liquid-chip array system Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Integrated DNA Technologies dna oligonucleotide array 5 cagcacggacaacggaacacagac 3
    Dna Oligonucleotide Array 5 Cagcacggacaacggaacacagac 3, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna oligonucleotide array 5 cagcacggacaacggaacacagac 3/product/Integrated DNA Technologies
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    dna oligonucleotide array 5 cagcacggacaacggaacacagac 3 - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    91
    Thermo Fisher genechip chromosome 21 22 1 0 array set
    Genechip Chromosome 21 22 1 0 Array Set, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genechip chromosome 21 22 1 0 array set/product/Thermo Fisher
    Average 91 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    genechip chromosome 21 22 1 0 array set - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    93
    Luminex liquid chip array system
    Liquid Chip Array System, supplied by Luminex, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/liquid chip array system/product/Luminex
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    liquid chip array system - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    90
    Ciphergen cm10 protein chip array
    Separation and identification of sB2M-9 in the supernatant of REC upon IL-1β and bacterial stimulation. ( a ) 50 ml of IL-1β-stimulated A549 culture medium for 24 h was incubated with 200 μl of cationic exchange (CM) beads. After CM extraction, the fraction was separated by RP- C18 HPLC as described in Methods section and the elution was monitored at 214 nm. The peaks containing the equivalent masses as those determined by <t>CM10/SELDI-TOF</t> are marked. Peak 15, 17 and 20 correspond to mass 7854, 8910, and 8345, respectively. ( b ) FCS-free media were collected from 24 h culture of A549 in response to non-stimulation (NS), IL-1β (1 ng/ml), MALP-2 (60 ng/ml), P(I:C) (5 μg/ml), Flagellin (50 μg/ml) and CpG ODN (100 ng/ml). Western blotting of the cationic extracts of culture medium was performed by using anti-B2M polyclonal antibodies, where B2M as a control. ( c ) Time course of sB2M-9 production was determined in A549 upon IL-1β (1 ng/ml) stimulation as compared with non-stimulation (NS). The cationic extracts of culture medium were analyzed by western blotting. ( d , e ) sB2M-9 was detected in the secretion of ( d ) A549 and ( e ) HBEC upon IL-1β (1 ng/ml), SA (1.2 × 10 4 cfu/ml), and KP (1.2 × 10 4 cfu/ml) treatment.
    Cm10 Protein Chip Array, supplied by Ciphergen, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cm10 protein chip array/product/Ciphergen
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    cm10 protein chip array - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    85
    Agilent technologies hplc chip protein column
    Separation and identification of sB2M-9 in the supernatant of REC upon IL-1β and bacterial stimulation. ( a ) 50 ml of IL-1β-stimulated A549 culture medium for 24 h was incubated with 200 μl of cationic exchange (CM) beads. After CM extraction, the fraction was separated by RP- C18 HPLC as described in Methods section and the elution was monitored at 214 nm. The peaks containing the equivalent masses as those determined by <t>CM10/SELDI-TOF</t> are marked. Peak 15, 17 and 20 correspond to mass 7854, 8910, and 8345, respectively. ( b ) FCS-free media were collected from 24 h culture of A549 in response to non-stimulation (NS), IL-1β (1 ng/ml), MALP-2 (60 ng/ml), P(I:C) (5 μg/ml), Flagellin (50 μg/ml) and CpG ODN (100 ng/ml). Western blotting of the cationic extracts of culture medium was performed by using anti-B2M polyclonal antibodies, where B2M as a control. ( c ) Time course of sB2M-9 production was determined in A549 upon IL-1β (1 ng/ml) stimulation as compared with non-stimulation (NS). The cationic extracts of culture medium were analyzed by western blotting. ( d , e ) sB2M-9 was detected in the secretion of ( d ) A549 and ( e ) HBEC upon IL-1β (1 ng/ml), SA (1.2 × 10 4 cfu/ml), and KP (1.2 × 10 4 cfu/ml) treatment.
    Hplc Chip Protein Column, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hplc chip protein column/product/Agilent technologies
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    hplc chip protein column - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    88
    Ciphergen reagents wcx2 protein chip
    Separation and identification of sB2M-9 in the supernatant of REC upon IL-1β and bacterial stimulation. ( a ) 50 ml of IL-1β-stimulated A549 culture medium for 24 h was incubated with 200 μl of cationic exchange (CM) beads. After CM extraction, the fraction was separated by RP- C18 HPLC as described in Methods section and the elution was monitored at 214 nm. The peaks containing the equivalent masses as those determined by <t>CM10/SELDI-TOF</t> are marked. Peak 15, 17 and 20 correspond to mass 7854, 8910, and 8345, respectively. ( b ) FCS-free media were collected from 24 h culture of A549 in response to non-stimulation (NS), IL-1β (1 ng/ml), MALP-2 (60 ng/ml), P(I:C) (5 μg/ml), Flagellin (50 μg/ml) and CpG ODN (100 ng/ml). Western blotting of the cationic extracts of culture medium was performed by using anti-B2M polyclonal antibodies, where B2M as a control. ( c ) Time course of sB2M-9 production was determined in A549 upon IL-1β (1 ng/ml) stimulation as compared with non-stimulation (NS). The cationic extracts of culture medium were analyzed by western blotting. ( d , e ) sB2M-9 was detected in the secretion of ( d ) A549 and ( e ) HBEC upon IL-1β (1 ng/ml), SA (1.2 × 10 4 cfu/ml), and KP (1.2 × 10 4 cfu/ml) treatment.
    Reagents Wcx2 Protein Chip, supplied by Ciphergen, used in various techniques. Bioz Stars score: 88/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reagents wcx2 protein chip/product/Ciphergen
    Average 88 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    reagents wcx2 protein chip - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    85
    Thermo Fisher yeast 2 0 gene chip
    Separation and identification of sB2M-9 in the supernatant of REC upon IL-1β and bacterial stimulation. ( a ) 50 ml of IL-1β-stimulated A549 culture medium for 24 h was incubated with 200 μl of cationic exchange (CM) beads. After CM extraction, the fraction was separated by RP- C18 HPLC as described in Methods section and the elution was monitored at 214 nm. The peaks containing the equivalent masses as those determined by <t>CM10/SELDI-TOF</t> are marked. Peak 15, 17 and 20 correspond to mass 7854, 8910, and 8345, respectively. ( b ) FCS-free media were collected from 24 h culture of A549 in response to non-stimulation (NS), IL-1β (1 ng/ml), MALP-2 (60 ng/ml), P(I:C) (5 μg/ml), Flagellin (50 μg/ml) and CpG ODN (100 ng/ml). Western blotting of the cationic extracts of culture medium was performed by using anti-B2M polyclonal antibodies, where B2M as a control. ( c ) Time course of sB2M-9 production was determined in A549 upon IL-1β (1 ng/ml) stimulation as compared with non-stimulation (NS). The cationic extracts of culture medium were analyzed by western blotting. ( d , e ) sB2M-9 was detected in the secretion of ( d ) A549 and ( e ) HBEC upon IL-1β (1 ng/ml), SA (1.2 × 10 4 cfu/ml), and KP (1.2 × 10 4 cfu/ml) treatment.
    Yeast 2 0 Gene Chip, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/yeast 2 0 gene chip/product/Thermo Fisher
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    yeast 2 0 gene chip - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    85
    Thermo Fisher liquid protein microarray detection system
    Separation and identification of sB2M-9 in the supernatant of REC upon IL-1β and bacterial stimulation. ( a ) 50 ml of IL-1β-stimulated A549 culture medium for 24 h was incubated with 200 μl of cationic exchange (CM) beads. After CM extraction, the fraction was separated by RP- C18 HPLC as described in Methods section and the elution was monitored at 214 nm. The peaks containing the equivalent masses as those determined by <t>CM10/SELDI-TOF</t> are marked. Peak 15, 17 and 20 correspond to mass 7854, 8910, and 8345, respectively. ( b ) FCS-free media were collected from 24 h culture of A549 in response to non-stimulation (NS), IL-1β (1 ng/ml), MALP-2 (60 ng/ml), P(I:C) (5 μg/ml), Flagellin (50 μg/ml) and CpG ODN (100 ng/ml). Western blotting of the cationic extracts of culture medium was performed by using anti-B2M polyclonal antibodies, where B2M as a control. ( c ) Time course of sB2M-9 production was determined in A549 upon IL-1β (1 ng/ml) stimulation as compared with non-stimulation (NS). The cationic extracts of culture medium were analyzed by western blotting. ( d , e ) sB2M-9 was detected in the secretion of ( d ) A549 and ( e ) HBEC upon IL-1β (1 ng/ml), SA (1.2 × 10 4 cfu/ml), and KP (1.2 × 10 4 cfu/ml) treatment.
    Liquid Protein Microarray Detection System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/liquid protein microarray detection system/product/Thermo Fisher
    Average 85 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    liquid protein microarray detection system - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    91
    Agilent technologies yeast dna microarray systems
    Separation and identification of sB2M-9 in the supernatant of REC upon IL-1β and bacterial stimulation. ( a ) 50 ml of IL-1β-stimulated A549 culture medium for 24 h was incubated with 200 μl of cationic exchange (CM) beads. After CM extraction, the fraction was separated by RP- C18 HPLC as described in Methods section and the elution was monitored at 214 nm. The peaks containing the equivalent masses as those determined by <t>CM10/SELDI-TOF</t> are marked. Peak 15, 17 and 20 correspond to mass 7854, 8910, and 8345, respectively. ( b ) FCS-free media were collected from 24 h culture of A549 in response to non-stimulation (NS), IL-1β (1 ng/ml), MALP-2 (60 ng/ml), P(I:C) (5 μg/ml), Flagellin (50 μg/ml) and CpG ODN (100 ng/ml). Western blotting of the cationic extracts of culture medium was performed by using anti-B2M polyclonal antibodies, where B2M as a control. ( c ) Time course of sB2M-9 production was determined in A549 upon IL-1β (1 ng/ml) stimulation as compared with non-stimulation (NS). The cationic extracts of culture medium were analyzed by western blotting. ( d , e ) sB2M-9 was detected in the secretion of ( d ) A549 and ( e ) HBEC upon IL-1β (1 ng/ml), SA (1.2 × 10 4 cfu/ml), and KP (1.2 × 10 4 cfu/ml) treatment.
    Yeast Dna Microarray Systems, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 91/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/yeast dna microarray systems/product/Agilent technologies
    Average 91 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    yeast dna microarray systems - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    92
    Luminex liquid protein microarray analysis system
    Separation and identification of sB2M-9 in the supernatant of REC upon IL-1β and bacterial stimulation. ( a ) 50 ml of IL-1β-stimulated A549 culture medium for 24 h was incubated with 200 μl of cationic exchange (CM) beads. After CM extraction, the fraction was separated by RP- C18 HPLC as described in Methods section and the elution was monitored at 214 nm. The peaks containing the equivalent masses as those determined by <t>CM10/SELDI-TOF</t> are marked. Peak 15, 17 and 20 correspond to mass 7854, 8910, and 8345, respectively. ( b ) FCS-free media were collected from 24 h culture of A549 in response to non-stimulation (NS), IL-1β (1 ng/ml), MALP-2 (60 ng/ml), P(I:C) (5 μg/ml), Flagellin (50 μg/ml) and CpG ODN (100 ng/ml). Western blotting of the cationic extracts of culture medium was performed by using anti-B2M polyclonal antibodies, where B2M as a control. ( c ) Time course of sB2M-9 production was determined in A549 upon IL-1β (1 ng/ml) stimulation as compared with non-stimulation (NS). The cationic extracts of culture medium were analyzed by western blotting. ( d , e ) sB2M-9 was detected in the secretion of ( d ) A549 and ( e ) HBEC upon IL-1β (1 ng/ml), SA (1.2 × 10 4 cfu/ml), and KP (1.2 × 10 4 cfu/ml) treatment.
    Liquid Protein Microarray Analysis System, supplied by Luminex, used in various techniques. Bioz Stars score: 92/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/liquid protein microarray analysis system/product/Luminex
    Average 92 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    liquid protein microarray analysis system - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    92
    Illumina Inc dna microarray
    Separation and identification of sB2M-9 in the supernatant of REC upon IL-1β and bacterial stimulation. ( a ) 50 ml of IL-1β-stimulated A549 culture medium for 24 h was incubated with 200 μl of cationic exchange (CM) beads. After CM extraction, the fraction was separated by RP- C18 HPLC as described in Methods section and the elution was monitored at 214 nm. The peaks containing the equivalent masses as those determined by <t>CM10/SELDI-TOF</t> are marked. Peak 15, 17 and 20 correspond to mass 7854, 8910, and 8345, respectively. ( b ) FCS-free media were collected from 24 h culture of A549 in response to non-stimulation (NS), IL-1β (1 ng/ml), MALP-2 (60 ng/ml), P(I:C) (5 μg/ml), Flagellin (50 μg/ml) and CpG ODN (100 ng/ml). Western blotting of the cationic extracts of culture medium was performed by using anti-B2M polyclonal antibodies, where B2M as a control. ( c ) Time course of sB2M-9 production was determined in A549 upon IL-1β (1 ng/ml) stimulation as compared with non-stimulation (NS). The cationic extracts of culture medium were analyzed by western blotting. ( d , e ) sB2M-9 was detected in the secretion of ( d ) A549 and ( e ) HBEC upon IL-1β (1 ng/ml), SA (1.2 × 10 4 cfu/ml), and KP (1.2 × 10 4 cfu/ml) treatment.
    Dna Microarray, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 93 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna microarray/product/Illumina Inc
    Average 92 stars, based on 93 article reviews
    Price from $9.99 to $1999.99
    dna microarray - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    85
    Ciphergen pbs2 seldi mass spectrometer
    Separation and identification of sB2M-9 in the supernatant of REC upon IL-1β and bacterial stimulation. ( a ) 50 ml of IL-1β-stimulated A549 culture medium for 24 h was incubated with 200 μl of cationic exchange (CM) beads. After CM extraction, the fraction was separated by RP- C18 HPLC as described in Methods section and the elution was monitored at 214 nm. The peaks containing the equivalent masses as those determined by <t>CM10/SELDI-TOF</t> are marked. Peak 15, 17 and 20 correspond to mass 7854, 8910, and 8345, respectively. ( b ) FCS-free media were collected from 24 h culture of A549 in response to non-stimulation (NS), IL-1β (1 ng/ml), MALP-2 (60 ng/ml), P(I:C) (5 μg/ml), Flagellin (50 μg/ml) and CpG ODN (100 ng/ml). Western blotting of the cationic extracts of culture medium was performed by using anti-B2M polyclonal antibodies, where B2M as a control. ( c ) Time course of sB2M-9 production was determined in A549 upon IL-1β (1 ng/ml) stimulation as compared with non-stimulation (NS). The cationic extracts of culture medium were analyzed by western blotting. ( d , e ) sB2M-9 was detected in the secretion of ( d ) A549 and ( e ) HBEC upon IL-1β (1 ng/ml), SA (1.2 × 10 4 cfu/ml), and KP (1.2 × 10 4 cfu/ml) treatment.
    Pbs2 Seldi Mass Spectrometer, supplied by Ciphergen, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pbs2 seldi mass spectrometer/product/Ciphergen
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    pbs2 seldi mass spectrometer - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    94
    Abcam anti hmga1 antibody
    HMGA proteins regulate NAMPT expression. a , ChIP analysis for the enhancer of NAMPT gene identified by <t>HMGA1</t> ChIP-seq using the indicated antibodies or an isotype matched IgG control during OIS (n = 3 independent experiments). b , c , HMGA1 in fully established senescent cells was knocked down using two independent short hairpin RNAs (shRNAs). Expression of NAMPT mRNA was determined by qRT-PCR ( b ) (n = 3 independent experiments), or the indicated proteins were determined by immunoblot ( c ). d, In established senescent cells, HMGA2 was knocked down using two independent shRNAs and expression of the indicated proteins was determined by immunoblot. e , ChIP analysis for the enhancer of NAMPT gene identified by HMGA1 ChIP-seq using an anti-HMGA2 antibody or an isotype matched IgG control during OIS (n = 3 independent experiments). f , g , Cells with or without ectopic V5-tagged HMGA1 expression with or without NAMPT knockdown were examined for the expression of the indicated proteins by immunoblot ( f ), or subjected to SA-β-gal staining or colony formation ( g ), scale bar = 100 μm. The percentage of SA-β-gal positive cells ( h ) and the integrated intensity of the colonies formed by the indicated cells ( i ) were quantified using NIH Image J software (n = 3 independent experiments). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .
    Anti Hmga1 Antibody, supplied by Abcam, used in various techniques. Bioz Stars score: 94/100, based on 134 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti hmga1 antibody/product/Abcam
    Average 94 stars, based on 134 article reviews
    Price from $9.99 to $1999.99
    anti hmga1 antibody - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    99
    Abcam rabbit monoclonal anti hmga1
    HMGA proteins regulate NAMPT expression. a , ChIP analysis for the enhancer of NAMPT gene identified by <t>HMGA1</t> ChIP-seq using the indicated antibodies or an isotype matched IgG control during OIS (n = 3 independent experiments). b , c , HMGA1 in fully established senescent cells was knocked down using two independent short hairpin RNAs (shRNAs). Expression of NAMPT mRNA was determined by qRT-PCR ( b ) (n = 3 independent experiments), or the indicated proteins were determined by immunoblot ( c ). d, In established senescent cells, HMGA2 was knocked down using two independent shRNAs and expression of the indicated proteins was determined by immunoblot. e , ChIP analysis for the enhancer of NAMPT gene identified by HMGA1 ChIP-seq using an anti-HMGA2 antibody or an isotype matched IgG control during OIS (n = 3 independent experiments). f , g , Cells with or without ectopic V5-tagged HMGA1 expression with or without NAMPT knockdown were examined for the expression of the indicated proteins by immunoblot ( f ), or subjected to SA-β-gal staining or colony formation ( g ), scale bar = 100 μm. The percentage of SA-β-gal positive cells ( h ) and the integrated intensity of the colonies formed by the indicated cells ( i ) were quantified using NIH Image J software (n = 3 independent experiments). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .
    Rabbit Monoclonal Anti Hmga1, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit monoclonal anti hmga1/product/Abcam
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    rabbit monoclonal anti hmga1 - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    92
    Thermo Fisher •human cot1 dna
    Principle of array-CGH. Genomic <t>DNA</t> from two cell populations is differentially labeled and hybridized to a microarray in the presence of <t>Cot1</t> DNA to suppress repeat sequences. The fluorescent ratios on each array spot are calculated and normalized so
    •Human Cot1 Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/•human cot1 dna/product/Thermo Fisher
    Average 92 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    •human cot1 dna - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    99
    Thermo Fisher human cot 1 dna
    Principle of array-CGH. Genomic <t>DNA</t> from two cell populations is differentially labeled and hybridized to a microarray in the presence of <t>Cot1</t> DNA to suppress repeat sequences. The fluorescent ratios on each array spot are calculated and normalized so
    Human Cot 1 Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2644 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human cot 1 dna/product/Thermo Fisher
    Average 99 stars, based on 2644 article reviews
    Price from $9.99 to $1999.99
    human cot 1 dna - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    Separation and identification of sB2M-9 in the supernatant of REC upon IL-1β and bacterial stimulation. ( a ) 50 ml of IL-1β-stimulated A549 culture medium for 24 h was incubated with 200 μl of cationic exchange (CM) beads. After CM extraction, the fraction was separated by RP- C18 HPLC as described in Methods section and the elution was monitored at 214 nm. The peaks containing the equivalent masses as those determined by CM10/SELDI-TOF are marked. Peak 15, 17 and 20 correspond to mass 7854, 8910, and 8345, respectively. ( b ) FCS-free media were collected from 24 h culture of A549 in response to non-stimulation (NS), IL-1β (1 ng/ml), MALP-2 (60 ng/ml), P(I:C) (5 μg/ml), Flagellin (50 μg/ml) and CpG ODN (100 ng/ml). Western blotting of the cationic extracts of culture medium was performed by using anti-B2M polyclonal antibodies, where B2M as a control. ( c ) Time course of sB2M-9 production was determined in A549 upon IL-1β (1 ng/ml) stimulation as compared with non-stimulation (NS). The cationic extracts of culture medium were analyzed by western blotting. ( d , e ) sB2M-9 was detected in the secretion of ( d ) A549 and ( e ) HBEC upon IL-1β (1 ng/ml), SA (1.2 × 10 4 cfu/ml), and KP (1.2 × 10 4 cfu/ml) treatment.

