mtor Search Results


86
Wanleibio rabbit anti mtor
Rabbit Anti Mtor, supplied by Wanleibio, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/anti+mtor+p+wl03694/pm37356737-99-126-130
Average 86 stars, based on 1 article reviews
rabbit anti mtor - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Epizyme Inc anti mtor
Anti Mtor, supplied by Epizyme Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/anti+mtor/10__2147_slash_ott__s539944-67-21-25
Average 86 stars, based on 1 article reviews
anti mtor - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

94
OriGene recombinant full length mtor
Recombinant Full Length Mtor, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/MTOR+(NM_004958)+Human+Recombinant+Protein/pmc07140413-92-13-16
Average 94 stars, based on 1 article reviews
recombinant full length mtor - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
OriGene cagccagtcatctttggagacc
Cagccagtcatctttggagacc, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/MTOR+Human+qPCR+Primer+Pair/pmc12895042-22-5-17
Average 94 stars, based on 1 article reviews
cagccagtcatctttggagacc - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

90
OriGene mirna
Mirna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/MTOR+(NM_004958)+Human+Untagged+Clone/10__1161_slash_circulationaha__110__000323-323-6-41
Average 90 stars, based on 1 article reviews
mirna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Addgene inc pcdna3 flag mtor l1460p
Pcdna3 Flag Mtor L1460p, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/pcDNA3-FLAG-MTOR-L1460P+(Plasmid+%2369006)/ppr0490909-170-4-16
Average 93 stars, based on 1 article reviews
pcdna3 flag mtor l1460p - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Addgene inc prk5 myc rat mtor
( a , b ) Immunoblot analysis of <t>mTOR</t> signalling pathway activity ( a ) and the activation status of translation factors ( b ) in heart lysates of 9-week-old WT and p38γ/δ −/− mice. Bar charts show quantification of total protein or vinculin-normalized band intensities ( n =4). Data are means±s.e.m. * P <0.05; *** P <0.001 ( t -test). ( c ) In vivo measurement of protein synthesis. Mice were injected intraperitoneally with 0.040 μmol g −1 puromycin dissolved in 100 μl PBS. Exactly 30 min after injection, tissues were extracted and frozen in liquid N 2 for immunoblot analysis with anti-puromycin antibody ( n =4).
Prk5 Myc Rat Mtor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/myc-mTOR+(Plasmid+%231861)/pmc05476828-208-8-14
Average 93 stars, based on 1 article reviews
prk5 myc rat mtor - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

mtor  (Bethyl)
91
Bethyl mtor
Figure 3. mTORC2, AKT, and GSK3b Signaling Components Are Present in Mitochondria-ER Junctions (A) Immunoblots of MEJ, PM, and EGC fractions and total lysate (T) from Jurkat T cells. Blots were probed with <t>mTOR,</t> RICTOR, RAPTOR, and <t>AKT</t> <t>antibodies.</t> COX IV was used as loading and fraction-validation control (representative of n = 3 independent experiments). (B) Immunoblots of EGC and MEJ fractions from NV and EM human CD8+ T cells probed with antibodies specific for RICTOR and mTOR. GRP75 was used to validate the respective fractions (representative of n = 2 independent samples, each sample consisted of 4 3 107 sorted cells, pooled from 2–4 donors). (C) Immunoblot analysis of EGC and MEJ fractions from bulk CD8+ T cells treated with non-loaded control beads (–) or activated with a-CD3 and a-CD28 mAb-loaded beads (+) for 2 hr. Blots were probed with mTOR and RICTOR antibodies. Cox IV was used as fraction validation control (representative of n = 3 independent experiments). (D) Left, immunoblot analysis of MEJ fractions from wild-type (WT) and rictor KO memory CD8+ T cells re-stimulated with OVA peptide for 1 hr (+) or from non-activated counterparts (–). Blots were probed for total Akt, pAkt-S473, pAkt-T308, and Cox IV. Right, quantification was performed by normalization of targets to Cox IV. Bar graphs show fold change in Akt phosphorylation following activation relative to non-activated controls (n = 3 independent experiments). (E and F) Summary of metabolic flux analysis on EM CD8+ T cells activated and assayed as in Figure 1A. Cells were treated with inhibitors of mTOR (OSI-027, 10 mM, and KU0063794, 10 mM) (E) or AKT (Akti, 10 mM, and MK2206, 10 mM) (F). Bar graphs show basal and maximal respiration (n = 4–8 donors). (G) Immunoblot analysis of total cell lysates from EM CD8+ T cells activated for 2 hr with a-CD3 and a-CD28 mAb loaded beads only or similarly activated in presence of nocodazole (10 mM). Bar graph shows AKT-Ser473 phosphorylation normalized to actin (n = 3 independent experiments). (H) Immunoblots of MEJ and PM fractions from Jurkat T cells. Blots were probed with GSK3b and COX IV antibodies (representative of n = 3 independent experiments). (I) Immunoblots of MEJ and EGC fractions from bulk CD8+ T cells either left unstimulated (–) or activated (+) with a-CD3 and a-CD28 mAb-loaded beads for 2 hr. Blots were probed for total GSK3b, pGSK3b Ser9, and COX IV (representative of n = 3 donors). (J) Left, immunoblot analysis of WT and rictor KO memory OT-I cells activated as in (D). MEJ fractions were probed for Gsk-3b, pGsk-3b Ser9, and Cox IV. Right, bar graphs display fold change in phosphoprotein levels relative to non-activated controls (n = 3 independent experiments). Data are presented as mean ± SEM. Two-tailed paired Student’s t test (D–G, J) were used to compare groups. *p < 0.05, **p < 0.01, ns, not significant. See also Figure S3.
Mtor, supplied by Bethyl, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/mTOR+Antibody/pm29523440-343-8-38
Average 91 stars, based on 1 article reviews
mtor - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

97
Cell Signaling Technology Inc mtor
See also Fig. . ( A ) Immunofluorescence analysis of hSPAR using an anti-hSPAR antibody in MDA-MB-231 cells ( n = 3 independent biological samples). Scale bar, 5 µm. ( B ) Immunoblotting against hSPAR, FIBRILLARIN (nuclear marker), β-Tubulin (cytoplasmic marker), and ATP1V1A (membrane marker) in nuclear, cytoplasmic (membrane components removed), and membrane fractions prepared from MDA-MB-231 cells (n = 3 independent biological samples). ( C ) Diagram of GFP-tagged hSPAR. ( D ) Living-cell images of GFP-hSPAR and lysosomes (Red, labeled with Lyso-Tracker) in MDA-MB-231 cells. The graphs display the fluorescence intensity (arbitrary units) of GFP-hSPAR and Lyso-Tracker over the distance from adjacent image (depicted by the arrow). The value of Pearson’s correlation Rr of SPAR and Lyso-Tracker is 0.907408. Scale bar, 5 µm, ( n = 3 independent biological samples). ( E ) Co-immunofluorescence staining of Flag (green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR. Nuclei were stained with Hoechst (blue). The Vector Ctrl and ΔATG1 + 2 are negative control groups, and Flag proteins are not expressed (The white “X” in Vector Ctrl and ΔATG1 + 2 groups indicates no green fluorescent signals). The graphs display the fluorescence intensity (arbitrary units) of Flag and the lysosomal marker LAMP1 over the distance from adjacent image (depicted by the arrows). The value of Pearson’s correlation Rr of Flag-hSPAR and LAMP1 is 0.934597. Scale bar, 25 µm ( n = 3 independent biological samples). ( F ) Immunoblotting against <t>p-mTOR,</t> <t>mTOR,</t> <t>p-S6K,</t> S6K, p-S6, S6, Flag and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR ( n = 3 independent biological samples). ( G ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( H ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, hSPAR, and GAPDH in extracts from the breast cancer tumoral tissues and their adjacent non-tumoral tissues ( n = 18 independent biological samples). ( I ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, p-S6/S6, and hSPAR/GAPDH from panel ( H ) ( n = 18 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( J ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR, with or without Rapamycin treatment (an mTOR inhibitor; 10 μM for 12 h) ( n = 3 independent biological samples). ( K ) Representative images of EdU assay in the presence of Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR, with or without Rapamycin treatment (10 μM for 12 h) ( n = 3 independent biological samples). Scale bar, 50 µm. ( L ) Quantification of cell proliferation rate from panel ( K ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .
Mtor, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/mTOR+Rabbit+mAb/pmc11876615-445-80-81
Average 97 stars, based on 1 article reviews
mtor - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

