mtor Search Results


86
Wanleibio rabbit anti mtor
Rabbit Anti Mtor, supplied by Wanleibio, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/anti+mtor+p+wl03694/pm37356737-99-126-130
Average 86 stars, based on 1 article reviews
rabbit anti mtor - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Epizyme Inc anti mtor
Anti Mtor, supplied by Epizyme Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/anti+mtor/10__2147_slash_ott__s539944-67-21-25
Average 86 stars, based on 1 article reviews
anti mtor - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

94
OriGene recombinant full length mtor
Recombinant Full Length Mtor, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/MTOR+(NM_004958)+Human+Recombinant+Protein/pmc07140413-92-13-16
Average 94 stars, based on 1 article reviews
recombinant full length mtor - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

94
OriGene cagccagtcatctttggagacc
Cagccagtcatctttggagacc, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/MTOR+Human+qPCR+Primer+Pair/pmc12895042-22-5-17
Average 94 stars, based on 1 article reviews
cagccagtcatctttggagacc - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

90
OriGene mirna
Mirna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/MTOR+(NM_004958)+Human+Untagged+Clone/10__1161_slash_circulationaha__110__000323-323-6-41
Average 90 stars, based on 1 article reviews
mirna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

97
Cell Signaling Technology Inc mtor
See also Fig. . ( A ) Immunofluorescence analysis of hSPAR using an anti-hSPAR antibody in MDA-MB-231 cells ( n = 3 independent biological samples). Scale bar, 5 µm. ( B ) Immunoblotting against hSPAR, FIBRILLARIN (nuclear marker), β-Tubulin (cytoplasmic marker), and ATP1V1A (membrane marker) in nuclear, cytoplasmic (membrane components removed), and membrane fractions prepared from MDA-MB-231 cells (n = 3 independent biological samples). ( C ) Diagram of GFP-tagged hSPAR. ( D ) Living-cell images of GFP-hSPAR and lysosomes (Red, labeled with Lyso-Tracker) in MDA-MB-231 cells. The graphs display the fluorescence intensity (arbitrary units) of GFP-hSPAR and Lyso-Tracker over the distance from adjacent image (depicted by the arrow). The value of Pearson’s correlation Rr of SPAR and Lyso-Tracker is 0.907408. Scale bar, 5 µm, ( n = 3 independent biological samples). ( E ) Co-immunofluorescence staining of Flag (green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR. Nuclei were stained with Hoechst (blue). The Vector Ctrl and ΔATG1 + 2 are negative control groups, and Flag proteins are not expressed (The white “X” in Vector Ctrl and ΔATG1 + 2 groups indicates no green fluorescent signals). The graphs display the fluorescence intensity (arbitrary units) of Flag and the lysosomal marker LAMP1 over the distance from adjacent image (depicted by the arrows). The value of Pearson’s correlation Rr of Flag-hSPAR and LAMP1 is 0.934597. Scale bar, 25 µm ( n = 3 independent biological samples). ( F ) Immunoblotting against <t>p-mTOR,</t> <t>mTOR,</t> <t>p-S6K,</t> S6K, p-S6, S6, Flag and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR ( n = 3 independent biological samples). ( G ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( H ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, hSPAR, and GAPDH in extracts from the breast cancer tumoral tissues and their adjacent non-tumoral tissues ( n = 18 independent biological samples). ( I ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, p-S6/S6, and hSPAR/GAPDH from panel ( H ) ( n = 18 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( J ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR, with or without Rapamycin treatment (an mTOR inhibitor; 10 μM for 12 h) ( n = 3 independent biological samples). ( K ) Representative images of EdU assay in the presence of Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR, with or without Rapamycin treatment (10 μM for 12 h) ( n = 3 independent biological samples). Scale bar, 50 µm. ( L ) Quantification of cell proliferation rate from panel ( K ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .
Mtor, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/mTOR+Rabbit+mAb/pmc11876615-445-80-81
Average 97 stars, based on 1 article reviews
mtor - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

91
Cell Signaling Technology Inc signalsilence mtor sirna
See also Fig. . ( A ) Immunofluorescence analysis of hSPAR using an anti-hSPAR antibody in MDA-MB-231 cells ( n = 3 independent biological samples). Scale bar, 5 µm. ( B ) Immunoblotting against hSPAR, FIBRILLARIN (nuclear marker), β-Tubulin (cytoplasmic marker), and ATP1V1A (membrane marker) in nuclear, cytoplasmic (membrane components removed), and membrane fractions prepared from MDA-MB-231 cells (n = 3 independent biological samples). ( C ) Diagram of GFP-tagged hSPAR. ( D ) Living-cell images of GFP-hSPAR and lysosomes (Red, labeled with Lyso-Tracker) in MDA-MB-231 cells. The graphs display the fluorescence intensity (arbitrary units) of GFP-hSPAR and Lyso-Tracker over the distance from adjacent image (depicted by the arrow). The value of Pearson’s correlation Rr of SPAR and Lyso-Tracker is 0.907408. Scale bar, 5 µm, ( n = 3 independent biological samples). ( E ) Co-immunofluorescence staining of Flag (green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR. Nuclei were stained with Hoechst (blue). The Vector Ctrl and ΔATG1 + 2 are negative control groups, and Flag proteins are not expressed (The white “X” in Vector Ctrl and ΔATG1 + 2 groups indicates no green fluorescent signals). The graphs display the fluorescence intensity (arbitrary units) of Flag and the lysosomal marker LAMP1 over the distance from adjacent image (depicted by the arrows). The value of Pearson’s correlation Rr of Flag-hSPAR and LAMP1 is 0.934597. Scale bar, 25 µm ( n = 3 independent biological samples). ( F ) Immunoblotting against <t>p-mTOR,</t> <t>mTOR,</t> <t>p-S6K,</t> S6K, p-S6, S6, Flag and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR ( n = 3 independent biological samples). ( G ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( H ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, hSPAR, and GAPDH in extracts from the breast cancer tumoral tissues and their adjacent non-tumoral tissues ( n = 18 independent biological samples). ( I ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, p-S6/S6, and hSPAR/GAPDH from panel ( H ) ( n = 18 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( J ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR, with or without Rapamycin treatment (an mTOR inhibitor; 10 μM for 12 h) ( n = 3 independent biological samples). ( K ) Representative images of EdU assay in the presence of Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR, with or without Rapamycin treatment (10 μM for 12 h) ( n = 3 independent biological samples). Scale bar, 50 µm. ( L ) Quantification of cell proliferation rate from panel ( K ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .
Signalsilence Mtor Sirna, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/SignalSilence+mTOR+siRNA+I/pmc02820807-242-7-10
Average 91 stars, based on 1 article reviews
signalsilence mtor sirna - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

