mock-infected ask ells Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher hoechst 33342
    Cell membrane integrity after ISAV infection . Microscopic analysis of apoptosis with YO-PRO-1 staining. Cells were mock or ISAV infected, or treated with SS (1 μM 24 h) and stained with YO-PRO-1, <t>Hoechst</t> 33342 and PI, and examined under a fluorescence microscope at the indicated time points (10× magnification).
    Hoechst 33342, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 54383 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hoechst 33342/product/Thermo Fisher
    Average 99 stars, based on 54383 article reviews
    Price from $9.99 to $1999.99
    hoechst 33342 - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Millipore ash2l shrna constructs
    hERG 1b modulation alters native I Kr . ( A ) Sample E-4031–sensitive traces representing endogenous I Kr from ( Top ) control, ( Middle ) <t>shRNA-transfected,</t> and ( Bottom ) PAS-infected iPSC-CMs. Pulses from −40 to 20 mV in 10-mV steps are shown.
    Ash2l Shrna Constructs, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 906 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ash2l shrna constructs/product/Millipore
    Average 99 stars, based on 906 article reviews
    Price from $9.99 to $1999.99
    ash2l shrna constructs - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    92
    GenePharma Company klf15
    Tanshinol regulates expression of <t>KLF15</t> gene under condition of Dex involving glucocorticoid receptor. C2C12 cells and MC3T3-E1 cells were treated with Dex and/or RU486 (RU, a direct target of glucocorticoid receptor) in the presence or absence of Tan for 12 h; mRNA expression of KLF15 gene was measured by qRT-PCR. Values are means ± SD of at least three independent experiments. ∗ P
    Klf15, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 92/100, based on 46 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/klf15/product/GenePharma Company
    Average 92 stars, based on 46 article reviews
    Price from $9.99 to $1999.99
    klf15 - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    Santa Cruz Biotechnology hela cells
    A myosin Va epitope is exposed preferentially in <t>HSV-infected</t> cells. <t>HeLa</t> cells were mock infected or infected with HSV-1(F) (MOI = 5 PFU per cell). At 16 hpi the cells were washed in PBS, fixed in 3% PFA for 15 min, and permeabilized
    Hela Cells, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 969 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hela cells/product/Santa Cruz Biotechnology
    Average 92 stars, based on 969 article reviews
    Price from $9.99 to $1999.99
    hela cells - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    88
    The Jackson Laboratory sex matched c57bl 6j mice
    CHIKV mos produces lower levels of viremia and footpad swelling in mice. Wild-type <t>C57BL/6J</t> mice were subcutaneously infected with 1 × 10 5 PFUs of CHIKV vero , CHIKV mos or mock infected with PBS and monitored daily for 10 days. (A) Viral load in blood at day 1, 2, 4 and 6-post infection (d.p.i) with CHIKV (Ross strain) is presented as ratio of CHIKV E1 copy number per 1000 copy of cellular β-actin . Swelling of hind footpad (perimetatarsal area) of mice (n = 5/group) infected with CHIKV Ross (B) and LR-OPY1 (C) are presented as relative increase in swelling that were calculated by measuring height (thickness) and breadth (width) of inoculated footpad. (D) Representative image showing footpad swelling after infection with CHIKV mos or CHIKV vero at 6 d.p.i. (E) H E stained histological images (100X) of foot tissue at 6 d.p.i displays subcutaneous necrosis (arrow) and infiltrated leukocytes (arrowhead). CHIKV vero and CHIKV mos data were compared using student’s t test (** denotes p
    Sex Matched C57bl 6j Mice, supplied by The Jackson Laboratory, used in various techniques. Bioz Stars score: 88/100, based on 49 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sex matched c57bl 6j mice/product/The Jackson Laboratory
    Average 88 stars, based on 49 article reviews
    Price from $9.99 to $1999.99
    sex matched c57bl 6j mice - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    91
    Matreya LLC gt1b
    GD1b and <t>GT1b</t> allow BKV infection of LNCaP cells. LNCaP cells were preincubated with medium containing the gangliosides GM1, GM2, GM3, GD1a, GD1b, or GT1b or ganglioside-free medium (mock), and infected with either BKV or SV40 at an MOI of 5 ffu/cell. A total of 25 μg of protein, extracted at 5 days postinfection, was analyzed for the expression of TAg or GAPDH as a loading control. The arrow denotes a background band detected even in mock-infected cells.
    Gt1b, supplied by Matreya LLC, used in various techniques. Bioz Stars score: 91/100, based on 86 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gt1b/product/Matreya LLC
    Average 91 stars, based on 86 article reviews
    Price from $9.99 to $1999.99
    gt1b - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    91
    Abcam h3k79me2
    <t>H3K79me2</t> and its methyltransferase DOT1L are up-regulated in response to HCMV infection. A , H3K79me2 is up-regulated by 72 hpi at a multiplicity of 3.0 TCID 50 /cell. Data is presented as fold change of infected fibroblasts as compared with mock-infected cells. B , Fibroblasts were mock or HCMV infected as in ( A ) and harvested at 72 hpi. Protein from purified histones were loaded at the indicated concentrations and probed with an antibody specific for H3K79me2. As a loading control, the samples were immunoblotted with an antibody directed at total H3 protein. C , The methyltransferase, DOT1L, specific for H3K79me2 methylation, is up-regulated in response to infection. Fibroblasts were infected as in ( A ) and total RNA was isolated at the indicated time points. DOT1L levels were measured by RT-qPCR. Each sample was analyzed in triplicate and in each case, normalized to cellular GAPDH.
    H3k79me2, supplied by Abcam, used in various techniques. Bioz Stars score: 91/100, based on 400 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/h3k79me2/product/Abcam
    Average 91 stars, based on 400 article reviews
    Price from $9.99 to $1999.99
    h3k79me2 - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    99
    Qiagen rneasy kit
    <t>H3K79me2</t> and its methyltransferase DOT1L are up-regulated in response to HCMV infection. A , H3K79me2 is up-regulated by 72 hpi at a multiplicity of 3.0 TCID 50 /cell. Data is presented as fold change of infected fibroblasts as compared with mock-infected cells. B , Fibroblasts were mock or HCMV infected as in ( A ) and harvested at 72 hpi. Protein from purified histones were loaded at the indicated concentrations and probed with an antibody specific for H3K79me2. As a loading control, the samples were immunoblotted with an antibody directed at total H3 protein. C , The methyltransferase, DOT1L, specific for H3K79me2 methylation, is up-regulated in response to infection. Fibroblasts were infected as in ( A ) and total RNA was isolated at the indicated time points. DOT1L levels were measured by RT-qPCR. Each sample was analyzed in triplicate and in each case, normalized to cellular GAPDH.
    Rneasy Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 110557 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy kit/product/Qiagen
    Average 99 stars, based on 110557 article reviews
    Price from $9.99 to $1999.99
    rneasy kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    90
    Santa Cruz Biotechnology rpa194
    UL24-independent relocalization of components of the RNAPI machinery upon infection with HSV-1. (A) Confocal images of mock-, KOS-, and UL24X-infected cells stained for either UBF (top panels) or <t>RPA194</t> (bottom panels) at 18 hpi. (B) Shown are KOS-infected cells that remained untreated (left panels) or that were treated with PAA (right panels) and stained for either UBF or RPA194 at 18 hpi. Nuclei were stained with Draq 5 (blue). (C) Mock- or KOS-infected cells were costained for UBF (green) and RPA194 (red). Merged confocal images are shown in the bottom panels. Nuclei were stained with Draq 5 (blue). (D) ChIP assays on lysates from mock- or KOS-infected cells at 10 hpi using UBF or control antibodies. Input represents 1/100 of sample analyzed in ChIPs. Shown is an agarose gel of the PCR products obtained using primers detecting rDNA promoter sequences. Minus and plus signs represent negative (water) and positive (Vero cell DNA) PCR controls, respectively.
    Rpa194, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 161 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rpa194/product/Santa Cruz Biotechnology
    Average 90 stars, based on 161 article reviews
    Price from $9.99 to $1999.99
    rpa194 - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Cell membrane integrity after ISAV infection . Microscopic analysis of apoptosis with YO-PRO-1 staining. Cells were mock or ISAV infected, or treated with SS (1 μM 24 h) and stained with YO-PRO-1, Hoechst 33342 and PI, and examined under a fluorescence microscope at the indicated time points (10× magnification).