    Journal: Scientific Reports

    Article Title: A novel role for β2-microglobulin: a precursor of antibacterial chemokine in respiratory epithelial cells

    doi: 10.1038/srep31035

    Figure Lengend Snippet: Separation and identification of sB2M-9 in the supernatant of REC upon IL-1β and bacterial stimulation. ( a ) 50 ml of IL-1β-stimulated A549 culture medium for 24 h was incubated with 200 μl of cationic exchange (CM) beads. After CM extraction, the fraction was separated by RP- C18 HPLC as described in Methods section and the elution was monitored at 214 nm. The peaks containing the equivalent masses as those determined by CM10/SELDI-TOF are marked. Peak 15, 17 and 20 correspond to mass 7854, 8910, and 8345, respectively. ( b ) FCS-free media were collected from 24 h culture of A549 in response to non-stimulation (NS), IL-1β (1 ng/ml), MALP-2 (60 ng/ml), P(I:C) (5 μg/ml), Flagellin (50 μg/ml) and CpG ODN (100 ng/ml). Western blotting of the cationic extracts of culture medium was performed by using anti-B2M polyclonal antibodies, where B2M as a control. ( c ) Time course of sB2M-9 production was determined in A549 upon IL-1β (1 ng/ml) stimulation as compared with non-stimulation (NS). The cationic extracts of culture medium were analyzed by western blotting. ( d , e ) sB2M-9 was detected in the secretion of ( d ) A549 and ( e ) HBEC upon IL-1β (1 ng/ml), SA (1.2 × 10 4 cfu/ml), and KP (1.2 × 10 4 cfu/ml) treatment.