95
Cell Signaling Technology Inc mtor pathway antibody sampler kit
See also Fig. . ( A ) Immunofluorescence analysis of hSPAR using an anti-hSPAR antibody in MDA-MB-231 cells ( n = 3 independent biological samples). Scale bar, 5 µm. ( B ) Immunoblotting against hSPAR, FIBRILLARIN (nuclear marker), β-Tubulin (cytoplasmic marker), and ATP1V1A (membrane marker) in nuclear, cytoplasmic (membrane components removed), and membrane fractions prepared from MDA-MB-231 cells (n = 3 independent biological samples). ( C ) Diagram of GFP-tagged hSPAR. ( D ) Living-cell images of GFP-hSPAR and lysosomes (Red, labeled with Lyso-Tracker) in MDA-MB-231 cells. The graphs display the fluorescence intensity (arbitrary units) of GFP-hSPAR and Lyso-Tracker over the distance from adjacent image (depicted by the arrow). The value of Pearson’s correlation Rr of SPAR and Lyso-Tracker is 0.907408. Scale bar, 5 µm, ( n = 3 independent biological samples). ( E ) Co-immunofluorescence staining of Flag (green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR. Nuclei were stained with Hoechst (blue). The Vector Ctrl and ΔATG1 + 2 are negative control groups, and Flag proteins are not expressed (The white “X” in Vector Ctrl and ΔATG1 + 2 groups indicates no green fluorescent signals). The graphs display the fluorescence intensity (arbitrary units) of Flag and the lysosomal marker LAMP1 over the distance from adjacent image (depicted by the arrows). The value of Pearson’s correlation Rr of Flag-hSPAR and LAMP1 is 0.934597. Scale bar, 25 µm ( n = 3 independent biological samples). ( F ) Immunoblotting against <t>p-mTOR,</t> <t>mTOR,</t> <t>p-S6K,</t> S6K, p-S6, S6, Flag and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR ( n = 3 independent biological samples). ( G ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( H ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, hSPAR, and GAPDH in extracts from the breast cancer tumoral tissues and their adjacent non-tumoral tissues ( n = 18 independent biological samples). ( I ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, p-S6/S6, and hSPAR/GAPDH from panel ( H ) ( n = 18 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( J ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR, with or without Rapamycin treatment (an mTOR inhibitor; 10 μM for 12 h) ( n = 3 independent biological samples). ( K ) Representative images of EdU assay in the presence of Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR, with or without Rapamycin treatment (10 μM for 12 h) ( n = 3 independent biological samples). Scale bar, 50 µm. ( L ) Quantification of cell proliferation rate from panel ( K ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .
Mtor Pathway Antibody Sampler Kit, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/mTOR+Pathway+Antibody+Sampler+Kit/pmc12561351-291-214-220
Average 95 stars, based on 1 article reviews
mtor pathway antibody sampler kit - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

Image Search Results


See also Fig. . ( A ) Immunofluorescence analysis of hSPAR using an anti-hSPAR antibody in MDA-MB-231 cells ( n = 3 independent biological samples). Scale bar, 5 µm. ( B ) Immunoblotting against hSPAR, FIBRILLARIN (nuclear marker), β-Tubulin (cytoplasmic marker), and ATP1V1A (membrane marker) in nuclear, cytoplasmic (membrane components removed), and membrane fractions prepared from MDA-MB-231 cells (n = 3 independent biological samples). ( C ) Diagram of GFP-tagged hSPAR. ( D ) Living-cell images of GFP-hSPAR and lysosomes (Red, labeled with Lyso-Tracker) in MDA-MB-231 cells. The graphs display the fluorescence intensity (arbitrary units) of GFP-hSPAR and Lyso-Tracker over the distance from adjacent image (depicted by the arrow). The value of Pearson’s correlation Rr of SPAR and Lyso-Tracker is 0.907408. Scale bar, 5 µm, ( n = 3 independent biological samples). ( E ) Co-immunofluorescence staining of Flag (green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR. Nuclei were stained with Hoechst (blue). The Vector Ctrl and ΔATG1 + 2 are negative control groups, and Flag proteins are not expressed (The white “X” in Vector Ctrl and ΔATG1 + 2 groups indicates no green fluorescent signals). The graphs display the fluorescence intensity (arbitrary units) of Flag and the lysosomal marker LAMP1 over the distance from adjacent image (depicted by the arrows). The value of Pearson’s correlation Rr of Flag-hSPAR and LAMP1 is 0.934597. Scale bar, 25 µm ( n = 3 independent biological samples). ( F ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR ( n = 3 independent biological samples). ( G ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( H ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, hSPAR, and GAPDH in extracts from the breast cancer tumoral tissues and their adjacent non-tumoral tissues ( n = 18 independent biological samples). ( I ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, p-S6/S6, and hSPAR/GAPDH from panel ( H ) ( n = 18 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( J ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR, with or without Rapamycin treatment (an mTOR inhibitor; 10 μM for 12 h) ( n = 3 independent biological samples). ( K ) Representative images of EdU assay in the presence of Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR, with or without Rapamycin treatment (10 μM for 12 h) ( n = 3 independent biological samples). Scale bar, 50 µm. ( L ) Quantification of cell proliferation rate from panel ( K ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Journal: The EMBO Journal