    Journal: Virology Journal

    Article Title: Analysis of host- and strain-dependent cell death responses during infectious salmon anemia virus infection in vitro

    doi: 10.1186/1743-422X-6-91

    Figure Lengend Snippet: Cell membrane integrity after ISAV infection . Microscopic analysis of apoptosis with YO-PRO-1 staining. Cells were mock or ISAV infected, or treated with SS (1 μM 24 h) and stained with YO-PRO-1, Hoechst 33342 and PI, and examined under a fluorescence microscope at the indicated time points (10× magnification).

    Article Snippet: Visualization of mitochondria Mitotracker green FM or Mitotracker Red CMXRos (Invitrogen, molecular Probes, Eugene, OR, USA) at a final concentration of 500 nM and Hoechst 33342 (membrane permeable) at a final concentration of 10 μM (Invitrogen, molecular Probes, Eugene, OR, USA) was mixed in L-15 medium without phenol red and added to ASK cells grown in chambered coverglasses (Nalge Nunc International, Roskilde, Denmark).

    Techniques: Infection, Staining, Fluorescence, Microscopy

    Fragmentation of mitochondria in ISAV infected cells . Morphology of mitochondria in ASK cells; control, infected with ISAV 4 or treated with 1 μM SS (lower panel). Cells were stained with Mitotracker and Hoechst 33342. Mitochondria of mock infected cells show an elongated, thread like morphology, while SS treated and ISAV infected cells, from day 3 p.i, show mitochondrial fragmentation. (40× magnification).

    Journal: Virology Journal

    Article Title: Analysis of host- and strain-dependent cell death responses during infectious salmon anemia virus infection in vitro

    doi: 10.1186/1743-422X-6-91

    Figure Lengend Snippet: Fragmentation of mitochondria in ISAV infected cells . Morphology of mitochondria in ASK cells; control, infected with ISAV 4 or treated with 1 μM SS (lower panel). Cells were stained with Mitotracker and Hoechst 33342. Mitochondria of mock infected cells show an elongated, thread like morphology, while SS treated and ISAV infected cells, from day 3 p.i, show mitochondrial fragmentation. (40× magnification).

    Article Snippet: Visualization of mitochondria Mitotracker green FM or Mitotracker Red CMXRos (Invitrogen, molecular Probes, Eugene, OR, USA) at a final concentration of 500 nM and Hoechst 33342 (membrane permeable) at a final concentration of 10 μM (Invitrogen, molecular Probes, Eugene, OR, USA) was mixed in L-15 medium without phenol red and added to ASK cells grown in chambered coverglasses (Nalge Nunc International, Roskilde, Denmark).

    Techniques: Infection, Staining

    hERG 1b modulation alters native I Kr . ( A ) Sample E-4031–sensitive traces representing endogenous I Kr from ( Top ) control, ( Middle ) shRNA-transfected, and ( Bottom ) PAS-infected iPSC-CMs. Pulses from −40 to 20 mV in 10-mV steps are shown.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: hERG 1b is critical for human cardiac repolarization

    doi: 10.1073/pnas.1414945111

    Figure Lengend Snippet: hERG 1b modulation alters native I Kr . ( A ) Sample E-4031–sensitive traces representing endogenous I Kr from ( Top ) control, ( Middle ) shRNA-transfected, and ( Bottom ) PAS-infected iPSC-CMs. Pulses from −40 to 20 mV in 10-mV steps are shown.

    Article Snippet: The custom shRNA construct (Sigma-Aldrich; sequence: CCACAACCACCCTGGCTTCAT) was transfected using Lipofectamine 2000 (Life Technologies).

    Techniques: shRNA, Transfection, Infection

    shRNA reduces hERG 1b expression levels. iPSC-CMs immunostained for hERG 1b (magenta) and actin (green; A ) under mock-transfected control conditions or ( B ) after transfection with 1b shRNA. ( C ) Sample linear fluorescence intensity profiles displaying

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: hERG 1b is critical for human cardiac repolarization

    doi: 10.1073/pnas.1414945111

    Figure Lengend Snippet: shRNA reduces hERG 1b expression levels. iPSC-CMs immunostained for hERG 1b (magenta) and actin (green; A ) under mock-transfected control conditions or ( B ) after transfection with 1b shRNA. ( C ) Sample linear fluorescence intensity profiles displaying

    Article Snippet: The custom shRNA construct (Sigma-Aldrich; sequence: CCACAACCACCCTGGCTTCAT) was transfected using Lipofectamine 2000 (Life Technologies).

    Techniques: shRNA, Expressing, Transfection, Fluorescence

    hERG 1b modulation prolongs iPSC-CM APD. ( A ) Typical AP recorded from iPSC-CM transfected with nontargeting shRNA control. Sample traces showing EADs from ( B ) mock-transfected control, ( C ) 1b shRNA-transfected, and ( D ) PAS-infected iPSC-CMs. The orange

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: hERG 1b is critical for human cardiac repolarization

    doi: 10.1073/pnas.1414945111

    Figure Lengend Snippet: hERG 1b modulation prolongs iPSC-CM APD. ( A ) Typical AP recorded from iPSC-CM transfected with nontargeting shRNA control. Sample traces showing EADs from ( B ) mock-transfected control, ( C ) 1b shRNA-transfected, and ( D ) PAS-infected iPSC-CMs. The orange

    Article Snippet: The custom shRNA construct (Sigma-Aldrich; sequence: CCACAACCACCCTGGCTTCAT) was transfected using Lipofectamine 2000 (Life Technologies).

