lipofectamine 2000 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher lipofectamine 2000 reagent
    Integrin αvβ3 and fibronectin cooperate to maintain slug expression (A), total cell extracts from HT1080 and 786-0 cells after treatment with β3 integrin, fibronectin or control siRNA compared to <t>Lipofectamine</t> 2000 alone (Mock) were probed for FN, β3 integrin, snail, twist and slug. Ponceau S (PS) staining shows protein loading. (B), total cell extracts from HT1080 and 786-0 cells after treatment with slug or control siRNA were probed for slug, β3 integrin and FN. Ponceau S (PS) staining shows protein loading. (C), 786-0 and HT1080 cells embedded in fibrin for 24 hours were analyzed for invadopodia formation after transfection with siRNA against slug or control siRNA. ***P
    Lipofectamine 2000 Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 80161 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lipofectamine 2000 reagent/product/Thermo Fisher
    Average 99 stars, based on 80161 article reviews
    Price from $9.99 to $1999.99
    lipofectamine 2000 reagent - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher lipofectamine 2000
    Transfection efficiency and stability of the mimics or inhibitor and effects of miR-140-5p in A549 cells on the Smad/TGF-β1 and Wnt1/β-catenin signaling pathways. miR-140-5p mimics, miR-140-5p mimic-NC, miR-140-5p inhibitor, and miR-140-5p inhibitor-NC were individually mixed with <t>Lipofectamine</t> 2000 (Invitrogen, Carlsbad, CA, USA) and placed into the cell culture to transfect A549 cells. After 48 h of transfection, (a) fluorescence expression of transfected cells after miR-140-5p mimics, miR-140-5p mimic-NC, miR-140-5p inhibitor, and miR-140-5p inhibitor-NC transfection (×50); (b) transfection efficiency of miR-140-5p mimics, miR-140-5p mimic-NC, miR-140-5p inhibitor, and miR-140-5p inhibitor-NC; (c) and (d) relative miR-140-5p expression levels were determined by qRT-PCR; (e)–(h) Wnt1, β-catenin, p-Smad3, and TGF-β1 expression levels were measured by Western blot analysis. Data from three independent experiments are presented as mean ± SD. * P
    Lipofectamine 2000, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 472848 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lipofectamine 2000/product/Thermo Fisher
    Average 99 stars, based on 472848 article reviews
    Price from $9.99 to $1999.99
    lipofectamine 2000 - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher lipofectamine rnaimax
    IRF3 is phosphorylated, translocates to the nucleus, and binds the CXCL10 promoter in HT29 cells in response to addition of poly(I:C). A , Western blots of HT29 cells were stimulated with poly(I:C) alone ( Poly(I:C) , 2.5 μg/ml) or transfected with poly(I:C) using <t>Lipofectamine</t> <t>RNAimax</t> ( LF + Poly(I:C) , 0–1200 min) and stained with antibodies against phospho-IRF3 Ser-396 , total IRF3, phosphor-p65 Ser-536 , total p65, or GAPDH. The results are representative of two independent experiments. MW , molecular weight. B and C , nuclear accumulation of IRF3 ( B ) and IRF1 ( C ) in HT29 cells left untreated ( 0 ), stimulated with poly(I:C) (5–2 μg/ml), or transfected with poly(I:C) complexed with Lipofectamine RNAimax (2 μg/ml) for 3 h or overnight ( o/n ). Stimulated cells were fixed and immunostained for IRF3 or IRF1, and cell nuclei were stained with Hoechst 3342. Cells were visualized by automated imaging, and analysis was done using ScanR. The results show the percentage of cells with positive staining of IRF3 and IRF1 in the nucleus. The results show mean ± S.D. of triplicate samples with a minimum of 1300 cells assayed and are representative of three independent experiments. D , CXCL10 promotor occupancy by IRF3 in HT29 cells after poly(I:C) (2 μg/ml) stimulation for 3 h. IRF3 binding to the CXCL10 promoter was investigated by ChIP followed by qPCR of the CXCL10 promoter region. RNA polymerase II occupancy was measured as a control. E and F , CXCL10 production ( left panels ) and IRF mRNA expression ( right panels ) in HT29 cells left untreated ( No add ), treated with siRNA against IRF3 ( E ) or IRF7 ( F ) (10 n m ), NS RNA (10 n m ), or transfection reagent alone ( LF ) for 24 h. Cells were subsequently stimulated with poly(I:C) (2.5 μg/ml) for 6 h. CXCL10 release was assessed by ELISA, whereas silencing of IRF3 and 7 was confirmed by assessing mRNA expression by qPCR using GAPDH as a reference control. The results show mean ± S.D. of triplicate samples.
    Lipofectamine Rnaimax, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 54508 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lipofectamine rnaimax/product/Thermo Fisher
    Average 99 stars, based on 54508 article reviews
    Price from $9.99 to $1999.99