Article Title: Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis

doi: 10.1038/s44318-024-00359-z

Figure Lengend Snippet: See also Fig. . ( A ) Immunofluorescence analysis of hSPAR using an anti-hSPAR antibody in MDA-MB-231 cells ( n = 3 independent biological samples). Scale bar, 5 µm. ( B ) Immunoblotting against hSPAR, FIBRILLARIN (nuclear marker), β-Tubulin (cytoplasmic marker), and ATP1V1A (membrane marker) in nuclear, cytoplasmic (membrane components removed), and membrane fractions prepared from MDA-MB-231 cells (n = 3 independent biological samples). ( C ) Diagram of GFP-tagged hSPAR. ( D ) Living-cell images of GFP-hSPAR and lysosomes (Red, labeled with Lyso-Tracker) in MDA-MB-231 cells. The graphs display the fluorescence intensity (arbitrary units) of GFP-hSPAR and Lyso-Tracker over the distance from adjacent image (depicted by the arrow). The value of Pearson’s correlation Rr of SPAR and Lyso-Tracker is 0.907408. Scale bar, 5 µm, ( n = 3 independent biological samples). ( E ) Co-immunofluorescence staining of Flag (green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR. Nuclei were stained with Hoechst (blue). The Vector Ctrl and ΔATG1 + 2 are negative control groups, and Flag proteins are not expressed (The white “X” in Vector Ctrl and ΔATG1 + 2 groups indicates no green fluorescent signals). The graphs display the fluorescence intensity (arbitrary units) of Flag and the lysosomal marker LAMP1 over the distance from adjacent image (depicted by the arrows). The value of Pearson’s correlation Rr of Flag-hSPAR and LAMP1 is 0.934597. Scale bar, 25 µm ( n = 3 independent biological samples). ( F ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR ( n = 3 independent biological samples). ( G ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( H ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, hSPAR, and GAPDH in extracts from the breast cancer tumoral tissues and their adjacent non-tumoral tissues ( n = 18 independent biological samples). ( I ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, p-S6/S6, and hSPAR/GAPDH from panel ( H ) ( n = 18 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( J ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR, with or without Rapamycin treatment (an mTOR inhibitor; 10 μM for 12 h) ( n = 3 independent biological samples). ( K ) Representative images of EdU assay in the presence of Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR, with or without Rapamycin treatment (10 μM for 12 h) ( n = 3 independent biological samples). Scale bar, 50 µm. ( L ) Quantification of cell proliferation rate from panel ( K ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Article Snippet: The membranes were blocked in 5% BSA (Sangon, China) for 1 h at room temperature, and then incubated at 4 °C overnight with primary antibody GAPDH (Proteintech, USA, 60004-1-Ig), hSPAR (HuaBio, China), Flag (Abcam, UK, ab205606), β-Tubulin (Proteintech, USA, 10068-1-AP), FIBRILLARIN (Proteintech, USA, 16021-1-AP), ATPV1A (Proteintech, USA, 14418-1-AP), LAMP2 (CST, USA, 49067), TRIM21 (Proteintech, USA, 67136-1-Ig), P27KIP1 (Proteintech, USA, 25614-1-AP), phospho-P27KIP1 (Abcam, USA, ab75908), SKP2 (Proteintech, USA, 15010-1-AP), SLC7A1 (Proteintech, USA, 14195-1-AP), SLC7A5 (Proteintech, USA, 28670-1-AP), phospho-mTOR (CST, USA, 5536), mTOR (CST, USA, 2983), phospho-S6K (CST, USA, 9234), S6K (CST, USA, 2708), phospho-S6 (CST, USA, 2211), S6 (CST, USA, 2217), phospho-AKT (CST, USA, 4060), AKT (CST, USA, 9272), Ubiquitin (Abcam, UK, ab134953), SLC38A2 (ImmunoWay, USA, YT4354), LAMTOR1(CST, USA, 8975), LAMTOR2 (CST, USA, 8145), LAMTOR3 (Proteintech, USA, 14492-1-AP), LAMTOR4 (CST, USA, 13140), LAMTOR5 (Proteintech, USA,11937-1-AP), RagA (CST, USA, 4357S) and TAT (Abcam, UK, ab42359).

Techniques: Immunofluorescence, Western Blot, Marker, Membrane, Labeling, Fluorescence, Staining, Transfection, Plasmid Preparation, Negative Control, Two Tailed Test, EdU Assay

See also Fig. . ( A ) List of the top10 hSPAR-interacting proteins identified by hSPAR Co-IP analysis and mass spectrometry. ( B ) Interaction of TRIM21 and Flag-hSPAR detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). ( C ) Immunoblotting against GFP, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH for extracts from MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). ( D ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( C ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( E ) Representative images of EdU assay in MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). Scale bar, 50 µm. ( F ) Quantification of cell proliferation rate from panel ( E ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Journal: The EMBO Journal