    Article Snippet: CM10 Protein Chip Array (Ciphergen) was used to screen the culture medium of REC upon IL-1β activations.

    Techniques: Incubation, High Performance Liquid Chromatography, Western Blot

    HMGA proteins regulate NAMPT expression. a , ChIP analysis for the enhancer of NAMPT gene identified by HMGA1 ChIP-seq using the indicated antibodies or an isotype matched IgG control during OIS (n = 3 independent experiments). b , c , HMGA1 in fully established senescent cells was knocked down using two independent short hairpin RNAs (shRNAs). Expression of NAMPT mRNA was determined by qRT-PCR ( b ) (n = 3 independent experiments), or the indicated proteins were determined by immunoblot ( c ). d, In established senescent cells, HMGA2 was knocked down using two independent shRNAs and expression of the indicated proteins was determined by immunoblot. e , ChIP analysis for the enhancer of NAMPT gene identified by HMGA1 ChIP-seq using an anti-HMGA2 antibody or an isotype matched IgG control during OIS (n = 3 independent experiments). f , g , Cells with or without ectopic V5-tagged HMGA1 expression with or without NAMPT knockdown were examined for the expression of the indicated proteins by immunoblot ( f ), or subjected to SA-β-gal staining or colony formation ( g ), scale bar = 100 μm. The percentage of SA-β-gal positive cells ( h ) and the integrated intensity of the colonies formed by the indicated cells ( i ) were quantified using NIH Image J software (n = 3 independent experiments). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Journal: Nature cell biology

    Article Title: NAD+ metabolism governs the proinflammatory senescence-associated secretome

    doi: 10.1038/s41556-019-0287-4

    Figure Lengend Snippet: HMGA proteins regulate NAMPT expression. a , ChIP analysis for the enhancer of NAMPT gene identified by HMGA1 ChIP-seq using the indicated antibodies or an isotype matched IgG control during OIS (n = 3 independent experiments). b , c , HMGA1 in fully established senescent cells was knocked down using two independent short hairpin RNAs (shRNAs). Expression of NAMPT mRNA was determined by qRT-PCR ( b ) (n = 3 independent experiments), or the indicated proteins were determined by immunoblot ( c ). d, In established senescent cells, HMGA2 was knocked down using two independent shRNAs and expression of the indicated proteins was determined by immunoblot. e , ChIP analysis for the enhancer of NAMPT gene identified by HMGA1 ChIP-seq using an anti-HMGA2 antibody or an isotype matched IgG control during OIS (n = 3 independent experiments). f , g , Cells with or without ectopic V5-tagged HMGA1 expression with or without NAMPT knockdown were examined for the expression of the indicated proteins by immunoblot ( f ), or subjected to SA-β-gal staining or colony formation ( g ), scale bar = 100 μm. The percentage of SA-β-gal positive cells ( h ) and the integrated intensity of the colonies formed by the indicated cells ( i ) were quantified using NIH Image J software (n = 3 independent experiments). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Article Snippet: Established senescent IMR90 cells induced by oncogenic RAS were prepared for ChIP-seq using 5 μL of anti-HMGA1 antibody (Abcam, Cat. No. 129153) or anti-HMGA2 (Abcam, Cat. No. 97276).

    Techniques: Expressing, Chromatin Immunoprecipitation, Quantitative RT-PCR, Staining, Software, Two Tailed Test, Marker

    NMN enhances the inflammatory environment and cancer progression in vivo . a , In established senescent cells, HMGA1 or NAMPT were knocked down or cells were treated with FK866 to assess the effect on the growth of co-cultured luciferase-expressing TOV21G ovarian cancer cells. Cell growth was assessed by luminescence following eight days of growth. (n=3 independent experiments). b - n , Wildtype mice were compared to KC mice treated with vehicle, NMN (500 mg/kg daily), or FK866 (25 mg/kg daily). Representative H E images of pancreas ( b ) and quantification of percent acinar area ( c ). Representative Masson trichrome staining images of pancreas ( d ) and quantification of percent trichrome area ( e ). Expression of IL1β, IL-6 and IL-8 was determined using qRT-PCR analysis ( f ). Representative immunohistochemical staining of infiltrating F4/80-positive immune cells ( g ) and quantification of percent F4/80 positive cells ( h ). Representative immunohistochemical staining of infiltrating CD3-positive immune cells ( i ) and quantification of the number of CD3 positive cells/field ( j ). Representative SA-β-gal staining ( k ) and quantification of SA-β-gal positive areas ( l ) in the indicated treatment groups. Expression of p16 ( m ) and p21 ( n ) was determined using qRT-PCR analysis. n=10 mice/group unless otherwise stated. Scale bar for all images is 200 μm. o , Immunoblot of the indicated protein in TOV21G cells containing doxycycline-inducible knockdown of NAMPT with or without doxycycline treatment. p , TOV21G and oncogene-induced senescent IMR90 cells were subcutaneously co-injected into the right dorsal flank of 6-8 week old NSG female mice. The mice (n=9 mice/group) were treated with vehicle control, NAM (500 mg/kg; intraperitoneal injection; every other days) for 17 days. Tumor growth in the indicated treatment groups was measured at the indicated time points. All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Journal: Nature cell biology

    Article Title: NAD+ metabolism governs the proinflammatory senescence-associated secretome

    doi: 10.1038/s41556-019-0287-4

    Figure Lengend Snippet: NMN enhances the inflammatory environment and cancer progression in vivo . a , In established senescent cells, HMGA1 or NAMPT were knocked down or cells were treated with FK866 to assess the effect on the growth of co-cultured luciferase-expressing TOV21G ovarian cancer cells. Cell growth was assessed by luminescence following eight days of growth. (n=3 independent experiments). b - n , Wildtype mice were compared to KC mice treated with vehicle, NMN (500 mg/kg daily), or FK866 (25 mg/kg daily). Representative H E images of pancreas ( b ) and quantification of percent acinar area ( c ). Representative Masson trichrome staining images of pancreas ( d ) and quantification of percent trichrome area ( e ). Expression of IL1β, IL-6 and IL-8 was determined using qRT-PCR analysis ( f ). Representative immunohistochemical staining of infiltrating F4/80-positive immune cells ( g ) and quantification of percent F4/80 positive cells ( h ). Representative immunohistochemical staining of infiltrating CD3-positive immune cells ( i ) and quantification of the number of CD3 positive cells/field ( j ). Representative SA-β-gal staining ( k ) and quantification of SA-β-gal positive areas ( l ) in the indicated treatment groups. Expression of p16 ( m ) and p21 ( n ) was determined using qRT-PCR analysis. n=10 mice/group unless otherwise stated. Scale bar for all images is 200 μm. o , Immunoblot of the indicated protein in TOV21G cells containing doxycycline-inducible knockdown of NAMPT with or without doxycycline treatment. p , TOV21G and oncogene-induced senescent IMR90 cells were subcutaneously co-injected into the right dorsal flank of 6-8 week old NSG female mice. The mice (n=9 mice/group) were treated with vehicle control, NAM (500 mg/kg; intraperitoneal injection; every other days) for 17 days. Tumor growth in the indicated treatment groups was measured at the indicated time points. All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Article Snippet: Established senescent IMR90 cells induced by oncogenic RAS were prepared for ChIP-seq using 5 μL of anti-HMGA1 antibody (Abcam, Cat. No. 129153) or anti-HMGA2 (Abcam, Cat. No. 97276).

    Techniques: In Vivo, Cell Culture, Luciferase, Expressing, Mouse Assay, Staining, Quantitative RT-PCR, Immunohistochemistry, Injection, Two Tailed Test, Marker

    AMPK signaling mediates proinflammatory SASP induced by NAD + metabolism. a-c , In established senescent cells, HMGA1 or NAMPT was knocked down using the indicated shRNAs. Under these conditions, cells were treated with NMN and the ADP/ATP ratio ( a ) and expression of the indicated proteins by immunoblot in the indicated HMGA1 knockdown ( b ) or NAMPT knockdown ( c ) cells were determined (n = 3 independent experiments). d - f , In established senescent cells, HMGA1 ( d ) or NAMPT ( e ) was knocked down using the indicated shRNAs or treated with FK866 ( f ). Under these conditions, cells were treated with Compound C (CC, 50 nM), an AMPK inhibitor. Expression of the indicated SASP genes was determined using qRT-PCR (n = 3 independent experiments). ( g ) In established senescent cells, HMGA1 or NAMPT was knocked down using the indicated shRNAs or treated with FK866. Under these conditions, cells were treated with NMN and NFκB reporter activity was determined (n = 3 independent experiments). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Journal: Nature cell biology

    Article Title: NAD+ metabolism governs the proinflammatory senescence-associated secretome

    doi: 10.1038/s41556-019-0287-4

    Figure Lengend Snippet: AMPK signaling mediates proinflammatory SASP induced by NAD + metabolism. a-c , In established senescent cells, HMGA1 or NAMPT was knocked down using the indicated shRNAs. Under these conditions, cells were treated with NMN and the ADP/ATP ratio ( a ) and expression of the indicated proteins by immunoblot in the indicated HMGA1 knockdown ( b ) or NAMPT knockdown ( c ) cells were determined (n = 3 independent experiments). d - f , In established senescent cells, HMGA1 ( d ) or NAMPT ( e ) was knocked down using the indicated shRNAs or treated with FK866 ( f ). Under these conditions, cells were treated with Compound C (CC, 50 nM), an AMPK inhibitor. Expression of the indicated SASP genes was determined using qRT-PCR (n = 3 independent experiments). ( g ) In established senescent cells, HMGA1 or NAMPT was knocked down using the indicated shRNAs or treated with FK866. Under these conditions, cells were treated with NMN and NFκB reporter activity was determined (n = 3 independent experiments). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Article Snippet: Established senescent IMR90 cells induced by oncogenic RAS were prepared for ChIP-seq using 5 μL of anti-HMGA1 antibody (Abcam, Cat. No. 129153) or anti-HMGA2 (Abcam, Cat. No. 97276).