    lipofectamine rnaimax - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher lipofectamine 3000
    Generation of GalNAc-T-knockout P19 cells. (A) Target sequence derived from the genomic sequence of B4galnt1 exon 1 was inserted into the GeneArt CRISPR nuclease vector. P19 cells were transfected with the vector using the <t>Lipofectamine</t> 3000 reagent. (B) Sequencing of the neighboring target region in exon 1 of the B4galnt1 gene of CRIPR/Cas9 vector-transfected P19 cells. Parts of the B4galnt1 gene from 3 different subcloned cells were amplified by PCR and subcloned into a TOPO cloning vector. Eight TOPO vectors derived from 3 subcloned cells (subclones 1 to 3) were sequenced. All target sites in the vectors contained the 14-nucleotide deletion, and neither other deletions nor original sequence were detected. Gray squares indicate the target sequences. (C) P19 neurons were fixed and stained with an Alexa Fluor 647-labeled CTB (magenta) or anti-GT1b mAb and Alexa Fluor 488-labeled anti-mouse IgG antibody (green). DAPI was used to stain the nuclei (blue). Differential interference contrast (DIC) and fluorescence images were collected using confocal microscopy. Neither CTB, which binds GM1, nor GT1b (using an anti-GT1b mAb) were detected on GalNAc-T-knockout P19 cells. WT and KO indicate wild-type and GalNAc-T-knockout cells, respectively. Scale bars indicate 10 μm.
    Lipofectamine 3000, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 43082 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lipofectamine 3000/product/Thermo Fisher
    Average 99 stars, based on 43082 article reviews
    Price from $9.99 to $1999.99
    lipofectamine 3000 - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher lipofectamine ltx
    Schematic illustration and characterization of pCMV-T7-HH-EV71-HDV dual-promoter EV-A71 infectious clone. (A) To construct the dual-promoter infectious clone, a T7 promoter was inserted right after the transcription start site of the CMV promoter and upstream of the HH ribozyme sequence. Arrows indicate transcription start sites for CMV and T7 promoters. CMV promoter-derived transcripts carry the T7 promoter sequence and will be removed by HH ribozyme to ensure a precise 5’ end. T7 promoter-derived transcripts carry the HH ribozyme upstream of the EV-A71 5’ UTR to ensure removal of non-viral nucleotides. (B) The plaque morphologies of the pCMV-EV71 and pCMV-T7-HH-EV71-HDV at 72 hours post-infection. The virus titers at 72 hours post-transfection of the (C) DNA and (D) in vitro synthesized RNA into RD cells using <t>Lipofectamine</t> <t>LTX</t> and TransIT-mRNA, respectively. Error bars indicate standard deviations of the mean values.
    Lipofectamine Ltx, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 30183 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lipofectamine ltx/product/Thermo Fisher
    Average 99 stars, based on 30183 article reviews
    Price from $9.99 to $1999.99
    lipofectamine ltx - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher lipofectamine reagent
    Interactions of ATF-2 with JunD in vitro as measured by glutathionine S -transferase (GST)-ATF-2 pull-down assays. A : human ATF-2 amino acid sequence. The basic region and leucine-zipper area were indicated by green and red colors, respectively. B : GST-ATF-2 fusion proteins: schematic diagram depicting various GST-ATF-2 constructs( a ); and GST-ATF-2 fusion proteins as measured by Coomassie blue staining assays( b ). Constructs were transformed into Eschericia coli BL21, and their expression was induced by treatment with isopropyl-b-d-thiogalactopyranoside (IPTG) at the concentration of 0.5 mM. Expressed GST (without ATF-2) or GST-ATF-2 fusion proteins were harvested and purified by equilibrated MagneGST particles. These fusion proteins were monitored by SDS-PAGE analysis and shown by Coomassie blue staining. C : ATF-2 association with JunD in cells overexpressing JunD. Cells were transfected by using the expression vector containing human junD cDNA by <t>LipofectAMINE</t> technique; whole cell lysates were harvested 48 h after the transfection. The magnetic particles bound to GST or GST-ATF-2 fusion proteins were incubated with cell lysate for 30 min, dissolved in 1× SDS loading buffer, and then subjected to SDS-PAGE. Levels of JunD in the complexes pull-down by using GST or GST-ATF-2 fusion proteins were measured by Western blot analysis with the antibody against JunD ( top ), whereas input GST or GST-ATF-2 fusion proteins were examined by using anti-GST antibody ( bottom ). Three experiments were performed that showed similar results. D : levels of JunD protein in the complexes pull-down by GST-ATF-2 fusion proteins GST-505 ( a ) and GST-176 ( b ) from control cells and cells treated with DFMO alone or DFMO plus Put for 6 days.
    Lipofectamine Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 22249 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lipofectamine reagent/product/Thermo Fisher
    Average 99 stars, based on 22249 article reviews
    Price from $9.99 to $1999.99
    lipofectamine reagent - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    92
    Thermo Fisher lipofectamine rnai max
    BRD4-NUT blocks NMC cellular differentiation by inhibiting c- fos transcription. A, HCC2429 cells were transfected with control siRNA or NUT siRNA#1 by <t>Lipofectamine</t> <t>RNAi</t> Max. Cells were harvested and lysed at indicated times post-transfection. Total cell lysates were resolved on SDS-PAGE and analyzed using indicated antibodies in Western blot. B, HCC2429 cells were transfected with control siRNA or NUT siRNA#1. Total RNA was extracted at 24 h post-transfection. Relative mRNA levels of selected genes were measured by RT-qPCR and normalized to the GAPDH mRNA level. Values represent the average of three independent experiments with error bars indicating standard deviation. C, HCC2429 cells were treated with siRNAs described in B . RNA extraction and RT-qPCR were performed at indicated times post-transfection. The mRNAs of BRD4-NUT and c- fos were normalized to GAPDH mRNA levels and presented as the ratio of transcript in knockdown sample relative to control sample at each time point. Values represent the average of three independent experiments with error bars indicating standard deviation.
    Lipofectamine Rnai Max, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 4747 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lipofectamine rnai max/product/Thermo Fisher
    Average 92 stars, based on 4747 article reviews
    Price from $9.99 to $1999.99
    lipofectamine rnai max - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    99
    Thermo Fisher lipofectamine 2000 kit
    Properties of N-BLR. a ISH of the tissue microarray (described in Additional file 3 : Figure S5) shows differential expression of N-BLR in colon cancer (Adenocarcinoma) and normal colon (Normal tissue). Hematoxylin and eosin (H E) staining of matched tissues was added to distinguish tissue morphology. Increasing magnifications were provide to evaluate the distribution of N-BLR in the nucleus and in the cytoplasm of cells (5X, 20X, and 60X). b Image analysis of ISH was conducted to measure the expression levels of N-BLR in the different tissues. Adenocarcinoma and metastatic colon cancer tissues expressed higher levels of N-BLR compared with normal colon tissue. There were not significant differences between normal tissue and benign/polyp and colitis tissues. c ISH data on cytoplasmic/nuclear localization of N-BLR. The full arrows point to cytoplasm and the dashed arrows to nucleus. Those two cellular compartments were identified using H E staining. The H E staining and ISH for N-BLR were done on serial sections; therefore, perfect overlapping of tissue morphology did not occur between the two images that show the same tissue area. d PARP-1 expression following transfection of Colo320 and SW620 cells with siRNAs (N-BLR siRNA1 + 3 pool) against N-BLR. Profiling was carried out at 96 and 120 h of siRNA transfection. e left Expression of survivin, c-IAP-1, XIAP after 96 h following transfection of Colo320 and SW620 cells with siRNAs (N-BLR siRNA1 + 3 pool) against N-BLR. right Quantification of survivin, c-IAP-1, XIAP in Colo320 cells. f Activity of Caspase 3/7, Caspase 8, and Caspase 9 following transfection of Colo320 and SW620 cells with siRNAs (N-BLR siRNA1 + 3 pool) against N-BLR. Profiling was carried out after 96 and 120 h (siR = N-BLR siRNA 1 + 3 pool; Ctr = scramble control siRNA; N = <t>lipofectamine</t> only; GAPDH was used as loading control). (Student’s t-test; * p
    Lipofectamine 2000 Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2133 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lipofectamine 2000 kit/product/Thermo Fisher
    Average 99 stars, based on 2133 article reviews
    Price from $9.99 to $1999.99
    lipofectamine 2000 kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Integrin αvβ3 and fibronectin cooperate to maintain slug expression (A), total cell extracts from HT1080 and 786-0 cells after treatment with β3 integrin, fibronectin or control siRNA compared to Lipofectamine 2000 alone (Mock) were probed for FN, β3 integrin, snail, twist and slug. Ponceau S (PS) staining shows protein loading. (B), total cell extracts from HT1080 and 786-0 cells after treatment with slug or control siRNA were probed for slug, β3 integrin and FN. Ponceau S (PS) staining shows protein loading. (C), 786-0 and HT1080 cells embedded in fibrin for 24 hours were analyzed for invadopodia formation after transfection with siRNA against slug or control siRNA. ***P

    Journal: Cancer research

    Article Title: Integrin αvβ3 and fibronectin upregulate Slug in cancer cells to promote clot invasion and metastasis

    doi: 10.1158/0008-5472.CAN-13-0602

    Figure Lengend Snippet: Integrin αvβ3 and fibronectin cooperate to maintain slug expression (A), total cell extracts from HT1080 and 786-0 cells after treatment with β3 integrin, fibronectin or control siRNA compared to Lipofectamine 2000 alone (Mock) were probed for FN, β3 integrin, snail, twist and slug. Ponceau S (PS) staining shows protein loading. (B), total cell extracts from HT1080 and 786-0 cells after treatment with slug or control siRNA were probed for slug, β3 integrin and FN. Ponceau S (PS) staining shows protein loading. (C), 786-0 and HT1080 cells embedded in fibrin for 24 hours were analyzed for invadopodia formation after transfection with siRNA against slug or control siRNA. ***P

    Article Snippet: Cells were transfected in Opti-MEM medium (Invitrogen) using LipofectAMINE 2000 reagent (Invitrogen) according to manufacturer instructions.

    Techniques: Expressing, Staining, Transfection

    ARV-p10 protein expression in B16 melanoma cells using NP-ARV. (a) The expression of the ARV-p10 protein (upper panel) and housekeeping GAPDH (lower panel) transcripts was determined by RT-PCR 48 hours posttransfection. A representative gel containing DNA ladder (L, lane 1), PCR blank control (control, lane 2), nontransfected cells (parental, lane 3), Lipofectamine pIRES-ARV-transfected cells (Lipo-ARV, lane 4), and NP-ARV-transfected cells (lane 5). (b) Expression of ARV-p10 protein determined by immunofluorescence. B16 (upper panel), Lipo-ARV-transfected B16 cells (middle panel), and NP-ARV-transfected B16 cells (lower panel) stained with DAPI (left column) and with an antibody against ARV-p10 protein (middle column). Merge is shown in the right column. (c) Syncytium formation 48 h posttransfection of B16 cells (upper panel), Lipo-ARV-transfected B16 cells (middle panel), and NP-ARV-transfected B16 cells (lower panel) stained with DAPI (left column) and CellMask (middle column). