multiplex pcr kit Qiagen Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen multiplex pcr
    (see p. 4).The effect of multiplex <t>PCR</t> thermocycler programs during the dual labeling process on the amplitude and signal strength of fragment peaks. Shown are electropherograms from microsatellite loci KA16, ch0203b, and ch01h01 in the ‘Redspire’ cultivar of Pyrus calleryana when the thermocycler cycling program was that (A) suggested by Schuelke (2000) as two series of cycles or recommended by the <t>QIAGEN</t> Multiplexing Kit for (B) 35 cycles, (C) 40 cycles, (D) 45 cycles, and (E) 50 cycles. For comparison, the same samples are presented (F) following traditional multiplexed PCR with prelabeled primers and (G) when analyzed individually with a single prelabeled primer pair; in both of these cases, the normal QIAGEN-recommended protocol was used with 35 cycles.
    Multiplex Pcr, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 2459 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplex pcr/product/Qiagen
    Average 99 stars, based on 2459 article reviews
    Price from $9.99 to $1999.99
    multiplex pcr - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    (see p. 4).The effect of multiplex PCR thermocycler programs during the dual labeling process on the amplitude and signal strength of fragment peaks. Shown are electropherograms from microsatellite loci KA16, ch0203b, and ch01h01 in the ‘Redspire’ cultivar of Pyrus calleryana when the thermocycler cycling program was that (A) suggested by Schuelke (2000) as two series of cycles or recommended by the QIAGEN Multiplexing Kit for (B) 35 cycles, (C) 40 cycles, (D) 45 cycles, and (E) 50 cycles. For comparison, the same samples are presented (F) following traditional multiplexed PCR with prelabeled primers and (G) when analyzed individually with a single prelabeled primer pair; in both of these cases, the normal QIAGEN-recommended protocol was used with 35 cycles.

    Journal: Applications in Plant Sciences

    Article Title: An efficient technique for primer development and application that integrates fluorescent labeling and multiplex PCR 1

    doi: 10.3732/apps.1300027

    Figure Lengend Snippet: (see p. 4).The effect of multiplex PCR thermocycler programs during the dual labeling process on the amplitude and signal strength of fragment peaks. Shown are electropherograms from microsatellite loci KA16, ch0203b, and ch01h01 in the ‘Redspire’ cultivar of Pyrus calleryana when the thermocycler cycling program was that (A) suggested by Schuelke (2000) as two series of cycles or recommended by the QIAGEN Multiplexing Kit for (B) 35 cycles, (C) 40 cycles, (D) 45 cycles, and (E) 50 cycles. For comparison, the same samples are presented (F) following traditional multiplexed PCR with prelabeled primers and (G) when analyzed individually with a single prelabeled primer pair; in both of these cases, the normal QIAGEN-recommended protocol was used with 35 cycles.

    Article Snippet: To expand the applicability of the earlier single-primer tagging method so investigators could fluorescently label multiple primers concurrently in the same PCR reaction and analyze multiple loci at once, we used the QIAGEN PCR Multiplexing Kit (catalog no. 206143; QIAGEN, Valencia, California, USA).

    Techniques: Multiplex Assay, Polymerase Chain Reaction, Labeling, Multiplexing

    H . pylori - specific PCR for DNA extracted from oral cavity. In this figure, one can see the amplification of VacA in the three cases previously identified as oral cavity positives for H. pylori (Hp positive sample #1 to #3), in comparison with other three cases that are oral cavity H. pylori negatives (Hp negative sample #1 to #3). As a positive control (Hp positive control) PCR for DNA extracted from H . pylori (strain 7354) diluted in saliva was used. Blank—PCR negative control.

    Journal: PLoS ONE

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations

    doi: 10.1371/journal.pone.0126923

    Figure Lengend Snippet: H . pylori - specific PCR for DNA extracted from oral cavity. In this figure, one can see the amplification of VacA in the three cases previously identified as oral cavity positives for H. pylori (Hp positive sample #1 to #3), in comparison with other three cases that are oral cavity H. pylori negatives (Hp negative sample #1 to #3). As a positive control (Hp positive control) PCR for DNA extracted from H . pylori (strain 7354) diluted in saliva was used. Blank—PCR negative control.

    Article Snippet: Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21).

    Techniques: Polymerase Chain Reaction, Amplification, Positive Control, Negative Control

    Highly sensitive PCR for detection of H . pylori . In order to evaluate the sensitivity of VacA -specific PCR, 50ng of DNA from H . pylori was successively diluted (1 to 1:100000) in saliva from two random cases (#3 and #10) that were shown previously to be negative for the presence of H . pylori . The PCR allowed the amplification of the expected product for all different dilutions.

    Journal: PLoS ONE

    Article Title: Oral and Gastric Helicobacter Pylori: Effects and Associations

    doi: 10.1371/journal.pone.0126923

    Figure Lengend Snippet: Highly sensitive PCR for detection of H . pylori . In order to evaluate the sensitivity of VacA -specific PCR, 50ng of DNA from H . pylori was successively diluted (1 to 1:100000) in saliva from two random cases (#3 and #10) that were shown previously to be negative for the presence of H . pylori . The PCR allowed the amplification of the expected product for all different dilutions.

    Article Snippet: Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H .pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21).

    Techniques: Polymerase Chain Reaction, Amplification

    MDS representation of the distances among 234 strains of X. citri pv. citri based on AFLP (A), IS-LM-PCR (B), and MLVA (C) data. X. citri pv. citri pathotypes are represented by different symbols, including symbols indicating the geographical origins

    Journal:

    Article Title: From Local Surveys to Global Surveillance: Three High-Throughput Genotyping Methods for Epidemiological Monitoring of Xanthomonas citri pv. citri Pathotypes ▿ pv. citri Pathotypes ▿ †

    doi: 10.1128/AEM.02245-08

    Figure Lengend Snippet: MDS representation of the distances among 234 strains of X. citri pv. citri based on AFLP (A), IS-LM-PCR (B), and MLVA (C) data. X. citri pv. citri pathotypes are represented by different symbols, including symbols indicating the geographical origins

    Article Snippet: Fourteen primer pairs targeting single-locus alleles designed from the full sequence of X. citri pv. citri strain 306 ( ) were used in a multiplex PCR format with a PCR kit from Qiagen (Courtaboeuf, France) ( ).

    Techniques: Polymerase Chain Reaction

    The relationship between the 21-3 VNTR allele and the BstUI cutting pattern for 10 Philippine M. leprae samples is shown in A and B, respectively. (A) BstUI-RFLP gel. (B) Agarose gel showing products of multiplex PCR for four VNTR loci. The 21-3 product

    Journal: Journal of Clinical Microbiology

    Article Title: Population-Based Molecular Epidemiology of Leprosy in Cebu, Philippines

    doi: 10.1128/JCM.02021-08

    Figure Lengend Snippet: The relationship between the 21-3 VNTR allele and the BstUI cutting pattern for 10 Philippine M. leprae samples is shown in A and B, respectively. (A) BstUI-RFLP gel. (B) Agarose gel showing products of multiplex PCR for four VNTR loci. The 21-3 product

    Article Snippet: A multiplex PCR protocol described previously by Kimura et al. comprising four reactions for the amplification of 15 VNTR loci was achieved using a multiplex PCR enzyme kit (Qiagen) and fluorescent 5′-labeled forward primers and reverse unlabeled primers ( ).

    Techniques: Agarose Gel Electrophoresis, Multiplex Assay, Polymerase Chain Reaction