    Techniques: Expressing, Quantitative RT-PCR, Activity Assay, Two Tailed Test, Marker

    NAD + metabolism drives proinflammatory SASP. a - c , In established senescent cells, HMGA1 or NAMPT were knocked down using the indicated short hairpin RNAs. The NAMPT activity was also inhibited by FK866. Steady-state metabolite levels were measured by LC-MS/MS. Heat map indicates fold change in comparison to the control condition ( a ) (n=6 independent experiments). NMN ( b ) (n=6 independent experiments) and NAD + /NADH ratio ( c ) were determined in the indicated cells. d , Cells were induced to senesce by oncogenic RAS and analyzed for the NAD + /NADH ratio at the indicated time points. e , Cells with or without ectopic V5-tagged HMGA1 expression with or without NAMPT knockdown were examined for the NAD + /NADH ratio. f , The NAD + /NADH ratio was determined in established senescent cells with or without HMGA1 knockdown with or without ectopic expression of a FLAG-tagged wild type or catalytically-inactive NAMPT. g , h , In established senescence, HMGA1 or NAMPT were knocked down using the indicated shRNAs. The NAMPT activity was also inhibited by FK866. Under these conditions, cells were treated with NMN and the NAD + /NADH ratio ( g ) and expression of the indicated SASP genes ( h ) were determined by qRT-PCR. i - k , Cells from the conditions as in (a) were incubated for 6 hours in the presence of 13 C 6 -glucose and intracellular metabolites were extracted for analysis by LC-MS to evaluate glycolytic flux in the form of pyruvate ( i ) and lactate ( j ) and mitochondrial respiration rates as indicated by citrate production ( k ). Data were normalized based on protein concentration. l , Cells from conditions as in (a) were incubated with a fluorescent glucose analog (2-NBDG) and analyzed by flow cytometry for glucose uptake. m , n , Cells from the conditions in (g) were analyzed using Seahorse Bioanalyzer XF e 96 for extracellular acidification (ECAR) ( m ) and oxygen consumption (OCR) ( n ). Data were normalized based on protein concentration. n = 3 independent experiments unless otherwise stated. All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 .

    Journal: Nature cell biology

    Article Title: NAD+ metabolism governs the proinflammatory senescence-associated secretome

    doi: 10.1038/s41556-019-0287-4

    Figure Lengend Snippet: NAD + metabolism drives proinflammatory SASP. a - c , In established senescent cells, HMGA1 or NAMPT were knocked down using the indicated short hairpin RNAs. The NAMPT activity was also inhibited by FK866. Steady-state metabolite levels were measured by LC-MS/MS. Heat map indicates fold change in comparison to the control condition ( a ) (n=6 independent experiments). NMN ( b ) (n=6 independent experiments) and NAD + /NADH ratio ( c ) were determined in the indicated cells. d , Cells were induced to senesce by oncogenic RAS and analyzed for the NAD + /NADH ratio at the indicated time points. e , Cells with or without ectopic V5-tagged HMGA1 expression with or without NAMPT knockdown were examined for the NAD + /NADH ratio. f , The NAD + /NADH ratio was determined in established senescent cells with or without HMGA1 knockdown with or without ectopic expression of a FLAG-tagged wild type or catalytically-inactive NAMPT. g , h , In established senescence, HMGA1 or NAMPT were knocked down using the indicated shRNAs. The NAMPT activity was also inhibited by FK866. Under these conditions, cells were treated with NMN and the NAD + /NADH ratio ( g ) and expression of the indicated SASP genes ( h ) were determined by qRT-PCR. i - k , Cells from the conditions as in (a) were incubated for 6 hours in the presence of 13 C 6 -glucose and intracellular metabolites were extracted for analysis by LC-MS to evaluate glycolytic flux in the form of pyruvate ( i ) and lactate ( j ) and mitochondrial respiration rates as indicated by citrate production ( k ). Data were normalized based on protein concentration. l , Cells from conditions as in (a) were incubated with a fluorescent glucose analog (2-NBDG) and analyzed by flow cytometry for glucose uptake. m , n , Cells from the conditions in (g) were analyzed using Seahorse Bioanalyzer XF e 96 for extracellular acidification (ECAR) ( m ) and oxygen consumption (OCR) ( n ). Data were normalized based on protein concentration. n = 3 independent experiments unless otherwise stated. All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 .

    Article Snippet: Established senescent IMR90 cells induced by oncogenic RAS were prepared for ChIP-seq using 5 μL of anti-HMGA1 antibody (Abcam, Cat. No. 129153) or anti-HMGA2 (Abcam, Cat. No. 97276).

    Techniques: Activity Assay, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Expressing, Quantitative RT-PCR, Incubation, Protein Concentration, Flow Cytometry, Cytometry, Two Tailed Test

    HMGA1-mediated NAMPT expression drives the proinflammatory SASP. a - c , The expression of indicated proteins in cells induced to senesce by oncogenic RAS at the indicated time points was analyzed by immunoblot ( a ). Expression of NAMPT ( b ) and the indicated proinflammatory SASP genes ( c ) were determined by qRT-PCR (n = 3 independent experiments). d - g , In established senescent cells, HMGA1 or NAMPT were knocked down using the indicated shRNAs. The NAMPT activity was also inhibited by FK866. The expression of the indicated proteins was determined by immunoblot ( d ). Expression of SASP genes was determined using quantitative RT-PCR (n = 3 independent experiments) ( e , f ). g , The secretion of soluble factors under the indicated conditions were detected by antibody arrays. Heat map indicates fold change in comparison to the control or RAS condition. Relative expression level per replicate and average fold change differences are shown (n = 4 independent experiments). h , V5-HMGA1 overexpressing cells had NAMPT knocked down and expression of NAMPT and the indicated SASP genes were determined using qRT-PCR (n = 3 independent experiments). i - j , In established senescent cells, HMGA1 was knocked down with or without ectopic expression of a FLAG-tagged wild type or catalytically-inactive NAMPT. The expression of the indicated proteins was determined by immunoblot ( i ). Expression of the indicated SASP genes was determined using qRT-PCR (n = 3 independent experiments) ( j ). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Journal: Nature cell biology

    Article Title: NAD+ metabolism governs the proinflammatory senescence-associated secretome

    doi: 10.1038/s41556-019-0287-4

    Figure Lengend Snippet: HMGA1-mediated NAMPT expression drives the proinflammatory SASP. a - c , The expression of indicated proteins in cells induced to senesce by oncogenic RAS at the indicated time points was analyzed by immunoblot ( a ). Expression of NAMPT ( b ) and the indicated proinflammatory SASP genes ( c ) were determined by qRT-PCR (n = 3 independent experiments). d - g , In established senescent cells, HMGA1 or NAMPT were knocked down using the indicated shRNAs. The NAMPT activity was also inhibited by FK866. The expression of the indicated proteins was determined by immunoblot ( d ). Expression of SASP genes was determined using quantitative RT-PCR (n = 3 independent experiments) ( e , f ). g , The secretion of soluble factors under the indicated conditions were detected by antibody arrays. Heat map indicates fold change in comparison to the control or RAS condition. Relative expression level per replicate and average fold change differences are shown (n = 4 independent experiments). h , V5-HMGA1 overexpressing cells had NAMPT knocked down and expression of NAMPT and the indicated SASP genes were determined using qRT-PCR (n = 3 independent experiments). i - j , In established senescent cells, HMGA1 was knocked down with or without ectopic expression of a FLAG-tagged wild type or catalytically-inactive NAMPT. The expression of the indicated proteins was determined by immunoblot ( i ). Expression of the indicated SASP genes was determined using qRT-PCR (n = 3 independent experiments) ( j ). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Article Snippet: Established senescent IMR90 cells induced by oncogenic RAS were prepared for ChIP-seq using 5 μL of anti-HMGA1 antibody (Abcam, Cat. No. 129153) or anti-HMGA2 (Abcam, Cat. No. 97276).

    Techniques: Expressing, Quantitative RT-PCR, Activity Assay, Two Tailed Test, Marker

    HMGA1/NAMPT axis regulates the strengths of SASP. a , Cells cultured at early passage (population doubling 30, PD30), late passage (population doubling 90, PD90), and oncogene-induced senescence (PD30 expressing oncogenic RAS) were compared. Expression of the indicated proteins was determined using immunoblot. b , Expression of NAMPT mRNA in the indicated cells was determined using qRT-PCR (n = 3 independent experiments). c, The indicated early passage and late passage cells were subjected to ChIP analysis for the NAMPT enhancer site using an anti-HMGA1 antibody. An isotype matched IgG was used as a control (n = 3 independent experiments). d , Cells from the conditions in ( a ) were assessed for their effects on the growth of co-cultured TOV21G cancer cells (n = 3 independent experiments). e - i, The indicated cells with or without NMN supplementation were compared. Cells were examined for expression of the indicated SASP genes using qRT-PCR (n = 3 independent experiments) ( e ), secretion of soluble factors using antibody arrays ( f ), NAD + /NADH ratio ( g ), NFκb reporter activity ( h ), and the effects on the growth of co-cultured TOV21G cancer cells ( i ). The heat map for the antibody array indicates fold change in comparison to the control or RAS + NMN condition. Relative expression level per replicate and average fold change differences are shown (n = 4 independent experiments). j , TOV21G cells overexpressing HMGA1 or NAMPT, or supplemented with NMN, were induced to senesce using etoposide (50 μM for 48 hours) and expression of the indicated SASP genes was determined by qRT-PCR (n = 3 independent experiments). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Journal: Nature cell biology

    Article Title: NAD+ metabolism governs the proinflammatory senescence-associated secretome

    doi: 10.1038/s41556-019-0287-4

    Figure Lengend Snippet: HMGA1/NAMPT axis regulates the strengths of SASP. a , Cells cultured at early passage (population doubling 30, PD30), late passage (population doubling 90, PD90), and oncogene-induced senescence (PD30 expressing oncogenic RAS) were compared. Expression of the indicated proteins was determined using immunoblot. b , Expression of NAMPT mRNA in the indicated cells was determined using qRT-PCR (n = 3 independent experiments). c, The indicated early passage and late passage cells were subjected to ChIP analysis for the NAMPT enhancer site using an anti-HMGA1 antibody. An isotype matched IgG was used as a control (n = 3 independent experiments). d , Cells from the conditions in ( a ) were assessed for their effects on the growth of co-cultured TOV21G cancer cells (n = 3 independent experiments). e - i, The indicated cells with or without NMN supplementation were compared. Cells were examined for expression of the indicated SASP genes using qRT-PCR (n = 3 independent experiments) ( e ), secretion of soluble factors using antibody arrays ( f ), NAD + /NADH ratio ( g ), NFκb reporter activity ( h ), and the effects on the growth of co-cultured TOV21G cancer cells ( i ). The heat map for the antibody array indicates fold change in comparison to the control or RAS + NMN condition. Relative expression level per replicate and average fold change differences are shown (n = 4 independent experiments). j , TOV21G cells overexpressing HMGA1 or NAMPT, or supplemented with NMN, were induced to senesce using etoposide (50 μM for 48 hours) and expression of the indicated SASP genes was determined by qRT-PCR (n = 3 independent experiments). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Article Snippet: Established senescent IMR90 cells induced by oncogenic RAS were prepared for ChIP-seq using 5 μL of anti-HMGA1 antibody (Abcam, Cat. No. 129153) or anti-HMGA2 (Abcam, Cat. No. 97276).

    Techniques: Cell Culture, Expressing, Quantitative RT-PCR, Chromatin Immunoprecipitation, Activity Assay, Ab Array, Two Tailed Test, Marker

    HMGA proteins regulate NAMPT expression. a , ChIP analysis for the enhancer of NAMPT gene identified by HMGA1 ChIP-seq using the indicated antibodies or an isotype matched IgG control during OIS (n = 3 independent experiments). b , c , HMGA1 in fully established senescent cells was knocked down using two independent short hairpin RNAs (shRNAs). Expression of NAMPT mRNA was determined by qRT-PCR ( b ) (n = 3 independent experiments), or the indicated proteins were determined by immunoblot ( c ). d, In established senescent cells, HMGA2 was knocked down using two independent shRNAs and expression of the indicated proteins was determined by immunoblot. e , ChIP analysis for the enhancer of NAMPT gene identified by HMGA1 ChIP-seq using an anti-HMGA2 antibody or an isotype matched IgG control during OIS (n = 3 independent experiments). f , g , Cells with or without ectopic V5-tagged HMGA1 expression with or without NAMPT knockdown were examined for the expression of the indicated proteins by immunoblot ( f ), or subjected to SA-β-gal staining or colony formation ( g ), scale bar = 100 μm. The percentage of SA-β-gal positive cells ( h ) and the integrated intensity of the colonies formed by the indicated cells ( i ) were quantified using NIH Image J software (n = 3 independent experiments). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Journal: Nature cell biology

    Article Title: NAD+ metabolism governs the proinflammatory senescence-associated secretome

    doi: 10.1038/s41556-019-0287-4

    Figure Lengend Snippet: HMGA proteins regulate NAMPT expression. a , ChIP analysis for the enhancer of NAMPT gene identified by HMGA1 ChIP-seq using the indicated antibodies or an isotype matched IgG control during OIS (n = 3 independent experiments). b , c , HMGA1 in fully established senescent cells was knocked down using two independent short hairpin RNAs (shRNAs). Expression of NAMPT mRNA was determined by qRT-PCR ( b ) (n = 3 independent experiments), or the indicated proteins were determined by immunoblot ( c ). d, In established senescent cells, HMGA2 was knocked down using two independent shRNAs and expression of the indicated proteins was determined by immunoblot. e , ChIP analysis for the enhancer of NAMPT gene identified by HMGA1 ChIP-seq using an anti-HMGA2 antibody or an isotype matched IgG control during OIS (n = 3 independent experiments). f , g , Cells with or without ectopic V5-tagged HMGA1 expression with or without NAMPT knockdown were examined for the expression of the indicated proteins by immunoblot ( f ), or subjected to SA-β-gal staining or colony formation ( g ), scale bar = 100 μm. The percentage of SA-β-gal positive cells ( h ) and the integrated intensity of the colonies formed by the indicated cells ( i ) were quantified using NIH Image J software (n = 3 independent experiments). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Article Snippet: Reagents, plasmids and antibodies The following antibodies were purchased from the indicated suppliers: rabbit monoclonal anti-AMPK (Cell Signaling, Cat. No. 2532, Clone 40H9, 1:1000 for immunoblot), mouse monoclonal anti-β-actin (Sigma, Cat. No. A5441, Clone AC-15, 1:10000 for immunoblot), rabbit polyclonal anti-Cyclin A (Santa Cruz Biotechnology, Cat. No. sc-751, 1:1000 for immunoblot), mouse monoclonal anti-FLAG (Sigma, Cat. No. F3165, Clone M2, 1:1000 for immunoblot), mouse monoclonal anti-γH2Ax (Millipore, Cat. No. 05–636, Clone JBW301, 1:1000 for immunoblot), rabbit polyclonal anti-H3K27Ac (Millipore, Cat. No. 07–360, 1:1000 for ChIP), rabbit polyclonal anti-H3K4Me1 (Abcam, Cat. No. ab8895, 1:1000 for ChIP), rabbit monoclonal anti-HMGA1 (Abcam, Cat. No. 129153, Clone EPR7839, 1:1000 for immunoblot and ChIP), rabbit polyclonal anti-HMGA2 (Abcam, Cat. No. 97276, 1:1000 for immunoblot), rabbit polyclonal anti-IgG (Santa Cruz, Cat. No. sc-2027, 1:1000 for ChIP), rabbit polyclonal anti-NAMPT (Bethyl Laboratories, Cat. No. A300–372A, 1:1000 for immunoblot), rabbit monoclonal anti-p-AMPK (Cell Signaling, Cat. No. 4188, Clone D79.5E,1:1000 for immunoblot), rabbit polyclonal anti-p-p38 (Cell Signaling, Cat. No. 9211, 1:1000 for immunoblot), rabbit polyclonal anti-p-p53 (Cell Signaling, Cat. No. 9284, 1:1000 for immunoblot), mouse monoclonal anti-p-p65 (Cell Signaling, Cat. No. 3036, Clone 7F1, 1:1000 for immunoblot), mouse monoclonal anti-p16 (Santa Cruz Biotechnology, Cat. No. sc-56330, Clone JC8, 1:1000 for immunoblot), mouse monoclonal anti-p38 (Cell Signaling, Cat. No. 9228, Clone L53F8, 1:1000 for immunoblot), mouse monoclonal anti-p53 (Millipore, Cat. No. OP43, Clone DO-1, 1:1000 for immunoblot), rabbit monoclonal anti-p65 (Cell Signaling, Cat. No. 8242, Clone D14E12, 1:1000 for immunoblot), mouse monoclonal anti-RAS (Becton Dickinson, Cat. No. 610001, Clone 18/RAS, 1:1000 for immunoblot), mouse monoclonal anti-V5 (Invitrogen, Cat. No. MA5–15253, Clone E10/V4RR, 1:1000 for immunoblot).

    Techniques: Expressing, Chromatin Immunoprecipitation, Quantitative RT-PCR, Staining, Software, Two Tailed Test, Marker

    NMN enhances the inflammatory environment and cancer progression in vivo . a , In established senescent cells, HMGA1 or NAMPT were knocked down or cells were treated with FK866 to assess the effect on the growth of co-cultured luciferase-expressing TOV21G ovarian cancer cells. Cell growth was assessed by luminescence following eight days of growth. (n=3 independent experiments). b - n , Wildtype mice were compared to KC mice treated with vehicle, NMN (500 mg/kg daily), or FK866 (25 mg/kg daily). Representative H E images of pancreas ( b ) and quantification of percent acinar area ( c ). Representative Masson trichrome staining images of pancreas ( d ) and quantification of percent trichrome area ( e ). Expression of IL1β, IL-6 and IL-8 was determined using qRT-PCR analysis ( f ). Representative immunohistochemical staining of infiltrating F4/80-positive immune cells ( g ) and quantification of percent F4/80 positive cells ( h ). Representative immunohistochemical staining of infiltrating CD3-positive immune cells ( i ) and quantification of the number of CD3 positive cells/field ( j ). Representative SA-β-gal staining ( k ) and quantification of SA-β-gal positive areas ( l ) in the indicated treatment groups. Expression of p16 ( m ) and p21 ( n ) was determined using qRT-PCR analysis. n=10 mice/group unless otherwise stated. Scale bar for all images is 200 μm. o , Immunoblot of the indicated protein in TOV21G cells containing doxycycline-inducible knockdown of NAMPT with or without doxycycline treatment. p , TOV21G and oncogene-induced senescent IMR90 cells were subcutaneously co-injected into the right dorsal flank of 6-8 week old NSG female mice. The mice (n=9 mice/group) were treated with vehicle control, NAM (500 mg/kg; intraperitoneal injection; every other days) for 17 days. Tumor growth in the indicated treatment groups was measured at the indicated time points. All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Journal: Nature cell biology

    Article Title: NAD+ metabolism governs the proinflammatory senescence-associated secretome

    doi: 10.1038/s41556-019-0287-4

    Figure Lengend Snippet: NMN enhances the inflammatory environment and cancer progression in vivo . a , In established senescent cells, HMGA1 or NAMPT were knocked down or cells were treated with FK866 to assess the effect on the growth of co-cultured luciferase-expressing TOV21G ovarian cancer cells. Cell growth was assessed by luminescence following eight days of growth. (n=3 independent experiments). b - n , Wildtype mice were compared to KC mice treated with vehicle, NMN (500 mg/kg daily), or FK866 (25 mg/kg daily). Representative H E images of pancreas ( b ) and quantification of percent acinar area ( c ). Representative Masson trichrome staining images of pancreas ( d ) and quantification of percent trichrome area ( e ). Expression of IL1β, IL-6 and IL-8 was determined using qRT-PCR analysis ( f ). Representative immunohistochemical staining of infiltrating F4/80-positive immune cells ( g ) and quantification of percent F4/80 positive cells ( h ). Representative immunohistochemical staining of infiltrating CD3-positive immune cells ( i ) and quantification of the number of CD3 positive cells/field ( j ). Representative SA-β-gal staining ( k ) and quantification of SA-β-gal positive areas ( l ) in the indicated treatment groups. Expression of p16 ( m ) and p21 ( n ) was determined using qRT-PCR analysis. n=10 mice/group unless otherwise stated. Scale bar for all images is 200 μm. o , Immunoblot of the indicated protein in TOV21G cells containing doxycycline-inducible knockdown of NAMPT with or without doxycycline treatment. p , TOV21G and oncogene-induced senescent IMR90 cells were subcutaneously co-injected into the right dorsal flank of 6-8 week old NSG female mice. The mice (n=9 mice/group) were treated with vehicle control, NAM (500 mg/kg; intraperitoneal injection; every other days) for 17 days. Tumor growth in the indicated treatment groups was measured at the indicated time points. All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Article Snippet: Reagents, plasmids and antibodies The following antibodies were purchased from the indicated suppliers: rabbit monoclonal anti-AMPK (Cell Signaling, Cat. No. 2532, Clone 40H9, 1:1000 for immunoblot), mouse monoclonal anti-β-actin (Sigma, Cat. No. A5441, Clone AC-15, 1:10000 for immunoblot), rabbit polyclonal anti-Cyclin A (Santa Cruz Biotechnology, Cat. No. sc-751, 1:1000 for immunoblot), mouse monoclonal anti-FLAG (Sigma, Cat. No. F3165, Clone M2, 1:1000 for immunoblot), mouse monoclonal anti-γH2Ax (Millipore, Cat. No. 05–636, Clone JBW301, 1:1000 for immunoblot), rabbit polyclonal anti-H3K27Ac (Millipore, Cat. No. 07–360, 1:1000 for ChIP), rabbit polyclonal anti-H3K4Me1 (Abcam, Cat. No. ab8895, 1:1000 for ChIP), rabbit monoclonal anti-HMGA1 (Abcam, Cat. No. 129153, Clone EPR7839, 1:1000 for immunoblot and ChIP), rabbit polyclonal anti-HMGA2 (Abcam, Cat. No. 97276, 1:1000 for immunoblot), rabbit polyclonal anti-IgG (Santa Cruz, Cat. No. sc-2027, 1:1000 for ChIP), rabbit polyclonal anti-NAMPT (Bethyl Laboratories, Cat. No. A300–372A, 1:1000 for immunoblot), rabbit monoclonal anti-p-AMPK (Cell Signaling, Cat. No. 4188, Clone D79.5E,1:1000 for immunoblot), rabbit polyclonal anti-p-p38 (Cell Signaling, Cat. No. 9211, 1:1000 for immunoblot), rabbit polyclonal anti-p-p53 (Cell Signaling, Cat. No. 9284, 1:1000 for immunoblot), mouse monoclonal anti-p-p65 (Cell Signaling, Cat. No. 3036, Clone 7F1, 1:1000 for immunoblot), mouse monoclonal anti-p16 (Santa Cruz Biotechnology, Cat. No. sc-56330, Clone JC8, 1:1000 for immunoblot), mouse monoclonal anti-p38 (Cell Signaling, Cat. No. 9228, Clone L53F8, 1:1000 for immunoblot), mouse monoclonal anti-p53 (Millipore, Cat. No. OP43, Clone DO-1, 1:1000 for immunoblot), rabbit monoclonal anti-p65 (Cell Signaling, Cat. No. 8242, Clone D14E12, 1:1000 for immunoblot), mouse monoclonal anti-RAS (Becton Dickinson, Cat. No. 610001, Clone 18/RAS, 1:1000 for immunoblot), mouse monoclonal anti-V5 (Invitrogen, Cat. No. MA5–15253, Clone E10/V4RR, 1:1000 for immunoblot).

    Techniques: In Vivo, Cell Culture, Luciferase, Expressing, Mouse Assay, Staining, Quantitative RT-PCR, Immunohistochemistry, Injection, Two Tailed Test, Marker

    AMPK signaling mediates proinflammatory SASP induced by NAD + metabolism. a-c , In established senescent cells, HMGA1 or NAMPT was knocked down using the indicated shRNAs. Under these conditions, cells were treated with NMN and the ADP/ATP ratio ( a ) and expression of the indicated proteins by immunoblot in the indicated HMGA1 knockdown ( b ) or NAMPT knockdown ( c ) cells were determined (n = 3 independent experiments). d - f , In established senescent cells, HMGA1 ( d ) or NAMPT ( e ) was knocked down using the indicated shRNAs or treated with FK866 ( f ). Under these conditions, cells were treated with Compound C (CC, 50 nM), an AMPK inhibitor. Expression of the indicated SASP genes was determined using qRT-PCR (n = 3 independent experiments). ( g ) In established senescent cells, HMGA1 or NAMPT was knocked down using the indicated shRNAs or treated with FK866. Under these conditions, cells were treated with NMN and NFκB reporter activity was determined (n = 3 independent experiments). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Journal: Nature cell biology

    Article Title: NAD+ metabolism governs the proinflammatory senescence-associated secretome

    doi: 10.1038/s41556-019-0287-4

    Figure Lengend Snippet: AMPK signaling mediates proinflammatory SASP induced by NAD + metabolism. a-c , In established senescent cells, HMGA1 or NAMPT was knocked down using the indicated shRNAs. Under these conditions, cells were treated with NMN and the ADP/ATP ratio ( a ) and expression of the indicated proteins by immunoblot in the indicated HMGA1 knockdown ( b ) or NAMPT knockdown ( c ) cells were determined (n = 3 independent experiments). d - f , In established senescent cells, HMGA1 ( d ) or NAMPT ( e ) was knocked down using the indicated shRNAs or treated with FK866 ( f ). Under these conditions, cells were treated with Compound C (CC, 50 nM), an AMPK inhibitor. Expression of the indicated SASP genes was determined using qRT-PCR (n = 3 independent experiments). ( g ) In established senescent cells, HMGA1 or NAMPT was knocked down using the indicated shRNAs or treated with FK866. Under these conditions, cells were treated with NMN and NFκB reporter activity was determined (n = 3 independent experiments). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Article Snippet: Reagents, plasmids and antibodies The following antibodies were purchased from the indicated suppliers: rabbit monoclonal anti-AMPK (Cell Signaling, Cat. No. 2532, Clone 40H9, 1:1000 for immunoblot), mouse monoclonal anti-β-actin (Sigma, Cat. No. A5441, Clone AC-15, 1:10000 for immunoblot), rabbit polyclonal anti-Cyclin A (Santa Cruz Biotechnology, Cat. No. sc-751, 1:1000 for immunoblot), mouse monoclonal anti-FLAG (Sigma, Cat. No. F3165, Clone M2, 1:1000 for immunoblot), mouse monoclonal anti-γH2Ax (Millipore, Cat. No. 05–636, Clone JBW301, 1:1000 for immunoblot), rabbit polyclonal anti-H3K27Ac (Millipore, Cat. No. 07–360, 1:1000 for ChIP), rabbit polyclonal anti-H3K4Me1 (Abcam, Cat. No. ab8895, 1:1000 for ChIP), rabbit monoclonal anti-HMGA1 (Abcam, Cat. No. 129153, Clone EPR7839, 1:1000 for immunoblot and ChIP), rabbit polyclonal anti-HMGA2 (Abcam, Cat. No. 97276, 1:1000 for immunoblot), rabbit polyclonal anti-IgG (Santa Cruz, Cat. No. sc-2027, 1:1000 for ChIP), rabbit polyclonal anti-NAMPT (Bethyl Laboratories, Cat. No. A300–372A, 1:1000 for immunoblot), rabbit monoclonal anti-p-AMPK (Cell Signaling, Cat. No. 4188, Clone D79.5E,1:1000 for immunoblot), rabbit polyclonal anti-p-p38 (Cell Signaling, Cat. No. 9211, 1:1000 for immunoblot), rabbit polyclonal anti-p-p53 (Cell Signaling, Cat. No. 9284, 1:1000 for immunoblot), mouse monoclonal anti-p-p65 (Cell Signaling, Cat. No. 3036, Clone 7F1, 1:1000 for immunoblot), mouse monoclonal anti-p16 (Santa Cruz Biotechnology, Cat. No. sc-56330, Clone JC8, 1:1000 for immunoblot), mouse monoclonal anti-p38 (Cell Signaling, Cat. No. 9228, Clone L53F8, 1:1000 for immunoblot), mouse monoclonal anti-p53 (Millipore, Cat. No. OP43, Clone DO-1, 1:1000 for immunoblot), rabbit monoclonal anti-p65 (Cell Signaling, Cat. No. 8242, Clone D14E12, 1:1000 for immunoblot), mouse monoclonal anti-RAS (Becton Dickinson, Cat. No. 610001, Clone 18/RAS, 1:1000 for immunoblot), mouse monoclonal anti-V5 (Invitrogen, Cat. No. MA5–15253, Clone E10/V4RR, 1:1000 for immunoblot).

    Techniques: Expressing, Quantitative RT-PCR, Activity Assay, Two Tailed Test, Marker

    NAD + metabolism drives proinflammatory SASP. a - c , In established senescent cells, HMGA1 or NAMPT were knocked down using the indicated short hairpin RNAs. The NAMPT activity was also inhibited by FK866. Steady-state metabolite levels were measured by LC-MS/MS. Heat map indicates fold change in comparison to the control condition ( a ) (n=6 independent experiments). NMN ( b ) (n=6 independent experiments) and NAD + /NADH ratio ( c ) were determined in the indicated cells. d , Cells were induced to senesce by oncogenic RAS and analyzed for the NAD + /NADH ratio at the indicated time points. e , Cells with or without ectopic V5-tagged HMGA1 expression with or without NAMPT knockdown were examined for the NAD + /NADH ratio. f , The NAD + /NADH ratio was determined in established senescent cells with or without HMGA1 knockdown with or without ectopic expression of a FLAG-tagged wild type or catalytically-inactive NAMPT. g , h , In established senescence, HMGA1 or NAMPT were knocked down using the indicated shRNAs. The NAMPT activity was also inhibited by FK866. Under these conditions, cells were treated with NMN and the NAD + /NADH ratio ( g ) and expression of the indicated SASP genes ( h ) were determined by qRT-PCR. i - k , Cells from the conditions as in (a) were incubated for 6 hours in the presence of 13 C 6 -glucose and intracellular metabolites were extracted for analysis by LC-MS to evaluate glycolytic flux in the form of pyruvate ( i ) and lactate ( j ) and mitochondrial respiration rates as indicated by citrate production ( k ). Data were normalized based on protein concentration. l , Cells from conditions as in (a) were incubated with a fluorescent glucose analog (2-NBDG) and analyzed by flow cytometry for glucose uptake. m , n , Cells from the conditions in (g) were analyzed using Seahorse Bioanalyzer XF e 96 for extracellular acidification (ECAR) ( m ) and oxygen consumption (OCR) ( n ). Data were normalized based on protein concentration. n = 3 independent experiments unless otherwise stated. All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 .

    Journal: Nature cell biology

    Article Title: NAD+ metabolism governs the proinflammatory senescence-associated secretome

    doi: 10.1038/s41556-019-0287-4

    Figure Lengend Snippet: NAD + metabolism drives proinflammatory SASP. a - c , In established senescent cells, HMGA1 or NAMPT were knocked down using the indicated short hairpin RNAs. The NAMPT activity was also inhibited by FK866. Steady-state metabolite levels were measured by LC-MS/MS. Heat map indicates fold change in comparison to the control condition ( a ) (n=6 independent experiments). NMN ( b ) (n=6 independent experiments) and NAD + /NADH ratio ( c ) were determined in the indicated cells. d , Cells were induced to senesce by oncogenic RAS and analyzed for the NAD + /NADH ratio at the indicated time points. e , Cells with or without ectopic V5-tagged HMGA1 expression with or without NAMPT knockdown were examined for the NAD + /NADH ratio. f , The NAD + /NADH ratio was determined in established senescent cells with or without HMGA1 knockdown with or without ectopic expression of a FLAG-tagged wild type or catalytically-inactive NAMPT. g , h , In established senescence, HMGA1 or NAMPT were knocked down using the indicated shRNAs. The NAMPT activity was also inhibited by FK866. Under these conditions, cells were treated with NMN and the NAD + /NADH ratio ( g ) and expression of the indicated SASP genes ( h ) were determined by qRT-PCR. i - k , Cells from the conditions as in (a) were incubated for 6 hours in the presence of 13 C 6 -glucose and intracellular metabolites were extracted for analysis by LC-MS to evaluate glycolytic flux in the form of pyruvate ( i ) and lactate ( j ) and mitochondrial respiration rates as indicated by citrate production ( k ). Data were normalized based on protein concentration. l , Cells from conditions as in (a) were incubated with a fluorescent glucose analog (2-NBDG) and analyzed by flow cytometry for glucose uptake. m , n , Cells from the conditions in (g) were analyzed using Seahorse Bioanalyzer XF e 96 for extracellular acidification (ECAR) ( m ) and oxygen consumption (OCR) ( n ). Data were normalized based on protein concentration. n = 3 independent experiments unless otherwise stated. All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 .

    Article Snippet: Reagents, plasmids and antibodies The following antibodies were purchased from the indicated suppliers: rabbit monoclonal anti-AMPK (Cell Signaling, Cat. No. 2532, Clone 40H9, 1:1000 for immunoblot), mouse monoclonal anti-β-actin (Sigma, Cat. No. A5441, Clone AC-15, 1:10000 for immunoblot), rabbit polyclonal anti-Cyclin A (Santa Cruz Biotechnology, Cat. No. sc-751, 1:1000 for immunoblot), mouse monoclonal anti-FLAG (Sigma, Cat. No. F3165, Clone M2, 1:1000 for immunoblot), mouse monoclonal anti-γH2Ax (Millipore, Cat. No. 05–636, Clone JBW301, 1:1000 for immunoblot), rabbit polyclonal anti-H3K27Ac (Millipore, Cat. No. 07–360, 1:1000 for ChIP), rabbit polyclonal anti-H3K4Me1 (Abcam, Cat. No. ab8895, 1:1000 for ChIP), rabbit monoclonal anti-HMGA1 (Abcam, Cat. No. 129153, Clone EPR7839, 1:1000 for immunoblot and ChIP), rabbit polyclonal anti-HMGA2 (Abcam, Cat. No. 97276, 1:1000 for immunoblot), rabbit polyclonal anti-IgG (Santa Cruz, Cat. No. sc-2027, 1:1000 for ChIP), rabbit polyclonal anti-NAMPT (Bethyl Laboratories, Cat. No. A300–372A, 1:1000 for immunoblot), rabbit monoclonal anti-p-AMPK (Cell Signaling, Cat. No. 4188, Clone D79.5E,1:1000 for immunoblot), rabbit polyclonal anti-p-p38 (Cell Signaling, Cat. No. 9211, 1:1000 for immunoblot), rabbit polyclonal anti-p-p53 (Cell Signaling, Cat. No. 9284, 1:1000 for immunoblot), mouse monoclonal anti-p-p65 (Cell Signaling, Cat. No. 3036, Clone 7F1, 1:1000 for immunoblot), mouse monoclonal anti-p16 (Santa Cruz Biotechnology, Cat. No. sc-56330, Clone JC8, 1:1000 for immunoblot), mouse monoclonal anti-p38 (Cell Signaling, Cat. No. 9228, Clone L53F8, 1:1000 for immunoblot), mouse monoclonal anti-p53 (Millipore, Cat. No. OP43, Clone DO-1, 1:1000 for immunoblot), rabbit monoclonal anti-p65 (Cell Signaling, Cat. No. 8242, Clone D14E12, 1:1000 for immunoblot), mouse monoclonal anti-RAS (Becton Dickinson, Cat. No. 610001, Clone 18/RAS, 1:1000 for immunoblot), mouse monoclonal anti-V5 (Invitrogen, Cat. No. MA5–15253, Clone E10/V4RR, 1:1000 for immunoblot).

    Techniques: Activity Assay, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Expressing, Quantitative RT-PCR, Incubation, Protein Concentration, Flow Cytometry, Cytometry, Two Tailed Test

    HMGA1-mediated NAMPT expression drives the proinflammatory SASP. a - c , The expression of indicated proteins in cells induced to senesce by oncogenic RAS at the indicated time points was analyzed by immunoblot ( a ). Expression of NAMPT ( b ) and the indicated proinflammatory SASP genes ( c ) were determined by qRT-PCR (n = 3 independent experiments). d - g , In established senescent cells, HMGA1 or NAMPT were knocked down using the indicated shRNAs. The NAMPT activity was also inhibited by FK866. The expression of the indicated proteins was determined by immunoblot ( d ). Expression of SASP genes was determined using quantitative RT-PCR (n = 3 independent experiments) ( e , f ). g , The secretion of soluble factors under the indicated conditions were detected by antibody arrays. Heat map indicates fold change in comparison to the control or RAS condition. Relative expression level per replicate and average fold change differences are shown (n = 4 independent experiments). h , V5-HMGA1 overexpressing cells had NAMPT knocked down and expression of NAMPT and the indicated SASP genes were determined using qRT-PCR (n = 3 independent experiments). i - j , In established senescent cells, HMGA1 was knocked down with or without ectopic expression of a FLAG-tagged wild type or catalytically-inactive NAMPT. The expression of the indicated proteins was determined by immunoblot ( i ). Expression of the indicated SASP genes was determined using qRT-PCR (n = 3 independent experiments) ( j ). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Journal: Nature cell biology

    Article Title: NAD+ metabolism governs the proinflammatory senescence-associated secretome

    doi: 10.1038/s41556-019-0287-4

    Figure Lengend Snippet: HMGA1-mediated NAMPT expression drives the proinflammatory SASP. a - c , The expression of indicated proteins in cells induced to senesce by oncogenic RAS at the indicated time points was analyzed by immunoblot ( a ). Expression of NAMPT ( b ) and the indicated proinflammatory SASP genes ( c ) were determined by qRT-PCR (n = 3 independent experiments). d - g , In established senescent cells, HMGA1 or NAMPT were knocked down using the indicated shRNAs. The NAMPT activity was also inhibited by FK866. The expression of the indicated proteins was determined by immunoblot ( d ). Expression of SASP genes was determined using quantitative RT-PCR (n = 3 independent experiments) ( e , f ). g , The secretion of soluble factors under the indicated conditions were detected by antibody arrays. Heat map indicates fold change in comparison to the control or RAS condition. Relative expression level per replicate and average fold change differences are shown (n = 4 independent experiments). h , V5-HMGA1 overexpressing cells had NAMPT knocked down and expression of NAMPT and the indicated SASP genes were determined using qRT-PCR (n = 3 independent experiments). i - j , In established senescent cells, HMGA1 was knocked down with or without ectopic expression of a FLAG-tagged wild type or catalytically-inactive NAMPT. The expression of the indicated proteins was determined by immunoblot ( i ). Expression of the indicated SASP genes was determined using qRT-PCR (n = 3 independent experiments) ( j ). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Article Snippet: Reagents, plasmids and antibodies The following antibodies were purchased from the indicated suppliers: rabbit monoclonal anti-AMPK (Cell Signaling, Cat. No. 2532, Clone 40H9, 1:1000 for immunoblot), mouse monoclonal anti-β-actin (Sigma, Cat. No. A5441, Clone AC-15, 1:10000 for immunoblot), rabbit polyclonal anti-Cyclin A (Santa Cruz Biotechnology, Cat. No. sc-751, 1:1000 for immunoblot), mouse monoclonal anti-FLAG (Sigma, Cat. No. F3165, Clone M2, 1:1000 for immunoblot), mouse monoclonal anti-γH2Ax (Millipore, Cat. No. 05–636, Clone JBW301, 1:1000 for immunoblot), rabbit polyclonal anti-H3K27Ac (Millipore, Cat. No. 07–360, 1:1000 for ChIP), rabbit polyclonal anti-H3K4Me1 (Abcam, Cat. No. ab8895, 1:1000 for ChIP), rabbit monoclonal anti-HMGA1 (Abcam, Cat. No. 129153, Clone EPR7839, 1:1000 for immunoblot and ChIP), rabbit polyclonal anti-HMGA2 (Abcam, Cat. No. 97276, 1:1000 for immunoblot), rabbit polyclonal anti-IgG (Santa Cruz, Cat. No. sc-2027, 1:1000 for ChIP), rabbit polyclonal anti-NAMPT (Bethyl Laboratories, Cat. No. A300–372A, 1:1000 for immunoblot), rabbit monoclonal anti-p-AMPK (Cell Signaling, Cat. No. 4188, Clone D79.5E,1:1000 for immunoblot), rabbit polyclonal anti-p-p38 (Cell Signaling, Cat. No. 9211, 1:1000 for immunoblot), rabbit polyclonal anti-p-p53 (Cell Signaling, Cat. No. 9284, 1:1000 for immunoblot), mouse monoclonal anti-p-p65 (Cell Signaling, Cat. No. 3036, Clone 7F1, 1:1000 for immunoblot), mouse monoclonal anti-p16 (Santa Cruz Biotechnology, Cat. No. sc-56330, Clone JC8, 1:1000 for immunoblot), mouse monoclonal anti-p38 (Cell Signaling, Cat. No. 9228, Clone L53F8, 1:1000 for immunoblot), mouse monoclonal anti-p53 (Millipore, Cat. No. OP43, Clone DO-1, 1:1000 for immunoblot), rabbit monoclonal anti-p65 (Cell Signaling, Cat. No. 8242, Clone D14E12, 1:1000 for immunoblot), mouse monoclonal anti-RAS (Becton Dickinson, Cat. No. 610001, Clone 18/RAS, 1:1000 for immunoblot), mouse monoclonal anti-V5 (Invitrogen, Cat. No. MA5–15253, Clone E10/V4RR, 1:1000 for immunoblot).

    Techniques: Expressing, Quantitative RT-PCR, Activity Assay, Two Tailed Test, Marker

    HMGA1/NAMPT axis regulates the strengths of SASP. a , Cells cultured at early passage (population doubling 30, PD30), late passage (population doubling 90, PD90), and oncogene-induced senescence (PD30 expressing oncogenic RAS) were compared. Expression of the indicated proteins was determined using immunoblot. b , Expression of NAMPT mRNA in the indicated cells was determined using qRT-PCR (n = 3 independent experiments). c, The indicated early passage and late passage cells were subjected to ChIP analysis for the NAMPT enhancer site using an anti-HMGA1 antibody. An isotype matched IgG was used as a control (n = 3 independent experiments). d , Cells from the conditions in ( a ) were assessed for their effects on the growth of co-cultured TOV21G cancer cells (n = 3 independent experiments). e - i, The indicated cells with or without NMN supplementation were compared. Cells were examined for expression of the indicated SASP genes using qRT-PCR (n = 3 independent experiments) ( e ), secretion of soluble factors using antibody arrays ( f ), NAD + /NADH ratio ( g ), NFκb reporter activity ( h ), and the effects on the growth of co-cultured TOV21G cancer cells ( i ). The heat map for the antibody array indicates fold change in comparison to the control or RAS + NMN condition. Relative expression level per replicate and average fold change differences are shown (n = 4 independent experiments). j , TOV21G cells overexpressing HMGA1 or NAMPT, or supplemented with NMN, were induced to senesce using etoposide (50 μM for 48 hours) and expression of the indicated SASP genes was determined by qRT-PCR (n = 3 independent experiments). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Journal: Nature cell biology

    Article Title: NAD+ metabolism governs the proinflammatory senescence-associated secretome

    doi: 10.1038/s41556-019-0287-4

    Figure Lengend Snippet: HMGA1/NAMPT axis regulates the strengths of SASP. a , Cells cultured at early passage (population doubling 30, PD30), late passage (population doubling 90, PD90), and oncogene-induced senescence (PD30 expressing oncogenic RAS) were compared. Expression of the indicated proteins was determined using immunoblot. b , Expression of NAMPT mRNA in the indicated cells was determined using qRT-PCR (n = 3 independent experiments). c, The indicated early passage and late passage cells were subjected to ChIP analysis for the NAMPT enhancer site using an anti-HMGA1 antibody. An isotype matched IgG was used as a control (n = 3 independent experiments). d , Cells from the conditions in ( a ) were assessed for their effects on the growth of co-cultured TOV21G cancer cells (n = 3 independent experiments). e - i, The indicated cells with or without NMN supplementation were compared. Cells were examined for expression of the indicated SASP genes using qRT-PCR (n = 3 independent experiments) ( e ), secretion of soluble factors using antibody arrays ( f ), NAD + /NADH ratio ( g ), NFκb reporter activity ( h ), and the effects on the growth of co-cultured TOV21G cancer cells ( i ). The heat map for the antibody array indicates fold change in comparison to the control or RAS + NMN condition. Relative expression level per replicate and average fold change differences are shown (n = 4 independent experiments). j , TOV21G cells overexpressing HMGA1 or NAMPT, or supplemented with NMN, were induced to senesce using etoposide (50 μM for 48 hours) and expression of the indicated SASP genes was determined by qRT-PCR (n = 3 independent experiments). All graphs represent mean ± s.d. P values were calculated using a two-tailed t -test. Statistical source data are provided in Supplementary Table 1 . Unprocessed original scans of all blots with size marker are shown in Supplementary Fig. 8 .

    Article Snippet: Reagents, plasmids and antibodies The following antibodies were purchased from the indicated suppliers: rabbit monoclonal anti-AMPK (Cell Signaling, Cat. No. 2532, Clone 40H9, 1:1000 for immunoblot), mouse monoclonal anti-β-actin (Sigma, Cat. No. A5441, Clone AC-15, 1:10000 for immunoblot), rabbit polyclonal anti-Cyclin A (Santa Cruz Biotechnology, Cat. No. sc-751, 1:1000 for immunoblot), mouse monoclonal anti-FLAG (Sigma, Cat. No. F3165, Clone M2, 1:1000 for immunoblot), mouse monoclonal anti-γH2Ax (Millipore, Cat. No. 05–636, Clone JBW301, 1:1000 for immunoblot), rabbit polyclonal anti-H3K27Ac (Millipore, Cat. No. 07–360, 1:1000 for ChIP), rabbit polyclonal anti-H3K4Me1 (Abcam, Cat. No. ab8895, 1:1000 for ChIP), rabbit monoclonal anti-HMGA1 (Abcam, Cat. No. 129153, Clone EPR7839, 1:1000 for immunoblot and ChIP), rabbit polyclonal anti-HMGA2 (Abcam, Cat. No. 97276, 1:1000 for immunoblot), rabbit polyclonal anti-IgG (Santa Cruz, Cat. No. sc-2027, 1:1000 for ChIP), rabbit polyclonal anti-NAMPT (Bethyl Laboratories, Cat. No. A300–372A, 1:1000 for immunoblot), rabbit monoclonal anti-p-AMPK (Cell Signaling, Cat. No. 4188, Clone D79.5E,1:1000 for immunoblot), rabbit polyclonal anti-p-p38 (Cell Signaling, Cat. No. 9211, 1:1000 for immunoblot), rabbit polyclonal anti-p-p53 (Cell Signaling, Cat. No. 9284, 1:1000 for immunoblot), mouse monoclonal anti-p-p65 (Cell Signaling, Cat. No. 3036, Clone 7F1, 1:1000 for immunoblot), mouse monoclonal anti-p16 (Santa Cruz Biotechnology, Cat. No. sc-56330, Clone JC8, 1:1000 for immunoblot), mouse monoclonal anti-p38 (Cell Signaling, Cat. No. 9228, Clone L53F8, 1:1000 for immunoblot), mouse monoclonal anti-p53 (Millipore, Cat. No. OP43, Clone DO-1, 1:1000 for immunoblot), rabbit monoclonal anti-p65 (Cell Signaling, Cat. No. 8242, Clone D14E12, 1:1000 for immunoblot), mouse monoclonal anti-RAS (Becton Dickinson, Cat. No. 610001, Clone 18/RAS, 1:1000 for immunoblot), mouse monoclonal anti-V5 (Invitrogen, Cat. No. MA5–15253, Clone E10/V4RR, 1:1000 for immunoblot).

    Techniques: Cell Culture, Expressing, Quantitative RT-PCR, Chromatin Immunoprecipitation, Activity Assay, Ab Array, Two Tailed Test, Marker

    Principle of array-CGH. Genomic DNA from two cell populations is differentially labeled and hybridized to a microarray in the presence of Cot1 DNA to suppress repeat sequences. The fluorescent ratios on each array spot are calculated and normalized so

    Journal:

    Article Title: Construction and use of spotted large-insert clone DNA microarrays for the detection of genomic copy number changes

    doi: 10.1038/nprot.2007.53

    Figure Lengend Snippet: Principle of array-CGH. Genomic DNA from two cell populations is differentially labeled and hybridized to a microarray in the presence of Cot1 DNA to suppress repeat sequences. The fluorescent ratios on each array spot are calculated and normalized so

    Article Snippet: •2× TY medium, pH 7.4 (see REAGENT SETUP) •Solution I (see REAGENT SETUP) •Solution II (see REAGENT SETUP) •Solution III (see REAGENT SETUP) •Isopropanol •70% ethanol •100% ethanol •80% ethanol •T0.1E solution, pH 8 (see REAGENT SETUP) •RNaseA (ICN Biochemicals, cat. no. 101076) •DOP-PCR primers: •DOP 1: 5′ CCGACTCGAGNNNNNNCTAGAA 3′ •DOP 2: 5′ CCGACTCGAGNNNNNNTAGGAG 3′ •DOP 3: 5′ CCGACTCGAGNNNNNNTTCTAG 3′ •TAPS ( N -[tris(hydroxymethyl)methyl]-3-aminopropanesulfonic acid (Sigma-Aldrich, cat. no. T5130) •TAPS salt solution (see REAGENT SETUP) •TAPS2 buffer (see REAGENT SETUP) •Amino-linked primer: •5′ GGAAACAGCCCGACTCGAG 3′ •Amplitaq polymerase, 5 U μl−1 (Roche, cat. no. N808-0145) •dNTPs (Amersham Biosciences, cat. no. 27-2035-01) •Amino-linking buffer (see REAGENT SETUP) •4× microarray spotting buffer: 1 M sodium phosphate buffer, pH 8.5, 0.001% sarkosyl •1% (w/v) ammonium hydroxide solution (prepared with HPLC water) •0.1% (w/v) sodium dodecyl sulfate solution (prepared with HPLC water) •HPCL water •BioPrime Labeling Kit (Invitrogen, cat. no. 18094011) •10× dNTP mix (1 mM dCTP, 2 mM dATP, 2 mM dGTP, 2 mM dTTP in TE buffer) •1 mM Cy3-dCTP (NEN Life Science, cat. no. NEL 576) •1 mM Cy5-dCTP (NEN Life Science, cat. no. NEL 577) •Manual array hybridization buffer (see REAGENT SETUP) •3 M NaAc, pH 5.2 •Human Cot1 DNA (Invitrogen, cat. no. 15279-101) •20% formamide solution •50% formamide/2× SSC •PBS/0.05% Tween 20 •Automated array pre/hybridization buffer (see REAGENT SETUP) •Herring sperm DNA (Sigma, cat. no. D7290) •0.1× SSC •PBS/0.05% Tween 20/2 mM cysteamine •Cysteamine (Sigma, cat. no. M9768)

    Techniques: Labeling, Microarray