91
Cell Signaling Technology Inc signalsilence mtor sirna
See also Fig. . ( A ) Immunofluorescence analysis of hSPAR using an anti-hSPAR antibody in MDA-MB-231 cells ( n = 3 independent biological samples). Scale bar, 5 µm. ( B ) Immunoblotting against hSPAR, FIBRILLARIN (nuclear marker), β-Tubulin (cytoplasmic marker), and ATP1V1A (membrane marker) in nuclear, cytoplasmic (membrane components removed), and membrane fractions prepared from MDA-MB-231 cells (n = 3 independent biological samples). ( C ) Diagram of GFP-tagged hSPAR. ( D ) Living-cell images of GFP-hSPAR and lysosomes (Red, labeled with Lyso-Tracker) in MDA-MB-231 cells. The graphs display the fluorescence intensity (arbitrary units) of GFP-hSPAR and Lyso-Tracker over the distance from adjacent image (depicted by the arrow). The value of Pearson’s correlation Rr of SPAR and Lyso-Tracker is 0.907408. Scale bar, 5 µm, ( n = 3 independent biological samples). ( E ) Co-immunofluorescence staining of Flag (green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR. Nuclei were stained with Hoechst (blue). The Vector Ctrl and ΔATG1 + 2 are negative control groups, and Flag proteins are not expressed (The white “X” in Vector Ctrl and ΔATG1 + 2 groups indicates no green fluorescent signals). The graphs display the fluorescence intensity (arbitrary units) of Flag and the lysosomal marker LAMP1 over the distance from adjacent image (depicted by the arrows). The value of Pearson’s correlation Rr of Flag-hSPAR and LAMP1 is 0.934597. Scale bar, 25 µm ( n = 3 independent biological samples). ( F ) Immunoblotting against <t>p-mTOR,</t> <t>mTOR,</t> <t>p-S6K,</t> S6K, p-S6, S6, Flag and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR ( n = 3 independent biological samples). ( G ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( H ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, hSPAR, and GAPDH in extracts from the breast cancer tumoral tissues and their adjacent non-tumoral tissues ( n = 18 independent biological samples). ( I ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, p-S6/S6, and hSPAR/GAPDH from panel ( H ) ( n = 18 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( J ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR, with or without Rapamycin treatment (an mTOR inhibitor; 10 μM for 12 h) ( n = 3 independent biological samples). ( K ) Representative images of EdU assay in the presence of Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR, with or without Rapamycin treatment (10 μM for 12 h) ( n = 3 independent biological samples). Scale bar, 50 µm. ( L ) Quantification of cell proliferation rate from panel ( K ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .
Signalsilence Mtor Sirna, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mtor/SignalSilence+mTOR+siRNA+I/pmc02820807-242-7-10
Average 91 stars, based on 1 article reviews
signalsilence mtor sirna - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

Image Search Results


( a , b ) Immunoblot analysis of mTOR signalling pathway activity ( a ) and the activation status of translation factors ( b ) in heart lysates of 9-week-old WT and p38γ/δ −/− mice. Bar charts show quantification of total protein or vinculin-normalized band intensities ( n =4). Data are means±s.e.m. * P <0.05; *** P <0.001 ( t -test). ( c ) In vivo measurement of protein synthesis. Mice were injected intraperitoneally with 0.040 μmol g −1 puromycin dissolved in 100 μl PBS. Exactly 30 min after injection, tissues were extracted and frozen in liquid N 2 for immunoblot analysis with anti-puromycin antibody ( n =4).

Journal: Nature Communications

Article Title: p38γ and δ promote heart hypertrophy by targeting the mTOR-inhibitory protein DEPTOR for degradation

doi: 10.1038/ncomms10477

Figure Lengend Snippet: ( a , b ) Immunoblot analysis of mTOR signalling pathway activity ( a ) and the activation status of translation factors ( b ) in heart lysates of 9-week-old WT and p38γ/δ −/− mice. Bar charts show quantification of total protein or vinculin-normalized band intensities ( n =4). Data are means±s.e.m. * P <0.05; *** P <0.001 ( t -test). ( c ) In vivo measurement of protein synthesis. Mice were injected intraperitoneally with 0.040 μmol g −1 puromycin dissolved in 100 μl PBS. Exactly 30 min after injection, tissues were extracted and frozen in liquid N 2 for immunoblot analysis with anti-puromycin antibody ( n =4).

Article Snippet: The plasmids used in the different experiments were pRK5 myc Rat mTOR (plasmid #1861, Addgene); pRK5 FLAG human DEPTOR (plasmid #21334, Addgene); pRK5 FLAG human DEPTOR (13xS/T→A; plasmid #21702, Addgene); pRK5 FLAG DEPTOR (PDZ domain; plasmid #21701, Addgene); pRK5 FLAG DEPTOR (DEP domains; plasmid #21700, Addgene); pcDNA3-myc3-CUL1 (plasmid #19896, Addgene); pcDNA3-myc3-bTrCP (plasmid #20718, Addgene); HA-Ubiquitin (plasmid #18712); pcDNA3 HA human p38γ and pcDNA3 HA human p38δ, kindly provided by Roger Davis (University of Massachusetts Medical School, Worcester, USA); and pCEFL Flag p38γ D129A and pCMV Flag p38δ F324S , kindly provided by David Engelberg (The Hebrew University of Jerusalem, Israel).

Techniques: Western Blot, Activity Assay, Activation Assay, In Vivo, Injection

( a ) Endogenous mTOR, Raptor, Rictor, Sin-1 and DEPTOR co-immunoprecipitate with endogenous p38γ. We immunoprecipitated p38γ from WT and p38γ/δ −/− MEF lysates using specific antibodies; immunoprecipitates (IP), supernatants and total lysates were analysed by SDS–PAGE using the antibodies indicated. ( b , c ) p38γ interacts with mTOR through DEPTOR. HEK-293 cells were transfected with HA-p38γ, Flag-DEPTOR or Myc-mTOR or a combination of these and immunoprecipitated with the indicated antibodies targeting the c-myc epitope ( b ) or Flag ( c ). Immunoblots were probed with the indicated antibodies. ( d ) Co-immunoprecipitation of p38γ and p38δ with DEPTOR in HEK-293 cells. HA-p38γ or HA-p38δ expression vectors were co-expressed with Flag-DEPTOR in HEK-293T cells. Anti-Flag immunoprecipitates were analysed by SDS–PAGE. ( e ) HA- p38δ co-immunoprecipitates with endogenous p38γ. p38γ immunoprecipitates from HEK-293T cells transfected with HA-p38δ were analysed by SDS–PAGE. IP, immunoprecipitation; TL, total lysate.

Journal: Nature Communications

Article Title: p38γ and δ promote heart hypertrophy by targeting the mTOR-inhibitory protein DEPTOR for degradation

doi: 10.1038/ncomms10477

Figure Lengend Snippet: ( a ) Endogenous mTOR, Raptor, Rictor, Sin-1 and DEPTOR co-immunoprecipitate with endogenous p38γ. We immunoprecipitated p38γ from WT and p38γ/δ −/− MEF lysates using specific antibodies; immunoprecipitates (IP), supernatants and total lysates were analysed by SDS–PAGE using the antibodies indicated. ( b , c ) p38γ interacts with mTOR through DEPTOR. HEK-293 cells were transfected with HA-p38γ, Flag-DEPTOR or Myc-mTOR or a combination of these and immunoprecipitated with the indicated antibodies targeting the c-myc epitope ( b ) or Flag ( c ). Immunoblots were probed with the indicated antibodies. ( d ) Co-immunoprecipitation of p38γ and p38δ with DEPTOR in HEK-293 cells. HA-p38γ or HA-p38δ expression vectors were co-expressed with Flag-DEPTOR in HEK-293T cells. Anti-Flag immunoprecipitates were analysed by SDS–PAGE. ( e ) HA- p38δ co-immunoprecipitates with endogenous p38γ. p38γ immunoprecipitates from HEK-293T cells transfected with HA-p38δ were analysed by SDS–PAGE. IP, immunoprecipitation; TL, total lysate.

Article Snippet: The plasmids used in the different experiments were pRK5 myc Rat mTOR (plasmid #1861, Addgene); pRK5 FLAG human DEPTOR (plasmid #21334, Addgene); pRK5 FLAG human DEPTOR (13xS/T→A; plasmid #21702, Addgene); pRK5 FLAG DEPTOR (PDZ domain; plasmid #21701, Addgene); pRK5 FLAG DEPTOR (DEP domains; plasmid #21700, Addgene); pcDNA3-myc3-CUL1 (plasmid #19896, Addgene); pcDNA3-myc3-bTrCP (plasmid #20718, Addgene); HA-Ubiquitin (plasmid #18712); pcDNA3 HA human p38γ and pcDNA3 HA human p38δ, kindly provided by Roger Davis (University of Massachusetts Medical School, Worcester, USA); and pCEFL Flag p38γ D129A and pCMV Flag p38δ F324S , kindly provided by David Engelberg (The Hebrew University of Jerusalem, Israel).

Techniques: Immunoprecipitation, SDS Page, Transfection, Western Blot, Expressing

( a ) p38γ/δ −/− MEFs present altered serum-induced DEPTOR degradation. WT and p38γ/δ −/− MEFs were serum-starved for 30 h, followed by serum addition. Cells were collected at successive time points for immunoblotting with the indicated antibodies. ( b ) p38γ/δ −/− MEFs are of below-normal size. Cell size was measured by flow cytometry (forward scatter). Right: representative histogram. Left: quantification graph of the forward scatter mean fluourescence intensity (FSC-A MFI) relative to WT. Data are means±s.e.m. *** P <0.001 ( t -test). ( c ) p38γ/δ −/− MEFs have downregulated protein synthesis. SUnSET was performed by pulsing 10 min 10 μg ml −1 puromycin and chasing for 1 h before FACS analysis with anti-puromycin 12D10 antibody and anti-mouse IgG conjugated with PE. Data are means±s.e.m. *** P <0.001 ( t -test). ( d ) p38γ/δ-induced DEPTOR degradation by the proteasome. HELA cells co-transfected with active p38γ and p38δ mutants were serum-starved for 30 h. Cells were treated with MG132 (10 μM) or vehicle together with 10 μM cycloheximide (CHX) for 9 h, and were analysed by immunoblotting with the indicated antibodies. ( e ) Silencing DEPTOR in p38γ/δ −/− MEF cells restores mTOR signalling. MEFs were singly or doubly infected with two different DEPTOR lentiviral shRNA constructs for 24 h. Uninfected cells were eliminated by selection with 3 μg ml −1 puromycin for 1 week. The resulting cell lines were then serum-starved for 24 h before collecting. Equal amounts of whole-cell lysates were immunoblotted with the indicated antibodies. ( f ) Silencing of DEPTOR in p38γ/δ −/− MEFs increases protein synthesis. MEFs were infected as in e . In the resulting cell lines, the protein concentration per cell was measured by SUnSET assay, performed as in b . Data are means±s.e.m. ** P <0.01; *** P <0.001 (one-way analysis of variance coupled to Bonferroni post tests).

