 5′-end-labeled oligonucleotide was preincubated with different concentrations of actinomycin D or distamycin A (Sigma, St. Louis, Mo.) or Hoechst 33258 or methyl green (Polysciences Inc., Warrington, Pa.) for 30 min at room temperature in a 10-μl reaction volume, followed by a 15-min incubation at room temperature with 1 μg of crude insect cell nuclear extract.

    Techniques: Infection

    Half-life of PPBP- polh B domain complex in Bm 5 cell line. (A) DNA-protein complex from Bm 5 has a shorter half-life. Preformed polh B-PPBP ( Bm 5) complex was challenged with an excess of cold polh B domain at the times (in minutes) indicated above each lane (inset). The dissociation of the original complex was plotted as percent maximal binding versus time. (B) The polh coding strand-PPBP complex from Bm 5 has a shorter half-life. Preformed polh B coding strand-PPBP ( Bm 5) complex was challenged with an excess of cold coding strand DNA. Reactions were loaded onto a running gel at various time points (in minutes) indicated above each lane (inset). The dissociation of the original complex was plotted as percent maximal binding versus time.

    Journal: Journal of Virology

    Article Title: The Host Factor Polyhedrin Promoter Binding Protein (PPBP) Is Involved in Transcription from the Baculovirus Polyhedrin Gene Promoter

    doi:

    Figure Lengend Snippet: Half-life of PPBP- polh B domain complex in Bm 5 cell line. (A) DNA-protein complex from Bm 5 has a shorter half-life. Preformed polh B-PPBP ( Bm 5) complex was challenged with an excess of cold polh B domain at the times (in minutes) indicated above each lane (inset). The dissociation of the original complex was plotted as percent maximal binding versus time. (B) The polh coding strand-PPBP complex from Bm 5 has a shorter half-life. Preformed polh B coding strand-PPBP ( Bm 5) complex was challenged with an excess of cold coding strand DNA. Reactions were loaded onto a running gel at various time points (in minutes) indicated above each lane (inset). The dissociation of the original complex was plotted as percent maximal binding versus time.

    Article Snippet: For determination of the DNA major and minor groove binding activities of PPBP, 1 ng of 5′-end-labeled oligonucleotide was preincubated with different concentrations of actinomycin D or distamycin A (Sigma, St. Louis, Mo.) or Hoechst 33258 or methyl green (Polysciences Inc., Warrington, Pa.) for 30 min at room temperature in a 10-μl reaction volume, followed by a 15-min incubation at room temperature with 1 μg of crude insect cell nuclear extract.

    Techniques: Binding Assay

    PPBP is different from TBP. (A) Labeled TFIID consensus oligonucleotide (lanes 1 to 8) and polh B domain (lanes 9 to 12) were used in gel mobility shift assays either alone (lanes 1 and 9), with 1 μg of HeLa cell nuclear extract (lanes 2 and 10), with 20 ng of purified TBP (Promega) (lanes 4, 7, 8, and 12), or with 1 μg of Sf 9 cell nuclear extract (lanes 3 and 11). For the supershift assay TFIID oligonucleotide was incubated either with a 1:500 dilution of normal rabbit serum (NRS) (lane 5) or a 1:500 dilution of anti-TBP serum (lane 6), with normal rabbit serum and 20 ng of purified TBP (lane 7), or with anti-TBP serum and 20 ng of purified TBP (lane 8). (B) Gel retardation assays were carried out with either labeled polh B domain (lanes 1 to 4 and 9) or TFIID consensus oligonucleotide (lanes 5 to 8 and 10). The labeled polh B domain was incubated either alone (lane 1), with 1 μg of Sf 9 cell nuclear extract (lanes 2 to 4), or with 1 μg of HeLa cell nuclear extract (lane 9). The DNA-protein complex obtained (lane 2) was competed with 25 ng of unlabeled polh B domain (lane 3) or with 25 ng of unlabeled TFIID domain (lane 4). The labeled TFIID oligonucleotide was incubated either alone (lane 5), with 1 μg of Sf 9 cell nuclear extract (lanes 6 to 8), or with 1 μg of HeLa cell nuclear extract (lane 10). The TFIID- Sf 9 complex obtained (lane 6) was competed with 25 ng of unlabeled polh B domain (lane 7) or with 25 ng of unlabeled TFIID domain (lane 8). (C) Western blot analysis. Lane 1, 60 ng of purified human Sp1 protein as a negative control; lane 2, 100 μg of Sf 9 cell nuclear extract; lanes 3 and 4, 60 ng of purified TBP and 100 μg of HeLa cell nuclear extract, respectively, as positive controls. The blot was probed with a 1:3,000 dilution of anti-hTBP antibody. Protein molecular mass markers are shown on the right.

    Journal: Journal of Virology

    Article Title: The Host Factor Polyhedrin Promoter Binding Protein (PPBP) Is Involved in Transcription from the Baculovirus Polyhedrin Gene Promoter

    doi:

    Figure Lengend Snippet: PPBP is different from TBP. (A) Labeled TFIID consensus oligonucleotide (lanes 1 to 8) and polh B domain (lanes 9 to 12) were used in gel mobility shift assays either alone (lanes 1 and 9), with 1 μg of HeLa cell nuclear extract (lanes 2 and 10), with 20 ng of purified TBP (Promega) (lanes 4, 7, 8, and 12), or with 1 μg of Sf 9 cell nuclear extract (lanes 3 and 11). For the supershift assay TFIID oligonucleotide was incubated either with a 1:500 dilution of normal rabbit serum (NRS) (lane 5) or a 1:500 dilution of anti-TBP serum (lane 6), with normal rabbit serum and 20 ng of purified TBP (lane 7), or with anti-TBP serum and 20 ng of purified TBP (lane 8). (B) Gel retardation assays were carried out with either labeled polh B domain (lanes 1 to 4 and 9) or TFIID consensus oligonucleotide (lanes 5 to 8 and 10). The labeled polh B domain was incubated either alone (lane 1), with 1 μg of Sf 9 cell nuclear extract (lanes 2 to 4), or with 1 μg of HeLa cell nuclear extract (lane 9). The DNA-protein complex obtained (lane 2) was competed with 25 ng of unlabeled polh B domain (lane 3) or with 25 ng of unlabeled TFIID domain (lane 4). The labeled TFIID oligonucleotide was incubated either alone (lane 5), with 1 μg of Sf 9 cell nuclear extract (lanes 6 to 8), or with 1 μg of HeLa cell nuclear extract (lane 10). The TFIID- Sf 9 complex obtained (lane 6) was competed with 25 ng of unlabeled polh B domain (lane 7) or with 25 ng of unlabeled TFIID domain (lane 8). (C) Western blot analysis. Lane 1, 60 ng of purified human Sp1 protein as a negative control; lane 2, 100 μg of Sf 9 cell nuclear extract; lanes 3 and 4, 60 ng of purified TBP and 100 μg of HeLa cell nuclear extract, respectively, as positive controls. The blot was probed with a 1:3,000 dilution of anti-hTBP antibody. Protein molecular mass markers are shown on the right.

    Article Snippet: For determination of the DNA major and minor groove binding activities of PPBP, 1 ng of 5′-end-labeled oligonucleotide was preincubated with different concentrations of actinomycin D or distamycin A (Sigma, St. Louis, Mo.) or Hoechst 33258 or methyl green (Polysciences Inc., Warrington, Pa.) for 30 min at room temperature in a 10-μl reaction volume, followed by a 15-min incubation at room temperature with 1 μg of crude insect cell nuclear extract.

    Techniques: Labeling, Mobility Shift, Purification, Incubation, Electrophoretic Mobility Shift Assay, Western Blot, Negative Control

    PPBP- polh promoter interaction is required for transcription in vivo. (A) Luciferase activity of the reporter construct pKN luc (pKN) is decreased in the presence of increasing amounts of the competitor plasmid pAJ pol (C). The total amount of transfected plasmid DNA was normalized to 20 μg with pUC18. The bars are labeled as follows: pKN, 10 μg of pKN luc in the absence of both competitor and pUC18; pKN+CO, 10 μg of pKN luc cotransfected with 10 μg of pUC18 in the absence of competitor; pKN+C2.5, 10 μg of pKN luc cotransfected with 2.5 μg of competitor; pKN+C5, 10 μg of pKN luc cotransfected with 5 μg of competitor; pKN+C10, 10 μg of pKN luc cotransfected with 10 μg of competitor. Southern hybridization of a DNA dot blot of transfected cells is shown in the right-hand panel. Replicates of three dilutions of cells from each transfection set were blotted and probed with the radiolabeled luc gene. Uninfected cells and vAc luc (a recombinant virus carrying the luc gene in place of the polyhedrin gene)-infected cells are shown as negative and positive controls, respectively. (B) Luciferase activity of the reporter construct pKN luc (pKN) is decreased in the presence of increasing amounts of the competitor plasmid pAJ pol (C) and in the presence of 1 μg of α-amanitin/ml added 8 h posttransfection. The bars are labeled as in panel A. The right-hand panel shows a dot blot of cells from each transfection set with the radiolabeled luc fragment as a probe. Error bars indicate standard deviations.

    Journal: Journal of Virology

    Article Title: The Host Factor Polyhedrin Promoter Binding Protein (PPBP) Is Involved in Transcription from the Baculovirus Polyhedrin Gene Promoter

    doi:

    Figure Lengend Snippet: PPBP- polh promoter interaction is required for transcription in vivo. (A) Luciferase activity of the reporter construct pKN luc (pKN) is decreased in the presence of increasing amounts of the competitor plasmid pAJ pol (C). The total amount of transfected plasmid DNA was normalized to 20 μg with pUC18. The bars are labeled as follows: pKN, 10 μg of pKN luc in the absence of both competitor and pUC18; pKN+CO, 10 μg of pKN luc cotransfected with 10 μg of pUC18 in the absence of competitor; pKN+C2.5, 10 μg of pKN luc cotransfected with 2.5 μg of competitor; pKN+C5, 10 μg of pKN luc cotransfected with 5 μg of competitor; pKN+C10, 10 μg of pKN luc cotransfected with 10 μg of competitor. Southern hybridization of a DNA dot blot of transfected cells is shown in the right-hand panel. Replicates of three dilutions of cells from each transfection set were blotted and probed with the radiolabeled luc gene. Uninfected cells and vAc luc (a recombinant virus carrying the luc gene in place of the polyhedrin gene)-infected cells are shown as negative and positive controls, respectively. (B) Luciferase activity of the reporter construct pKN luc (pKN) is decreased in the presence of increasing amounts of the competitor plasmid pAJ pol (C) and in the presence of 1 μg of α-amanitin/ml added 8 h posttransfection. The bars are labeled as in panel A. The right-hand panel shows a dot blot of cells from each transfection set with the radiolabeled luc fragment as a probe. Error bars indicate standard deviations.

    Article Snippet: For determination of the DNA major and minor groove binding activities of PPBP, 1 ng of 5′-end-labeled oligonucleotide was preincubated with different concentrations of actinomycin D or distamycin A (Sigma, St. Louis, Mo.) or Hoechst 33258 or methyl green (Polysciences Inc., Warrington, Pa.) for 30 min at room temperature in a 10-μl reaction volume, followed by a 15-min incubation at room temperature with 1 μg of crude insect cell nuclear extract.

    Techniques: In Vivo, Luciferase, Activity Assay, Construct, Plasmid Preparation, Transfection, Labeling, Hybridization, Dot Blot, Recombinant, Infection

    Electrophoretic mobility shift assay analysis of recombinant CsoR variants binding to the putative promoters upstream of copA (P copA ), copB (P copB ), and mco (P mco ). (A) Schematic representation of the copA - copZ and copB - mco operons with putative promoter sequences. (B to D) Recombinant wild-type (WT) CsoR WT or the CsoR CHC mutant (CsoR C41A/H66A/C70A [CHC]) were purified and tested for binding to PCR products containing the DNA sequences (∼200 bp) upstream of the respective start codon, and a control DNA fragment of nonspecific DNA sequence (nsDNA). The concentrations of protein (in micromolar) are shown above the lanes. (B) Incubation of P copA DNA with wild-type apo-CsoR, but not Cu(I)-CsoR, retards the migration of P copA . (C) CsoR CHC retards migration of P copA in both the presence and absence of Cu(I). (D) CsoR retards migration of P copA and P copB , but not migration of P mco .

    Journal: mBio

    Article Title: Mobile-Genetic-Element-Encoded Hypertolerance to Copper Protects Staphylococcus aureus from Killing by Host Phagocytes

    doi: 10.1128/mBio.00550-18

    Figure Lengend Snippet: Electrophoretic mobility shift assay analysis of recombinant CsoR variants binding to the putative promoters upstream of copA (P copA ), copB (P copB ), and mco (P mco ). (A) Schematic representation of the copA - copZ and copB - mco operons with putative promoter sequences. (B to D) Recombinant wild-type (WT) CsoR WT or the CsoR CHC mutant (CsoR C41A/H66A/C70A [CHC]) were purified and tested for binding to PCR products containing the DNA sequences (∼200 bp) upstream of the respective start codon, and a control DNA fragment of nonspecific DNA sequence (nsDNA). The concentrations of protein (in micromolar) are shown above the lanes. (B) Incubation of P copA DNA with wild-type apo-CsoR, but not Cu(I)-CsoR, retards the migration of P copA . (C) CsoR CHC retards migration of P copA in both the presence and absence of Cu(I). (D) CsoR retards migration of P copA and P copB , but not migration of P mco .

    Article Snippet: EMSAs were performed by incubating fully reduced (as determined with Ellman’s reagent) recombinant CsoR variants (0 to 100 µM) with the respective promoter DNA plus the negative-control DNA (both 0.1 µM) in 20 mM HEPES (pH 7.0), 100 mM NaCl, 100 ng/µl poly(dI-dC) (Sigma), 1 mM DTT, 0.4 mg/ml bovine serum albumin (BSA) at room temperature for 30 min. All incubations were performed anaerobically inside an N2 atmosphere glove box ([O2 ] < 5 ppm) (Belle Technology), and Cu(I)-CsoR was prepared by anaerobically incubating protein for 10 min with 1 mol equivalent of Cu(I) prepared as previously described ( ).

    Techniques: Electrophoretic Mobility Shift Assay, Recombinant, Binding Assay, Mutagenesis, Purification, Polymerase Chain Reaction, Sequencing, Incubation, Migration

    PCR and Southern blot experiments showed that group II intron-based vectors efficiently targeted the Clostridium cellulolyticum mdh and ldh genes in pure cultures . (A) Primers MdhF/intronR1 (5' junction) and intronF1/MdhR (3' junction) produced bands from the Ccel_0137 mutant cells (lanes 1 and 2) but not from wild-type (lanes 4 and 5). Primers MdhF/MdhR amplified a single band from the mutant (lane 3) that is 915 bp larger than the wild-type (lane 6). (B) Primers LdhF/intronR1 (5' junction) and intronF1/LdhR (3' junction) produced bands in the Ccel_2485 mutant cells (lanes 1 and 2) but not in the wild-type (lanes 4 and 5). Primers LdhF/LdhR, amplified a single band from the mutant (lane 3), which is 915 bp larger than the wild-type (lane 6). (C) Amplifications using plasmid-specific primers pWH199F2 and pintronR1 confirmed plasmid curing. Lane 1, positive control (plasmid); lane 2, Ccel_0137 mutant; lane 3, Ccel_2485 mutant; lane 4, negative control. (D) Amplification from wild-type DNA using primers LdhF-R (lane 1) and MdhF-R (lane 2) produced low molecular weight products. Genes containing insertions were amplified from the ldh mutant using primers LdhF-R (lane 3) and from the mdh mutant using primers MdhF-R (lane 4), producing larger products. The same size PCR products were obtained in amplifications from ldh mdh mutant DNA using primers LdhF-R (lane 5) and MdhF-R (lane 6). (E) A Southern blot using an intron-specific probe confirmed the intron insertions in DNA digested with Eco RI. No band was detected in the chromosomal DNA of wild-type cells (lane 1), while two bands in the ldh mdh mutant (lane 2) correspond to bands in the ldh mutant (lane 3) and the mdh mutant (lane 4). No band corresponding to the plasmid (lane 5) was identified in any of the plasmid-cured strains.

    Journal: Biotechnology for Biofuels

    Article Title: Combined inactivation of the Clostridium cellulolyticum lactate and malate dehydrogenase genes substantially increases ethanol yield from cellulose and switchgrass fermentations

    doi: 10.1186/1754-6834-5-2

    Figure Lengend Snippet: PCR and Southern blot experiments showed that group II intron-based vectors efficiently targeted the Clostridium cellulolyticum mdh and ldh genes in pure cultures . (A) Primers MdhF/intronR1 (5' junction) and intronF1/MdhR (3' junction) produced bands from the Ccel_0137 mutant cells (lanes 1 and 2) but not from wild-type (lanes 4 and 5). Primers MdhF/MdhR amplified a single band from the mutant (lane 3) that is 915 bp larger than the wild-type (lane 6). (B) Primers LdhF/intronR1 (5' junction) and intronF1/LdhR (3' junction) produced bands in the Ccel_2485 mutant cells (lanes 1 and 2) but not in the wild-type (lanes 4 and 5). Primers LdhF/LdhR, amplified a single band from the mutant (lane 3), which is 915 bp larger than the wild-type (lane 6). (C) Amplifications using plasmid-specific primers pWH199F2 and pintronR1 confirmed plasmid curing. Lane 1, positive control (plasmid); lane 2, Ccel_0137 mutant; lane 3, Ccel_2485 mutant; lane 4, negative control. (D) Amplification from wild-type DNA using primers LdhF-R (lane 1) and MdhF-R (lane 2) produced low molecular weight products. Genes containing insertions were amplified from the ldh mutant using primers LdhF-R (lane 3) and from the mdh mutant using primers MdhF-R (lane 4), producing larger products. The same size PCR products were obtained in amplifications from ldh mdh mutant DNA using primers LdhF-R (lane 5) and MdhF-R (lane 6). (E) A Southern blot using an intron-specific probe confirmed the intron insertions in DNA digested with Eco RI. No band was detected in the chromosomal DNA of wild-type cells (lane 1), while two bands in the ldh mdh mutant (lane 2) correspond to bands in the ldh mutant (lane 3) and the mdh mutant (lane 4). No band corresponding to the plasmid (lane 5) was identified in any of the plasmid-cured strains.

    Article Snippet: To insert the intron into pWH199 downstream of a Clostridium pasteurianum ferredoxin (Fd) promoter [ ], a DNA fragment containing the intron and ltrA was amplified from pJIR750ai (Sigma-Aldrich, St. Louis, MO) by PCR using primers pJIR750aiXmaIF and pJIR750aiXhoIR (Additional file ).

    Techniques: Polymerase Chain Reaction, Southern Blot, Produced, Mutagenesis, Amplification, Plasmid Preparation, Positive Control, Negative Control, Molecular Weight

    High levels of FEZ1 expression and reduced HIV-1 infectivity in neurons. ( A ) qPCR showing the level of endogenous FEZ1 expression in human lines and rat primary cells of brain origin. Cytoplasmic RNA prepared from human brain cell lines; neuronblastoma line (SH-SY5Y), glioblastoma/astrocytoma (1321N1, U87MG, and U138MG), and microglia (CHME3) or from primary rat hippocampus neurons (Rat N) and primary rat cortex astrocytes (Rat A) was reverse transcribed and used as template for qPCR. Data are median copy numbers normalized to cypA (for human cells) or GAPDH (for rat cells) obtained in triplicates from 2 independent RNA preparations. ( B ) Western blotting showing the levels of FEZ1 protein in representative human brain cell lines. Upper , endogenous FEZ1 expression was detected using anti-FEZ1 antibodies. Lower , loading of equal amounts of protein was confirmed using NCBP1 antibody. ( C and D ) Susceptibility of brain cell lines to infection with pseudotyped HIV-1. The 3 representative lines as in B were incubated with various amounts of HIV-1-puro ( C ) or 2 different dilutions (1:2 and 1:10) of HIV-1-luc ( D ) viruses. Noninfected (NI) cells were included as negative control. Cells were either selected in medium containing puromycin and the number of HIV-1-puro transduced colonies was counted after 8–12 days or were lysed and assayed for luciferase activity 48 h postinfection. Similar results were obtained in at least 3 independent experiments. ( E and F ) Analysis of viral DNA synthesis using qPCR. The indicated cell lines were infected with different dilutions (1:2, 1:5, and 1:10) of HIV-1-puro pseudotyped with VSV-G envelope. Low molecular hirt DNA was isolated at 24 h after infection and the amount of total viral DNA ( E ) and circular DNA ( F ) synthesized was measured by qPCR using primers specific to puromycin or 2-LTR DNA, respectively. Each sample was assayed in triplicate at a minimum of 3 different time points.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: The brain-specific factor FEZ1 is a determinant of neuronal susceptibility to HIV-1 infection

    doi: 10.1073/pnas.0900502106

    Figure Lengend Snippet: High levels of FEZ1 expression and reduced HIV-1 infectivity in neurons. ( A ) qPCR showing the level of endogenous FEZ1 expression in human lines and rat primary cells of brain origin. Cytoplasmic RNA prepared from human brain cell lines; neuronblastoma line (SH-SY5Y), glioblastoma/astrocytoma (1321N1, U87MG, and U138MG), and microglia (CHME3) or from primary rat hippocampus neurons (Rat N) and primary rat cortex astrocytes (Rat A) was reverse transcribed and used as template for qPCR. Data are median copy numbers normalized to cypA (for human cells) or GAPDH (for rat cells) obtained in triplicates from 2 independent RNA preparations. ( B ) Western blotting showing the levels of FEZ1 protein in representative human brain cell lines. Upper , endogenous FEZ1 expression was detected using anti-FEZ1 antibodies. Lower , loading of equal amounts of protein was confirmed using NCBP1 antibody. ( C and D ) Susceptibility of brain cell lines to infection with pseudotyped HIV-1. The 3 representative lines as in B were incubated with various amounts of HIV-1-puro ( C ) or 2 different dilutions (1:2 and 1:10) of HIV-1-luc ( D ) viruses. Noninfected (NI) cells were included as negative control. Cells were either selected in medium containing puromycin and the number of HIV-1-puro transduced colonies was counted after 8–12 days or were lysed and assayed for luciferase activity 48 h postinfection. Similar results were obtained in at least 3 independent experiments. ( E and F ) Analysis of viral DNA synthesis using qPCR. The indicated cell lines were infected with different dilutions (1:2, 1:5, and 1:10) of HIV-1-puro pseudotyped with VSV-G envelope. Low molecular hirt DNA was isolated at 24 h after infection and the amount of total viral DNA ( E ) and circular DNA ( F ) synthesized was measured by qPCR using primers specific to puromycin or 2-LTR DNA, respectively. Each sample was assayed in triplicate at a minimum of 3 different time points.

    Article Snippet: Hirt DNA was isolated at 24 h after infection ( ) and 1 μL used as template for 40 cycles (15 s at 94°C, 60 s at 60°C, and 60 s at 72°C) of 3-step PCR of total viral DNA and DNA circles (2-LTR) using SYBR Green JumpStart Taq ReadyMix (Sigma) including 200 nM of each primer puro-S2 5′CTCGACATCGGCAAGGTGTG3′ and puro-A2 5′GCCTTCCATCTGTTGCTGCG3′ or U3rev1: 5′GGGAGTGAATTAGCCCTTCC3′ and U5for1: 5′GTAGTGTGTGCCCGTCTGT3′, respectively.

    Techniques: Expressing, Infection, Real-time Polymerase Chain Reaction, Western Blot, Incubation, Negative Control, Luciferase, Activity Assay, DNA Synthesis, Isolation, Synthesized

    ChIRP-Seq reveals m-Meg3 enrichment at multiple m-c-Met loci. (A) Representative agarose gel image showing the specificity of the m-Meg3 ChIRP probes. RNA was isolated after m-Meg3 ChIRP from the V3 (vector) and the M5 (stable MIN6-4N cells stably expressing the m-Meg3-3 isoform which lacks exon 4) cell lines. The RNA was then used for RT-PCR. Input corresponds to the RT-PCR product using RNA isolated before m-Meg3 ChIRP-Seq. Odd and even correspond to RT-PCR using RNA after m-Meg3 ChIRP with probes located at odd and even locations on the m-Meg3 RNA. The gel image represents products of the RT-PCR performed with primers 1F/1R (flanking exon 7 and exon 8) that recognize all m-Meg3 isoforms. gapdh served as the negative control. cDNAs from three replicates of V3 and M5 ChIRP-Seq were pooled due to low yields and sequenced. (B) m-Meg3 ChIRP-PCR in a stable cell line expressing full-length m-Meg3. RNA was isolated after m-Meg3 ChIRP from the 9V (vector) and the 14M (stable MIN6-4N cells with the m-Meg3-1 isoform, which encompasses all 10 exons) cell lines. The RNA was then used for RT-PCR. Input corresponds to RT-PCR from RNA isolated before m-Meg3 ChIRP. RT-PCR was performed with primers 1F/1R (flanking exons 7 and 8) that recognize all m-Meg3 isoforms and further confirmed with the ex3F/ex4R primer pair (flanking exons 3 and 4), specific for the m-Meg3-1 isoform. gapdh served as the negative control. (C) m-Meg3 enrichment patterns at discrete m-c-Met genomic regions in different m-Meg3 stable cell lines. DNA was isolated after m-Meg3 ChIRP from two different m-Meg-3 stable MIN6-4N cell lines and their respective vector controls. The DNA was then subjected to whole-genome amplification (WGA) and subsequent purification. The purified WGA DNA was then used to set up qPCRs in duplicate with primers specific for m-c-Met genomic regions identified by m-Meg3 ChIRP-Seq, namely, the m-c-Met upstream region, the m-c-Met exon 18 region, the m-c-Met exon 20 region, and also the previously identified kb +63 enhancer. The qPCR data are represented as percent input of DNA.

    Journal: Molecular and Cellular Biology

    Article Title: Long Noncoding RNA MEG3 Is an Epigenetic Determinant of Oncogenic Signaling in Functional Pancreatic Neuroendocrine Tumor Cells

    doi: 10.1128/MCB.00278-17

    Figure Lengend Snippet: ChIRP-Seq reveals m-Meg3 enrichment at multiple m-c-Met loci. (A) Representative agarose gel image showing the specificity of the m-Meg3 ChIRP probes. RNA was isolated after m-Meg3 ChIRP from the V3 (vector) and the M5 (stable MIN6-4N cells stably expressing the m-Meg3-3 isoform which lacks exon 4) cell lines. The RNA was then used for RT-PCR. Input corresponds to the RT-PCR product using RNA isolated before m-Meg3 ChIRP-Seq. Odd and even correspond to RT-PCR using RNA after m-Meg3 ChIRP with probes located at odd and even locations on the m-Meg3 RNA. The gel image represents products of the RT-PCR performed with primers 1F/1R (flanking exon 7 and exon 8) that recognize all m-Meg3 isoforms. gapdh served as the negative control. cDNAs from three replicates of V3 and M5 ChIRP-Seq were pooled due to low yields and sequenced. (B) m-Meg3 ChIRP-PCR in a stable cell line expressing full-length m-Meg3. RNA was isolated after m-Meg3 ChIRP from the 9V (vector) and the 14M (stable MIN6-4N cells with the m-Meg3-1 isoform, which encompasses all 10 exons) cell lines. The RNA was then used for RT-PCR. Input corresponds to RT-PCR from RNA isolated before m-Meg3 ChIRP. RT-PCR was performed with primers 1F/1R (flanking exons 7 and 8) that recognize all m-Meg3 isoforms and further confirmed with the ex3F/ex4R primer pair (flanking exons 3 and 4), specific for the m-Meg3-1 isoform. gapdh served as the negative control. (C) m-Meg3 enrichment patterns at discrete m-c-Met genomic regions in different m-Meg3 stable cell lines. DNA was isolated after m-Meg3 ChIRP from two different m-Meg-3 stable MIN6-4N cell lines and their respective vector controls. The DNA was then subjected to whole-genome amplification (WGA) and subsequent purification. The purified WGA DNA was then used to set up qPCRs in duplicate with primers specific for m-c-Met genomic regions identified by m-Meg3 ChIRP-Seq, namely, the m-c-Met upstream region, the m-c-Met exon 18 region, the m-c-Met exon 20 region, and also the previously identified kb +63 enhancer. The qPCR data are represented as percent input of DNA.

