multiplex oligos Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Integrated DNA Technologies standard desalted ultramer oligonucleotides
    Standard Desalted Ultramer Oligonucleotides, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/standard desalted ultramer oligonucleotides/product/Integrated DNA Technologies
    Average 99 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    standard desalted ultramer oligonucleotides - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs multiplex oligos oligonucleotides
    Multiplex Oligos Oligonucleotides, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 12481 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplex oligos oligonucleotides/product/New England Biolabs
    Average 99 stars, based on 12481 article reviews
    Price from $9.99 to $1999.99
    multiplex oligos oligonucleotides - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Illumina Inc multiplex oligos
    Multiplex Oligos, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 332 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplex oligos/product/Illumina Inc
    Average 99 stars, based on 332 article reviews
    Price from $9.99 to $1999.99
    multiplex oligos - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs nebnext multiplex oligos
    Nebnext Multiplex Oligos, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3815 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nebnext multiplex oligos/product/New England Biolabs
    Average 99 stars, based on 3815 article reviews
    Price from $9.99 to $1999.99
    nebnext multiplex oligos - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    85
    Illumina Inc illumina multiplexing oligos
    Illumina Multiplexing Oligos, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina multiplexing oligos/product/Illumina Inc
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    illumina multiplexing oligos - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    99
    New England Biolabs nebnext multiple oligos
    Nebnext Multiple Oligos, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nebnext multiple oligos/product/New England Biolabs
    Average 99 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    nebnext multiple oligos - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    93
    Illumina Inc multiplex oligos kit
    Multiplex Oligos Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplex oligos kit/product/Illumina Inc
    Average 93 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    multiplex oligos kit - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    94
    Illumina Inc vahts multiplex oligos
    Vahts Multiplex Oligos, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vahts multiplex oligos/product/Illumina Inc
    Average 94 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    vahts multiplex oligos - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    99
    New England Biolabs primer nebnext multiplex oligos
    Primer Nebnext Multiplex Oligos, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer nebnext multiplex oligos/product/New England Biolabs
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    primer nebnext multiplex oligos - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    95
    Illumina Inc ngs multiplex oligos
    Ngs Multiplex Oligos, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 95/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ngs multiplex oligos/product/Illumina Inc
    Average 95 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    ngs multiplex oligos - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    99
    New England Biolabs no e7500s l neb next multiplex oligos
    No E7500s L Neb Next Multiplex Oligos, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 198 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/no e7500s l neb next multiplex oligos/product/New England Biolabs
    Average 99 stars, based on 198 article reviews
    Price from $9.99 to $1999.99
    no e7500s l neb next multiplex oligos - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    80
    Illumina Inc nebnext㠂 â multiplex oligos
    Nebnext㠂 â Multiplex Oligos, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 80/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nebnext㠂 â multiplex oligos/product/Illumina Inc
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    nebnext㠂 â multiplex oligos - by Bioz Stars, 2020-04
    80/100 stars
      Buy from Supplier

    99
    New England Biolabs dual index nebnext multiplex oligos
    Dual Index Nebnext Multiplex Oligos, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 47 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dual index nebnext multiplex oligos/product/New England Biolabs
    Average 99 stars, based on 47 article reviews
    Price from $9.99 to $1999.99
    dual index nebnext multiplex oligos - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore 3 oligonucleotide primers
    Construction and characterization of T7-Pep and the PhIP-Seq methodology ( a ) The T7-Pep library is made from 413,611 <t>DNA</t> sequences encoding 36 amino acid peptide tiles that span 24,239 unique ORFs from build 35.1 of the human genome. Each tile overlaps its neighbors by seven amino acids on each side. ( b ) The DNA sequences from (a) were printed as 140-mer <t>oligos</t> on releasable DNA microarrays. (i) After oligo release, the DNA was PCR-amplified and cloned into a FLAG-expressing derivative of the T7Select 10-3b mid copy phage display system. (ii) The T7-Pep library is mixed with patient samples containing autoantibodies. (iii) Antibodies and bound phage are captured on magnetic protein A/G coated beads. (iv) DNA from the immunoprecipitated phage is recovered and (v) library inserts are PCR-amplified with sequencing adapters. A single nucleotide change (arrow) is introduced for multiplex analysis. ( c ) Pie chart showing results of plaque sequencing of 71 phage from T7-Pep Pool 1 and T7-CPep Pool 1. ( d ) Histogram plot showing results from Illumina sequencing of T7-Pep. 78% of the total area lies between the vertical red lines at 10 and 100 reads, demonstrating the relative uniformity of the library. Representation of each subpool in T7-Pep (inset) compared to expected (horizontal red line).
    3 Oligonucleotide Primers, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/3 oligonucleotide primers/product/Millipore
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    3 oligonucleotide primers - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    94
    Thermo Fisher barcode oligonucleotides
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Barcode Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/barcode oligonucleotides/product/Thermo Fisher
    Average 94 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    barcode oligonucleotides - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    86
    Illumina Inc pcr multiplexing oligos
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Pcr Multiplexing Oligos, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 86/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr multiplexing oligos/product/Illumina Inc
    Average 86 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    pcr multiplexing oligos - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    99
    Integrated DNA Technologies oligos
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Oligos, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1104 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Integrated DNA Technologies
    Average 99 stars, based on 1104 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    94
    Illumina Inc standard illumina truseq multiplexing oligos
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Standard Illumina Truseq Multiplexing Oligos, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/standard illumina truseq multiplexing oligos/product/Illumina Inc
    Average 94 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    standard illumina truseq multiplexing oligos - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    99
    New England Biolabs nebnext multiplex oligos for illumina methylated adaptor index primers set 1
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Nebnext Multiplex Oligos For Illumina Methylated Adaptor Index Primers Set 1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 65 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nebnext multiplex oligos for illumina methylated adaptor index primers set 1/product/New England Biolabs
    Average 99 stars, based on 65 article reviews
    Price from $9.99 to $1999.99
    nebnext multiplex oligos for illumina methylated adaptor index primers set 1 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    91
    Beckman Coulter nebnext multiplex oligos for illumina index primers set 2
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Nebnext Multiplex Oligos For Illumina Index Primers Set 2, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nebnext multiplex oligos for illumina index primers set 2/product/Beckman Coulter
    Average 91 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    nebnext multiplex oligos for illumina index primers set 2 - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    89
    Illumina Inc multiplex oligonucleotide
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Multiplex Oligonucleotide, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 89/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplex oligonucleotide/product/Illumina Inc
    Average 89 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    multiplex oligonucleotide - by Bioz Stars, 2020-04
    89/100 stars
      Buy from Supplier

    93
    Agilent technologies multiplex format oligo arrays
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Multiplex Format Oligo Arrays, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplex format oligo arrays/product/Agilent technologies
    Average 93 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    multiplex format oligo arrays - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher oligos
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2907 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligos/product/Thermo Fisher
    Average 99 stars, based on 2907 article reviews
    Price from $9.99 to $1999.99
    oligos - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    Roche amplification oligos
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Amplification Oligos, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amplification oligos/product/Roche
    Average 86 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    amplification oligos - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    93
    Illumina Inc multiplex sample preparation oligonucleotide kit
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Multiplex Sample Preparation Oligonucleotide Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 93/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplex sample preparation oligonucleotide kit/product/Illumina Inc
    Average 93 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    multiplex sample preparation oligonucleotide kit - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    97
    Illumina Inc nebnext multiplex oligos for illumina index primers set 1
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Nebnext Multiplex Oligos For Illumina Index Primers Set 1, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 97/100, based on 48 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nebnext multiplex oligos for illumina index primers set 1/product/Illumina Inc
    Average 97 stars, based on 48 article reviews
    Price from $9.99 to $1999.99
    nebnext multiplex oligos for illumina index primers set 1 - by Bioz Stars, 2020-04
    97/100 stars
      Buy from Supplier

    92
    Illumina Inc multiplexing sample preparation oligonucleotide kit
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Multiplexing Sample Preparation Oligonucleotide Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 280 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multiplexing sample preparation oligonucleotide kit/product/Illumina Inc
    Average 92 stars, based on 280 article reviews
    Price from $9.99 to $1999.99
    multiplexing sample preparation oligonucleotide kit - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    99
    Thermo Fisher fluorescence labeled oligos
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Fluorescence Labeled Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorescence labeled oligos/product/Thermo Fisher
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    fluorescence labeled oligos - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Construction and characterization of T7-Pep and the PhIP-Seq methodology ( a ) The T7-Pep library is made from 413,611 DNA sequences encoding 36 amino acid peptide tiles that span 24,239 unique ORFs from build 35.1 of the human genome. Each tile overlaps its neighbors by seven amino acids on each side. ( b ) The DNA sequences from (a) were printed as 140-mer oligos on releasable DNA microarrays. (i) After oligo release, the DNA was PCR-amplified and cloned into a FLAG-expressing derivative of the T7Select 10-3b mid copy phage display system. (ii) The T7-Pep library is mixed with patient samples containing autoantibodies. (iii) Antibodies and bound phage are captured on magnetic protein A/G coated beads. (iv) DNA from the immunoprecipitated phage is recovered and (v) library inserts are PCR-amplified with sequencing adapters. A single nucleotide change (arrow) is introduced for multiplex analysis. ( c ) Pie chart showing results of plaque sequencing of 71 phage from T7-Pep Pool 1 and T7-CPep Pool 1. ( d ) Histogram plot showing results from Illumina sequencing of T7-Pep. 78% of the total area lies between the vertical red lines at 10 and 100 reads, demonstrating the relative uniformity of the library. Representation of each subpool in T7-Pep (inset) compared to expected (horizontal red line).

    Journal: Nature biotechnology

    Article Title: Application of a synthetic human proteome to autoantigen discovery through PhIP-Seq

    doi: 10.1038/nbt.1856

    Figure Lengend Snippet: Construction and characterization of T7-Pep and the PhIP-Seq methodology ( a ) The T7-Pep library is made from 413,611 DNA sequences encoding 36 amino acid peptide tiles that span 24,239 unique ORFs from build 35.1 of the human genome. Each tile overlaps its neighbors by seven amino acids on each side. ( b ) The DNA sequences from (a) were printed as 140-mer oligos on releasable DNA microarrays. (i) After oligo release, the DNA was PCR-amplified and cloned into a FLAG-expressing derivative of the T7Select 10-3b mid copy phage display system. (ii) The T7-Pep library is mixed with patient samples containing autoantibodies. (iii) Antibodies and bound phage are captured on magnetic protein A/G coated beads. (iv) DNA from the immunoprecipitated phage is recovered and (v) library inserts are PCR-amplified with sequencing adapters. A single nucleotide change (arrow) is introduced for multiplex analysis. ( c ) Pie chart showing results of plaque sequencing of 71 phage from T7-Pep Pool 1 and T7-CPep Pool 1. ( d ) Histogram plot showing results from Illumina sequencing of T7-Pep. 78% of the total area lies between the vertical red lines at 10 and 100 reads, demonstrating the relative uniformity of the library. Representation of each subpool in T7-Pep (inset) compared to expected (horizontal red line).

    Article Snippet: The peptide-coding sequences were synthesized as 140-mer oligonucleotides with primer sequences on releasable DNA microarrays in 19 pools of 22,000 oligos each, PCR-amplified and cloned into a derivative of the T7Select 10-3b phage display vector (Novagen; and ).

    Techniques: Polymerase Chain Reaction, Amplification, Clone Assay, Expressing, Immunoprecipitation, Sequencing, Multiplex Assay

    Correlative light and electron spectroscopic imaging (LM/ESI) of SK-N-SH cells expressing LacI-tagged SC35 using fluorogold dsDNA oligos. Detection of nuclear speckles (arrow) via the Cy3 fluorophore ( A , left panel), and confirmation of gold conjugation to the dsDNA oligo through silver enhancement (A, right panel). Untransfected cells (arrowhead) contain background levels of silver deposition. Scale bar = 200 nm. ( B ) Overlay of fluorescence and low magnification ESI micrographs collected at 155 eV. With two rounds of the silver enhancement using a LM enhancement kit (B, left panel), the silver particles are visible as bright spots. The right panel is an overlay image of a nucleus containing EM-enhanced gold. Scale bar = 2 μm. An area corresponding to an IGC, as defined by a box in the left panel is analysed at high resolution, and maps of phosphorus ( C , red panel) and nitrogen (C, green panel) show the ultrastructure of the IGC region, which is low in phosphorus content and contains protein-based fibrous structures. The fluorogold oligo localization is indicated with silver-enhanced gold particles false-coloured in white. The composite map ( D , left panel) illustrates the position of the IGC relative to chromatin (Ch, yellow) and the nucleolus (Nu, yellow-green). The silver particles in the interior of the IGC are labelled with arrowheads, whereas those proximal to the neighbouring chromatin are indicated by arrows. The composite map (D, right panel) of the EM-enhanced nucleus (B, right panel) contains smaller but uniform silver particles, as indicated by the arrows and arrowheads. Scale bar = 5 μm.

    Journal: Nucleic Acids Research

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides

    doi: 10.1093/nar/gnh164

    Figure Lengend Snippet: Correlative light and electron spectroscopic imaging (LM/ESI) of SK-N-SH cells expressing LacI-tagged SC35 using fluorogold dsDNA oligos. Detection of nuclear speckles (arrow) via the Cy3 fluorophore ( A , left panel), and confirmation of gold conjugation to the dsDNA oligo through silver enhancement (A, right panel). Untransfected cells (arrowhead) contain background levels of silver deposition. Scale bar = 200 nm. ( B ) Overlay of fluorescence and low magnification ESI micrographs collected at 155 eV. With two rounds of the silver enhancement using a LM enhancement kit (B, left panel), the silver particles are visible as bright spots. The right panel is an overlay image of a nucleus containing EM-enhanced gold. Scale bar = 2 μm. An area corresponding to an IGC, as defined by a box in the left panel is analysed at high resolution, and maps of phosphorus ( C , red panel) and nitrogen (C, green panel) show the ultrastructure of the IGC region, which is low in phosphorus content and contains protein-based fibrous structures. The fluorogold oligo localization is indicated with silver-enhanced gold particles false-coloured in white. The composite map ( D , left panel) illustrates the position of the IGC relative to chromatin (Ch, yellow) and the nucleolus (Nu, yellow-green). The silver particles in the interior of the IGC are labelled with arrowheads, whereas those proximal to the neighbouring chromatin are indicated by arrows. The composite map (D, right panel) of the EM-enhanced nucleus (B, right panel) contains smaller but uniform silver particles, as indicated by the arrows and arrowheads. Scale bar = 5 μm.

    Article Snippet: For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma).

    Techniques: Imaging, Expressing, Conjugation Assay, Fluorescence

    Isolation of LacI-tagged SC35 from human SK-N-SH cells using dsDNA oligonucleotides. Total cellular lysates and isolated protein (PI) lysates were prepared from SK-N-SH cells transiently expressing LacI or LacI-tagged SC35. The protein isolation of LacI and LacI-tagged SC35 from PI-lysates was carried out using streptavidin beads pre-incubated with biotinylated dsDNA oligo specific for LacI (O-Sym). Western analysis of total cellular lysate (1), PI lysate (2), protein isolated by dsDNA oligos (oligo-PI) (3), and mock oligo-PI (4) from LacI–SC35 expressing cells, or PI lysate were generated from LacI expressing cells. Proteins were detected using either anti-Flag ( A ) or anti-SR protein (mAb 104) ( B ) antibodies. In addition, a Coomassie stained SDS–PAGE gel is shown as a qualitative comparison of dsDNA oligo PI versus immunopreciptiation (IP) using an anti-Flag antibody ( C ). In panel C: lane M, protein molecular weight marker; lane 1, 40 μg of total lysate; lane 2, oligo-PI; lane 3, Mock oligo-PI; and lane 4, anti-Flag IP. The asterisk marks the position of co-purifying immunoglobulin (i.e. heavy chain is shown) in the Flag-IP. The black arrows indicate the position of LacI–SC35 in panels B,C. Approximately 250–500 μg or 500–1000 μg of total protein lysate was used for western or Coomassie SDS–PAGE analysis, respectively.

    Journal: Nucleic Acids Research

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides

    doi: 10.1093/nar/gnh164

    Figure Lengend Snippet: Isolation of LacI-tagged SC35 from human SK-N-SH cells using dsDNA oligonucleotides. Total cellular lysates and isolated protein (PI) lysates were prepared from SK-N-SH cells transiently expressing LacI or LacI-tagged SC35. The protein isolation of LacI and LacI-tagged SC35 from PI-lysates was carried out using streptavidin beads pre-incubated with biotinylated dsDNA oligo specific for LacI (O-Sym). Western analysis of total cellular lysate (1), PI lysate (2), protein isolated by dsDNA oligos (oligo-PI) (3), and mock oligo-PI (4) from LacI–SC35 expressing cells, or PI lysate were generated from LacI expressing cells. Proteins were detected using either anti-Flag ( A ) or anti-SR protein (mAb 104) ( B ) antibodies. In addition, a Coomassie stained SDS–PAGE gel is shown as a qualitative comparison of dsDNA oligo PI versus immunopreciptiation (IP) using an anti-Flag antibody ( C ). In panel C: lane M, protein molecular weight marker; lane 1, 40 μg of total lysate; lane 2, oligo-PI; lane 3, Mock oligo-PI; and lane 4, anti-Flag IP. The asterisk marks the position of co-purifying immunoglobulin (i.e. heavy chain is shown) in the Flag-IP. The black arrows indicate the position of LacI–SC35 in panels B,C. Approximately 250–500 μg or 500–1000 μg of total protein lysate was used for western or Coomassie SDS–PAGE analysis, respectively.

    Article Snippet: For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma).

    Techniques: Isolation, Expressing, Incubation, Western Blot, Generated, Staining, SDS Page, Molecular Weight, Marker

    In situ detection and isolation of proteins using dsDNA oligonucleotides. ( A ) Detection of proteins in situ using dsDNA oligos. Cells grown on slides are fixed and hybridized with fluorescently labelled dsDNA oligos (red or green) that can detect the presence of proteins fused to either LacI (1) or TetR (2). The fluorescent dsDNA oligos corresponding to the operator sequences for LacI or TetR (green or red, respectively) bind each bacterial fusion protein specifically without cross hybridizing resulting in the sub-nuclear localization of the tagged proteins by light microscopy. ( B ) Isolation and detection of proteins in vitro using dsDNA oligos. Streptavidin-sepharose beads (S) are sequentially incubated with biotinylated dsDNA oligos representing the operator sequences for LacI followed by incubation with a cell lysate containing LacI fused to a protein of interest (1). After binding the beads are washed and the resulting purified LacI-fusion protein can be observed by SDS–PAGE. M, marker, IN, input lysate, PI, isolated protein.

    Journal: Nucleic Acids Research

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides

    doi: 10.1093/nar/gnh164

    Figure Lengend Snippet: In situ detection and isolation of proteins using dsDNA oligonucleotides. ( A ) Detection of proteins in situ using dsDNA oligos. Cells grown on slides are fixed and hybridized with fluorescently labelled dsDNA oligos (red or green) that can detect the presence of proteins fused to either LacI (1) or TetR (2). The fluorescent dsDNA oligos corresponding to the operator sequences for LacI or TetR (green or red, respectively) bind each bacterial fusion protein specifically without cross hybridizing resulting in the sub-nuclear localization of the tagged proteins by light microscopy. ( B ) Isolation and detection of proteins in vitro using dsDNA oligos. Streptavidin-sepharose beads (S) are sequentially incubated with biotinylated dsDNA oligos representing the operator sequences for LacI followed by incubation with a cell lysate containing LacI fused to a protein of interest (1). After binding the beads are washed and the resulting purified LacI-fusion protein can be observed by SDS–PAGE. M, marker, IN, input lysate, PI, isolated protein.

    Article Snippet: For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma).

    Techniques: In Situ, Isolation, Light Microscopy, In Vitro, Incubation, Binding Assay, Purification, SDS Page, Marker

    In situ localization of SC35 and PML in human SK-N-SH cells using dsDNA oligonucleotides. ( A ) Localization of the LacI-tagged SC35 in paraformaldehyde fixed cells transfected with pGD-Flag-Lac-SC35 using the anti-Flag antibody M2 (Flag, red) or ( B ) with a Cy3-labelled dsDNA oligo (O-Sym, red) specific for LacI. PRP4 kinase was also localized as an endogenous marker for splicing speckles by antibody detection (PRP4K, green). Positive co-localization between PRP4K and LacI-tagged SC35 is demonstrated by a yellow signal in the merged images. The localization of the LacI–SC35 fusion protein was observed only in transfected cells (see B, O-Sym) and showed complete co-localization with PRP4 kinase (PRP4K, green) in nuclear speckles. ( C ) Localization of the TetR-tagged PML in paraformaldehyde fixed cells transfected with pGD-HA-TET-PML using the anti-HA (HA, red) or ( D ) with a Cy5-labelled dsDNA oligo (TET-O, red) specific for TetR. Endogenous PML was also localized as a marker for PML nuclear bodies antibody detection (PML, green). Positive co-localization between PML and TetR-tagged PML is demonstrated by a yellow signal in the merged images. The localization of the TetR–PML fusion protein was observed only in transfected cells (see C, TET-O) and showed complete co-localization with PML (PML, green) in PML nuclear bodies. ( E ) Multiple detection and localization of LacI–SC35 and TetR–PML in cells transfected with pGD-HA-TET-PML and pGD-Flag-Lac338-Sc35. Localization of LacI–SC35 and TetR–PML was accomplished using Cy3-labelled O-Sym or Cy5-labelled TET-O dsDNA oligos, respectively. TetR–PML and LacI–SC35 do not co-localize [separate red and green signals (respectively) in merged image], thus demonstrating the utility of dsDNA oligos for the multiplex detection of proteins in situ . DNA was counterstained with DAPI (blue in merged images). Scale bars = 5 μm.

    Journal: Nucleic Acids Research

    Article Title: In situ imaging and isolation of proteins using dsDNA oligonucleotides

    doi: 10.1093/nar/gnh164

    Figure Lengend Snippet: In situ localization of SC35 and PML in human SK-N-SH cells using dsDNA oligonucleotides. ( A ) Localization of the LacI-tagged SC35 in paraformaldehyde fixed cells transfected with pGD-Flag-Lac-SC35 using the anti-Flag antibody M2 (Flag, red) or ( B ) with a Cy3-labelled dsDNA oligo (O-Sym, red) specific for LacI. PRP4 kinase was also localized as an endogenous marker for splicing speckles by antibody detection (PRP4K, green). Positive co-localization between PRP4K and LacI-tagged SC35 is demonstrated by a yellow signal in the merged images. The localization of the LacI–SC35 fusion protein was observed only in transfected cells (see B, O-Sym) and showed complete co-localization with PRP4 kinase (PRP4K, green) in nuclear speckles. ( C ) Localization of the TetR-tagged PML in paraformaldehyde fixed cells transfected with pGD-HA-TET-PML using the anti-HA (HA, red) or ( D ) with a Cy5-labelled dsDNA oligo (TET-O, red) specific for TetR. Endogenous PML was also localized as a marker for PML nuclear bodies antibody detection (PML, green). Positive co-localization between PML and TetR-tagged PML is demonstrated by a yellow signal in the merged images. The localization of the TetR–PML fusion protein was observed only in transfected cells (see C, TET-O) and showed complete co-localization with PML (PML, green) in PML nuclear bodies. ( E ) Multiple detection and localization of LacI–SC35 and TetR–PML in cells transfected with pGD-HA-TET-PML and pGD-Flag-Lac338-Sc35. Localization of LacI–SC35 and TetR–PML was accomplished using Cy3-labelled O-Sym or Cy5-labelled TET-O dsDNA oligos, respectively. TetR–PML and LacI–SC35 do not co-localize [separate red and green signals (respectively) in merged image], thus demonstrating the utility of dsDNA oligos for the multiplex detection of proteins in situ . DNA was counterstained with DAPI (blue in merged images). Scale bars = 5 μm.

    Article Snippet: For construction of functionalized dsDNA oligos recognized by LacI, two 41 bp single-stranded oligonucleotides were constructed encoding the symmetrical Lac operator 19 bp core sequence O-Sym ( ): O-Sym-1 (* gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (* agattcaagaaattgtgagcgctcacaattctggctcacgc); where * represents a 5′ modification with either biotin, Cy3 or a disulfide group linked via a (CH2 )6 spacer (Sigma).

    Techniques: In Situ, Transfection, Marker, Multiplex Assay

    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each barcode in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.

    Journal: Scientific Reports

    Article Title: Overlap Extension Barcoding for the Next Generation Sequencing and Genotyping of Plasmodium falciparum in Individual Patients in Western Kenya

    doi: 10.1038/srep41108

    Figure Lengend Snippet: Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each barcode in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.

    Article Snippet: The final set of primers were designed to amplify the full length library consisting of the barcode oligonucleotides (IonTorrent Adaptor A-Barcode-Linker) and the gene target amplicons (Linker-Amplicon-TrP1) using the products of Step 1A and Step 1B as template.

    Techniques: Next-Generation Sequencing, Multiplex Assay, Sequencing, Chromatin Immunoprecipitation, Amplification

    ( a ) Workflow for preparation of individually identifiable sequence data from dried blood spots. ( b ) PCR Schema to append unique barcode oligonucleotides to multiplexed gene-target amplicons.

    Journal: Scientific Reports

    Article Title: Overlap Extension Barcoding for the Next Generation Sequencing and Genotyping of Plasmodium falciparum in Individual Patients in Western Kenya

    doi: 10.1038/srep41108

    Figure Lengend Snippet: ( a ) Workflow for preparation of individually identifiable sequence data from dried blood spots. ( b ) PCR Schema to append unique barcode oligonucleotides to multiplexed gene-target amplicons.

    Article Snippet: The final set of primers were designed to amplify the full length library consisting of the barcode oligonucleotides (IonTorrent Adaptor A-Barcode-Linker) and the gene target amplicons (Linker-Amplicon-TrP1) using the products of Step 1A and Step 1B as template.

    Techniques: Sequencing, Polymerase Chain Reaction

    Haplotypes present in clinical infection samples. ( a ) Number of unique pf-csp haplotypes contained in field-collected sample DNA by individual, sorted by barcode number. ( b ) Number of individuals bearing each pf-csp haplotype. ( c ) Distribution of pf-csp haplotypes among field-collected sample DNA. Each color indicates a different haplotype. ( d ) MOI values segregated based upon symptomaticity. ( e ) MOI values segregated based upon sampling date.

    Journal: Scientific Reports

    Article Title: Overlap Extension Barcoding for the Next Generation Sequencing and Genotyping of Plasmodium falciparum in Individual Patients in Western Kenya

    doi: 10.1038/srep41108

    Figure Lengend Snippet: Haplotypes present in clinical infection samples. ( a ) Number of unique pf-csp haplotypes contained in field-collected sample DNA by individual, sorted by barcode number. ( b ) Number of individuals bearing each pf-csp haplotype. ( c ) Distribution of pf-csp haplotypes among field-collected sample DNA. Each color indicates a different haplotype. ( d ) MOI values segregated based upon symptomaticity. ( e ) MOI values segregated based upon sampling date.

    Article Snippet: The final set of primers were designed to amplify the full length library consisting of the barcode oligonucleotides (IonTorrent Adaptor A-Barcode-Linker) and the gene target amplicons (Linker-Amplicon-TrP1) using the products of Step 1A and Step 1B as template.

    Techniques: Infection, Sampling