Journal: Nature Communications

Article Title: p38γ and δ promote heart hypertrophy by targeting the mTOR-inhibitory protein DEPTOR for degradation

doi: 10.1038/ncomms10477

Figure Lengend Snippet: ( a ) p38γ/δ −/− MEFs present altered serum-induced DEPTOR degradation. WT and p38γ/δ −/− MEFs were serum-starved for 30 h, followed by serum addition. Cells were collected at successive time points for immunoblotting with the indicated antibodies. ( b ) p38γ/δ −/− MEFs are of below-normal size. Cell size was measured by flow cytometry (forward scatter). Right: representative histogram. Left: quantification graph of the forward scatter mean fluourescence intensity (FSC-A MFI) relative to WT. Data are means±s.e.m. *** P <0.001 ( t -test). ( c ) p38γ/δ −/− MEFs have downregulated protein synthesis. SUnSET was performed by pulsing 10 min 10 μg ml −1 puromycin and chasing for 1 h before FACS analysis with anti-puromycin 12D10 antibody and anti-mouse IgG conjugated with PE. Data are means±s.e.m. *** P <0.001 ( t -test). ( d ) p38γ/δ-induced DEPTOR degradation by the proteasome. HELA cells co-transfected with active p38γ and p38δ mutants were serum-starved for 30 h. Cells were treated with MG132 (10 μM) or vehicle together with 10 μM cycloheximide (CHX) for 9 h, and were analysed by immunoblotting with the indicated antibodies. ( e ) Silencing DEPTOR in p38γ/δ −/− MEF cells restores mTOR signalling. MEFs were singly or doubly infected with two different DEPTOR lentiviral shRNA constructs for 24 h. Uninfected cells were eliminated by selection with 3 μg ml −1 puromycin for 1 week. The resulting cell lines were then serum-starved for 24 h before collecting. Equal amounts of whole-cell lysates were immunoblotted with the indicated antibodies. ( f ) Silencing of DEPTOR in p38γ/δ −/− MEFs increases protein synthesis. MEFs were infected as in e . In the resulting cell lines, the protein concentration per cell was measured by SUnSET assay, performed as in b . Data are means±s.e.m. ** P <0.01; *** P <0.001 (one-way analysis of variance coupled to Bonferroni post tests).

Article Snippet: The plasmids used in the different experiments were pRK5 myc Rat mTOR (plasmid #1861, Addgene); pRK5 FLAG human DEPTOR (plasmid #21334, Addgene); pRK5 FLAG human DEPTOR (13xS/T→A; plasmid #21702, Addgene); pRK5 FLAG DEPTOR (PDZ domain; plasmid #21701, Addgene); pRK5 FLAG DEPTOR (DEP domains; plasmid #21700, Addgene); pcDNA3-myc3-CUL1 (plasmid #19896, Addgene); pcDNA3-myc3-bTrCP (plasmid #20718, Addgene); HA-Ubiquitin (plasmid #18712); pcDNA3 HA human p38γ and pcDNA3 HA human p38δ, kindly provided by Roger Davis (University of Massachusetts Medical School, Worcester, USA); and pCEFL Flag p38γ D129A and pCMV Flag p38δ F324S , kindly provided by David Engelberg (The Hebrew University of Jerusalem, Israel).

Techniques: Western Blot, Flow Cytometry, Transfection, Infection, shRNA, Construct, Selection, Protein Concentration

( a ) Endogenous cardiac Sin-1, mTOR, GβL, Rictor, Raptor and DEPTOR co-immunoprecipitate with endogenous p38γ. p38γ immunoprecipitates (IP), total lysates and Co-IP supernatants from WT heart lysates were analysed by SDS–PAGE. EB: beads with IgG control. ( b ) Endogenous cardiac DEPTOR co-immunoprecipitates with p38δ. Immunoblot analysis of p38δ immunoprecipitates (IP) and total lysates (TL) from the hearts of 9-week-old p38γ/δ −/− mice infected with AAV-TnT-p38γ act and AAV-TnT-p38δ act . ( c ) p38γ/δ −/− hearts express above-normal levels of DEPTOR protein. Immunoblot analysis of heart lysates from WT and p38γ/δ −/− mice starved for 4 h and re-fed for 2h ( n =3–4). ( d ) Cardiac DEPTOR levels during postnatal development correlate negatively with p38γ and p38δ activation and mTOR pathway activation. Heart lysates from WT p1 and 2-week-old mice were analysed by immunoblot ( n =6). ( e ) Levels of DEPTOR phosphorylation and ubiquitination in vivo are reduced in p38γ/δ −/− hearts. Upper panel: poly-ubiquitinated proteins were IP from WT and p38γ/δ −/− heart lysates and immunoprecipitates were immunoblotted with anti-DEPTOR antibody. Lower panels: WT and p38γ/δ −/− mice were intravenously injected with AAV-TNT-Flag-DEPTOR and hearts harvested at the age of 2 weeks. Flag-DEPTOR was immunoprecipitated from heart lysates, and immunoprecipitates were analysed by immunoblotting with the indicated antibodies. ( n =5). ( f ) Angiotensin II (ANGII) treatment induces a reduction in DEPTOR levels in WT hearts. WT mice were treated with ANGII or saline for 21 days. Heart lysates were analysed by immunoblotting. ( n =3). ( g – i ) MCKdelta KO mice have small hearts. ( f ) Heart-weight-to-tibia-length ratios in WT and MCKdelta KO (p38δ MCK−KO ) mice killed at 9 weeks. ( g ) Top: representative haematoxylin and eosin staining of transverse heart sections from 9-week-old WT and MCKdelta KO mice. Bottom: representative staining with FITC-WGA (green) in hearts from 9-week-old WT and MCKdelta KO mice. ( h ) Cardiomyocyte cross-sectional area quantified from WGA-stained hearts. ( j ) MCKdelta KO hearts have higher protein levels of DEPTOR. MCK-Cre control mice and MCKdelta KO (p38δ MCK−KO ) mice were starved for 4 h before being killed and tissue was collected. Heart lysates were analysed by immunoblotting; the bar chart shows quantification of vinculin-normalized band intensities (ImageJ; n =4). Data are means±s.e.m. ( n =5). ** P <0.01; *** P <0.001 ( t -test).

Journal: Nature Communications

Article Title: p38γ and δ promote heart hypertrophy by targeting the mTOR-inhibitory protein DEPTOR for degradation

doi: 10.1038/ncomms10477

Figure Lengend Snippet: ( a ) Endogenous cardiac Sin-1, mTOR, GβL, Rictor, Raptor and DEPTOR co-immunoprecipitate with endogenous p38γ. p38γ immunoprecipitates (IP), total lysates and Co-IP supernatants from WT heart lysates were analysed by SDS–PAGE. EB: beads with IgG control. ( b ) Endogenous cardiac DEPTOR co-immunoprecipitates with p38δ. Immunoblot analysis of p38δ immunoprecipitates (IP) and total lysates (TL) from the hearts of 9-week-old p38γ/δ −/− mice infected with AAV-TnT-p38γ act and AAV-TnT-p38δ act . ( c ) p38γ/δ −/− hearts express above-normal levels of DEPTOR protein. Immunoblot analysis of heart lysates from WT and p38γ/δ −/− mice starved for 4 h and re-fed for 2h ( n =3–4). ( d ) Cardiac DEPTOR levels during postnatal development correlate negatively with p38γ and p38δ activation and mTOR pathway activation. Heart lysates from WT p1 and 2-week-old mice were analysed by immunoblot ( n =6). ( e ) Levels of DEPTOR phosphorylation and ubiquitination in vivo are reduced in p38γ/δ −/− hearts. Upper panel: poly-ubiquitinated proteins were IP from WT and p38γ/δ −/− heart lysates and immunoprecipitates were immunoblotted with anti-DEPTOR antibody. Lower panels: WT and p38γ/δ −/− mice were intravenously injected with AAV-TNT-Flag-DEPTOR and hearts harvested at the age of 2 weeks. Flag-DEPTOR was immunoprecipitated from heart lysates, and immunoprecipitates were analysed by immunoblotting with the indicated antibodies. ( n =5). ( f ) Angiotensin II (ANGII) treatment induces a reduction in DEPTOR levels in WT hearts. WT mice were treated with ANGII or saline for 21 days. Heart lysates were analysed by immunoblotting. ( n =3). ( g – i ) MCKdelta KO mice have small hearts. ( f ) Heart-weight-to-tibia-length ratios in WT and MCKdelta KO (p38δ MCK−KO ) mice killed at 9 weeks. ( g ) Top: representative haematoxylin and eosin staining of transverse heart sections from 9-week-old WT and MCKdelta KO mice. Bottom: representative staining with FITC-WGA (green) in hearts from 9-week-old WT and MCKdelta KO mice. ( h ) Cardiomyocyte cross-sectional area quantified from WGA-stained hearts. ( j ) MCKdelta KO hearts have higher protein levels of DEPTOR. MCK-Cre control mice and MCKdelta KO (p38δ MCK−KO ) mice were starved for 4 h before being killed and tissue was collected. Heart lysates were analysed by immunoblotting; the bar chart shows quantification of vinculin-normalized band intensities (ImageJ; n =4). Data are means±s.e.m. ( n =5). ** P <0.01; *** P <0.001 ( t -test).

