|
Bioss
ser2448 Ser2448, supplied by Bioss, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtor/pmc13041546-61-3-5?v=Bioss Average 94 stars, based on 1 article reviews
ser2448 - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
Epizyme Inc
anti mtor Anti Mtor, supplied by Epizyme Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtor/10__2147_slash_ott__s539944-67-21-25?v=Epizyme+Inc Average 86 stars, based on 1 article reviews
anti mtor - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Proteintech
mtor ![]() Mtor, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtor/pmc12891626-107-37-38?v=Proteintech Average 96 stars, based on 1 article reviews
mtor - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Addgene inc
addgene pcdna3 au1 mtor e2419k ![]() Addgene Pcdna3 Au1 Mtor E2419k, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtor/pmc12390678-71-2-2?v=Addgene+inc Average 93 stars, based on 1 article reviews
addgene pcdna3 au1 mtor e2419k - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Addgene inc
id ![]() Id, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtor/pmc12393069-191-15-11?v=Addgene+inc Average 93 stars, based on 1 article reviews
id - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
p mtor ![]() P Mtor, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtor/pmc07204046-61-4-25?v=Santa+Cruz+Biotechnology Average 96 stars, based on 1 article reviews
p mtor - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
mtor ![]() Mtor, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtor/pm29405784-34-28-42?v=Santa+Cruz+Biotechnology Average 96 stars, based on 1 article reviews
mtor - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Selleck Chemicals
mtor inhibitors ![]() Mtor Inhibitors, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtor/pmc12533367-375-32-51?v=Selleck+Chemicals Average 94 stars, based on 1 article reviews
mtor inhibitors - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
Bethyl
mtor antibody ![]() Mtor Antibody, supplied by Bethyl, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtor/us09249466-560-15-17?v=Bethyl Average 91 stars, based on 1 article reviews
mtor antibody - by Bioz Stars,
2026-07
91/100 stars
|
Buy from Supplier |
|
OriGene
recombinant full length mtor ![]() Recombinant Full Length Mtor, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtor/pmc07140413-92-13-16?v=OriGene Average 94 stars, based on 1 article reviews
recombinant full length mtor - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
cagccagtcatctttggagacc ![]() Cagccagtcatctttggagacc, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtor/pmc12895042-22-5-17?v=OriGene Average 94 stars, based on 1 article reviews
cagccagtcatctttggagacc - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
mirna ![]() Mirna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtor/10__1161_slash_circulationaha__110__000323-323-6-41?v=OriGene Average 90 stars, based on 1 article reviews
mirna - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Scientific Reports
Article Title: KIN17 facilitates the initiation and progression of renal tumor progression through the PI3K-AKT-mTOR pathway
doi: 10.1038/s41598-026-35851-5
Figure Lengend Snippet: KIN17 positively regulates PI3K/AKT/mTOR expression in RCC and PF-04691502 can reverse the pathway protein expression and biological function. ( A ) Predict effects of KIN17 knockdown on the pathways of RCC cells (ACHN and 786–0) in vitro by kegg and GSEA. ( B ) p-mTOR, mTOR, p-AKT, AKT, p-PI3K and PI3K protein levels were measured by WB using the paired RCC cells (ACHN and 786–0) group and knockdown KIN17 group. ( C ) p-mTOR, mTOR, p-AKT, AKT, p-PI3K and PI3K protein levels were measured by WB using the paired RCC vector cells group (VE groups), overexpression KIN17 group (OE groups), VE groups + PF-04691502 and OE groups + PF-04691502. ( D ) N-cadherin and Vimentin protein levels were measured by WB using the paired RCC cells (ACHN and 786–0) in knockdown KIN17 group and different using PF-04691502 groups.
Article Snippet: The membranes were then blocked with 5% non-fat milk in TBS/Tween (0.05% Tween-20 in TBS) for 2 h. Membranes were incubated with primary antibodies including KIN17(Santa Cruz, Catalog number: sc-32768, 1:500), AKT (Proteintech, Catalog number: 60203–2-Ig, 1:10,000),
Techniques: Expressing, Knockdown, In Vitro, Plasmid Preparation, Over Expression
Journal: Scientific Reports
Article Title: KIN17 facilitates the initiation and progression of renal tumor progression through the PI3K-AKT-mTOR pathway
doi: 10.1038/s41598-026-35851-5
Figure Lengend Snippet: KIN17 promotes tumor growth and suppression of tumor growth by PF-04691502 in vivo ( A ) Representative images of xenograft tumors 786–0 cells with expression of shNC and shKIN17 (n = 7 in each group). Tumor volume and tumor weight were analyzed. ( B ) Representative H&E staining and immunohistochemstry staining of Ki67, TUNEL, KIN17, p-mTOR and p-AKT in the xenograft tumor tissues (× 400 magnification). ( C ) Representative images of xenograft tumors 786–0 cells with expression of Vector, Vector + PF-04691502, OE and OE + PF-04691502 (n = 8 in each group). Tumor volume and tumor weight were analyzed. ( D ) Representative H&E staining and immunohistochemstry staining of Ki67, TUNEL, KIN17, p-mTOR and p-AKT in the xenograft tumor tissues (× 400 magnification). The error bars represent the mean ± SD of triplicate technical replicates. * P < 0.05, ** P < 0.01, ***P < 0.001.
Article Snippet: The membranes were then blocked with 5% non-fat milk in TBS/Tween (0.05% Tween-20 in TBS) for 2 h. Membranes were incubated with primary antibodies including KIN17(Santa Cruz, Catalog number: sc-32768, 1:500), AKT (Proteintech, Catalog number: 60203–2-Ig, 1:10,000),
Techniques: In Vivo, Expressing, Staining, TUNEL Assay, Plasmid Preparation
Journal: Journal of Experimental & Clinical Cancer Research : CR
Article Title: SNCG promotes the progression and metastasis of high-grade serous ovarian cancer via targeting the PI3K/AKT signaling pathway
doi: 10.1186/s13046-020-01589-9
Figure Lengend Snippet: SNCG induces ovarian cancer progression via activating the PI3K/AKT signaling pathway. a-b A phospho-kinase array kit was performed on protein lysates of SKOV3-sh1 and control cells. Thirteen proteins were obvious changes in their phosphorylation status and highlighted by boxes. c Western blot analysis of the levels of Akt, p-Akt (Sec473), p70S6 kinase, p-p70S6 kinase (Thr389), mTOR, and p-mTOR (Sec2448) in SKOV3 and HO-8901 PM cells transfected with SNCG-shRNA or Scr, and OVCAR3 cells transfected with SNCG-Ove or Ctrl. d Expression levels of Akt, p-Akt (Sec473), p70S6 kinase, p-p70S6 kinase (Thr389), mTOR, and p-mTOR (Sec2448) in cells transfected with SNCG shRNA, Scr, SNCG Ove, Ctrl, IGF-1, and DMSO were determined by Western blot. e Expression levels of Akt, p-Akt (Sec473), p70S6 kinase, p-p70S6 kinase (Thr389), mTOR, and p-mTOR (Sec2448) in cells transfected with SNCG shRNA, Scr, SNCG Ove, Ctrl, LY294002, and DMSO were determined by Western blot. f Wound healing assay (upper, original magnification × 40) and cell colony formation (lower) of cells transfected with SNCG shRNA, Scr, SNCG Ove, Ctrl, IGF-1, LY294002, and DMSO confirmed the effect of SNCG on the PI3K/AKT signaling pathway. ▲ , P < 0.05. *, P < 0.001. IGF-1: insulin-like growth factor 1; sh-SNCG: small hairpin RNAs of SNCG
Article Snippet: Antibodies against mTOR (sc-517,464),
Techniques: Control, Phospho-proteomics, Western Blot, Transfection, shRNA, Expressing, Wound Healing Assay
Journal: Journal of Experimental & Clinical Cancer Research : CR
Article Title: SNCG promotes the progression and metastasis of high-grade serous ovarian cancer via targeting the PI3K/AKT signaling pathway
doi: 10.1186/s13046-020-01589-9
Figure Lengend Snippet: The schematic diagram summarizing the role of SNCG in promoting HGSOC progression. SNCG promotes the phosphorylation of AKT, mTOR, and p70S6K, which regulating the malignant behaviors in ovarian cancer cells
Article Snippet: Antibodies against mTOR (sc-517,464),
Techniques: Phospho-proteomics
Journal: Artificial cells, nanomedicine, and biotechnology
Article Title: Carvacrol nanoemulsion evokes cell cycle arrest, apoptosis induction and autophagy inhibition in doxorubicin resistant-A549 cell line.
doi: 10.1080/21691401.2018.1434187
Figure Lengend Snippet: Figure 5. CANE abolishes autophagy in A549DR. (A) CANE was treated to A549DR cells for 24 h and autophagic protein levels detected such as LC-3, p62, Beclin-1, mTOR, ATG5 and ATG7. Densitometry analysis of the respective proteins was evaluated by Image J software, and results were normalized with b-actin with respect to controls. (B) For further confirmation, autophagic vacoule formation detected with the help of fluorogenic dye LysoTracker V R Red, DAPI was used as counter stain to stain nucleus. Acridine orange was used to detect the autopaghic vacoule formation. Image J software was used for quantification of oxidative stress. Images were taken at 40 magnification [scale bar¼ 0.1 mm]. Each value in the graph represents as the mean ± SD of three independent experiments. Values with different superscripts differ significantly from each other (p < .05).
Article Snippet: Carvacrol, 3-Methyladenine (3-MA), N-acetyl-L-cysteine (NAC), primary antibodies against b-actin, JNK, p-JNK, caspase-3, caspase-9, Bax, Bcl2, cytochrome C, CDK2, CDK4, CDK6, Cyclin E, Cyclin D1, p21, LC-3, ATG5, ATG7,
Techniques: Software, Staining
Journal: Advanced Science
Article Title: Long Non‐Coding RNA IGFRIL Couples with PTBP1 to Destabilize IGFBP3 mRNA to Promote the IGF1R‐AKT‐mTOR Axis and Hepatocellular Carcinoma
doi: 10.1002/advs.202507676
Figure Lengend Snippet: IGFRIL couples with PTBP1 to enhance the activation of AKT‐mTOR signaling in HCC cells. A) Overlapping DEGs upon IGFRIL and PTBP1 knockdown in HepG2 cells. B) GO and KEGG pathway enrichment analyses of the overlapping differentially expressed genes (DEGs). C) Spearman's correlation of gene set enrichment scores between IGFRIL and PTBP1 knockdown. NES, normalized enrichment score. D) GSEA plots of “PI3K_EVENTS_IN_ERBB4_SIGNALING” in IGFRIL ‐knocked‐down and PTBP1 ‐knocked‐down HepG2 cells. E) IB assays of key cascades of the receptor tyrosine kinases (RTK) and AKT‐mTOR signaling in HepG2 cells upon IGFRIL knockdown or overexpression. F) Knockdown of IGFRIL accelerates the autophagic flux in HepG2 cells. HepG2 cells stably expressing mRFP‐GFP‐LC3 were treated with DMSO, NVP‐AEW541 (2 µ m ), or Rapamycin (10 µ m ) for 12 h upon knockdown of IGFRIL , followed by staining with DAPI. Red puncta represent the autophagosomes; and yellow puncta in the merged picture represent the autolysosomes. Scale bars, 40 µm. G,H) Rapamycin attenuates the promoting effects of IGFRIL overexpression on cell malignant phenotypes and mTOR signaling. Data are shown as mean ± SEM, * P < 0.05, ** P < 0.01, *** P < 0.001 by 1‐way ANOVA (E,G,H). n.s., not significant.
Article Snippet: When the tumor volume reached ≈100 mm 3 after implantation, the mice were randomly divided into three treatment groups for assessing the sensitivity of PDXs with different IGFRIL levels to IGF1R or
Techniques: Activation Assay, Knockdown, Over Expression, Stable Transfection, Expressing, Staining
Journal: Advanced Science
Article Title: Long Non‐Coding RNA IGFRIL Couples with PTBP1 to Destabilize IGFBP3 mRNA to Promote the IGF1R‐AKT‐mTOR Axis and Hepatocellular Carcinoma
doi: 10.1002/advs.202507676
Figure Lengend Snippet: IGFRIL activates the IGF1R‐AKT‐mTOR signaling and plays oncogenic roles dependent on IGFBP3. A) The effects of knockdown or overexpression of IGFBP3 on the activities of the IGF1R‐AKT‐mTOR axis. B) The effects of IGFBP3 overexpression on IGFRIL ‐activated IGF1R‐AKT‐mTOR axis, and the effects of IGFBP3 knockdown on IGFRIL knockdown‐repressed IGF1R‐AKT‐mTOR axis. C,D) The effects of IGFBP3 knockdown or overexpression on the abilities of plate colony formation, migration, and invasion. E) The effects of IGFBP3 overexpression on the IGFRIL ‐enhanced plate colony formation, migration, and invasion. F) The effects of IGFBP3 knockdown on the IGFRIL knockdown‐reduced plate colony formation, migration, and invasion. G) The effects of IGF1R inhibition with its inhibitor AEW541 (2 µM) or siRNAs against IGF1R on the IGFRIL‐activated IGF1R‐AKT‐mTOR axis. H,I) The effects of IGF1R inhibition on the IGFRIL ‐enhanced plate colony formation, migration, and invasion. J) j Spearman's correlations between the levels of IGFRIL and levels of IGFBP3, p‐IGF1R, p‐AKT and p‐mTOR, respectively, in HCC tumor tissues ( n = 83) from the VALI1 cohort. Data are shown as mean ± SEM, * P < 0.05, ** P < 0.01, *** P < 0.001 by 1‐way ANOVA (C,E,F,G,I) or Student's t‐ test (D).
Article Snippet: When the tumor volume reached ≈100 mm 3 after implantation, the mice were randomly divided into three treatment groups for assessing the sensitivity of PDXs with different IGFRIL levels to IGF1R or
Techniques: Knockdown, Over Expression, Migration, Inhibition
Journal: Advanced Science
Article Title: Long Non‐Coding RNA IGFRIL Couples with PTBP1 to Destabilize IGFBP3 mRNA to Promote the IGF1R‐AKT‐mTOR Axis and Hepatocellular Carcinoma
doi: 10.1002/advs.202507676
Figure Lengend Snippet: Upregulation of IGFRIL sensitizes HCC cells to IGF1R and mTOR inhibitors. A) Spearman's correlations between the levels of IGFRIL and sensitivities to inhibitors against IGF1R (BMS‐754807) and mTOR (rapamycin) in eight types of HCC cell lines. The effects of BMS‐754807 or rapamycin on HCC cell growth were determined by CCK‐8 assays. B) The effects of IGFRIL knockdown on the sensitivity to BMS‐754807 or rapamycin in HepG2 cells. C) The effects of IGFRIL overexpression on the sensitivity to BMS‐754807 or rapamycin in JHH‐2 cells. D) The effects of BMS‐754807 or rapamycin treatment on tumor growth in patient‐derived xenografts (PDX) mouse models. The mice were treated with control (DMSO), BMS‐754807 (25 mg kg −1 every 5 days, intraperitoneal injection) or rapamycin (10 mg kg −1 every 5 days, intraperitoneal injection) ( n = 5 mice/group). E–G) The effects of IGFRIL knockdown or overexpression on the cell growth, migration, and invasion (E,F), and the activities of the IGF1R‐AKT‐mTOR axis (G) in IGFRIL high and IGFRIL low patient‐derived primary tumor cells (PDCs), respectively. H) The effects of BMS‐754807 (left) or rapamycin (right) treatment on the growth of IGFRIL high or IGFRIL low PDCs. I) The effects of IGFRIL knockdown or overexpression on the sensitivities to BMS‐754807 and rapamycin in IGFRIL high and IGFRIL low PDCs, respectively. J) Schematic diagram of the function and mechanism of IGFRIL in HCC tumorigenesis and drug sensitivity. Data are shown as mean ± SEM, * P < 0.05, ** P < 0.01, *** P < 0.001 by 1‐way ANOVA (B,D,E,I) or Student's t test (C,F,H).
Article Snippet: When the tumor volume reached ≈100 mm 3 after implantation, the mice were randomly divided into three treatment groups for assessing the sensitivity of PDXs with different IGFRIL levels to IGF1R or
Techniques: CCK-8 Assay, Knockdown, Over Expression, Derivative Assay, Control, Injection, Migration