Article Title: Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis

doi: 10.1038/s44318-024-00359-z

Figure Lengend Snippet: See also Fig. . ( A ) List of the top10 hSPAR-interacting proteins identified by hSPAR Co-IP analysis and mass spectrometry. ( B ) Interaction of TRIM21 and Flag-hSPAR detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). ( C ) Immunoblotting against GFP, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH for extracts from MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). ( D ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( C ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( E ) Representative images of EdU assay in MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). Scale bar, 50 µm. ( F ) Quantification of cell proliferation rate from panel ( E ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Article Snippet: The membranes were blocked in 5% BSA (Sangon, China) for 1 h at room temperature, and then incubated at 4 °C overnight with primary antibody GAPDH (Proteintech, USA, 60004-1-Ig), hSPAR (HuaBio, China), Flag (Abcam, UK, ab205606), β-Tubulin (Proteintech, USA, 10068-1-AP), FIBRILLARIN (Proteintech, USA, 16021-1-AP), ATPV1A (Proteintech, USA, 14418-1-AP), LAMP2 (CST, USA, 49067), TRIM21 (Proteintech, USA, 67136-1-Ig), P27KIP1 (Proteintech, USA, 25614-1-AP), phospho-P27KIP1 (Abcam, USA, ab75908), SKP2 (Proteintech, USA, 15010-1-AP), SLC7A1 (Proteintech, USA, 14195-1-AP), SLC7A5 (Proteintech, USA, 28670-1-AP), phospho-mTOR (CST, USA, 5536), mTOR (CST, USA, 2983), phospho-S6K (CST, USA, 9234), S6K (CST, USA, 2708), phospho-S6 (CST, USA, 2211), S6 (CST, USA, 2217), phospho-AKT (CST, USA, 4060), AKT (CST, USA, 9272), Ubiquitin (Abcam, UK, ab134953), SLC38A2 (ImmunoWay, USA, YT4354), LAMTOR1(CST, USA, 8975), LAMTOR2 (CST, USA, 8145), LAMTOR3 (Proteintech, USA, 14492-1-AP), LAMTOR4 (CST, USA, 13140), LAMTOR5 (Proteintech, USA,11937-1-AP), RagA (CST, USA, 4357S) and TAT (Abcam, UK, ab42359).

Techniques: Co-Immunoprecipitation Assay, Mass Spectrometry, Western Blot, Transfection, Construct, EdU Assay

See also Fig. . ( A ) Interaction of TRIM21 and P27KIP1 detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). ( B ) Changes of the ubiquitination level of P27KIP1 detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR, together with HA-Ub, followed by treatment with DMSO or the proteasome inhibitor MG132 (5 μM). Left, immunoblotting of inputs. Middle, immunoblotting using antibody against ubiquitin following IP of P27KIP1. Right, immunoblotting using the antibody against P27KIP1 following IP of HA ( n = 3 independent biological samples). ( C ) Changes of the ubiquitination level of P27KIP1 after co-transfection with GFP-TRIM21 in the presence of Flag-hSPAR and HA-Ub detected by Co-IP and immunoblotting from MDA-MB-231 cells. Left, immunoblotting of inputs. Middle, immunoblotting using antibody against ubiquitin following IP of P27KIP1. Right, immunoblotting using the antibody against P27KIP1 following IP of HA ( n = 3 independent biological samples). ( D ) Immunoblotting against P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, hSPAR, and GAPDH in extracts from MDA-MB-231 cells in the presence of siCtrl or indicated si hSPAR s ( n = 3 independent biological samples). ( E ) Quantified relative levels of P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( D ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( F ) Immunoblotting against P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH for extracts from MDA-MB-231 cells transfected with the indicated controls, and Flag-hSPAR with or without P27KIP1 knockdown ( n = 3 independent biological samples). ( G ) Quantified relative levels of P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( H ) Representative images of EdU assay in the indicated controls, and Flag-hSPAR with or without P27KIP1 knockdown ( n = 3 independent biological samples). Scale bar, 50 µm. ( I ) Quantification of cell proliferation rate from panel ( H ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Journal: The EMBO Journal

Article Title: Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis

doi: 10.1038/s44318-024-00359-z

Figure Lengend Snippet: See also Fig. . ( A ) Interaction of TRIM21 and P27KIP1 detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). ( B ) Changes of the ubiquitination level of P27KIP1 detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR, together with HA-Ub, followed by treatment with DMSO or the proteasome inhibitor MG132 (5 μM). Left, immunoblotting of inputs. Middle, immunoblotting using antibody against ubiquitin following IP of P27KIP1. Right, immunoblotting using the antibody against P27KIP1 following IP of HA ( n = 3 independent biological samples). ( C ) Changes of the ubiquitination level of P27KIP1 after co-transfection with GFP-TRIM21 in the presence of Flag-hSPAR and HA-Ub detected by Co-IP and immunoblotting from MDA-MB-231 cells. Left, immunoblotting of inputs. Middle, immunoblotting using antibody against ubiquitin following IP of P27KIP1. Right, immunoblotting using the antibody against P27KIP1 following IP of HA ( n = 3 independent biological samples). ( D ) Immunoblotting against P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, hSPAR, and GAPDH in extracts from MDA-MB-231 cells in the presence of siCtrl or indicated si hSPAR s ( n = 3 independent biological samples). ( E ) Quantified relative levels of P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( D ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( F ) Immunoblotting against P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH for extracts from MDA-MB-231 cells transfected with the indicated controls, and Flag-hSPAR with or without P27KIP1 knockdown ( n = 3 independent biological samples). ( G ) Quantified relative levels of P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( H ) Representative images of EdU assay in the indicated controls, and Flag-hSPAR with or without P27KIP1 knockdown ( n = 3 independent biological samples). Scale bar, 50 µm. ( I ) Quantification of cell proliferation rate from panel ( H ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Article Snippet: The membranes were blocked in 5% BSA (Sangon, China) for 1 h at room temperature, and then incubated at 4 °C overnight with primary antibody GAPDH (Proteintech, USA, 60004-1-Ig), hSPAR (HuaBio, China), Flag (Abcam, UK, ab205606), β-Tubulin (Proteintech, USA, 10068-1-AP), FIBRILLARIN (Proteintech, USA, 16021-1-AP), ATPV1A (Proteintech, USA, 14418-1-AP), LAMP2 (CST, USA, 49067), TRIM21 (Proteintech, USA, 67136-1-Ig), P27KIP1 (Proteintech, USA, 25614-1-AP), phospho-P27KIP1 (Abcam, USA, ab75908), SKP2 (Proteintech, USA, 15010-1-AP), SLC7A1 (Proteintech, USA, 14195-1-AP), SLC7A5 (Proteintech, USA, 28670-1-AP), phospho-mTOR (CST, USA, 5536), mTOR (CST, USA, 2983), phospho-S6K (CST, USA, 9234), S6K (CST, USA, 2708), phospho-S6 (CST, USA, 2211), S6 (CST, USA, 2217), phospho-AKT (CST, USA, 4060), AKT (CST, USA, 9272), Ubiquitin (Abcam, UK, ab134953), SLC38A2 (ImmunoWay, USA, YT4354), LAMTOR1(CST, USA, 8975), LAMTOR2 (CST, USA, 8145), LAMTOR3 (Proteintech, USA, 14492-1-AP), LAMTOR4 (CST, USA, 13140), LAMTOR5 (Proteintech, USA,11937-1-AP), RagA (CST, USA, 4357S) and TAT (Abcam, UK, ab42359).