Article Snippet: The plasmids used in the different experiments were pRK5 myc Rat mTOR (plasmid #1861, Addgene); pRK5 FLAG human DEPTOR (plasmid #21334, Addgene); pRK5 FLAG human DEPTOR (13xS/T→A; plasmid #21702, Addgene); pRK5 FLAG DEPTOR (PDZ domain; plasmid #21701, Addgene); pRK5 FLAG DEPTOR (DEP domains; plasmid #21700, Addgene); pcDNA3-myc3-CUL1 (plasmid #19896, Addgene); pcDNA3-myc3-bTrCP (plasmid #20718, Addgene); HA-Ubiquitin (plasmid #18712); pcDNA3 HA human p38γ and pcDNA3 HA human p38δ, kindly provided by Roger Davis (University of Massachusetts Medical School, Worcester, USA); and pCEFL Flag p38γ D129A and pCMV Flag p38δ F324S , kindly provided by David Engelberg (The Hebrew University of Jerusalem, Israel).

Techniques: Co-Immunoprecipitation Assay, SDS Page, Control, Western Blot, Infection, Activation Assay, Phospho-proteomics, Ubiquitin Proteomics, In Vivo, Injection, Immunoprecipitation, Saline, Staining

Figure 3. mTORC2, AKT, and GSK3b Signaling Components Are Present in Mitochondria-ER Junctions (A) Immunoblots of MEJ, PM, and EGC fractions and total lysate (T) from Jurkat T cells. Blots were probed with mTOR, RICTOR, RAPTOR, and AKT antibodies. COX IV was used as loading and fraction-validation control (representative of n = 3 independent experiments). (B) Immunoblots of EGC and MEJ fractions from NV and EM human CD8+ T cells probed with antibodies specific for RICTOR and mTOR. GRP75 was used to validate the respective fractions (representative of n = 2 independent samples, each sample consisted of 4 3 107 sorted cells, pooled from 2–4 donors). (C) Immunoblot analysis of EGC and MEJ fractions from bulk CD8+ T cells treated with non-loaded control beads (–) or activated with a-CD3 and a-CD28 mAb-loaded beads (+) for 2 hr. Blots were probed with mTOR and RICTOR antibodies. Cox IV was used as fraction validation control (representative of n = 3 independent experiments). (D) Left, immunoblot analysis of MEJ fractions from wild-type (WT) and rictor KO memory CD8+ T cells re-stimulated with OVA peptide for 1 hr (+) or from non-activated counterparts (–). Blots were probed for total Akt, pAkt-S473, pAkt-T308, and Cox IV. Right, quantification was performed by normalization of targets to Cox IV. Bar graphs show fold change in Akt phosphorylation following activation relative to non-activated controls (n = 3 independent experiments). (E and F) Summary of metabolic flux analysis on EM CD8+ T cells activated and assayed as in Figure 1A. Cells were treated with inhibitors of mTOR (OSI-027, 10 mM, and KU0063794, 10 mM) (E) or AKT (Akti, 10 mM, and MK2206, 10 mM) (F). Bar graphs show basal and maximal respiration (n = 4–8 donors). (G) Immunoblot analysis of total cell lysates from EM CD8+ T cells activated for 2 hr with a-CD3 and a-CD28 mAb loaded beads only or similarly activated in presence of nocodazole (10 mM). Bar graph shows AKT-Ser473 phosphorylation normalized to actin (n = 3 independent experiments). (H) Immunoblots of MEJ and PM fractions from Jurkat T cells. Blots were probed with GSK3b and COX IV antibodies (representative of n = 3 independent experiments). (I) Immunoblots of MEJ and EGC fractions from bulk CD8+ T cells either left unstimulated (–) or activated (+) with a-CD3 and a-CD28 mAb-loaded beads for 2 hr. Blots were probed for total GSK3b, pGSK3b Ser9, and COX IV (representative of n = 3 donors). (J) Left, immunoblot analysis of WT and rictor KO memory OT-I cells activated as in (D). MEJ fractions were probed for Gsk-3b, pGsk-3b Ser9, and Cox IV. Right, bar graphs display fold change in phosphoprotein levels relative to non-activated controls (n = 3 independent experiments). Data are presented as mean ± SEM. Two-tailed paired Student’s t test (D–G, J) were used to compare groups. *p < 0.05, **p < 0.01, ns, not significant. See also Figure S3.

Journal: Immunity

Article Title: Mitochondria-Endoplasmic Reticulum Contact Sites Function as Immunometabolic Hubs that Orchestrate the Rapid Recall Response of Memory CD8 + T Cells.

doi: 10.1016/j.immuni.2018.02.012

Figure Lengend Snippet: Figure 3. mTORC2, AKT, and GSK3b Signaling Components Are Present in Mitochondria-ER Junctions (A) Immunoblots of MEJ, PM, and EGC fractions and total lysate (T) from Jurkat T cells. Blots were probed with mTOR, RICTOR, RAPTOR, and AKT antibodies. COX IV was used as loading and fraction-validation control (representative of n = 3 independent experiments). (B) Immunoblots of EGC and MEJ fractions from NV and EM human CD8+ T cells probed with antibodies specific for RICTOR and mTOR. GRP75 was used to validate the respective fractions (representative of n = 2 independent samples, each sample consisted of 4 3 107 sorted cells, pooled from 2–4 donors). (C) Immunoblot analysis of EGC and MEJ fractions from bulk CD8+ T cells treated with non-loaded control beads (–) or activated with a-CD3 and a-CD28 mAb-loaded beads (+) for 2 hr. Blots were probed with mTOR and RICTOR antibodies. Cox IV was used as fraction validation control (representative of n = 3 independent experiments). (D) Left, immunoblot analysis of MEJ fractions from wild-type (WT) and rictor KO memory CD8+ T cells re-stimulated with OVA peptide for 1 hr (+) or from non-activated counterparts (–). Blots were probed for total Akt, pAkt-S473, pAkt-T308, and Cox IV. Right, quantification was performed by normalization of targets to Cox IV. Bar graphs show fold change in Akt phosphorylation following activation relative to non-activated controls (n = 3 independent experiments). (E and F) Summary of metabolic flux analysis on EM CD8+ T cells activated and assayed as in Figure 1A. Cells were treated with inhibitors of mTOR (OSI-027, 10 mM, and KU0063794, 10 mM) (E) or AKT (Akti, 10 mM, and MK2206, 10 mM) (F). Bar graphs show basal and maximal respiration (n = 4–8 donors). (G) Immunoblot analysis of total cell lysates from EM CD8+ T cells activated for 2 hr with a-CD3 and a-CD28 mAb loaded beads only or similarly activated in presence of nocodazole (10 mM). Bar graph shows AKT-Ser473 phosphorylation normalized to actin (n = 3 independent experiments). (H) Immunoblots of MEJ and PM fractions from Jurkat T cells. Blots were probed with GSK3b and COX IV antibodies (representative of n = 3 independent experiments). (I) Immunoblots of MEJ and EGC fractions from bulk CD8+ T cells either left unstimulated (–) or activated (+) with a-CD3 and a-CD28 mAb-loaded beads for 2 hr. Blots were probed for total GSK3b, pGSK3b Ser9, and COX IV (representative of n = 3 donors). (J) Left, immunoblot analysis of WT and rictor KO memory OT-I cells activated as in (D). MEJ fractions were probed for Gsk-3b, pGsk-3b Ser9, and Cox IV. Right, bar graphs display fold change in phosphoprotein levels relative to non-activated controls (n = 3 independent experiments). Data are presented as mean ± SEM. Two-tailed paired Student’s t test (D–G, J) were used to compare groups. *p < 0.05, **p < 0.01, ns, not significant. See also Figure S3.

Article Snippet: Membranes were probed with antibodies against ACC, rictor, mTOR, HK-I, HK-II, Sin1, Cox iv, Akt, pAkt Thr308, pAkt Ser473, p-(S/T) Akt substrate motif, pGsk-3b Ser9 (all from cell signaling), GRP75, VDAC1, Gsk-3b (from Abcam), actin (Sigma-Aldrich), or raptor (Bethyl).

Techniques: Western Blot, Biomarker Discovery, Control, Phospho-proteomics, Activation Assay, Two Tailed Test

See also Fig. . ( A ) Immunofluorescence analysis of hSPAR using an anti-hSPAR antibody in MDA-MB-231 cells ( n = 3 independent biological samples). Scale bar, 5 µm. ( B ) Immunoblotting against hSPAR, FIBRILLARIN (nuclear marker), β-Tubulin (cytoplasmic marker), and ATP1V1A (membrane marker) in nuclear, cytoplasmic (membrane components removed), and membrane fractions prepared from MDA-MB-231 cells (n = 3 independent biological samples). ( C ) Diagram of GFP-tagged hSPAR. ( D ) Living-cell images of GFP-hSPAR and lysosomes (Red, labeled with Lyso-Tracker) in MDA-MB-231 cells. The graphs display the fluorescence intensity (arbitrary units) of GFP-hSPAR and Lyso-Tracker over the distance from adjacent image (depicted by the arrow). The value of Pearson’s correlation Rr of SPAR and Lyso-Tracker is 0.907408. Scale bar, 5 µm, ( n = 3 independent biological samples). ( E ) Co-immunofluorescence staining of Flag (green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR. Nuclei were stained with Hoechst (blue). The Vector Ctrl and ΔATG1 + 2 are negative control groups, and Flag proteins are not expressed (The white “X” in Vector Ctrl and ΔATG1 + 2 groups indicates no green fluorescent signals). The graphs display the fluorescence intensity (arbitrary units) of Flag and the lysosomal marker LAMP1 over the distance from adjacent image (depicted by the arrows). The value of Pearson’s correlation Rr of Flag-hSPAR and LAMP1 is 0.934597. Scale bar, 25 µm ( n = 3 independent biological samples). ( F ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR ( n = 3 independent biological samples). ( G ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( H ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, hSPAR, and GAPDH in extracts from the breast cancer tumoral tissues and their adjacent non-tumoral tissues ( n = 18 independent biological samples). ( I ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, p-S6/S6, and hSPAR/GAPDH from panel ( H ) ( n = 18 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( J ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR, with or without Rapamycin treatment (an mTOR inhibitor; 10 μM for 12 h) ( n = 3 independent biological samples). ( K ) Representative images of EdU assay in the presence of Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR, with or without Rapamycin treatment (10 μM for 12 h) ( n = 3 independent biological samples). Scale bar, 50 µm. ( L ) Quantification of cell proliferation rate from panel ( K ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Journal: The EMBO Journal

Article Title: Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis

doi: 10.1038/s44318-024-00359-z

Figure Lengend Snippet: See also Fig. . ( A ) Immunofluorescence analysis of hSPAR using an anti-hSPAR antibody in MDA-MB-231 cells ( n = 3 independent biological samples). Scale bar, 5 µm. ( B ) Immunoblotting against hSPAR, FIBRILLARIN (nuclear marker), β-Tubulin (cytoplasmic marker), and ATP1V1A (membrane marker) in nuclear, cytoplasmic (membrane components removed), and membrane fractions prepared from MDA-MB-231 cells (n = 3 independent biological samples). ( C ) Diagram of GFP-tagged hSPAR. ( D ) Living-cell images of GFP-hSPAR and lysosomes (Red, labeled with Lyso-Tracker) in MDA-MB-231 cells. The graphs display the fluorescence intensity (arbitrary units) of GFP-hSPAR and Lyso-Tracker over the distance from adjacent image (depicted by the arrow). The value of Pearson’s correlation Rr of SPAR and Lyso-Tracker is 0.907408. Scale bar, 5 µm, ( n = 3 independent biological samples). ( E ) Co-immunofluorescence staining of Flag (green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR. Nuclei were stained with Hoechst (blue). The Vector Ctrl and ΔATG1 + 2 are negative control groups, and Flag proteins are not expressed (The white “X” in Vector Ctrl and ΔATG1 + 2 groups indicates no green fluorescent signals). The graphs display the fluorescence intensity (arbitrary units) of Flag and the lysosomal marker LAMP1 over the distance from adjacent image (depicted by the arrows). The value of Pearson’s correlation Rr of Flag-hSPAR and LAMP1 is 0.934597. Scale bar, 25 µm ( n = 3 independent biological samples). ( F ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR ( n = 3 independent biological samples). ( G ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( H ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, hSPAR, and GAPDH in extracts from the breast cancer tumoral tissues and their adjacent non-tumoral tissues ( n = 18 independent biological samples). ( I ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, p-S6/S6, and hSPAR/GAPDH from panel ( H ) ( n = 18 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( J ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH in extracts from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, or Flag-hSPAR, with or without Rapamycin treatment (an mTOR inhibitor; 10 μM for 12 h) ( n = 3 independent biological samples). ( K ) Representative images of EdU assay in the presence of Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR, with or without Rapamycin treatment (10 μM for 12 h) ( n = 3 independent biological samples). Scale bar, 50 µm. ( L ) Quantification of cell proliferation rate from panel ( K ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Article Snippet: The membranes were blocked in 5% BSA (Sangon, China) for 1 h at room temperature, and then incubated at 4 °C overnight with primary antibody GAPDH (Proteintech, USA, 60004-1-Ig), hSPAR (HuaBio, China), Flag (Abcam, UK, ab205606), β-Tubulin (Proteintech, USA, 10068-1-AP), FIBRILLARIN (Proteintech, USA, 16021-1-AP), ATPV1A (Proteintech, USA, 14418-1-AP), LAMP2 (CST, USA, 49067), TRIM21 (Proteintech, USA, 67136-1-Ig), P27KIP1 (Proteintech, USA, 25614-1-AP), phospho-P27KIP1 (Abcam, USA, ab75908), SKP2 (Proteintech, USA, 15010-1-AP), SLC7A1 (Proteintech, USA, 14195-1-AP), SLC7A5 (Proteintech, USA, 28670-1-AP), phospho-mTOR (CST, USA, 5536), mTOR (CST, USA, 2983), phospho-S6K (CST, USA, 9234), S6K (CST, USA, 2708), phospho-S6 (CST, USA, 2211), S6 (CST, USA, 2217), phospho-AKT (CST, USA, 4060), AKT (CST, USA, 9272), Ubiquitin (Abcam, UK, ab134953), SLC38A2 (ImmunoWay, USA, YT4354), LAMTOR1(CST, USA, 8975), LAMTOR2 (CST, USA, 8145), LAMTOR3 (Proteintech, USA, 14492-1-AP), LAMTOR4 (CST, USA, 13140), LAMTOR5 (Proteintech, USA,11937-1-AP), RagA (CST, USA, 4357S) and TAT (Abcam, UK, ab42359).

Techniques: Immunofluorescence, Western Blot, Marker, Membrane, Labeling, Fluorescence, Staining, Transfection, Plasmid Preparation, Negative Control, Two Tailed Test, EdU Assay

See also Fig. . ( A ) List of the top10 hSPAR-interacting proteins identified by hSPAR Co-IP analysis and mass spectrometry. ( B ) Interaction of TRIM21 and Flag-hSPAR detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). ( C ) Immunoblotting against GFP, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH for extracts from MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). ( D ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( C ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( E ) Representative images of EdU assay in MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). Scale bar, 50 µm. ( F ) Quantification of cell proliferation rate from panel ( E ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Journal: The EMBO Journal

Article Title: Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis

doi: 10.1038/s44318-024-00359-z

Figure Lengend Snippet: See also Fig. . ( A ) List of the top10 hSPAR-interacting proteins identified by hSPAR Co-IP analysis and mass spectrometry. ( B ) Interaction of TRIM21 and Flag-hSPAR detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). ( C ) Immunoblotting against GFP, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH for extracts from MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). ( D ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( C ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( E ) Representative images of EdU assay in MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). Scale bar, 50 µm. ( F ) Quantification of cell proliferation rate from panel ( E ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Article Snippet: The membranes were blocked in 5% BSA (Sangon, China) for 1 h at room temperature, and then incubated at 4 °C overnight with primary antibody GAPDH (Proteintech, USA, 60004-1-Ig), hSPAR (HuaBio, China), Flag (Abcam, UK, ab205606), β-Tubulin (Proteintech, USA, 10068-1-AP), FIBRILLARIN (Proteintech, USA, 16021-1-AP), ATPV1A (Proteintech, USA, 14418-1-AP), LAMP2 (CST, USA, 49067), TRIM21 (Proteintech, USA, 67136-1-Ig), P27KIP1 (Proteintech, USA, 25614-1-AP), phospho-P27KIP1 (Abcam, USA, ab75908), SKP2 (Proteintech, USA, 15010-1-AP), SLC7A1 (Proteintech, USA, 14195-1-AP), SLC7A5 (Proteintech, USA, 28670-1-AP), phospho-mTOR (CST, USA, 5536), mTOR (CST, USA, 2983), phospho-S6K (CST, USA, 9234), S6K (CST, USA, 2708), phospho-S6 (CST, USA, 2211), S6 (CST, USA, 2217), phospho-AKT (CST, USA, 4060), AKT (CST, USA, 9272), Ubiquitin (Abcam, UK, ab134953), SLC38A2 (ImmunoWay, USA, YT4354), LAMTOR1(CST, USA, 8975), LAMTOR2 (CST, USA, 8145), LAMTOR3 (Proteintech, USA, 14492-1-AP), LAMTOR4 (CST, USA, 13140), LAMTOR5 (Proteintech, USA,11937-1-AP), RagA (CST, USA, 4357S) and TAT (Abcam, UK, ab42359).

Techniques: Co-Immunoprecipitation Assay, Mass Spectrometry, Western Blot, Transfection, Construct, EdU Assay

See also Fig. . ( A ) Interaction of TRIM21 and P27KIP1 detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). ( B ) Changes of the ubiquitination level of P27KIP1 detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR, together with HA-Ub, followed by treatment with DMSO or the proteasome inhibitor MG132 (5 μM). Left, immunoblotting of inputs. Middle, immunoblotting using antibody against ubiquitin following IP of P27KIP1. Right, immunoblotting using the antibody against P27KIP1 following IP of HA ( n = 3 independent biological samples). ( C ) Changes of the ubiquitination level of P27KIP1 after co-transfection with GFP-TRIM21 in the presence of Flag-hSPAR and HA-Ub detected by Co-IP and immunoblotting from MDA-MB-231 cells. Left, immunoblotting of inputs. Middle, immunoblotting using antibody against ubiquitin following IP of P27KIP1. Right, immunoblotting using the antibody against P27KIP1 following IP of HA ( n = 3 independent biological samples). ( D ) Immunoblotting against P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, hSPAR, and GAPDH in extracts from MDA-MB-231 cells in the presence of siCtrl or indicated si hSPAR s ( n = 3 independent biological samples). ( E ) Quantified relative levels of P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( D ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( F ) Immunoblotting against P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH for extracts from MDA-MB-231 cells transfected with the indicated controls, and Flag-hSPAR with or without P27KIP1 knockdown ( n = 3 independent biological samples). ( G ) Quantified relative levels of P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( H ) Representative images of EdU assay in the indicated controls, and Flag-hSPAR with or without P27KIP1 knockdown ( n = 3 independent biological samples). Scale bar, 50 µm. ( I ) Quantification of cell proliferation rate from panel ( H ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Journal: The EMBO Journal

Article Title: Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis

doi: 10.1038/s44318-024-00359-z

Figure Lengend Snippet: See also Fig. . ( A ) Interaction of TRIM21 and P27KIP1 detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with the indicated constructs ( n = 3 independent biological samples). ( B ) Changes of the ubiquitination level of P27KIP1 detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR, together with HA-Ub, followed by treatment with DMSO or the proteasome inhibitor MG132 (5 μM). Left, immunoblotting of inputs. Middle, immunoblotting using antibody against ubiquitin following IP of P27KIP1. Right, immunoblotting using the antibody against P27KIP1 following IP of HA ( n = 3 independent biological samples). ( C ) Changes of the ubiquitination level of P27KIP1 after co-transfection with GFP-TRIM21 in the presence of Flag-hSPAR and HA-Ub detected by Co-IP and immunoblotting from MDA-MB-231 cells. Left, immunoblotting of inputs. Middle, immunoblotting using antibody against ubiquitin following IP of P27KIP1. Right, immunoblotting using the antibody against P27KIP1 following IP of HA ( n = 3 independent biological samples). ( D ) Immunoblotting against P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, hSPAR, and GAPDH in extracts from MDA-MB-231 cells in the presence of siCtrl or indicated si hSPAR s ( n = 3 independent biological samples). ( E ) Quantified relative levels of P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( D ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( F ) Immunoblotting against P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag, and GAPDH for extracts from MDA-MB-231 cells transfected with the indicated controls, and Flag-hSPAR with or without P27KIP1 knockdown ( n = 3 independent biological samples). ( G ) Quantified relative levels of P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( H ) Representative images of EdU assay in the indicated controls, and Flag-hSPAR with or without P27KIP1 knockdown ( n = 3 independent biological samples). Scale bar, 50 µm. ( I ) Quantification of cell proliferation rate from panel ( H ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Article Snippet: The membranes were blocked in 5% BSA (Sangon, China) for 1 h at room temperature, and then incubated at 4 °C overnight with primary antibody GAPDH (Proteintech, USA, 60004-1-Ig), hSPAR (HuaBio, China), Flag (Abcam, UK, ab205606), β-Tubulin (Proteintech, USA, 10068-1-AP), FIBRILLARIN (Proteintech, USA, 16021-1-AP), ATPV1A (Proteintech, USA, 14418-1-AP), LAMP2 (CST, USA, 49067), TRIM21 (Proteintech, USA, 67136-1-Ig), P27KIP1 (Proteintech, USA, 25614-1-AP), phospho-P27KIP1 (Abcam, USA, ab75908), SKP2 (Proteintech, USA, 15010-1-AP), SLC7A1 (Proteintech, USA, 14195-1-AP), SLC7A5 (Proteintech, USA, 28670-1-AP), phospho-mTOR (CST, USA, 5536), mTOR (CST, USA, 2983), phospho-S6K (CST, USA, 9234), S6K (CST, USA, 2708), phospho-S6 (CST, USA, 2211), S6 (CST, USA, 2217), phospho-AKT (CST, USA, 4060), AKT (CST, USA, 9272), Ubiquitin (Abcam, UK, ab134953), SLC38A2 (ImmunoWay, USA, YT4354), LAMTOR1(CST, USA, 8975), LAMTOR2 (CST, USA, 8145), LAMTOR3 (Proteintech, USA, 14492-1-AP), LAMTOR4 (CST, USA, 13140), LAMTOR5 (Proteintech, USA,11937-1-AP), RagA (CST, USA, 4357S) and TAT (Abcam, UK, ab42359).

Techniques: Co-Immunoprecipitation Assay, Western Blot, Transfection, Construct, Ubiquitin Proteomics, Plasmid Preparation, Cotransfection, Knockdown, EdU Assay

See also Figs. and . ( A ) Immunoblotting of whole-cell extracts (left panel), cytoplasmic (lysosome components removed) and lysosomal extracts (right panel) prepared from MDA-MB-231 cells transfected with the indicated constructs against p-mTOR, mTOR, RagA, LAMTOR1-5, Flag, GAPDH, LAMP2 (lysosomal marker), and β-Tubulin (cytoplasmic marker) ( n = 3 independent biological samples). ( B ) Heatmap shows the relative expression analysis of the displayed experiment for each protein to β-Tubulin (cytoplasmic fractions) or LAMP2 (lysosomal fractions) from panel ( A ) ( n = 3 independent biological samples). ( C ) Interaction of LAMTOR1 with P27KIP1, LAMTOR2-5, RagA and mTOR, or P27KIP1 with LAMTOR1 detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with the indicated constructs. Left: immunoblotting of inputs. Upper right: immunoblotting using antibodies against LAMTOR1 and P27KIP1 after IP of P27KIP1. Lower right: immunoblotting using antibodies against P27KIP1, LAMTOR1-5, RagA and mTOR after IP of LAMTOR1 ( n = 3 independent biological samples). ( D ) Immunoblotting of cytoplasmic (lysosome components removed) and lysosomal extracts (right panel) prepared from MDA-MB-231 cells transfected with siCtrl, indicated siTRIM21s, or siTRIM21s together with siSLC38A2s against P27KIP1, TRIM21, SLC38A2, p-mTOR, mTOR, RagA, LAMTOR1-5, LAMP2 (lysosomal marker) and β-Tubulin (cytoplasmic marker) ( n = 3 independent biological samples). ( E ) Heatmap shows the relative expression analysis of the displayed experiment for each protein to β-Tubulin (cytoplasmic fractions) or LAMP2 (lysosomal fractions) from panel ( D ) ( n = 3 independent biological samples). ( F ) Immunoblotting against TRIM21, SLC38A2, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6 and GAPDH for extracts from MDA-MB-231 cells transfected with siCtrl, indicated siTRIM21s or siSLC38A2s, or siTRIM21s together with siSLC38A2s ( n = 3 independent biological samples). ( G ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Journal: The EMBO Journal

Article Title: Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis

doi: 10.1038/s44318-024-00359-z

Figure Lengend Snippet: See also Figs. and . ( A ) Immunoblotting of whole-cell extracts (left panel), cytoplasmic (lysosome components removed) and lysosomal extracts (right panel) prepared from MDA-MB-231 cells transfected with the indicated constructs against p-mTOR, mTOR, RagA, LAMTOR1-5, Flag, GAPDH, LAMP2 (lysosomal marker), and β-Tubulin (cytoplasmic marker) ( n = 3 independent biological samples). ( B ) Heatmap shows the relative expression analysis of the displayed experiment for each protein to β-Tubulin (cytoplasmic fractions) or LAMP2 (lysosomal fractions) from panel ( A ) ( n = 3 independent biological samples). ( C ) Interaction of LAMTOR1 with P27KIP1, LAMTOR2-5, RagA and mTOR, or P27KIP1 with LAMTOR1 detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with the indicated constructs. Left: immunoblotting of inputs. Upper right: immunoblotting using antibodies against LAMTOR1 and P27KIP1 after IP of P27KIP1. Lower right: immunoblotting using antibodies against P27KIP1, LAMTOR1-5, RagA and mTOR after IP of LAMTOR1 ( n = 3 independent biological samples). ( D ) Immunoblotting of cytoplasmic (lysosome components removed) and lysosomal extracts (right panel) prepared from MDA-MB-231 cells transfected with siCtrl, indicated siTRIM21s, or siTRIM21s together with siSLC38A2s against P27KIP1, TRIM21, SLC38A2, p-mTOR, mTOR, RagA, LAMTOR1-5, LAMP2 (lysosomal marker) and β-Tubulin (cytoplasmic marker) ( n = 3 independent biological samples). ( E ) Heatmap shows the relative expression analysis of the displayed experiment for each protein to β-Tubulin (cytoplasmic fractions) or LAMP2 (lysosomal fractions) from panel ( D ) ( n = 3 independent biological samples). ( F ) Immunoblotting against TRIM21, SLC38A2, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6 and GAPDH for extracts from MDA-MB-231 cells transfected with siCtrl, indicated siTRIM21s or siSLC38A2s, or siTRIM21s together with siSLC38A2s ( n = 3 independent biological samples). ( G ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K, and p-S6/S6 from panel ( F ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Article Snippet: The membranes were blocked in 5% BSA (Sangon, China) for 1 h at room temperature, and then incubated at 4 °C overnight with primary antibody GAPDH (Proteintech, USA, 60004-1-Ig), hSPAR (HuaBio, China), Flag (Abcam, UK, ab205606), β-Tubulin (Proteintech, USA, 10068-1-AP), FIBRILLARIN (Proteintech, USA, 16021-1-AP), ATPV1A (Proteintech, USA, 14418-1-AP), LAMP2 (CST, USA, 49067), TRIM21 (Proteintech, USA, 67136-1-Ig), P27KIP1 (Proteintech, USA, 25614-1-AP), phospho-P27KIP1 (Abcam, USA, ab75908), SKP2 (Proteintech, USA, 15010-1-AP), SLC7A1 (Proteintech, USA, 14195-1-AP), SLC7A5 (Proteintech, USA, 28670-1-AP), phospho-mTOR (CST, USA, 5536), mTOR (CST, USA, 2983), phospho-S6K (CST, USA, 9234), S6K (CST, USA, 2708), phospho-S6 (CST, USA, 2211), S6 (CST, USA, 2217), phospho-AKT (CST, USA, 4060), AKT (CST, USA, 9272), Ubiquitin (Abcam, UK, ab134953), SLC38A2 (ImmunoWay, USA, YT4354), LAMTOR1(CST, USA, 8975), LAMTOR2 (CST, USA, 8145), LAMTOR3 (Proteintech, USA, 14492-1-AP), LAMTOR4 (CST, USA, 13140), LAMTOR5 (Proteintech, USA,11937-1-AP), RagA (CST, USA, 4357S) and TAT (Abcam, UK, ab42359).

Techniques: Western Blot, Transfection, Construct, Marker, Expressing, Co-Immunoprecipitation Assay

( A ) Immunoblotting against P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH for extracts from HEK293T cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). ( B ) Quantified relative levels of P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( A ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( C ) Representative images of EdU assay HEK293T cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). Scale bar, 50 µm. ( D ) Quantification of cell proliferation rate from panel ( C ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( E ) Immunoblotting against SLC38A2, P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH for extracts from MDA-MB-468 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). ( F ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( E ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( G ) Representative images of EdU assay MDA-MB-468 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). Scale bar, 50 µm. ( H ) Quantification of cell proliferation rate from panel ( G ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( I ) Immunoblotting against SLC38A2, P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH for extracts from MCF7 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). ( J ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( I ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( K ) Representative images of EdU assay MCF7 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). Scale bar, 50 µm. ( L ) Quantification of cell proliferation rate from panel ( K ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text.

Journal: The EMBO Journal

Article Title: Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis

doi: 10.1038/s44318-024-00359-z

Figure Lengend Snippet: ( A ) Immunoblotting against P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH for extracts from HEK293T cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). ( B ) Quantified relative levels of P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( A ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( C ) Representative images of EdU assay HEK293T cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). Scale bar, 50 µm. ( D ) Quantification of cell proliferation rate from panel ( C ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( E ) Immunoblotting against SLC38A2, P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH for extracts from MDA-MB-468 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). ( F ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( E ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( G ) Representative images of EdU assay MDA-MB-468 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). Scale bar, 50 µm. ( H ) Quantification of cell proliferation rate from panel ( G ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( I ) Immunoblotting against SLC38A2, P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, Flag and GAPDH for extracts from MCF7 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). ( J ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel ( I ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( K ) Representative images of EdU assay MCF7 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR ( n = 3 independent biological samples). Scale bar, 50 µm. ( L ) Quantification of cell proliferation rate from panel ( K ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. The hSPAR-regulated proteins shown by immunoblotting are marked by red text.

Article Snippet: The membranes were blocked in 5% BSA (Sangon, China) for 1 h at room temperature, and then incubated at 4 °C overnight with primary antibody GAPDH (Proteintech, USA, 60004-1-Ig), hSPAR (HuaBio, China), Flag (Abcam, UK, ab205606), β-Tubulin (Proteintech, USA, 10068-1-AP), FIBRILLARIN (Proteintech, USA, 16021-1-AP), ATPV1A (Proteintech, USA, 14418-1-AP), LAMP2 (CST, USA, 49067), TRIM21 (Proteintech, USA, 67136-1-Ig), P27KIP1 (Proteintech, USA, 25614-1-AP), phospho-P27KIP1 (Abcam, USA, ab75908), SKP2 (Proteintech, USA, 15010-1-AP), SLC7A1 (Proteintech, USA, 14195-1-AP), SLC7A5 (Proteintech, USA, 28670-1-AP), phospho-mTOR (CST, USA, 5536), mTOR (CST, USA, 2983), phospho-S6K (CST, USA, 9234), S6K (CST, USA, 2708), phospho-S6 (CST, USA, 2211), S6 (CST, USA, 2217), phospho-AKT (CST, USA, 4060), AKT (CST, USA, 9272), Ubiquitin (Abcam, UK, ab134953), SLC38A2 (ImmunoWay, USA, YT4354), LAMTOR1(CST, USA, 8975), LAMTOR2 (CST, USA, 8145), LAMTOR3 (Proteintech, USA, 14492-1-AP), LAMTOR4 (CST, USA, 13140), LAMTOR5 (Proteintech, USA,11937-1-AP), RagA (CST, USA, 4357S) and TAT (Abcam, UK, ab42359).

Techniques: Western Blot, Transfection, Plasmid Preparation, EdU Assay

( A ) hSPAR is composed of an N-terminal domain, a transmembrane (TM) domain and a C-terminal domain as predicted by Alphafold2. ( B ) Diagram of Flag-tagged full-length hSPAR and three hSPAR domain deletion variants. ( C ) Co-immunofluorescence staining of P27KIP1 (green) and Lyso-Tracker (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble P27KIP1. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of P27KIP1 and Lyso-Tracker over the distance from adjacent image (depicted by the arrows). Scale bar, 5 µm ( n = 3 independent biological samples). ( D ) Co-immunofluorescence staining of mTOR (green) and Lyso-Tracker (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble mTOR. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of mTOR and Lyso-Tracker over the distance from adjacent image (depicted by the arrows). Scale bar, 5 µm ( n = 3 independent biological samples). ( E ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( F ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( G ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( H ) Quantification of cell proliferation rate from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( I ) Quantification of cell proliferation rate from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( J ) Immunohistochemistry of TAT-hSPAR-C detected by immunohistochemistry with the anti-hSPAR antibody in the xenografts from panel (Fig. ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( K ) Immunohistochemistry of cell proliferation marker Ki67 in the xenografts from panel (Fig. ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( L ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction.

Journal: The EMBO Journal

Article Title: Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis

doi: 10.1038/s44318-024-00359-z

Figure Lengend Snippet: ( A ) hSPAR is composed of an N-terminal domain, a transmembrane (TM) domain and a C-terminal domain as predicted by Alphafold2. ( B ) Diagram of Flag-tagged full-length hSPAR and three hSPAR domain deletion variants. ( C ) Co-immunofluorescence staining of P27KIP1 (green) and Lyso-Tracker (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble P27KIP1. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of P27KIP1 and Lyso-Tracker over the distance from adjacent image (depicted by the arrows). Scale bar, 5 µm ( n = 3 independent biological samples). ( D ) Co-immunofluorescence staining of mTOR (green) and Lyso-Tracker (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble mTOR. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of mTOR and Lyso-Tracker over the distance from adjacent image (depicted by the arrows). Scale bar, 5 µm ( n = 3 independent biological samples). ( E ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( F ) Quantified relative levels of p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( G ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( H ) Quantification of cell proliferation rate from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using one-way ANOVA with Dunnett’ multiple comparisons test. ( I ) Quantification of cell proliferation rate from panel (Fig. ) ( n = 3 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( J ) Immunohistochemistry of TAT-hSPAR-C detected by immunohistochemistry with the anti-hSPAR antibody in the xenografts from panel (Fig. ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( K ) Immunohistochemistry of cell proliferation marker Ki67 in the xenografts from panel (Fig. ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( L ) Quantified relative levels of SLC38A2/GAPDH, P27KIP1/GAPDH, p-mTOR/mTOR, p-S6K/S6K and p-S6/S6 from panel (Fig. ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction.

Article Snippet: The membranes were blocked in 5% BSA (Sangon, China) for 1 h at room temperature, and then incubated at 4 °C overnight with primary antibody GAPDH (Proteintech, USA, 60004-1-Ig), hSPAR (HuaBio, China), Flag (Abcam, UK, ab205606), β-Tubulin (Proteintech, USA, 10068-1-AP), FIBRILLARIN (Proteintech, USA, 16021-1-AP), ATPV1A (Proteintech, USA, 14418-1-AP), LAMP2 (CST, USA, 49067), TRIM21 (Proteintech, USA, 67136-1-Ig), P27KIP1 (Proteintech, USA, 25614-1-AP), phospho-P27KIP1 (Abcam, USA, ab75908), SKP2 (Proteintech, USA, 15010-1-AP), SLC7A1 (Proteintech, USA, 14195-1-AP), SLC7A5 (Proteintech, USA, 28670-1-AP), phospho-mTOR (CST, USA, 5536), mTOR (CST, USA, 2983), phospho-S6K (CST, USA, 9234), S6K (CST, USA, 2708), phospho-S6 (CST, USA, 2211), S6 (CST, USA, 2217), phospho-AKT (CST, USA, 4060), AKT (CST, USA, 9272), Ubiquitin (Abcam, UK, ab134953), SLC38A2 (ImmunoWay, USA, YT4354), LAMTOR1(CST, USA, 8975), LAMTOR2 (CST, USA, 8145), LAMTOR3 (Proteintech, USA, 14492-1-AP), LAMTOR4 (CST, USA, 13140), LAMTOR5 (Proteintech, USA,11937-1-AP), RagA (CST, USA, 4357S) and TAT (Abcam, UK, ab42359).

Techniques: Immunofluorescence, Staining, Transfection, Construct, Fluorescence, Two Tailed Test, Immunohistochemistry, Marker

See also Fig. . ( A ) Changes of interaction between TRIM21 and P27KIP1, TRIM21, and Flag-hSPAR-C detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR-C. Upper, immunoblotting of inputs. Middle, immunoblotting using antibodies against TRIM21, P27KIP1 and Flag following IP of TRIM21. Lower, immunoblotting using antibodies against Flag and TRIM21 following IP of Flag ( n = 3 independent biological samples). ( B ) Co-immunofluorescence staining of P27KIP1(green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble P27KIP1. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of P27KIP1 and LAMP1 over the distance from adjacent image (depicted by the arrows). The graphs display the values of Pearson’s correlation Rr of P27KIP1 and LAMP1 with the indicated constructs. Scale bar, 25 µm ( n = 3 independent biological samples). ( C ) Co-immunofluorescence staining of mTOR (green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble mTOR. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of mTOR and LAMP1 over the distance from adjacent image (depicted by the arrows). The graphs display the values of Pearson’s correlation Rr of mTOR and LAMP1 with the indicated constructs. Scale bar, 25 µm ( n = 3 independent biological samples). ( D ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, and S6 in extracts from MDA-MB-231 cells transfected with ΔATG1 + 2, Flag-tagged full-length hSPAR or three indicated hSPAR domain deletion variants. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( E ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, and S6 in extracts from MDA-MB-231 cells transfected with ΔATG1 + 2, Flag-hSPAR or Flag-hSPAR-C (hSPAR’s C-terminal domain). Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( F ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, P27KIP1, SLC38A2 and TAT in extracts from MDA-MB-231 cells treated with TAT-hSPAR-C (150 nM) at the indicated time. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( G ) Representative images of EdU assay detected in MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, Flag-hSPAR, ΔN-hSPAR, ΔTM-hSPAR, ΔC-hSPAR, or Flag-hSPAR-C. Scale bar, 50 µm. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( H ) Representative images of EdU assay detected in MDA-MB-231 cells treated with TAT or TAT-hSPAR. Scale bar, 50 µm. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( I ) Images of tumors from breast cancer xenograft mice with injection of TAT ( n = 6 independent biological samples) or TAT-hSPAR-C peptide ( n = 6 independent biological samples). ( J ) Time-course analysis of tumor volume in the xenografts from panel ( I ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( K ) Tumor weight in the xenografts from panel ( I ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( L ) Levels of glutamine in the xenografts from panel ( I ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( M ) Immunohistochemistry of SLC38A2 detected by immunohistochemistry with the anti-SLC38A2 antibody in the xenografts from panel ( I ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( N ) Immunohistochemistry of P27KIP1 detected by immunohistochemistry with the anti-P27KIP1 antibody in the xenografts from panel ( I ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( O ) Immunoblotting against SLC38A2, P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, TAT, and GAPDH in the xenografts from panel ( I ). Statistical analysis is shown in Fig. ( n = 12 independent biological samples). ( P ) Working model: in cancer cells or xenograft tumors, hSPAR or hSPAR-C interacts with E3 ligase TRIM21 and disrupts TRIM21-P27KIP1 interaction, resulting escape of P27KIP1 from ubiquitin-proteasome degradation and increase of P27KIP1 expression level in cytosol. Coordinately, acting as an inhibitor for glutamine uptake, hSPAR results in glutamine deprivation by suppressing SLC38A2, and promotes P27KIP1 lysosomal-localization. Lysosome-localized P27KIP1 competitively interacts with LAMTOR1 to disassemble mTORC1 complex and inhibit cancer cell proliferation. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Journal: The EMBO Journal

Article Title: Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis

doi: 10.1038/s44318-024-00359-z

Figure Lengend Snippet: See also Fig. . ( A ) Changes of interaction between TRIM21 and P27KIP1, TRIM21, and Flag-hSPAR-C detected by Co-IP and immunoblotting from MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2 or Flag-hSPAR-C. Upper, immunoblotting of inputs. Middle, immunoblotting using antibodies against TRIM21, P27KIP1 and Flag following IP of TRIM21. Lower, immunoblotting using antibodies against Flag and TRIM21 following IP of Flag ( n = 3 independent biological samples). ( B ) Co-immunofluorescence staining of P27KIP1(green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble P27KIP1. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of P27KIP1 and LAMP1 over the distance from adjacent image (depicted by the arrows). The graphs display the values of Pearson’s correlation Rr of P27KIP1 and LAMP1 with the indicated constructs. Scale bar, 25 µm ( n = 3 independent biological samples). ( C ) Co-immunofluorescence staining of mTOR (green) and the lysosomal marker LAMP1 (red) in MDA-MB-231 cells transfected with the indicated constructs. Cells were permeabilized with digitonin to remove the soluble mTOR. Nuclei were stained with Hoechst (blue). The graphs display the fluorescence intensity (arbitrary units) of mTOR and LAMP1 over the distance from adjacent image (depicted by the arrows). The graphs display the values of Pearson’s correlation Rr of mTOR and LAMP1 with the indicated constructs. Scale bar, 25 µm ( n = 3 independent biological samples). ( D ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, and S6 in extracts from MDA-MB-231 cells transfected with ΔATG1 + 2, Flag-tagged full-length hSPAR or three indicated hSPAR domain deletion variants. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( E ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, and S6 in extracts from MDA-MB-231 cells transfected with ΔATG1 + 2, Flag-hSPAR or Flag-hSPAR-C (hSPAR’s C-terminal domain). Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( F ) Immunoblotting against p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, P27KIP1, SLC38A2 and TAT in extracts from MDA-MB-231 cells treated with TAT-hSPAR-C (150 nM) at the indicated time. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( G ) Representative images of EdU assay detected in MDA-MB-231 cells transfected with Vector Ctrl, ΔATG1 + 2, Flag-hSPAR, ΔN-hSPAR, ΔTM-hSPAR, ΔC-hSPAR, or Flag-hSPAR-C. Scale bar, 50 µm. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( H ) Representative images of EdU assay detected in MDA-MB-231 cells treated with TAT or TAT-hSPAR. Scale bar, 50 µm. Statistical analysis is shown in Fig. ( n = 3 independent biological samples). ( I ) Images of tumors from breast cancer xenograft mice with injection of TAT ( n = 6 independent biological samples) or TAT-hSPAR-C peptide ( n = 6 independent biological samples). ( J ) Time-course analysis of tumor volume in the xenografts from panel ( I ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( K ) Tumor weight in the xenografts from panel ( I ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( L ) Levels of glutamine in the xenografts from panel ( I ) ( n = 12 independent biological samples). Data are presented as the mean ± SEM and analyzed using two-tailed Student’s t test with Welch’s correction. ( M ) Immunohistochemistry of SLC38A2 detected by immunohistochemistry with the anti-SLC38A2 antibody in the xenografts from panel ( I ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( N ) Immunohistochemistry of P27KIP1 detected by immunohistochemistry with the anti-P27KIP1 antibody in the xenografts from panel ( I ) ( n = 12 independent biological samples). Scale bar, 20 µm. ( O ) Immunoblotting against SLC38A2, P27KIP1, p-mTOR, mTOR, p-S6K, S6K, p-S6, S6, TAT, and GAPDH in the xenografts from panel ( I ). Statistical analysis is shown in Fig. ( n = 12 independent biological samples). ( P ) Working model: in cancer cells or xenograft tumors, hSPAR or hSPAR-C interacts with E3 ligase TRIM21 and disrupts TRIM21-P27KIP1 interaction, resulting escape of P27KIP1 from ubiquitin-proteasome degradation and increase of P27KIP1 expression level in cytosol. Coordinately, acting as an inhibitor for glutamine uptake, hSPAR results in glutamine deprivation by suppressing SLC38A2, and promotes P27KIP1 lysosomal-localization. Lysosome-localized P27KIP1 competitively interacts with LAMTOR1 to disassemble mTORC1 complex and inhibit cancer cell proliferation. The hSPAR-regulated proteins shown by immunoblotting are marked by red text. .

Article Snippet: The membranes were blocked in 5% BSA (Sangon, China) for 1 h at room temperature, and then incubated at 4 °C overnight with primary antibody GAPDH (Proteintech, USA, 60004-1-Ig), hSPAR (HuaBio, China), Flag (Abcam, UK, ab205606), β-Tubulin (Proteintech, USA, 10068-1-AP), FIBRILLARIN (Proteintech, USA, 16021-1-AP), ATPV1A (Proteintech, USA, 14418-1-AP), LAMP2 (CST, USA, 49067), TRIM21 (Proteintech, USA, 67136-1-Ig), P27KIP1 (Proteintech, USA, 25614-1-AP), phospho-P27KIP1 (Abcam, USA, ab75908), SKP2 (Proteintech, USA, 15010-1-AP), SLC7A1 (Proteintech, USA, 14195-1-AP), SLC7A5 (Proteintech, USA, 28670-1-AP), phospho-mTOR (CST, USA, 5536), mTOR (CST, USA, 2983), phospho-S6K (CST, USA, 9234), S6K (CST, USA, 2708), phospho-S6 (CST, USA, 2211), S6 (CST, USA, 2217), phospho-AKT (CST, USA, 4060), AKT (CST, USA, 9272), Ubiquitin (Abcam, UK, ab134953), SLC38A2 (ImmunoWay, USA, YT4354), LAMTOR1(CST, USA, 8975), LAMTOR2 (CST, USA, 8145), LAMTOR3 (Proteintech, USA, 14492-1-AP), LAMTOR4 (CST, USA, 13140), LAMTOR5 (Proteintech, USA,11937-1-AP), RagA (CST, USA, 4357S) and TAT (Abcam, UK, ab42359).

Techniques: Co-Immunoprecipitation Assay, Western Blot, Transfection, Plasmid Preparation, Immunofluorescence, Staining, Marker, Construct, Fluorescence, EdU Assay, Injection, Two Tailed Test, Immunohistochemistry, Ubiquitin Proteomics, Expressing