    Techniques: Transfection, shRNA, Infection

    hERG 1b modulation increases APD variability. ( A ) Sample APs depicting beat-to-beat variability at 1-Hz pacing in nontargeting shRNA-transfected (Non), 1b shRNA-transfected, mock-transfected, and PAS-infected iPSC-CMs; 50 sequential APs are shown for

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: hERG 1b is critical for human cardiac repolarization

    doi: 10.1073/pnas.1414945111

    Figure Lengend Snippet: hERG 1b modulation increases APD variability. ( A ) Sample APs depicting beat-to-beat variability at 1-Hz pacing in nontargeting shRNA-transfected (Non), 1b shRNA-transfected, mock-transfected, and PAS-infected iPSC-CMs; 50 sequential APs are shown for

    Article Snippet: The custom shRNA construct (Sigma-Aldrich; sequence: CCACAACCACCCTGGCTTCAT) was transfected using Lipofectamine 2000 (Life Technologies).

    Techniques: shRNA, Transfection, Infection

    Knockdown of Mp1 in E14T ES cells resembles Nanog overexpression or growth in the presence of LIF. (A) Growth curves (left) of ES cells infected with shMp1, the negative control shGFP, or the positive control shMbd3 when grown in LDM for 3 wk. After 3 wk, colonies were stained for AP. Additional positive controls were transfection with pCAG-Nanog or addition of LIF. Knockdown of Mbd3, as measured with qPCR, is shown below the Mbd3 growth curve. (B) AP staining shows that knockdown of Mp1 in two other ES cell lines, E14/Tg2a and F1V6.5, inhibits differentiation when these cells were grown in LDM for 2 wk. Knockdown was performed using the shRNA identified from the library (shMp1-Lib) and an additional shRNA indicated by shMp1-G. Negative controls were shGFP and a shRNA containing a random sequence (shRnd1). Western blot analysis shows the knockdown levels of Mp1 in these cell lines (right). Data represent at least two independent experiments. Error bars, standard deviation. Bar, 100 µm.

    Journal: The Journal of Experimental Medicine

    Article Title: A genome-wide RNAi screen in mouse embryonic stem cells identifies Mp1 as a key mediator of differentiation

    doi: 10.1084/jem.20102037

    Figure Lengend Snippet: Knockdown of Mp1 in E14T ES cells resembles Nanog overexpression or growth in the presence of LIF. (A) Growth curves (left) of ES cells infected with shMp1, the negative control shGFP, or the positive control shMbd3 when grown in LDM for 3 wk. After 3 wk, colonies were stained for AP. Additional positive controls were transfection with pCAG-Nanog or addition of LIF. Knockdown of Mbd3, as measured with qPCR, is shown below the Mbd3 growth curve. (B) AP staining shows that knockdown of Mp1 in two other ES cell lines, E14/Tg2a and F1V6.5, inhibits differentiation when these cells were grown in LDM for 2 wk. Knockdown was performed using the shRNA identified from the library (shMp1-Lib) and an additional shRNA indicated by shMp1-G. Negative controls were shGFP and a shRNA containing a random sequence (shRnd1). Western blot analysis shows the knockdown levels of Mp1 in these cell lines (right). Data represent at least two independent experiments. Error bars, standard deviation. Bar, 100 µm.

    Article Snippet: To differentiate NCC-IT cells , which are considered equivalent to a stage intermediate between Sem and embryonal carcinoma, cells were transfected with a stealth siRNA against MP1 or a mock siRNA using Lipofectamine, or cells were infected with an shRNA against MP1 (Sigma-Aldrich) or a mock shRNA vector (SHC002; Sigma-Aldrich).

    Techniques: Over Expression, Infection, Negative Control, Positive Control, Staining, Transfection, Real-time Polymerase Chain Reaction, shRNA, Sequencing, Western Blot, Standard Deviation

    Knockdown of Mp1 inhibits differentiation and stimulates proliferation in ES cells. (A) FACS plot of E14T-Nanog-GFP reporter ES cells containing a randomly targeted Nanog promoter fragment that drives GFP expression. Reporter activity was assayed after growing the cells in LDM for 4 d after knockdown of Mp1 or after using a control shRNA containing a random sequence (shRnd1). Knockdown was performed using the shRNA identified from the library (shMp1-Lib) and an additional shRNA indicated by shMp1-G. Positive control cells were grown in the presence of LIF for 4 d. Knockdown of Mp1 was confirmed by qPCR (bottom) and Western blotting (middle right). Knockdown of Mp1 in the absence of Bmp4 maintains OCT3/4 expression (positive fraction is shown in red) while suppressing Nestin expression (positive fraction is shown in green). Positive controls were: undifferentiated ES cells and subventricular zone neural stem cells. (B) Knockdown of Mp1 gives a proliferation advantage in the absence (top) and presence (middle) of LIF in the total population of seeded cells, but also in Nanog-GFP–positive ES cells that were cultured 4 d without LIF (bottom). Error bars, standard deviation. Data represent two independent experiments.

    Journal: The Journal of Experimental Medicine

    Article Title: A genome-wide RNAi screen in mouse embryonic stem cells identifies Mp1 as a key mediator of differentiation

    doi: 10.1084/jem.20102037

    Figure Lengend Snippet: Knockdown of Mp1 inhibits differentiation and stimulates proliferation in ES cells. (A) FACS plot of E14T-Nanog-GFP reporter ES cells containing a randomly targeted Nanog promoter fragment that drives GFP expression. Reporter activity was assayed after growing the cells in LDM for 4 d after knockdown of Mp1 or after using a control shRNA containing a random sequence (shRnd1). Knockdown was performed using the shRNA identified from the library (shMp1-Lib) and an additional shRNA indicated by shMp1-G. Positive control cells were grown in the presence of LIF for 4 d. Knockdown of Mp1 was confirmed by qPCR (bottom) and Western blotting (middle right). Knockdown of Mp1 in the absence of Bmp4 maintains OCT3/4 expression (positive fraction is shown in red) while suppressing Nestin expression (positive fraction is shown in green). Positive controls were: undifferentiated ES cells and subventricular zone neural stem cells. (B) Knockdown of Mp1 gives a proliferation advantage in the absence (top) and presence (middle) of LIF in the total population of seeded cells, but also in Nanog-GFP–positive ES cells that were cultured 4 d without LIF (bottom). Error bars, standard deviation. Data represent two independent experiments.

    Article Snippet: To differentiate NCC-IT cells , which are considered equivalent to a stage intermediate between Sem and embryonal carcinoma, cells were transfected with a stealth siRNA against MP1 or a mock siRNA using Lipofectamine, or cells were infected with an shRNA against MP1 (Sigma-Aldrich) or a mock shRNA vector (SHC002; Sigma-Aldrich).