    Article Snippet: For validation of the ChIRP-Seq data, the DNA obtained from ChIRP was subjected to two rounds of whole-genome amplification (WGA) to amplify the ChIRP DNA using a WGA3 kit with WGA polymerase (Sigma-Aldrich, St. Louis, MO).

    Techniques: Agarose Gel Electrophoresis, Isolation, Plasmid Preparation, Stable Transfection, Expressing, Reverse Transcription Polymerase Chain Reaction, Negative Control, Polymerase Chain Reaction, Whole Genome Amplification, Purification, Real-time Polymerase Chain Reaction

    Viral chromatin structure in early phases of infection. ( A ) The illustration of the structure of Ad genome. Arrows represent each promoter region of viral genes. Target region of primer set for Hexon is indicated as a bar. ( B ) ChIP assays using quantitative PCR (qPCR). HeLa cells were infected with HAdV5 at an MOI of 100 and harvested at 1, 2, 4, 6 or 10 hpi. In the case of 10 hpi, HU was added right after infection to prevent viral DNA replication. The cells were cross-linked by formaldehyde and lysed. The lysates were subjected to immunoprecipitation with antibodies against histone H3, acetylated histone H3 (AcH3), protein VII and FLAG. qPCR was performed with primers for five regions of the viral genome (the E1A promoter region, E1A pro; the E3 promoter region, E3 pro; the E4 promoter region, E4 pro; major late promoter region, MLP; and hexon ORF region, Hexon) and immunoprecipitated DNA as templates. ( C ) Re-ChIP assays with antiprotein VII antibody. HeLa cells were infected with HAdV5 at an MOI of 100 and harvested at 6 hpi. The cells were subjected to first ChIP using anti-FLAG (lanes 4–7) or antiprotein VII (lanes 8–11) antibodies, and the immunoprecipitated complex was then subjected to the second ChIP with anti-FLAG (lanes 5 and 9), antihistone H3 (lanes 6 and 10) and anti-AcH3 (lanes 7 and 11) antibodies. For lanes 4 and 8, DNAs purified from 10% of the first immunocomplexes were used as template. Immunoprecipitated DNA was amplified by semi-quantitative PCR using primer sets for E1A pro (upper panel) and MLP (lower panel). PCR products were separated on a 7% polyacrylamide gel and visualized by staining with EtBr. Input DNAs (lanes 1–3) were purified from 0.2, 0.05 and 0.0125% of cell lysates used for first ChIP. ( D ) Re-ChIP assays with anti-RNA polymerase II (pol II) antibody. Re-ChIP assays were performed as described in ( C ), except that anti-pol II antibody was used for the first immunoprecipitation (lanes 8–11).

    Journal: Nucleic Acids Research

    Article Title: Cellular and viral chromatin proteins are positive factors in the regulation of adenovirus gene expression

    doi: 10.1093/nar/gkq783

    Figure Lengend Snippet: Viral chromatin structure in early phases of infection. ( A ) The illustration of the structure of Ad genome. Arrows represent each promoter region of viral genes. Target region of primer set for Hexon is indicated as a bar. ( B ) ChIP assays using quantitative PCR (qPCR). HeLa cells were infected with HAdV5 at an MOI of 100 and harvested at 1, 2, 4, 6 or 10 hpi. In the case of 10 hpi, HU was added right after infection to prevent viral DNA replication. The cells were cross-linked by formaldehyde and lysed. The lysates were subjected to immunoprecipitation with antibodies against histone H3, acetylated histone H3 (AcH3), protein VII and FLAG. qPCR was performed with primers for five regions of the viral genome (the E1A promoter region, E1A pro; the E3 promoter region, E3 pro; the E4 promoter region, E4 pro; major late promoter region, MLP; and hexon ORF region, Hexon) and immunoprecipitated DNA as templates. ( C ) Re-ChIP assays with antiprotein VII antibody. HeLa cells were infected with HAdV5 at an MOI of 100 and harvested at 6 hpi. The cells were subjected to first ChIP using anti-FLAG (lanes 4–7) or antiprotein VII (lanes 8–11) antibodies, and the immunoprecipitated complex was then subjected to the second ChIP with anti-FLAG (lanes 5 and 9), antihistone H3 (lanes 6 and 10) and anti-AcH3 (lanes 7 and 11) antibodies. For lanes 4 and 8, DNAs purified from 10% of the first immunocomplexes were used as template. Immunoprecipitated DNA was amplified by semi-quantitative PCR using primer sets for E1A pro (upper panel) and MLP (lower panel). PCR products were separated on a 7% polyacrylamide gel and visualized by staining with EtBr. Input DNAs (lanes 1–3) were purified from 0.2, 0.05 and 0.0125% of cell lysates used for first ChIP. ( D ) Re-ChIP assays with anti-RNA polymerase II (pol II) antibody. Re-ChIP assays were performed as described in ( C ), except that anti-pol II antibody was used for the first immunoprecipitation (lanes 8–11).

    Article Snippet: HeLa cells were transfected with Ad-core, TP-DNA, or the reconstituted complexes (100 ng DNA) using GeneJuice (Novagen) according to the manufacturer’s protocol.

    Techniques: Infection, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Immunoprecipitation, Purification, Amplification, Polymerase Chain Reaction, Staining

    Ad-core/TP-DNA transfection assays. ( A ) ChIP assays of viral chromatin in transfected cells. HeLa cells were transfected with TP-DNA (left three panels) or Ad-core (right three panels). At 8, 16 and 24 hpt, cells were collected, and cell lysates were subjected to ChIP assays using indicated antibodies. Semi-quantitative PCR was performed using primer sets for E1A pro, E4 pro or MLP and immunoprecipitated DNA as templates. PCR products were separated on a 7% polyacrylamide gel and visualized by staining with EtBr. Input DNAs (lanes 13–15 and 28–30) were purified from 2% of cell lysates used for ChIP. ( B ) Semi-quantitative RT–PCR assays. HeLa cells were transfected with Ad-core (Ad; lanes 2, 5, 8 and 11), TP-DNA (TP; lanes 1, 4, 7 and 10), or mock-DNA (Mo; lanes 3, 6, 9 and 12), and total RNAs were purified at 12 (lanes 1–3 and 7–9) and 24 hpt (lanes 4–6 and 10–12). cDNAs were synthesized without (lanes 1–6) or with (lanes 7–12) reverse transcription. Semi-quantitative PCR was performed using primer sets for E1A, E4, MLP and β-actin mRNAs. PCR products were analyzed as described in the legend for (A). ( C ) The amount of nuclear and cytoplasmic viral DNA in transfected cells. Ad-core and TP-DNA were used for transfection (100 ng DNA) into HeLa cells. Transfected cells were cultured in the presence of HU to prevent viral DNA replication. At 12 (lower panel, lanes 1–12) and 24 hpt (lanes 13–30), nuclear and cytoplasmic fractions were prepared from Ad-core- (lower panel, lanes 1–6 and 13–18), TP-DNA- (lanes 7–12 and 19–24), and mock-transfected cells (lanes 25–30) as described in ‘Materials and Methods’ section. To confirm the separation of each fraction, nuclear (upper panels, lanes 1, 3, 5, 7 and 9) and cytoplasmic fractions (lanes 2, 4, 6, 8 and 10) were subjected to western blot analyses using antihistone H3 and anti-Hsp90 antibodies for nuclear and cytoplasmic marker proteins, respectively. The viral DNA of nuclear (lower panel, lanes 1–3, 7–9, 13–15, 19–21 and 25–27) and cytoplasmic fractions (lanes 4–6, 10–12, 16–18, 22–24 and 28–30) was amplified by semi-quantitative PCR with a primer set for the MLP region. PCR products were analyzed as described in the legend for (A). For each fraction, 4-fold serial dilution (1, 1/4 and 1/16 volume) was used as templates for PCR.

    Journal: Nucleic Acids Research

    Article Title: Cellular and viral chromatin proteins are positive factors in the regulation of adenovirus gene expression

    doi: 10.1093/nar/gkq783

    Figure Lengend Snippet: Ad-core/TP-DNA transfection assays. ( A ) ChIP assays of viral chromatin in transfected cells. HeLa cells were transfected with TP-DNA (left three panels) or Ad-core (right three panels). At 8, 16 and 24 hpt, cells were collected, and cell lysates were subjected to ChIP assays using indicated antibodies. Semi-quantitative PCR was performed using primer sets for E1A pro, E4 pro or MLP and immunoprecipitated DNA as templates. PCR products were separated on a 7% polyacrylamide gel and visualized by staining with EtBr. Input DNAs (lanes 13–15 and 28–30) were purified from 2% of cell lysates used for ChIP. ( B ) Semi-quantitative RT–PCR assays. HeLa cells were transfected with Ad-core (Ad; lanes 2, 5, 8 and 11), TP-DNA (TP; lanes 1, 4, 7 and 10), or mock-DNA (Mo; lanes 3, 6, 9 and 12), and total RNAs were purified at 12 (lanes 1–3 and 7–9) and 24 hpt (lanes 4–6 and 10–12). cDNAs were synthesized without (lanes 1–6) or with (lanes 7–12) reverse transcription. Semi-quantitative PCR was performed using primer sets for E1A, E4, MLP and β-actin mRNAs. PCR products were analyzed as described in the legend for (A). ( C ) The amount of nuclear and cytoplasmic viral DNA in transfected cells. Ad-core and TP-DNA were used for transfection (100 ng DNA) into HeLa cells. Transfected cells were cultured in the presence of HU to prevent viral DNA replication. At 12 (lower panel, lanes 1–12) and 24 hpt (lanes 13–30), nuclear and cytoplasmic fractions were prepared from Ad-core- (lower panel, lanes 1–6 and 13–18), TP-DNA- (lanes 7–12 and 19–24), and mock-transfected cells (lanes 25–30) as described in ‘Materials and Methods’ section. To confirm the separation of each fraction, nuclear (upper panels, lanes 1, 3, 5, 7 and 9) and cytoplasmic fractions (lanes 2, 4, 6, 8 and 10) were subjected to western blot analyses using antihistone H3 and anti-Hsp90 antibodies for nuclear and cytoplasmic marker proteins, respectively. The viral DNA of nuclear (lower panel, lanes 1–3, 7–9, 13–15, 19–21 and 25–27) and cytoplasmic fractions (lanes 4–6, 10–12, 16–18, 22–24 and 28–30) was amplified by semi-quantitative PCR with a primer set for the MLP region. PCR products were analyzed as described in the legend for (A). For each fraction, 4-fold serial dilution (1, 1/4 and 1/16 volume) was used as templates for PCR.

    Article Snippet: HeLa cells were transfected with Ad-core, TP-DNA, or the reconstituted complexes (100 ng DNA) using GeneJuice (Novagen) according to the manufacturer’s protocol.

    Techniques: Transfection, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Immunoprecipitation, Polymerase Chain Reaction, Staining, Purification, Quantitative RT-PCR, Synthesized, Cell Culture, Western Blot, Marker, Amplification, Serial Dilution

    Reconstitution of protein VII–DNA complexes. ( A ) Electrophoresis mobility shift assays. Left panel shows Coomassie Brilliant Blue staining of recombinant protein VII (100 ng, lane 2) separated by a 12.5% SDS–PAGE. Lane 1 shows molecular size markers (M). pSV-Luc (100 ng) was incubated at 37°C for 15 min in the absence (right panel, lane 2) or presence of protein VII (25, 50, 100, 200, 300, 400 ng for lanes 3, 4, 5, 6, 7 and 8, respectively). The samples were separated on a 1% agarose gel in 0.5 × TBE buffer, and DNAs were visualized by staining with EtBr. Lane 1 shows DNA size markers (M). ( B ) The illustration of the pSV-Luc structure. Filled triangle and open boxes represent the promoter region and the ORF region, respectively. Two black bars are target regions for ChIP assays. ( C ) Luciferase assays. HeLa cells were transfected with the reconstituted complexes shown in (A). At 24 hpt, cell lysates were prepared, and the luciferase activity was measured. ( D ) ChIP assays. pSV-Luc (100 ng) was incubated without (DNA alone) or with protein VII (100 ng) and used for transfection into HeLa cells as described in (A). At 24 hpt, cells were harvested, and cell lysates were subjected to ChIP assays. qPCR was performed using primer sets for SV40 promoter (SV40 pro) and ORF region of β-lactamase gene (Amp ORF) and immunoprecipitated DNA as templates. Note that the binding level of Sp1 is calculated as fold enrichment relative to negative control (anti-FLAG antibody) and then normalized by that at Amp ORF in naked DNA-transfected cells. ( E ) The amount of pSV-Luc in the nucleus of transfected cells. Cells transfected as described in (D) was harvested at 24 hpt, and nuclear and cytoplasmic fractions were prepared as performed in Figure 4 C. DNAs recovered from nuclear fraction were subjected to qPCR using primer sets for SV40 pro and β-actin gene (for cellular genome number). The amounts of pSV-Luc in the nucleus were normalized by cellular genome number and graphed.

    Journal: Nucleic Acids Research

    Article Title: Cellular and viral chromatin proteins are positive factors in the regulation of adenovirus gene expression

    doi: 10.1093/nar/gkq783

    Figure Lengend Snippet: Reconstitution of protein VII–DNA complexes. ( A ) Electrophoresis mobility shift assays. Left panel shows Coomassie Brilliant Blue staining of recombinant protein VII (100 ng, lane 2) separated by a 12.5% SDS–PAGE. Lane 1 shows molecular size markers (M). pSV-Luc (100 ng) was incubated at 37°C for 15 min in the absence (right panel, lane 2) or presence of protein VII (25, 50, 100, 200, 300, 400 ng for lanes 3, 4, 5, 6, 7 and 8, respectively). The samples were separated on a 1% agarose gel in 0.5 × TBE buffer, and DNAs were visualized by staining with EtBr. Lane 1 shows DNA size markers (M). ( B ) The illustration of the pSV-Luc structure. Filled triangle and open boxes represent the promoter region and the ORF region, respectively. Two black bars are target regions for ChIP assays. ( C ) Luciferase assays. HeLa cells were transfected with the reconstituted complexes shown in (A). At 24 hpt, cell lysates were prepared, and the luciferase activity was measured. ( D ) ChIP assays. pSV-Luc (100 ng) was incubated without (DNA alone) or with protein VII (100 ng) and used for transfection into HeLa cells as described in (A). At 24 hpt, cells were harvested, and cell lysates were subjected to ChIP assays. qPCR was performed using primer sets for SV40 promoter (SV40 pro) and ORF region of β-lactamase gene (Amp ORF) and immunoprecipitated DNA as templates. Note that the binding level of Sp1 is calculated as fold enrichment relative to negative control (anti-FLAG antibody) and then normalized by that at Amp ORF in naked DNA-transfected cells. ( E ) The amount of pSV-Luc in the nucleus of transfected cells. Cells transfected as described in (D) was harvested at 24 hpt, and nuclear and cytoplasmic fractions were prepared as performed in Figure 4 C. DNAs recovered from nuclear fraction were subjected to qPCR using primer sets for SV40 pro and β-actin gene (for cellular genome number). The amounts of pSV-Luc in the nucleus were normalized by cellular genome number and graphed.

    Article Snippet: HeLa cells were transfected with Ad-core, TP-DNA, or the reconstituted complexes (100 ng DNA) using GeneJuice (Novagen) according to the manufacturer’s protocol.

    Techniques: Electrophoresis, Mobility Shift, Staining, Recombinant, SDS Page, Incubation, Agarose Gel Electrophoresis, Chromatin Immunoprecipitation, Luciferase, Transfection, Activity Assay, Real-time Polymerase Chain Reaction, Immunoprecipitation, Binding Assay, Negative Control

    Effect of knockdown of TAF-I expression on Sp1 recruitment. ( A ) Expression level of TAF-I. Western blot analyses were performed with lysates from HeLa cells treated with control siRNA (siControl, lanes 1–3) or siRNA for TAF-I (siTAF-I, lane 4). For siControl-treated cells, 25% (lane 1) and 50% (lane 2) volume of lysate were also loaded. ( B ) Transfection of siRNA-treated cells with reconstituted protein VII–DNA complexes. siControl- or siTAF-I-treated cells were transfected with reconstituted protein VII–DNA complexes, and cell lysates were subjected to ChIP assays as described in Figure 5 D. P -values are calculated using Student’s t -test.

    Journal: Nucleic Acids Research

    Article Title: Cellular and viral chromatin proteins are positive factors in the regulation of adenovirus gene expression

    doi: 10.1093/nar/gkq783

    Figure Lengend Snippet: Effect of knockdown of TAF-I expression on Sp1 recruitment. ( A ) Expression level of TAF-I. Western blot analyses were performed with lysates from HeLa cells treated with control siRNA (siControl, lanes 1–3) or siRNA for TAF-I (siTAF-I, lane 4). For siControl-treated cells, 25% (lane 1) and 50% (lane 2) volume of lysate were also loaded. ( B ) Transfection of siRNA-treated cells with reconstituted protein VII–DNA complexes. siControl- or siTAF-I-treated cells were transfected with reconstituted protein VII–DNA complexes, and cell lysates were subjected to ChIP assays as described in Figure 5 D. P -values are calculated using Student’s t -test.

    Article Snippet: HeLa cells were transfected with Ad-core, TP-DNA, or the reconstituted complexes (100 ng DNA) using GeneJuice (Novagen) according to the manufacturer’s protocol.

    Techniques: Expressing, Western Blot, Transfection, Chromatin Immunoprecipitation

    Comparison of the endonuclease activity of virus PA-Nter proteins expressed in E. coli . Virus PA-Nter proteins were expressed in E. coli , purified, and identified by SDS-PAGE and Western blot using Anti-His antibodies. After concentrated and quantified, the PA-Nter proteins were then incubated with DNA substrates, which contained FAM and BHQ conjugated to the 5′ and 3′ ends, respectively. Fluorescence signals were released and measured at the indicated time points. The purified protein from unmodified vector was achieved and used as a negative control. ( A ) The Coomassie-stained SDS-PAGE image and Western blot result of WT-H7N7 PA-Nter and negative control protein (Vector). CL, cell lysates; FT, flow-through (wash fractions); E1, 1st eluates; and E2, 2nd eluates. E2 proteins were concentrated and used for the endonuclease assay. ( B ) Western blot result of purified PA-Nter proteins of the indicated mutants. ( C ) Endonuclease assay of the WT-H7N7 PA-Nter protein. Data represented are means ± SD of independent experiments performed at least three times. ( D ) Comparison of the endonuclease activity of the PA-Nter proteins of WT-H7N7 and the indicated mutants. Fluorescence signals were collected at 32 minutes after incubation. The experiments were independently performed at least three times. Results presented are the relative endonuclease activity of PA-Nter proteins of the indicated mutants to that of WT-H7N7 (means ± SD).