Techniques: Co-Immunoprecipitation Assay, Western Blot, Transfection, Construct, Ubiquitin Proteomics, Plasmid Preparation, Cotransfection, Knockdown, EdU Assay

See also Figs. and . ( A ) Immunoblotting of whole-cell extracts (left panel), cytoplasmic (lysosome components removed) and lysosomal extracts (right panel) prepared from MDA-MB-231 cells transfected with the indicated constructs against p-mTOR, mTOR, RagA, LAMTOR1-5, Flag, GAPDH, LAMP2 (lysosomal marker), and β-Tubulin (cytoplasmic marker) ( n = 3 independent biological samples). ( B ) Heatmap shows the relative expression analysis of the displayed experiment for each protein to β-Tubulin (cytoplasmic fractions) or LAMP2 (lysosomal fractions) from panel ( A ) ( n = 3 independent biological samples). ( C ) Interaction of LAMTOR1 with P27KIP1, LAMTOR2-5, RagA and mTOR, or P27KIP1 with LAMTOR1 detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with the indicated constructs. Left: immunoblotting of inputs. Upper right: immunoblotting using antibodies against LAMTOR1 and P27KIP1 after IP of P27KIP1. Lower right: immunoblotting using antibodies against P27KIP1, LAMTOR1-5, RagA and mTOR after IP of LAMTOR1 ( n = 3 independent biological samples). ( D ) Immunoblotting of cytoplasmic (lysosome components removed) and lysosomal extracts (right panel) prepared from MDA-MB-231 cells transfected with siCtrl, indicated siTRIM21s, or siTRIM21s together with siSLC38A2s against P27KIP1, TRIM21, SLC38A2, p-mTOR, mTOR, RagA, LAMTOR1-5, LAMP2 (lysosomal marker) and β-Tubulin (cytoplasmic marker) ( n = 3 independent biological samples). ( E ) Heatmap shows the relative expression analysis of the displayed experiment for each protein to β-Tubulin (cytoplasmic fractions) or LAMP2 (lysosomal fractions) from panel ( D ) ( n = 3 independent biological samples). ( F ) Immunoblotting against TRIM21, SLC38A2, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6 and GAPDH for extracts from MDA-MB-231 cells transfected with siCtrl, indicated siTRIM21s or siSLC38A2s, or siTRIM21s together with siSLC38A2s ( n = 3 independent biological samples). ( G ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Journal: The EMBO Journal

Article Title: Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis

doi: 10.1038/s44318-024-00359-z

Figure Lengend Snippet: See also Figs. and . ( A ) Immunoblotting of whole-cell extracts (left panel), cytoplasmic (lysosome components removed) and lysosomal extracts (right panel) prepared from MDA-MB-231 cells transfected with the indicated constructs against p-mTOR, mTOR, RagA, LAMTOR1-5, Flag, GAPDH, LAMP2 (lysosomal marker), and β-Tubulin (cytoplasmic marker) ( n = 3 independent biological samples). ( B ) Heatmap shows the relative expression analysis of the displayed experiment for each protein to β-Tubulin (cytoplasmic fractions) or LAMP2 (lysosomal fractions) from panel ( A ) ( n = 3 independent biological samples). ( C ) Interaction of LAMTOR1 with P27KIP1, LAMTOR2-5, RagA and mTOR, or P27KIP1 with LAMTOR1 detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with the indicated constructs. Left: immunoblotting of inputs. Upper right: immunoblotting using antibodies against LAMTOR1 and P27KIP1 after IP of P27KIP1. Lower right: immunoblotting using antibodies against P27KIP1, LAMTOR1-5, RagA and mTOR after IP of LAMTOR1 ( n = 3 independent biological samples). ( D ) Immunoblotting of cytoplasmic (lysosome components removed) and lysosomal extracts (right panel) prepared from MDA-MB-231 cells transfected with siCtrl, indicated siTRIM21s, or siTRIM21s together with siSLC38A2s against P27KIP1, TRIM21, SLC38A2, p-mTOR, mTOR, RagA, LAMTOR1-5, LAMP2 (lysosomal marker) and β-Tubulin (cytoplasmic marker) ( n = 3 independent biological samples). ( E ) Heatmap shows the relative expression analysis of the displayed experiment for each protein to β-Tubulin (cytoplasmic fractions) or LAMP2 (lysosomal fractions) from panel ( D ) ( n = 3 independent biological samples). ( F ) Immunoblotting against TRIM21, SLC38A2, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6 and GAPDH for extracts from MDA-MB-231 cells transfected with siCtrl, indicated siTRIM21s or siSLC38A2s, or siTRIM21s together with siSLC38A2s ( n = 3 independent biological samples). ( G ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Article Snippet: The membranes were blocked in 5% BSA (Sangon, China) for 1 h at room temperature, and then incubated at 4 °C overnight with primary antibody GAPDH (Proteintech, USA, 60004-1-Ig), hSPAR (HuaBio, China), Flag (Abcam, UK, ab205606), β-Tubulin (Proteintech, USA, 10068-1-AP), FIBRILLARIN (Proteintech, USA, 16021-1-AP), ATPV1A (Proteintech, USA, 14418-1-AP), LAMP2 (CST, USA, 49067), TRIM21 (Proteintech, USA, 67136-1-Ig), P27KIP1 (Proteintech, USA, 25614-1-AP), phospho-P27KIP1 (Abcam, USA, ab75908), SKP2 (Proteintech, USA, 15010-1-AP), SLC7A1 (Proteintech, USA, 14195-1-AP), SLC7A5 (Proteintech, USA, 28670-1-AP), phospho-mTOR (CST, USA, 5536), mTOR (CST, USA, 2983), phospho-S6K (CST, USA, 9234), S6K (CST, USA, 2708), phospho-S6 (CST, USA, 2211), S6 (CST, USA, 2217), phospho-AKT (CST, USA, 4060), AKT (CST, USA, 9272), Ubiquitin (Abcam, UK, ab134953), SLC38A2 (ImmunoWay, USA, YT4354), LAMTOR1(CST, USA, 8975), LAMTOR2 (CST, USA, 8145), LAMTOR3 (Proteintech, USA, 14492-1-AP), LAMTOR4 (CST, USA, 13140), LAMTOR5 (Proteintech, USA,11937-1-AP), RagA (CST, USA, 4357S) and TAT (Abcam, UK, ab42359).

Techniques: Western Blot, Transfection, Construct, Marker, Expressing, Co-Immunoprecipitation Assay

( A ) Immunoblotting against P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH for extracts from HEK293T cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). ( B ) Quantified relative levels of P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( A ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( C ) Representative images of EdU assay HEK293T cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). Scale bar, 50 µm. ( D ) Quantification of cell proliferation rate from panel ( C ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( E ) Immunoblotting against SLC38A2, P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH for extracts from MDA-MB-468 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). ( F ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( E ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( G ) Representative images of EdU assay MDA-MB-468 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). Scale bar, 50 µm. ( H ) Quantification of cell proliferation rate from panel ( G ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( I ) Immunoblotting against SLC38A2, P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH for extracts from MCF7 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). ( J ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( I ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( K ) Representative images of EdU assay MCF7 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). Scale bar, 50 µm. ( L ) Quantification of cell proliferation rate from panel ( K ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text.

Journal: The EMBO Journal

Article Title: Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis

doi: 10.1038/s44318-024-00359-z

Figure Lengend Snippet: ( A ) Immunoblotting against P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH for extracts from HEK293T cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). ( B ) Quantified relative levels of P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( A ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( C ) Representative images of EdU assay HEK293T cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). Scale bar, 50 µm. ( D ) Quantification of cell proliferation rate from panel ( C ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( E ) Immunoblotting against SLC38A2, P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH for extracts from MDA-MB-468 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). ( F ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( E ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( G ) Representative images of EdU assay MDA-MB-468 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). Scale bar, 50 µm. ( H ) Quantification of cell proliferation rate from panel ( G ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( I ) Immunoblotting against SLC38A2, P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH for extracts from MCF7 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). ( J ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( I ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( K ) Representative images of EdU assay MCF7 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). Scale bar, 50 µm. ( L ) Quantification of cell proliferation rate from panel ( K ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text.

Article Snippet: The membranes were blocked in 5% BSA (Sangon, China) for 1 h at room temperature, and then incubated at 4 °C overnight with primary antibody GAPDH (Proteintech, USA, 60004-1-Ig), hSPAR (HuaBio, China), Flag (Abcam, UK, ab205606), β-Tubulin (Proteintech, USA, 10068-1-AP), FIBRILLARIN (Proteintech, USA, 16021-1-AP), ATPV1A (Proteintech, USA, 14418-1-AP), LAMP2 (CST, USA, 49067), TRIM21 (Proteintech, USA, 67136-1-Ig), P27KIP1 (Proteintech, USA, 25614-1-AP), phospho-P27KIP1 (Abcam, USA, ab75908), SKP2 (Proteintech, USA, 15010-1-AP), SLC7A1 (Proteintech, USA, 14195-1-AP), SLC7A5 (Proteintech, USA, 28670-1-AP), phospho-mTOR (CST, USA, 5536), mTOR (CST, USA, 2983), phospho-S6K (CST, USA, 9234), S6K (CST, USA, 2708), phospho-S6 (CST, USA, 2211), S6 (CST, USA, 2217), phospho-AKT (CST, USA, 4060), AKT (CST, USA, 9272), Ubiquitin (Abcam, UK, ab134953), SLC38A2 (ImmunoWay, USA, YT4354), LAMTOR1(CST, USA, 8975), LAMTOR2 (CST, USA, 8145), LAMTOR3 (Proteintech, USA, 14492-1-AP), LAMTOR4 (CST, USA, 13140), LAMTOR5 (Proteintech, USA,11937-1-AP), RagA (CST, USA, 4357S) and TAT (Abcam, UK, ab42359).

Techniques: Western Blot, Transfection, Plasmid Preparation, EdU Assay

( A ) hSPAR is composed of an N-terminal domain, a transmembrane (TM) domain and a C-terminal domain as predicted by Alphafold2. ( B ) Diagram of Flag-tagged full-length hSPAR and three hSPAR domain deletion variants. ( C ) Co-immunofluorescence staining of P27KIP1 (green) and Lyso-Tracker (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble P27KIP1. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of P27KIP1 and Lyso-Tracker over the distance from adjacent image (depicted by the arrows). Scale bar, 5 µm ( n = 3 independent biological samples). ( D ) Co-immunofluorescence staining of mTOR (green) and Lyso-Tracker (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble mTOR. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of mTOR and Lyso-Tracker over the distance from adjacent image (depicted by the arrows). Scale bar, 5 µm ( n = 3 independent biological samples). ( E ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( F ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( G ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( H ) Quantification of cell proliferation rate from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( I ) Quantification of cell proliferation rate from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( J ) Immunohistochemistry of TAT-hSPAR-C detected by immunohistochemistry with the anti-hSPAR antibody in the xenografts from panel (Fig. ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( K ) Immunohistochemistry of cell proliferation marker Ki67 in the xenografts from panel (Fig. ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( L ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction.