    Techniques: FACS, Expressing, Activity Assay, shRNA, Sequencing, Positive Control, Real-time Polymerase Chain Reaction, Western Blot, Cell Culture, Standard Deviation

    The Setup of CherryOFF-GFP Reporter and Its Comparison with HPRT Assay in a Known Mutagenic Context for additional information for the impact of threshold changes on analysis results. (B) HCT116 colon cancer cells carrying CherryOFF-GFP and small hairpin RNA (shRNA) targeting USP24 for USP24 KD efficiency. Representative flow diagrams of these cells show a small fraction of positive red events in the cells with NS shRNA, and a higher signal in the USP24 KD cells. (C) Quantification of the mutation frequencies of HCT116 cells with USP24 for representative images for the HPRT assay. The anticipated increase of mutation frequency in USP24 KD was detected by both assays, although the difference and significance are more obvious in the CherryOFF-GFP assay. Mean cell and colony numbers are shown (±SEM) from three independent experiments. Statistical significance was calculated by Student’s t test: *p

    Journal: Cell chemical biology

    Article Title: A Rapid and Precise Mutation-Activated Fluorescence Reporter for Analyzing Acute Mutagenesis Frequency

    doi: 10.1016/j.chembiol.2018.05.010

    Figure Lengend Snippet: The Setup of CherryOFF-GFP Reporter and Its Comparison with HPRT Assay in a Known Mutagenic Context for additional information for the impact of threshold changes on analysis results. (B) HCT116 colon cancer cells carrying CherryOFF-GFP and small hairpin RNA (shRNA) targeting USP24 for USP24 KD efficiency. Representative flow diagrams of these cells show a small fraction of positive red events in the cells with NS shRNA, and a higher signal in the USP24 KD cells. (C) Quantification of the mutation frequencies of HCT116 cells with USP24 for representative images for the HPRT assay. The anticipated increase of mutation frequency in USP24 KD was detected by both assays, although the difference and significance are more obvious in the CherryOFF-GFP assay. Mean cell and colony numbers are shown (±SEM) from three independent experiments. Statistical significance was calculated by Student’s t test: *p

    Article Snippet: Lentiviral particles were purchased from Sigma Aldrich encoding shRNA sequences against human USP24 and nonsilencing control (SHCLNV- and SHC002V).

    Techniques: shRNA, Flow Cytometry, Mutagenesis

    CherryOFF-GFP Compared with HPRT to Assess UV-Driven Mutagenesis in HCT116 Cells With or Without USP24 KD (A) Representative red-green flow diagrams of HCT116 cells carrying CherryOFF-GFP and USP24 KD or nonsilencing shRNA control, exposed to 10 or 40 J/m 2 UV radiation, or untreated. UV irradiation increased mutagenesis in both cell lines, and higher mutagenesis was seen in USP24 KD. (B) Quantification of (A). (C) HPRT assay was performed with the same conditions as CherryOFF-GFP assay as in (A). Results for 40 J/m 2 could not be reported by the HPRT assay due to high levels of cell death, which lead to no visible colonies formed by the tested HCT116 cells with or without USP24 KD, in the presence or absence of 6-HT. Further, no statistical significance could be found in control cells treated with 10 J/m 2 . Mean cell or colony numbers are shown (±SEM) from three independent experiments. Statistics: *p

    Journal: Cell chemical biology

    Article Title: A Rapid and Precise Mutation-Activated Fluorescence Reporter for Analyzing Acute Mutagenesis Frequency

    doi: 10.1016/j.chembiol.2018.05.010

    Figure Lengend Snippet: CherryOFF-GFP Compared with HPRT to Assess UV-Driven Mutagenesis in HCT116 Cells With or Without USP24 KD (A) Representative red-green flow diagrams of HCT116 cells carrying CherryOFF-GFP and USP24 KD or nonsilencing shRNA control, exposed to 10 or 40 J/m 2 UV radiation, or untreated. UV irradiation increased mutagenesis in both cell lines, and higher mutagenesis was seen in USP24 KD. (B) Quantification of (A). (C) HPRT assay was performed with the same conditions as CherryOFF-GFP assay as in (A). Results for 40 J/m 2 could not be reported by the HPRT assay due to high levels of cell death, which lead to no visible colonies formed by the tested HCT116 cells with or without USP24 KD, in the presence or absence of 6-HT. Further, no statistical significance could be found in control cells treated with 10 J/m 2 . Mean cell or colony numbers are shown (±SEM) from three independent experiments. Statistics: *p

    Article Snippet: Lentiviral particles were purchased from Sigma Aldrich encoding shRNA sequences against human USP24 and nonsilencing control (SHCLNV- and SHC002V).

    Techniques: Mutagenesis, Flow Cytometry, shRNA, Irradiation

    Tanshinol regulates expression of KLF15 gene under condition of Dex involving glucocorticoid receptor. C2C12 cells and MC3T3-E1 cells were treated with Dex and/or RU486 (RU, a direct target of glucocorticoid receptor) in the presence or absence of Tan for 12 h; mRNA expression of KLF15 gene was measured by qRT-PCR. Values are means ± SD of at least three independent experiments. ∗ P

    Journal: Oxidative Medicine and Cellular Longevity

    Article Title: Tanshinol Rescues the Impaired Bone Formation Elicited by Glucocorticoid Involved in KLF15 Pathway

    doi: 10.1155/2016/1092746

    Figure Lengend Snippet: Tanshinol regulates expression of KLF15 gene under condition of Dex involving glucocorticoid receptor. C2C12 cells and MC3T3-E1 cells were treated with Dex and/or RU486 (RU, a direct target of glucocorticoid receptor) in the presence or absence of Tan for 12 h; mRNA expression of KLF15 gene was measured by qRT-PCR. Values are means ± SD of at least three independent experiments. ∗ P

    Article Snippet: Overexpression of KLF15 could repress the relative luminescence units (RLU) of Osterix-luc but Dex showed no influence on RLU of Osterix-luc.

    Techniques: Expressing, Quantitative RT-PCR

    Tanshinol attenuates downregulation of canonical Wnt signaling elicited by Dex associated with regulation KLF15. ((a) and (b)) C2C12 cells or MC3T3-E1 cells were cotransfected with the Tcf4-luc or FoxO3a-luc reporter plasmid in combination with KLF15 siRNA or the scrambled sequence. ((c) and (d)) C2C12 cells or MC3T3-E1 cells were infected with the FoxO3a-luc or Tcf4-luc reporter plasmid in combination with recombinant adenovirus Ad-KLF15 or mock (noninfection). Luciferase activity assays were explored using the Dual-Luciferase Reporter Assay System as described under Section 2.8 in Materials and Methods. The data represent mean ± SD of luciferase relative luminescence units (RLU) normalized to corresponding renilla luciferase activity (triplicates). (e) Tcf4 (a requisite mediator for downstream effector Tcf of canonical Wnt pathway contributing to bone formation) in MC3T3-E1 cells exposed to Ad-KLF15 and mock was detected by Western blot assay. Representative figure was shown on the left panel, and quantification is shown on the right panel. Bars indicate mean ± SD of triplicate determinations. ∗ P

    Journal: Oxidative Medicine and Cellular Longevity

    Article Title: Tanshinol Rescues the Impaired Bone Formation Elicited by Glucocorticoid Involved in KLF15 Pathway

    doi: 10.1155/2016/1092746

    Figure Lengend Snippet: Tanshinol attenuates downregulation of canonical Wnt signaling elicited by Dex associated with regulation KLF15. ((a) and (b)) C2C12 cells or MC3T3-E1 cells were cotransfected with the Tcf4-luc or FoxO3a-luc reporter plasmid in combination with KLF15 siRNA or the scrambled sequence. ((c) and (d)) C2C12 cells or MC3T3-E1 cells were infected with the FoxO3a-luc or Tcf4-luc reporter plasmid in combination with recombinant adenovirus Ad-KLF15 or mock (noninfection). Luciferase activity assays were explored using the Dual-Luciferase Reporter Assay System as described under Section 2.8 in Materials and Methods. The data represent mean ± SD of luciferase relative luminescence units (RLU) normalized to corresponding renilla luciferase activity (triplicates). (e) Tcf4 (a requisite mediator for downstream effector Tcf of canonical Wnt pathway contributing to bone formation) in MC3T3-E1 cells exposed to Ad-KLF15 and mock was detected by Western blot assay. Representative figure was shown on the left panel, and quantification is shown on the right panel. Bars indicate mean ± SD of triplicate determinations. ∗ P

    Article Snippet: Overexpression of KLF15 could repress the relative luminescence units (RLU) of Osterix-luc but Dex showed no influence on RLU of Osterix-luc.

    Techniques: Plasmid Preparation, Sequencing, Infection, Recombinant, Luciferase, Activity Assay, Reporter Assay, Western Blot

    Regulation of differential genes by KLF15 and involvement of Osterix in protective effect of tanshinol on bone formation. (a) MC3T3-E1 cells were infected with recombinant adenovirus Ad-KLF15 for 4 days. mRNA expression of bone formation-related genes and KLF15 gene was measured by qRT-PCR. (b) MC3T3-E1 cells transfected with KLF15 siRNA for 18 h. mRNA expression of bone formation-related genes and KLF15 gene was measured by qRT-PCR. (c) MC3T3-E1 cells were infected with Osterix-luc reporter plasmid in combination with recombinant adenovirus Ad-KLF15 or mock (noninfection). (d) MC3T3-E1 cells were cotransfected with the Osterix-luc reporter plasmid in combination with KLF15 siRNA or the scrambled sequence. Luciferase activity assays were explored using the Dual-Luciferase Reporter Assay System as described under Section 2.8 in Materials and Methods. The data represent mean ± SD of luciferase relative luminescence units (RLU) normalized to corresponding renilla luciferase activity (triplicates). ∗ P

    Journal: Oxidative Medicine and Cellular Longevity

    Article Title: Tanshinol Rescues the Impaired Bone Formation Elicited by Glucocorticoid Involved in KLF15 Pathway

    doi: 10.1155/2016/1092746

    Figure Lengend Snippet: Regulation of differential genes by KLF15 and involvement of Osterix in protective effect of tanshinol on bone formation. (a) MC3T3-E1 cells were infected with recombinant adenovirus Ad-KLF15 for 4 days. mRNA expression of bone formation-related genes and KLF15 gene was measured by qRT-PCR. (b) MC3T3-E1 cells transfected with KLF15 siRNA for 18 h. mRNA expression of bone formation-related genes and KLF15 gene was measured by qRT-PCR. (c) MC3T3-E1 cells were infected with Osterix-luc reporter plasmid in combination with recombinant adenovirus Ad-KLF15 or mock (noninfection). (d) MC3T3-E1 cells were cotransfected with the Osterix-luc reporter plasmid in combination with KLF15 siRNA or the scrambled sequence. Luciferase activity assays were explored using the Dual-Luciferase Reporter Assay System as described under Section 2.8 in Materials and Methods. The data represent mean ± SD of luciferase relative luminescence units (RLU) normalized to corresponding renilla luciferase activity (triplicates). ∗ P

    Article Snippet: Overexpression of KLF15 could repress the relative luminescence units (RLU) of Osterix-luc but Dex showed no influence on RLU of Osterix-luc.

    Techniques: Infection, Recombinant, Expressing, Quantitative RT-PCR, Transfection, Plasmid Preparation, Sequencing, Luciferase, Activity Assay, Reporter Assay

    Tanshinol counteracts GC-induced oxidative stress and caspase-3-dependent apoptosis linked to phosphorylation of p66 Shc . MC3T3-E1 cells were transfected with KLF15 siRNA or recombinant adenovirus Ad-KLF15 in the presence or absence of Dex and/or tanshinol, and measurements were explored as follows. ((a) and (c)) ROS level indicated oxidative stress status was analyzed by DCFH-DA probe. ((b) and (d)) Cellular apoptosis was detected by caspase-3 activity. (e) Phosphorylated p66 Shc in MC3T3-E1 cells exposed to Ad-KLF15 and mock was detected by Western blot assay (left panel). Representative figure was shown on the left panel, and quantification is shown on the right panel. Bars indicate mean ± SD of triplicate determinations. ∗ P

    Journal: Oxidative Medicine and Cellular Longevity

    Article Title: Tanshinol Rescues the Impaired Bone Formation Elicited by Glucocorticoid Involved in KLF15 Pathway

    doi: 10.1155/2016/1092746

    Figure Lengend Snippet: Tanshinol counteracts GC-induced oxidative stress and caspase-3-dependent apoptosis linked to phosphorylation of p66 Shc . MC3T3-E1 cells were transfected with KLF15 siRNA or recombinant adenovirus Ad-KLF15 in the presence or absence of Dex and/or tanshinol, and measurements were explored as follows. ((a) and (c)) ROS level indicated oxidative stress status was analyzed by DCFH-DA probe. ((b) and (d)) Cellular apoptosis was detected by caspase-3 activity. (e) Phosphorylated p66 Shc in MC3T3-E1 cells exposed to Ad-KLF15 and mock was detected by Western blot assay (left panel). Representative figure was shown on the left panel, and quantification is shown on the right panel. Bars indicate mean ± SD of triplicate determinations. ∗ P

    Article Snippet: Overexpression of KLF15 could repress the relative luminescence units (RLU) of Osterix-luc but Dex showed no influence on RLU of Osterix-luc.

    Techniques: Transfection, Recombinant, Activity Assay, Western Blot

    Tanshinol protects osteoblastic differentiation against GC involved in Wnt signaling and KLF15 transcriptional factor. Rats were treated as in Figure 1 , and measurements were made as follows. (a) mRNA levels of Runx2 gene and Osterix gene which contribute to osteoblast differentiation and of Axin2 gene (an indicator of Wnt pathway) were determined by qRT-PCR assay in long bone of rats. (b) mRNA levels of KLF15 gene were detected by qRT-PCR assay in long bone of rats. (c) Expression of β -catenin protein (a key molecule of canonical Wnt signaling) in the left tibia was measured by Western blot method. Representative figure was shown on the left panel, and quantification is shown on the right panel. Data are given as mean ± SD ( n = 3). ∗ P

    Journal: Oxidative Medicine and Cellular Longevity

    Article Title: Tanshinol Rescues the Impaired Bone Formation Elicited by Glucocorticoid Involved in KLF15 Pathway

    doi: 10.1155/2016/1092746

    Figure Lengend Snippet: Tanshinol protects osteoblastic differentiation against GC involved in Wnt signaling and KLF15 transcriptional factor. Rats were treated as in Figure 1 , and measurements were made as follows. (a) mRNA levels of Runx2 gene and Osterix gene which contribute to osteoblast differentiation and of Axin2 gene (an indicator of Wnt pathway) were determined by qRT-PCR assay in long bone of rats. (b) mRNA levels of KLF15 gene were detected by qRT-PCR assay in long bone of rats. (c) Expression of β -catenin protein (a key molecule of canonical Wnt signaling) in the left tibia was measured by Western blot method. Representative figure was shown on the left panel, and quantification is shown on the right panel. Data are given as mean ± SD ( n = 3). ∗ P

    Article Snippet: Overexpression of KLF15 could repress the relative luminescence units (RLU) of Osterix-luc but Dex showed no influence on RLU of Osterix-luc.

    Techniques: Quantitative RT-PCR, Expressing, Western Blot

    Tanshinol counteracts inhibition of osteoblastic differentiation and bone formation elicited by Dex in connection with downregulation of KLF15. C2C12 cells and MC3T3-E1 cells were transfected with KLF15 siRNA for 18 h, followed by DMEM medium supplemented with Dex in the presence or absence of tanshinol for 7 days. (a) Capacity of osteoblastic differentiation in C2C12 cells was determined by using ALP staining. (b) Capacity of osteoblastic differentiation in MC3T3-E1 cells. Original magnification (×100) in representative microscopic images. (c) Effects of knockdown of KLF15 on activity of bone formation. MC3T3-E1 cells were treated with KLF15 siRNA for 18 h, followed by Dex treatment with or without tanshinol for 21 days. Mineralization activity with the indicated treatments was stained using Alizarin Red S at day 21. Original magnification (×100) in representative microscopic images (upper panel). Quantitative determination was carried out by CPC solution (pH 7.0) (lower panel). Vehicle: vehicle control (Veh). Values are means ± SD of at least three independent experiments. ∗ P

    Journal: Oxidative Medicine and Cellular Longevity

    Article Title: Tanshinol Rescues the Impaired Bone Formation Elicited by Glucocorticoid Involved in KLF15 Pathway

    doi: 10.1155/2016/1092746

    Figure Lengend Snippet: Tanshinol counteracts inhibition of osteoblastic differentiation and bone formation elicited by Dex in connection with downregulation of KLF15. C2C12 cells and MC3T3-E1 cells were transfected with KLF15 siRNA for 18 h, followed by DMEM medium supplemented with Dex in the presence or absence of tanshinol for 7 days. (a) Capacity of osteoblastic differentiation in C2C12 cells was determined by using ALP staining. (b) Capacity of osteoblastic differentiation in MC3T3-E1 cells. Original magnification (×100) in representative microscopic images. (c) Effects of knockdown of KLF15 on activity of bone formation. MC3T3-E1 cells were treated with KLF15 siRNA for 18 h, followed by Dex treatment with or without tanshinol for 21 days. Mineralization activity with the indicated treatments was stained using Alizarin Red S at day 21. Original magnification (×100) in representative microscopic images (upper panel). Quantitative determination was carried out by CPC solution (pH 7.0) (lower panel). Vehicle: vehicle control (Veh). Values are means ± SD of at least three independent experiments. ∗ P

    Article Snippet: Overexpression of KLF15 could repress the relative luminescence units (RLU) of Osterix-luc but Dex showed no influence on RLU of Osterix-luc.

    Techniques: Inhibition, Transfection, ALP Assay, Staining, Activity Assay

    A myosin Va epitope is exposed preferentially in HSV-infected cells. HeLa cells were mock infected or infected with HSV-1(F) (MOI = 5 PFU per cell). At 16 hpi the cells were washed in PBS, fixed in 3% PFA for 15 min, and permeabilized

    Journal: Journal of Virology

    Article Title: Myosin Va Enhances Secretion of Herpes Simplex Virus 1 Virions and Cell Surface Expression of Viral Glycoproteins ▿Myosin Va Enhances Secretion of Herpes Simplex Virus 1 Virions and Cell Surface Expression of Viral Glycoproteins ▿ †

    doi: 10.1128/JVI.00732-10

    Figure Lengend Snippet: A myosin Va epitope is exposed preferentially in HSV-infected cells. HeLa cells were mock infected or infected with HSV-1(F) (MOI = 5 PFU per cell). At 16 hpi the cells were washed in PBS, fixed in 3% PFA for 15 min, and permeabilized

    Article Snippet: To address this possibility, HeLa cells were either mock infected or HSV-1(F) infected and coimmunostained with the original goat polyclonal antibody to myoVa and a second polyclonal antibody made in rabbits that binds to amino acids 981 to 1070 (sc-25726; Santa Cruz Biotechnology) in the myoVa tail dimerization domain.

    Techniques: Infection

    DN-MyoVa colocalizes with TGN but not Golgi markers in HSV-infected cells. HeLa cells were transfected with mRED-DN-myoVa BRLT (left column) or MCLT (center and right columns). At 23 h posttransfection the cells were infected with HSV-1(F) at an MOI of

    Journal: Journal of Virology

    Article Title: Myosin Va Enhances Secretion of Herpes Simplex Virus 1 Virions and Cell Surface Expression of Viral Glycoproteins ▿Myosin Va Enhances Secretion of Herpes Simplex Virus 1 Virions and Cell Surface Expression of Viral Glycoproteins ▿ †

    doi: 10.1128/JVI.00732-10

    Figure Lengend Snippet: DN-MyoVa colocalizes with TGN but not Golgi markers in HSV-infected cells. HeLa cells were transfected with mRED-DN-myoVa BRLT (left column) or MCLT (center and right columns). At 23 h posttransfection the cells were infected with HSV-1(F) at an MOI of

    Article Snippet: To address this possibility, HeLa cells were either mock infected or HSV-1(F) infected and coimmunostained with the original goat polyclonal antibody to myoVa and a second polyclonal antibody made in rabbits that binds to amino acids 981 to 1070 (sc-25726; Santa Cruz Biotechnology) in the myoVa tail dimerization domain.

    Techniques: Infection, Transfection

    CHIKV mos produces lower levels of viremia and footpad swelling in mice. Wild-type C57BL/6J mice were subcutaneously infected with 1 × 10 5 PFUs of CHIKV vero , CHIKV mos or mock infected with PBS and monitored daily for 10 days. (A) Viral load in blood at day 1, 2, 4 and 6-post infection (d.p.i) with CHIKV (Ross strain) is presented as ratio of CHIKV E1 copy number per 1000 copy of cellular β-actin . Swelling of hind footpad (perimetatarsal area) of mice (n = 5/group) infected with CHIKV Ross (B) and LR-OPY1 (C) are presented as relative increase in swelling that were calculated by measuring height (thickness) and breadth (width) of inoculated footpad. (D) Representative image showing footpad swelling after infection with CHIKV mos or CHIKV vero at 6 d.p.i. (E) H E stained histological images (100X) of foot tissue at 6 d.p.i displays subcutaneous necrosis (arrow) and infiltrated leukocytes (arrowhead). CHIKV vero and CHIKV mos data were compared using student’s t test (** denotes p

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Loss of Glycosaminoglycan Receptor Binding after Mosquito Cell Passage Reduces Chikungunya Virus Infectivity

    doi: 10.1371/journal.pntd.0004139

    Figure Lengend Snippet: CHIKV mos produces lower levels of viremia and footpad swelling in mice. Wild-type C57BL/6J mice were subcutaneously infected with 1 × 10 5 PFUs of CHIKV vero , CHIKV mos or mock infected with PBS and monitored daily for 10 days. (A) Viral load in blood at day 1, 2, 4 and 6-post infection (d.p.i) with CHIKV (Ross strain) is presented as ratio of CHIKV E1 copy number per 1000 copy of cellular β-actin . Swelling of hind footpad (perimetatarsal area) of mice (n = 5/group) infected with CHIKV Ross (B) and LR-OPY1 (C) are presented as relative increase in swelling that were calculated by measuring height (thickness) and breadth (width) of inoculated footpad. (D) Representative image showing footpad swelling after infection with CHIKV mos or CHIKV vero at 6 d.p.i. (E) H E stained histological images (100X) of foot tissue at 6 d.p.i displays subcutaneous necrosis (arrow) and infiltrated leukocytes (arrowhead). CHIKV vero and CHIKV mos data were compared using student’s t test (** denotes p

    Article Snippet: To test this, we infected five-week-old, sex-matched C57BL/6J mice subcutaneously via footpad inoculations with 1 × 105 PFUs of CHIKVmos or CHIKVvero (Ross strain) or PBS as a vehicle control (mock), according to the previous reports [ – ].

    Techniques: Mouse Assay, Infection, Staining

    GD1b and GT1b allow BKV infection of LNCaP cells. LNCaP cells were preincubated with medium containing the gangliosides GM1, GM2, GM3, GD1a, GD1b, or GT1b or ganglioside-free medium (mock), and infected with either BKV or SV40 at an MOI of 5 ffu/cell. A total of 25 μg of protein, extracted at 5 days postinfection, was analyzed for the expression of TAg or GAPDH as a loading control. The arrow denotes a background band detected even in mock-infected cells.

    Journal: Journal of Virology

    Article Title: Identification of Gangliosides GD1b and GT1b as Receptors for BK Virus

    doi: 10.1128/JVI.80.3.1361-1366.2006

    Figure Lengend Snippet: GD1b and GT1b allow BKV infection of LNCaP cells. LNCaP cells were preincubated with medium containing the gangliosides GM1, GM2, GM3, GD1a, GD1b, or GT1b or ganglioside-free medium (mock), and infected with either BKV or SV40 at an MOI of 5 ffu/cell. A total of 25 μg of protein, extracted at 5 days postinfection, was analyzed for the expression of TAg or GAPDH as a loading control. The arrow denotes a background band detected even in mock-infected cells.

    Article Snippet: We therefore asked whether the addition of gangliosides GD1b and GT1b to LNCaP cells would allow infection with BKV.

    Techniques: Infection, Expressing

    H3K79me2 and its methyltransferase DOT1L are up-regulated in response to HCMV infection. A , H3K79me2 is up-regulated by 72 hpi at a multiplicity of 3.0 TCID 50 /cell. Data is presented as fold change of infected fibroblasts as compared with mock-infected cells. B , Fibroblasts were mock or HCMV infected as in ( A ) and harvested at 72 hpi. Protein from purified histones were loaded at the indicated concentrations and probed with an antibody specific for H3K79me2. As a loading control, the samples were immunoblotted with an antibody directed at total H3 protein. C , The methyltransferase, DOT1L, specific for H3K79me2 methylation, is up-regulated in response to infection. Fibroblasts were infected as in ( A ) and total RNA was isolated at the indicated time points. DOT1L levels were measured by RT-qPCR. Each sample was analyzed in triplicate and in each case, normalized to cellular GAPDH.

    Journal: Molecular & Cellular Proteomics : MCP

    Article Title: Quantitative Proteomic Discovery of Dynamic Epigenome Changes that Control Human Cytomegalovirus (HCMV) Infection *

    doi: 10.1074/mcp.M114.039792

    Figure Lengend Snippet: H3K79me2 and its methyltransferase DOT1L are up-regulated in response to HCMV infection. A , H3K79me2 is up-regulated by 72 hpi at a multiplicity of 3.0 TCID 50 /cell. Data is presented as fold change of infected fibroblasts as compared with mock-infected cells. B , Fibroblasts were mock or HCMV infected as in ( A ) and harvested at 72 hpi. Protein from purified histones were loaded at the indicated concentrations and probed with an antibody specific for H3K79me2. As a loading control, the samples were immunoblotted with an antibody directed at total H3 protein. C , The methyltransferase, DOT1L, specific for H3K79me2 methylation, is up-regulated in response to infection. Fibroblasts were infected as in ( A ) and total RNA was isolated at the indicated time points. DOT1L levels were measured by RT-qPCR. Each sample was analyzed in triplicate and in each case, normalized to cellular GAPDH.

    Article Snippet: The increase of H3K79me2 was confirmed by purifying histones from mock or HCMV-infected fibroblasts and assessing the levels of this PTM by immunoblot analysis ( B ).

    Techniques: Infection, Purification, Methylation, Isolation, Quantitative RT-PCR

    Time course of fold changes in the histone methylation flux for select histone H3 modified forms following HCMV infection. A , Illustration of the heavy methyl-SILAC (hm-SILAC) approach, where heavy methyl groups ( 13 CD 3 ) are dynamically transferred by HKMTs onto histones in cells and result in a mass shift of +4 Da from existing populations of the same modified histone form in the mass spectrum. H3K27me1K36me1 is presented as an example, where H3K27me1K36me1:0 denotes 0 heavy methylation PTMs ( i.e. both methyl groups are ‘old’), H3K27me1K36me1:1 denotes 1 heavy methylation PTM, and H3K27me1K36me1:2 denotes both methylation PTMs are newly incorporated heavy methyl groups. In the case of 1 heavy methylation PTM, the tandem MS ions must be examined to confirm if it is on H3K27 or H3K36. The corresponding mass shifts are illustrated in a mass spectrum for the z = 2+ precursor ions. In B and C , the values correspond to log2 of the average ratio of the relative PTM abundance (normalized to the sum of the abundance of all isotopically labeled states of the same modified form) of infected samples over the mock-infected samples for each time point. Error bars corresponding to ± 2 standard deviations around the average values are included for each time point. B , Temporal changes in the incorporation of ‘new’ methylation PTMs on the H3K27me3K36me2 modified form during HCMV infection relative to mock infection. C , Temporal changes in the incorporation of “new” methylation PTMs on the H3K79me1 and H3K79me2 modified forms during HCMV infection relative to mock infection.

    Journal: Molecular & Cellular Proteomics : MCP

    Article Title: Quantitative Proteomic Discovery of Dynamic Epigenome Changes that Control Human Cytomegalovirus (HCMV) Infection *

    doi: 10.1074/mcp.M114.039792

    Figure Lengend Snippet: Time course of fold changes in the histone methylation flux for select histone H3 modified forms following HCMV infection. A , Illustration of the heavy methyl-SILAC (hm-SILAC) approach, where heavy methyl groups ( 13 CD 3 ) are dynamically transferred by HKMTs onto histones in cells and result in a mass shift of +4 Da from existing populations of the same modified histone form in the mass spectrum. H3K27me1K36me1 is presented as an example, where H3K27me1K36me1:0 denotes 0 heavy methylation PTMs ( i.e. both methyl groups are ‘old’), H3K27me1K36me1:1 denotes 1 heavy methylation PTM, and H3K27me1K36me1:2 denotes both methylation PTMs are newly incorporated heavy methyl groups. In the case of 1 heavy methylation PTM, the tandem MS ions must be examined to confirm if it is on H3K27 or H3K36. The corresponding mass shifts are illustrated in a mass spectrum for the z = 2+ precursor ions. In B and C , the values correspond to log2 of the average ratio of the relative PTM abundance (normalized to the sum of the abundance of all isotopically labeled states of the same modified form) of infected samples over the mock-infected samples for each time point. Error bars corresponding to ± 2 standard deviations around the average values are included for each time point. B , Temporal changes in the incorporation of ‘new’ methylation PTMs on the H3K27me3K36me2 modified form during HCMV infection relative to mock infection. C , Temporal changes in the incorporation of “new” methylation PTMs on the H3K79me1 and H3K79me2 modified forms during HCMV infection relative to mock infection.

    Article Snippet: The increase of H3K79me2 was confirmed by purifying histones from mock or HCMV-infected fibroblasts and assessing the levels of this PTM by immunoblot analysis ( B ).

    Techniques: Methylation, Modification, Infection, Mass Spectrometry, Labeling

    HCMV and HSV-1, but not adenovirus, generate less infectious extracellular progeny in DOT1L knockdown cells. A , DOT1L expression and H3k79me2 levels are decreased in response to shRNA knockdown in fibroblasts. Two independently generated DOT1L cell populations were generated by transducing lentiviruses expressing two separate shRNA sequences targeting DOT1L (KD1 and KD2). As a control, a separate cell population was generated using a lentivirus containing a scrambled sequence (scramble). RNA from the three cell populations was collected and analyzed for DOT1L expression by RT-qPCR. Each sample was analyzed in triplicate and in each case, normalized to cellular GAPDH. Each of the knockdown cell populations as well as the scramble knockdown population were infected with either ( B ) HCMV (multiplicity of 0.01 PFU/ml) ( C ) HSV-1 (multiplicity of 0.1 PFU/ml), and ( D ) adenovirus (multiplicity of 5.0 PFU/ml) and harvested at the indicated time points.

    Journal: Molecular & Cellular Proteomics : MCP

    Article Title: Quantitative Proteomic Discovery of Dynamic Epigenome Changes that Control Human Cytomegalovirus (HCMV) Infection *

    doi: 10.1074/mcp.M114.039792

    Figure Lengend Snippet: HCMV and HSV-1, but not adenovirus, generate less infectious extracellular progeny in DOT1L knockdown cells. A , DOT1L expression and H3k79me2 levels are decreased in response to shRNA knockdown in fibroblasts. Two independently generated DOT1L cell populations were generated by transducing lentiviruses expressing two separate shRNA sequences targeting DOT1L (KD1 and KD2). As a control, a separate cell population was generated using a lentivirus containing a scrambled sequence (scramble). RNA from the three cell populations was collected and analyzed for DOT1L expression by RT-qPCR. Each sample was analyzed in triplicate and in each case, normalized to cellular GAPDH. Each of the knockdown cell populations as well as the scramble knockdown population were infected with either ( B ) HCMV (multiplicity of 0.01 PFU/ml) ( C ) HSV-1 (multiplicity of 0.1 PFU/ml), and ( D ) adenovirus (multiplicity of 5.0 PFU/ml) and harvested at the indicated time points.

    Article Snippet: The increase of H3K79me2 was confirmed by purifying histones from mock or HCMV-infected fibroblasts and assessing the levels of this PTM by immunoblot analysis ( B ).

    Techniques: Expressing, shRNA, Generated, Sequencing, Quantitative RT-PCR, Infection

    UL24-independent relocalization of components of the RNAPI machinery upon infection with HSV-1. (A) Confocal images of mock-, KOS-, and UL24X-infected cells stained for either UBF (top panels) or RPA194 (bottom panels) at 18 hpi. (B) Shown are KOS-infected cells that remained untreated (left panels) or that were treated with PAA (right panels) and stained for either UBF or RPA194 at 18 hpi. Nuclei were stained with Draq 5 (blue). (C) Mock- or KOS-infected cells were costained for UBF (green) and RPA194 (red). Merged confocal images are shown in the bottom panels. Nuclei were stained with Draq 5 (blue). (D) ChIP assays on lysates from mock- or KOS-infected cells at 10 hpi using UBF or control antibodies. Input represents 1/100 of sample analyzed in ChIPs. Shown is an agarose gel of the PCR products obtained using primers detecting rDNA promoter sequences. Minus and plus signs represent negative (water) and positive (Vero cell DNA) PCR controls, respectively.

    Journal: Journal of Virology

    Article Title: Relocalization of Upstream Binding Factor to Viral Replication Compartments Is UL24 Independent and Follows the Onset of Herpes Simplex Virus 1 DNA Synthesis ▿Relocalization of Upstream Binding Factor to Viral Replication Compartments Is UL24 Independent and Follows the Onset of Herpes Simplex Virus 1 DNA Synthesis ▿ †

    doi: 10.1128/JVI.02437-09

    Figure Lengend Snippet: UL24-independent relocalization of components of the RNAPI machinery upon infection with HSV-1. (A) Confocal images of mock-, KOS-, and UL24X-infected cells stained for either UBF (top panels) or RPA194 (bottom panels) at 18 hpi. (B) Shown are KOS-infected cells that remained untreated (left panels) or that were treated with PAA (right panels) and stained for either UBF or RPA194 at 18 hpi. Nuclei were stained with Draq 5 (blue). (C) Mock- or KOS-infected cells were costained for UBF (green) and RPA194 (red). Merged confocal images are shown in the bottom panels. Nuclei were stained with Draq 5 (blue). (D) ChIP assays on lysates from mock- or KOS-infected cells at 10 hpi using UBF or control antibodies. Input represents 1/100 of sample analyzed in ChIPs. Shown is an agarose gel of the PCR products obtained using primers detecting rDNA promoter sequences. Minus and plus signs represent negative (water) and positive (Vero cell DNA) PCR controls, respectively.

    Article Snippet: Cells were either mock infected or infected with KOS or the UL24-deficient virus UL24X , fixed at 18 hpi, and stained for UBF or RPA194 (Santa Cruz).

    Techniques: Infection, Staining, Chromatin Immunoprecipitation, Agarose Gel Electrophoresis, Polymerase Chain Reaction