    Journal: Scientific Reports

    Article Title: Amino acid substitutions V63I or A37S/I61T/V63I/V100A in the PA N-terminal domain increase the virulence of H7N7 influenza A virus

    doi: 10.1038/srep37800

    Figure Lengend Snippet: Comparison of the endonuclease activity of virus PA-Nter proteins expressed in E. coli . Virus PA-Nter proteins were expressed in E. coli , purified, and identified by SDS-PAGE and Western blot using Anti-His antibodies. After concentrated and quantified, the PA-Nter proteins were then incubated with DNA substrates, which contained FAM and BHQ conjugated to the 5′ and 3′ ends, respectively. Fluorescence signals were released and measured at the indicated time points. The purified protein from unmodified vector was achieved and used as a negative control. ( A ) The Coomassie-stained SDS-PAGE image and Western blot result of WT-H7N7 PA-Nter and negative control protein (Vector). CL, cell lysates; FT, flow-through (wash fractions); E1, 1st eluates; and E2, 2nd eluates. E2 proteins were concentrated and used for the endonuclease assay. ( B ) Western blot result of purified PA-Nter proteins of the indicated mutants. ( C ) Endonuclease assay of the WT-H7N7 PA-Nter protein. Data represented are means ± SD of independent experiments performed at least three times. ( D ) Comparison of the endonuclease activity of the PA-Nter proteins of WT-H7N7 and the indicated mutants. Fluorescence signals were collected at 32 minutes after incubation. The experiments were independently performed at least three times. Results presented are the relative endonuclease activity of PA-Nter proteins of the indicated mutants to that of WT-H7N7 (means ± SD).

    Article Snippet: Cloning and expression of virus PA-Nter proteins The DNA fragments of PA-Nter (residues 1–196) were amplified from pHW2000-PA plasmids (with or without the substitutions) and cloned into pET-32a (+) expression vector containing a His6 -tag (Novagen).

    Techniques: Activity Assay, Purification, SDS Page, Western Blot, Incubation, Fluorescence, Plasmid Preparation, Negative Control, Staining, Flow Cytometry

    Satb1 is a direct target of p63 in keratinocytes. Primary keratinocytes isolated from E16.5 embryos or newborn mice were processed for ChIP analysis with an antibody against the p63 protein or purified rabbit IgGs. HaCaT cells were used in cotransfection experiments with Satb1 promoter–driven reporter construct. (A and B) Quantitative RT-PCR analysis of two distinct regions of the Satb1 (a predicted high-affinity p63-binding site and a negative control site) showing a specific high-affinity p63-binding site at the Satb1 promoter. In A, the position 1 refers to 5′ of Satb1 transcript (AK037740). The uppercase letters of the sequence show the p63 putative binding sites in the promoter region of the Satb1 gene chosen for the quantitative PCR analysis after ChIP. The promoter region of the Cldn1 was used as a positive control. The input levels of unprecipitated chromatin DNA were used as loading controls. Error bars represent SEM, and three independent experiments were run in triplicate. (C) HaCaT keratinocytes were cotransfected with the luciferase reporter plasmid containing a mouse Satb1 promoter fragment and pΔNp63 expression plasmid or control pcDNA3 plasmid. The increase in the pSatb1-luc activities by cotransfection with pΔNp63 compared with the control pcDNA3 was ∼3.3 fold (mean ± SEM, n = 3; *, P

    Journal: The Journal of Cell Biology

    Article Title: p63 regulates Satb1 to control tissue-specific chromatin remodeling during development of the epidermis

    doi: 10.1083/jcb.201101148

    Figure Lengend Snippet: Satb1 is a direct target of p63 in keratinocytes. Primary keratinocytes isolated from E16.5 embryos or newborn mice were processed for ChIP analysis with an antibody against the p63 protein or purified rabbit IgGs. HaCaT cells were used in cotransfection experiments with Satb1 promoter–driven reporter construct. (A and B) Quantitative RT-PCR analysis of two distinct regions of the Satb1 (a predicted high-affinity p63-binding site and a negative control site) showing a specific high-affinity p63-binding site at the Satb1 promoter. In A, the position 1 refers to 5′ of Satb1 transcript (AK037740). The uppercase letters of the sequence show the p63 putative binding sites in the promoter region of the Satb1 gene chosen for the quantitative PCR analysis after ChIP. The promoter region of the Cldn1 was used as a positive control. The input levels of unprecipitated chromatin DNA were used as loading controls. Error bars represent SEM, and three independent experiments were run in triplicate. (C) HaCaT keratinocytes were cotransfected with the luciferase reporter plasmid containing a mouse Satb1 promoter fragment and pΔNp63 expression plasmid or control pcDNA3 plasmid. The increase in the pSatb1-luc activities by cotransfection with pΔNp63 compared with the control pcDNA3 was ∼3.3 fold (mean ± SEM, n = 3; *, P

    Article Snippet: For ChIP-on-chip analysis, precipitated DNA was analyzed by quantitative PCR or after one round of amplification (WGA2; Sigma-Aldrich) and applied to a general extended NimbleGen MM8 Deluxe Promoter HX1 array (MOgene, LC).

    Techniques: Isolation, Mouse Assay, Chromatin Immunoprecipitation, Purification, Cotransfection, Construct, Quantitative RT-PCR, Binding Assay, Negative Control, Sequencing, Real-time Polymerase Chain Reaction, Positive Control, Luciferase, Plasmid Preparation, Expressing

    Alterations in the conformation of the 5 Mb chromatin domain containing EDC in the epidermis of p63 −/− and Satb1 −/− mice. The skin of E16.5 p63 −/− , Satb1 −/− , and corresponding WT mice was processed for 3D FISH analyses, which were correlated with changes in gene expression determined by quantitative RT-PCR. (A) A schematic structure of the 5 Mb domain on mouse chromosome 3 (mChr3) containing the EDC locus, Rps27 , and Gabpb2 genes. 3D FISH DNA probes detecting the corresponding domains are shown in green ( Loricrin ), pink ( Rps27 ), and yellow ( Gabpb2 ). Genes selected for quantitative RT-PCR analysis (shown in E) are shown in red. LEP, late-cornified envelope protein. (B) Multicolor 3D FISH with BACs covering the Rps27 , Lor , and Gabpb2 in the epidermal cells of p63 −/− , Satb1 −/− , and corresponding WT mice at E16.5 (representative single Z sections). Bar, 2 µm. (C) 3D FISH distances between the Rps27 and Lor normalized to the radius of each nuclei in basal epidermal cells of p63 −/− , Satb1 −/− , and corresponding WT mice. Pairwise comparisons represent a significant increase in the Lor-Rps27 distances between the E16.5 WT versus p63 −/− or Satb1 −/− mice (mean ± SEM, n = 60; *, P

    Journal: The Journal of Cell Biology

    Article Title: p63 regulates Satb1 to control tissue-specific chromatin remodeling during development of the epidermis

    doi: 10.1083/jcb.201101148

    Figure Lengend Snippet: Alterations in the conformation of the 5 Mb chromatin domain containing EDC in the epidermis of p63 −/− and Satb1 −/− mice. The skin of E16.5 p63 −/− , Satb1 −/− , and corresponding WT mice was processed for 3D FISH analyses, which were correlated with changes in gene expression determined by quantitative RT-PCR. (A) A schematic structure of the 5 Mb domain on mouse chromosome 3 (mChr3) containing the EDC locus, Rps27 , and Gabpb2 genes. 3D FISH DNA probes detecting the corresponding domains are shown in green ( Loricrin ), pink ( Rps27 ), and yellow ( Gabpb2 ). Genes selected for quantitative RT-PCR analysis (shown in E) are shown in red. LEP, late-cornified envelope protein. (B) Multicolor 3D FISH with BACs covering the Rps27 , Lor , and Gabpb2 in the epidermal cells of p63 −/− , Satb1 −/− , and corresponding WT mice at E16.5 (representative single Z sections). Bar, 2 µm. (C) 3D FISH distances between the Rps27 and Lor normalized to the radius of each nuclei in basal epidermal cells of p63 −/− , Satb1 −/− , and corresponding WT mice. Pairwise comparisons represent a significant increase in the Lor-Rps27 distances between the E16.5 WT versus p63 −/− or Satb1 −/− mice (mean ± SEM, n = 60; *, P

    Article Snippet: For ChIP-on-chip analysis, precipitated DNA was analyzed by quantitative PCR or after one round of amplification (WGA2; Sigma-Aldrich) and applied to a general extended NimbleGen MM8 Deluxe Promoter HX1 array (MOgene, LC).

    Techniques: Mouse Assay, Fluorescence In Situ Hybridization, Expressing, Quantitative RT-PCR

    In the initial two experiments with bovine chondrocytes, HMGB1 synergized with IL-1 β on upregulating metalloproteinase production while MTDs (fMLF and CpG DNA) or HMGB1 alone showed little effect. Cells were harvested from cartilage in bovine stifle joints and cultured for 1 week. Passage 1 cells were treated with MTDs, HMGB1, and/or IL-1 β . After 24 hrs, culture medium was collected, dialyzed, and concentrated. The expression of MMPs in each medium sample was determined with Western blotting. U. C. = untreated control; CpG = CpG-rich DNA; CpG N. C. = CpG-rich DNA negative control.