Journal: The EMBO Journal

Article Title: Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis

doi: 10.1038/s44318-024-00359-z

Figure Lengend Snippet: ( A ) hSPAR is composed of an N-terminal domain, a transmembrane (TM) domain and a C-terminal domain as predicted by Alphafold2. ( B ) Diagram of Flag-tagged full-length hSPAR and three hSPAR domain deletion variants. ( C ) Co-immunofluorescence staining of P27KIP1 (green) and Lyso-Tracker (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble P27KIP1. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of P27KIP1 and Lyso-Tracker over the distance from adjacent image (depicted by the arrows). Scale bar, 5 µm ( n = 3 independent biological samples). ( D ) Co-immunofluorescence staining of mTOR (green) and Lyso-Tracker (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble mTOR. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of mTOR and Lyso-Tracker over the distance from adjacent image (depicted by the arrows). Scale bar, 5 µm ( n = 3 independent biological samples). ( E ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( F ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( G ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( H ) Quantification of cell proliferation rate from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( I ) Quantification of cell proliferation rate from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( J ) Immunohistochemistry of TAT-hSPAR-C detected by immunohistochemistry with the anti-hSPAR antibody in the xenografts from panel (Fig. ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( K ) Immunohistochemistry of cell proliferation marker Ki67 in the xenografts from panel (Fig. ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( L ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction.

Article Snippet: The membranes were blocked in 5% BSA (Sangon, China) for 1 h at room temperature, and then incubated at 4 °C overnight with primary antibody GAPDH (Proteintech, USA, 60004-1-Ig), hSPAR (HuaBio, China), Flag (Abcam, UK, ab205606), β-Tubulin (Proteintech, USA, 10068-1-AP), FIBRILLARIN (Proteintech, USA, 16021-1-AP), ATPV1A (Proteintech, USA, 14418-1-AP), LAMP2 (CST, USA, 49067), TRIM21 (Proteintech, USA, 67136-1-Ig), P27KIP1 (Proteintech, USA, 25614-1-AP), phospho-P27KIP1 (Abcam, USA, ab75908), SKP2 (Proteintech, USA, 15010-1-AP), SLC7A1 (Proteintech, USA, 14195-1-AP), SLC7A5 (Proteintech, USA, 28670-1-AP), phospho-mTOR (CST, USA, 5536), mTOR (CST, USA, 2983), phospho-S6K (CST, USA, 9234), S6K (CST, USA, 2708), phospho-S6 (CST, USA, 2211), S6 (CST, USA, 2217), phospho-AKT (CST, USA, 4060), AKT (CST, USA, 9272), Ubiquitin (Abcam, UK, ab134953), SLC38A2 (ImmunoWay, USA, YT4354), LAMTOR1(CST, USA, 8975), LAMTOR2 (CST, USA, 8145), LAMTOR3 (Proteintech, USA, 14492-1-AP), LAMTOR4 (CST, USA, 13140), LAMTOR5 (Proteintech, USA,11937-1-AP), RagA (CST, USA, 4357S) and TAT (Abcam, UK, ab42359).

Techniques: Immunofluorescence, Staining, Transfection, Construct, Fluorescence, Two Tailed Test, Immunohistochemistry, Marker

See also Fig. . ( A ) Changes of interaction between TRIM21 and P27KIP1, TRIM21, and Flag-hSPAR-C detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR-C. Upper, immunoblotting of inputs. Middle, immunoblotting using antibodies against TRIM21, P27KIP1 and Flag following IP of TRIM21. Lower, immunoblotting using antibodies against Flag and TRIM21 following IP of Flag ( n = 3 independent biological samples). ( B ) Co-immunofluorescence staining of P27KIP1(green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble P27KIP1. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of P27KIP1 and LAMP1 over the distance from adjacent image (depicted by the arrows). The graphs display the values of Pearson’s correlation Rr of P27KIP1 and LAMP1 with the indicated constructs. Scale bar, 25 µm ( n = 3 independent biological samples). ( C ) Co-immunofluorescence staining of mTOR (green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble mTOR. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of mTOR and LAMP1 over the distance from adjacent image (depicted by the arrows). The graphs display the values of Pearson’s correlation Rr of mTOR and LAMP1 with the indicated constructs. Scale bar, 25 µm ( n = 3 independent biological samples). ( D ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, and S6 in extracts from MDA-MB-231 cells transfected with ΔATG1 + 2, Flag-tagged full-length hSPAR or three indicated hSPAR domain deletion variants. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( E ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, and S6 in extracts from MDA-MB-231 cells transfected with ΔATG1 + 2, Flag-hSPAR or Flag-hSPAR-C (hSPAR’s C-terminal domain). Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( F ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, P27KIP1, SLC38A2 and TAT in extracts from MDA-MB-231 cells treated with TAT-hSPAR-C (150 nM) at the indicated time. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( G ) Representative images of EdU assay detected in MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, Flag-hSPAR, ΔN-hSPAR, ΔTM-hSPAR, ΔC-hSPAR, or Flag-hSPAR-C. Scale bar, 50 µm. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( H ) Representative images of EdU assay detected in MDA-MB-231 cells treated with TAT or TAT-hSPAR. Scale bar, 50 µm. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( I ) Images of tumors from breast cancer xenograft mice with injection of TAT ( n = 6 independent biological samples) or TAT-hSPAR-C peptide ( n = 6 independent biological samples). ( J ) Time-course analysis of tumor volume in the xenografts from panel ( I ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( K ) Tumor weight in the xenografts from panel ( I ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( L ) Levels of glutamine in the xenografts from panel ( I ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( M ) Immunohistochemistry of SLC38A2 detected by immunohistochemistry with the anti-SLC38A2 antibody in the xenografts from panel ( I ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( N ) Immunohistochemistry of P27KIP1 detected by immunohistochemistry with the anti-P27KIP1 antibody in the xenografts from panel ( I ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( O ) Immunoblotting against SLC38A2, P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, TAT, and GAPDH in the xenografts from panel ( I ). Statistical analysis is shown in Fig. ( n = 12 independent biological samples). ( P ) Working model: in cancer cells or xenograft tumors, hSPAR or hSPAR-C interacts with E3 ligase TRIM21 and disrupts TRIM21-P27KIP1 interaction, resulting escape of P27KIP1 from ubiquitin-proteasome degradation and increase of P27KIP1 expression level in cytosol. Coordinately, acting as an inhibitor for glutamine uptake, hSPAR results in glutamine deprivation by suppressing SLC38A2, and promotes P27KIP1 lysosomal-localization. Lysosome-localized P27KIP1 competitively interacts with LAMTOR1 to disassemble mTORC1 complex and inhibit cancer cell proliferation. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Journal: The EMBO Journal