    Journal: Mediators of Inflammation

    Article Title: DAMPs Synergize with Cytokines or Fibronectin Fragment on Inducing Chondrolysis but Lose Effect When Acting Alone

    doi: 10.1155/2017/2642549

    Figure Lengend Snippet: In the initial two experiments with bovine chondrocytes, HMGB1 synergized with IL-1 β on upregulating metalloproteinase production while MTDs (fMLF and CpG DNA) or HMGB1 alone showed little effect. Cells were harvested from cartilage in bovine stifle joints and cultured for 1 week. Passage 1 cells were treated with MTDs, HMGB1, and/or IL-1 β . After 24 hrs, culture medium was collected, dialyzed, and concentrated. The expression of MMPs in each medium sample was determined with Western blotting. U. C. = untreated control; CpG = CpG-rich DNA; CpG N. C. = CpG-rich DNA negative control.

    Article Snippet: In the 1st and 2nd experiments, bovine chondrocytes were treated with synthetic MTDs including 1 or 10 nM N-formyl-met-leu-phe (fMLF) (Tocris Bioscience, Bristol, UK), 10 μ g/mL CpG DNA (a 22-mer oligonucleotides containing CpG motifs), and 10 μ g/mL CpG DNA negative control (InvivoGen, San Diego, CA).

    Techniques: Cell Culture, Expressing, Western Blot, Negative Control

    Relative gene expression of matrix-related target genes and DNA, glycosaminoglycan (GAG), and collagen content in intervertebral discs (IVDs) injected with rhBMP-7. A . GAG/DNA and collagen/DNA did not significantly differ between the treatments. GAG/DNA in the nucleus pulposus (NP) (open bars) was significantly higher than in the annulus fibrosus (AF) (filled bars). B . Relative gene expression of collagen type 2 alpha 1 ( COL2A1 ) and collagen type 1 alpha 1 ( COL1A1 ) did not significantly differ between treatments. Gene expression levels of COL2A1 were significantly higher in the NP than in the AF, whereas the expression levels of COL1A1 were significantly lower in the NP than in the AF. GAG/DNA and collagen/DNA are expressed as mean ± SD, and COL2A1 and COL1A1 as relative expression ± SD. **Indicates a significant difference at a 99% confidence interval (CI).

    Journal: Arthritis Research & Therapy

    Article Title: Intradiscal application of rhBMP-7 does not induce regeneration in a canine model of spontaneous intervertebral disc degeneration

    doi: 10.1186/s13075-015-0625-2

    Figure Lengend Snippet: Relative gene expression of matrix-related target genes and DNA, glycosaminoglycan (GAG), and collagen content in intervertebral discs (IVDs) injected with rhBMP-7. A . GAG/DNA and collagen/DNA did not significantly differ between the treatments. GAG/DNA in the nucleus pulposus (NP) (open bars) was significantly higher than in the annulus fibrosus (AF) (filled bars). B . Relative gene expression of collagen type 2 alpha 1 ( COL2A1 ) and collagen type 1 alpha 1 ( COL1A1 ) did not significantly differ between treatments. Gene expression levels of COL2A1 were significantly higher in the NP than in the AF, whereas the expression levels of COL1A1 were significantly lower in the NP than in the AF. GAG/DNA and collagen/DNA are expressed as mean ± SD, and COL2A1 and COL1A1 as relative expression ± SD. **Indicates a significant difference at a 99% confidence interval (CI).

    Article Snippet: Glycosaminoglycan and DNA content of nucleus pulposus cell pellets and glycosaminoglycan content of culture media At days 7 and 28, two NPC pellets per donor and condition were digested overnight at 60°C in papain (250 μg/ml papain (P3125, 100 mg, Sigma-Aldrich) + 1.57 mg cysteine HCL (C7880, Sigma-Aldrich)).

    Techniques: Expressing, Injection

    Glycosaminoglycan (GAG) release and GAG, DNA, and GAG/DNA content in cultured nucleus pulposus cells (NPCs) treated with 10 or 100 ng/ml rhBMP-7. A . NPC pellets treated with rhBMP-7 show a significant dose-dependent increase in cumulative GAG release into the medium compared with the negative control. B . Regardless of the culture condition, DNA content of the NPC pellets was significantly lower compared with DNA content at day 0 (DNA 0 ; dashed line), indicated by #. NPC pellets treated with 100 ng/ml rhBMP-7 showed a significantly higher DNA content at day 28 compared with the negative control and the 10 ng/ml rhBMP-7-treated NPC pellets. C , D . A significant increase in GAG content and GAG/DNA at day 28 was shown in the 100 ng/ml rhBMP-7-treated NPC pellets compared with the negative control and the 10 ng/ml rhBMP-7-treated NPC pellets. Data are expressed as mean ± SD. **Indicates significant difference at a 99% confidence interval (CI); *indicates significant difference at a 98% CI; # indicates a significant difference at a 99% CI.

    Journal: Arthritis Research & Therapy

    Article Title: Intradiscal application of rhBMP-7 does not induce regeneration in a canine model of spontaneous intervertebral disc degeneration

    doi: 10.1186/s13075-015-0625-2

    Figure Lengend Snippet: Glycosaminoglycan (GAG) release and GAG, DNA, and GAG/DNA content in cultured nucleus pulposus cells (NPCs) treated with 10 or 100 ng/ml rhBMP-7. A . NPC pellets treated with rhBMP-7 show a significant dose-dependent increase in cumulative GAG release into the medium compared with the negative control. B . Regardless of the culture condition, DNA content of the NPC pellets was significantly lower compared with DNA content at day 0 (DNA 0 ; dashed line), indicated by #. NPC pellets treated with 100 ng/ml rhBMP-7 showed a significantly higher DNA content at day 28 compared with the negative control and the 10 ng/ml rhBMP-7-treated NPC pellets. C , D . A significant increase in GAG content and GAG/DNA at day 28 was shown in the 100 ng/ml rhBMP-7-treated NPC pellets compared with the negative control and the 10 ng/ml rhBMP-7-treated NPC pellets. Data are expressed as mean ± SD. **Indicates significant difference at a 99% confidence interval (CI); *indicates significant difference at a 98% CI; # indicates a significant difference at a 99% CI.

    Article Snippet: Glycosaminoglycan and DNA content of nucleus pulposus cell pellets and glycosaminoglycan content of culture media At days 7 and 28, two NPC pellets per donor and condition were digested overnight at 60°C in papain (250 μg/ml papain (P3125, 100 mg, Sigma-Aldrich) + 1.57 mg cysteine HCL (C7880, Sigma-Aldrich)).

    Techniques: Cell Culture, Negative Control

    Agarose gel electrophoresis pattern of MDV 132 bp repeates specific PCR Products (approximately 434 in case of double 132 bp repeates) amplified with primer pairs Bam H1/ Bam H1. M: DNA molecular weight Markers, N: negative control, 1–3:

    Journal: Indian journal of virology : an official organ of Indian Virological Society

    Article Title: Characterization of 132 bp Repeats BamH1-H Region in Pathogenic Marek's Disease Virus of Poultry in Gujarat, India, Using PCR and Sequencing

    doi: 10.1007/s13337-011-0031-6

    Figure Lengend Snippet: Agarose gel electrophoresis pattern of MDV 132 bp repeates specific PCR Products (approximately 434 in case of double 132 bp repeates) amplified with primer pairs Bam H1/ Bam H1. M: DNA molecular weight Markers, N: negative control, 1–3:

    Article Snippet: PCR was carried out in a final reaction volume of 25 μl using 200 μl capacity thin wall PCR tube containing 3 μl template DNA, 10 × PCR buffer (Sigma-Aldrich, USA), 25 mM MgCl2 , 200 μM of the four dNTPs, 10 pmol of each primer (Bangalore Genei, India), and 1U Taq DNA polymerase (Sigma-Aldrich, USA).

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Molecular Weight, Negative Control

    Constructs for plastid and nuclear transformations. ( a ) Construct for plastid transformation. lacO DNA (1 or ∼2.5 kb; dashed lines) was inserted between the HindIII and SmaI restriction sites into a polylinker in the unique Bsu36I site ( 31 ) of pZS197 ( 30 ). P rrn , plastid rrn promoter driving the aadA gene conferring resistance to spectinomycin; T psbA , terminator region from plastid psbA . Plastid rbcL and accD sequences are used for recombination into the plastid genome; their direction of transcription is shown by the arrowheads. The EcoRV restriction site was destroyed in the production of pZS197 but is restored in transplastomic plants. 1: position of 1.24 kb probe used in Southern DNA analysis. 2: position of the rbcL primer used to determine the size of the lacO insert in (b); 3: position of the forward and reverse primers used to analyse immunoprecipitated DNA for the presence of lacO . ( b ) PCR analysis of leaf DNA from transplastomic lacO lines. Lanes 1–4 and 5–8, putative transplastomic lines containing lacO constructs with 1 or ∼2.5 kb lacO DNA, respectively. Lane 9, no-template negative control. Lane 10, positive control, PCR on plasmid containing 1 kb lacO. Marker sizes are shown on the left. Primers were used to amplify a region extending from rbcL to accD and were expected to give band sizes of 2.6 or ∼4.0 kb with 1 kb or ∼2.5 kb of lacO , respectively. ( c ) Southern blot analysis of transplastomic tobacco lines, regenerated following bombardment with a plasmid containing ∼2.5 kb lacO repeat sequence. Total leaf DNA (0.3 µg) was cut with EcoRV and SacII and probed with a 32 P-labelled 1.24 kb BamHI fragment from rbcL [see (a) above]. Lanes 1–6, putative transplastomic lines. WT, ‘Petite Havana’ wild-type. Band sizes are shown on the left. ( d , e ) Constructs for nuclear transformation containing the CaMV 35S promoter and nos terminator in pBIN19 ( 32 ). (d) gfp-lacI DNA was inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and SacI restriction sites. (e) lacI-gfp has been inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and StuI restriction sites.

    Journal: Nucleic Acids Research

    Article Title: Binding of lac repressor-GFP fusion protein to lac operator sites inserted in the tobacco chloroplast genome examined by chromatin immunoprecipitation

    doi: 10.1093/nar/gkq413

    Figure Lengend Snippet: Constructs for plastid and nuclear transformations. ( a ) Construct for plastid transformation. lacO DNA (1 or ∼2.5 kb; dashed lines) was inserted between the HindIII and SmaI restriction sites into a polylinker in the unique Bsu36I site ( 31 ) of pZS197 ( 30 ). P rrn , plastid rrn promoter driving the aadA gene conferring resistance to spectinomycin; T psbA , terminator region from plastid psbA . Plastid rbcL and accD sequences are used for recombination into the plastid genome; their direction of transcription is shown by the arrowheads. The EcoRV restriction site was destroyed in the production of pZS197 but is restored in transplastomic plants. 1: position of 1.24 kb probe used in Southern DNA analysis. 2: position of the rbcL primer used to determine the size of the lacO insert in (b); 3: position of the forward and reverse primers used to analyse immunoprecipitated DNA for the presence of lacO . ( b ) PCR analysis of leaf DNA from transplastomic lacO lines. Lanes 1–4 and 5–8, putative transplastomic lines containing lacO constructs with 1 or ∼2.5 kb lacO DNA, respectively. Lane 9, no-template negative control. Lane 10, positive control, PCR on plasmid containing 1 kb lacO. Marker sizes are shown on the left. Primers were used to amplify a region extending from rbcL to accD and were expected to give band sizes of 2.6 or ∼4.0 kb with 1 kb or ∼2.5 kb of lacO , respectively. ( c ) Southern blot analysis of transplastomic tobacco lines, regenerated following bombardment with a plasmid containing ∼2.5 kb lacO repeat sequence. Total leaf DNA (0.3 µg) was cut with EcoRV and SacII and probed with a 32 P-labelled 1.24 kb BamHI fragment from rbcL [see (a) above]. Lanes 1–6, putative transplastomic lines. WT, ‘Petite Havana’ wild-type. Band sizes are shown on the left. ( d , e ) Constructs for nuclear transformation containing the CaMV 35S promoter and nos terminator in pBIN19 ( 32 ). (d) gfp-lacI DNA was inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and SacI restriction sites. (e) lacI-gfp has been inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and StuI restriction sites.

    Article Snippet: Total leaf DNA of wild-type and transplastomic lacO plants was analysed by PCR in a 25 µl reaction volume containing 0.5-µl DNA template, 0.5 u KOD Hot Start DNA polymerase (Novagen, http://www.emdbiosciences.com ), 2.5 µl of 10× reaction buffer supplied with the enzyme, 1 mM MgSO4 , 200 µM each of dATP, dCTP, dGTP, dTTP and 0.3 µM of each primer.

    Techniques: Construct, Transformation Assay, Immunoprecipitation, Polymerase Chain Reaction, Negative Control, Positive Control, Plasmid Preparation, Marker, Southern Blot, Sequencing

    Binding of GFP-LacI to chloroplast-located lacO sequences. ( a ) PCR analysis of immunoprecipitated chloroplast DNA. Immunoprecipitation was carried out with the following treatments: antibody to A. thaliana TTG1, antibody to GFP or no antibody. Total DNA was extracted from a fraction of the chloroplast lysate that did not undergo immunoprecipitation. Control reactions for PCR included genomic DNA isolated from a transplastomic lacO line (+) and water (−). M, DNA size markers. (a) Binding of GFP-LacI to lacO. Primers were used to amplify a 409-bp sequence, which includes plastid-localized lacO (marked as position 3 in Figure 1(a). Experimental lines are listed on the left. Treatments shown in the left half of the panel were carried out following formaldehyde cross-linking, those on the right were not subjected to formaldehyde cross-linking. ( b ) Effect of IPTG on binding of GFP-LacI to lacO. PCR analysis of immunoprecipitated chloroplast DNA from lacO /GFP-LacI lines, using primers to amplify a 409-bp fragment encompassing lacO and a 396-bp fragment from atpBE (shown on left side). Treatments shown in the left half of the panel were carried out in the absence of IPTG, those in the right half were carried out in the presence of 20 mM IPTG.

    Journal: Nucleic Acids Research

    Article Title: Binding of lac repressor-GFP fusion protein to lac operator sites inserted in the tobacco chloroplast genome examined by chromatin immunoprecipitation

    doi: 10.1093/nar/gkq413

    Figure Lengend Snippet: Binding of GFP-LacI to chloroplast-located lacO sequences. ( a ) PCR analysis of immunoprecipitated chloroplast DNA. Immunoprecipitation was carried out with the following treatments: antibody to A. thaliana TTG1, antibody to GFP or no antibody. Total DNA was extracted from a fraction of the chloroplast lysate that did not undergo immunoprecipitation. Control reactions for PCR included genomic DNA isolated from a transplastomic lacO line (+) and water (−). M, DNA size markers. (a) Binding of GFP-LacI to lacO. Primers were used to amplify a 409-bp sequence, which includes plastid-localized lacO (marked as position 3 in Figure 1(a). Experimental lines are listed on the left. Treatments shown in the left half of the panel were carried out following formaldehyde cross-linking, those on the right were not subjected to formaldehyde cross-linking. ( b ) Effect of IPTG on binding of GFP-LacI to lacO. PCR analysis of immunoprecipitated chloroplast DNA from lacO /GFP-LacI lines, using primers to amplify a 409-bp fragment encompassing lacO and a 396-bp fragment from atpBE (shown on left side). Treatments shown in the left half of the panel were carried out in the absence of IPTG, those in the right half were carried out in the presence of 20 mM IPTG.

    Article Snippet: Total leaf DNA of wild-type and transplastomic lacO plants was analysed by PCR in a 25 µl reaction volume containing 0.5-µl DNA template, 0.5 u KOD Hot Start DNA polymerase (Novagen, http://www.emdbiosciences.com ), 2.5 µl of 10× reaction buffer supplied with the enzyme, 1 mM MgSO4 , 200 µM each of dATP, dCTP, dGTP, dTTP and 0.3 µM of each primer.

    Techniques: Binding Assay, Polymerase Chain Reaction, Immunoprecipitation, Isolation, Sequencing

    Binding of GFP-LacI to chloroplast sequences. Experimental lines are listed on the left; treatments shown in the left half of the panels were carried out following a formaldehyde cross-linking step, those on the right were not subjected to cross-linking. ( a ) PCR analysis of immunoprecipitated chloroplast DNA using primers to amplify a 396-bp fragment from plastid atpB/E . ( b ) PCR analysis of formaldehyde cross-linked, immunoprecipitated chloroplast DNA using primers to amplify a 233-bp fragment from plastid 23S rDNA. ( c ) PCR analysis of immunoprecipitated chloroplast DNA using primers to amplify a 167-bp fragment from plastid psbT . Total DNA was extracted from a fraction of the lysate that did not undergo immunoprecipitation. Control reactions for PCR included genomic DNA isolated from a transplastomic lacO line (+) and water (−).

    Journal: Nucleic Acids Research

    Article Title: Binding of lac repressor-GFP fusion protein to lac operator sites inserted in the tobacco chloroplast genome examined by chromatin immunoprecipitation

    doi: 10.1093/nar/gkq413

    Figure Lengend Snippet: Binding of GFP-LacI to chloroplast sequences. Experimental lines are listed on the left; treatments shown in the left half of the panels were carried out following a formaldehyde cross-linking step, those on the right were not subjected to cross-linking. ( a ) PCR analysis of immunoprecipitated chloroplast DNA using primers to amplify a 396-bp fragment from plastid atpB/E . ( b ) PCR analysis of formaldehyde cross-linked, immunoprecipitated chloroplast DNA using primers to amplify a 233-bp fragment from plastid 23S rDNA. ( c ) PCR analysis of immunoprecipitated chloroplast DNA using primers to amplify a 167-bp fragment from plastid psbT . Total DNA was extracted from a fraction of the lysate that did not undergo immunoprecipitation. Control reactions for PCR included genomic DNA isolated from a transplastomic lacO line (+) and water (−).

    Article Snippet: Total leaf DNA of wild-type and transplastomic lacO plants was analysed by PCR in a 25 µl reaction volume containing 0.5-µl DNA template, 0.5 u KOD Hot Start DNA polymerase (Novagen, http://www.emdbiosciences.com ), 2.5 µl of 10× reaction buffer supplied with the enzyme, 1 mM MgSO4 , 200 µM each of dATP, dCTP, dGTP, dTTP and 0.3 µM of each primer.

    Techniques: Binding Assay, Polymerase Chain Reaction, Immunoprecipitation, Isolation