Article Title: Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis

doi: 10.1038/s44318-024-00359-z

Figure Lengend Snippet: See also Fig. . ( A ) Changes of interaction between TRIM21 and P27KIP1, TRIM21, and Flag-hSPAR-C detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR-C. Upper, immunoblotting of inputs. Middle, immunoblotting using antibodies against TRIM21, P27KIP1 and Flag following IP of TRIM21. Lower, immunoblotting using antibodies against Flag and TRIM21 following IP of Flag ( n = 3 independent biological samples). ( B ) Co-immunofluorescence staining of P27KIP1(green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble P27KIP1. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of P27KIP1 and LAMP1 over the distance from adjacent image (depicted by the arrows). The graphs display the values of Pearson’s correlation Rr of P27KIP1 and LAMP1 with the indicated constructs. Scale bar, 25 µm ( n = 3 independent biological samples). ( C ) Co-immunofluorescence staining of mTOR (green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble mTOR. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of mTOR and LAMP1 over the distance from adjacent image (depicted by the arrows). The graphs display the values of Pearson’s correlation Rr of mTOR and LAMP1 with the indicated constructs. Scale bar, 25 µm ( n = 3 independent biological samples). ( D ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, and S6 in extracts from MDA-MB-231 cells transfected with ΔATG1 + 2, Flag-tagged full-length hSPAR or three indicated hSPAR domain deletion variants. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( E ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, and S6 in extracts from MDA-MB-231 cells transfected with ΔATG1 + 2, Flag-hSPAR or Flag-hSPAR-C (hSPAR’s C-terminal domain). Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( F ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, P27KIP1, SLC38A2 and TAT in extracts from MDA-MB-231 cells treated with TAT-hSPAR-C (150 nM) at the indicated time. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( G ) Representative images of EdU assay detected in MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, Flag-hSPAR, ΔN-hSPAR, ΔTM-hSPAR, ΔC-hSPAR, or Flag-hSPAR-C. Scale bar, 50 µm. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( H ) Representative images of EdU assay detected in MDA-MB-231 cells treated with TAT or TAT-hSPAR. Scale bar, 50 µm. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( I ) Images of tumors from breast cancer xenograft mice with injection of TAT ( n = 6 independent biological samples) or TAT-hSPAR-C peptide ( n = 6 independent biological samples). ( J ) Time-course analysis of tumor volume in the xenografts from panel ( I ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( K ) Tumor weight in the xenografts from panel ( I ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( L ) Levels of glutamine in the xenografts from panel ( I ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( M ) Immunohistochemistry of SLC38A2 detected by immunohistochemistry with the anti-SLC38A2 antibody in the xenografts from panel ( I ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( N ) Immunohistochemistry of P27KIP1 detected by immunohistochemistry with the anti-P27KIP1 antibody in the xenografts from panel ( I ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( O ) Immunoblotting against SLC38A2, P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, TAT, and GAPDH in the xenografts from panel ( I ). Statistical analysis is shown in Fig. ( n = 12 independent biological samples). ( P ) Working model: in cancer cells or xenograft tumors, hSPAR or hSPAR-C interacts with E3 ligase TRIM21 and disrupts TRIM21-P27KIP1 interaction, resulting escape of P27KIP1 from ubiquitin-proteasome degradation and increase of P27KIP1 expression level in cytosol. Coordinately, acting as an inhibitor for glutamine uptake, hSPAR results in glutamine deprivation by suppressing SLC38A2, and promotes P27KIP1 lysosomal-localization. Lysosome-localized P27KIP1 competitively interacts with LAMTOR1 to disassemble mTORC1 complex and inhibit cancer cell proliferation. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Article Snippet: The membranes were blocked in 5% BSA (Sangon, China) for 1 h at room temperature, and then incubated at 4 °C overnight with primary antibody GAPDH (Proteintech, USA, 60004-1-Ig), hSPAR (HuaBio, China), Flag (Abcam, UK, ab205606), β-Tubulin (Proteintech, USA, 10068-1-AP), FIBRILLARIN (Proteintech, USA, 16021-1-AP), ATPV1A (Proteintech, USA, 14418-1-AP), LAMP2 (CST, USA, 49067), TRIM21 (Proteintech, USA, 67136-1-Ig), P27KIP1 (Proteintech, USA, 25614-1-AP), phospho-P27KIP1 (Abcam, USA, ab75908), SKP2 (Proteintech, USA, 15010-1-AP), SLC7A1 (Proteintech, USA, 14195-1-AP), SLC7A5 (Proteintech, USA, 28670-1-AP), phospho-mTOR (CST, USA, 5536), mTOR (CST, USA, 2983), phospho-S6K (CST, USA, 9234), S6K (CST, USA, 2708), phospho-S6 (CST, USA, 2211), S6 (CST, USA, 2217), phospho-AKT (CST, USA, 4060), AKT (CST, USA, 9272), Ubiquitin (Abcam, UK, ab134953), SLC38A2 (ImmunoWay, USA, YT4354), LAMTOR1(CST, USA, 8975), LAMTOR2 (CST, USA, 8145), LAMTOR3 (Proteintech, USA, 14492-1-AP), LAMTOR4 (CST, USA, 13140), LAMTOR5 (Proteintech, USA,11937-1-AP), RagA (CST, USA, 4357S) and TAT (Abcam, UK, ab42359).

Techniques: Co-Immunoprecipitation Assay, Western Blot, Transfection, Plasmid Preparation, Immunofluorescence, Staining, Marker, Construct, Fluorescence, EdU Assay, Injection, Two Tailed Test, Immunohistochemistry, Ubiquitin Proteomics, Expressing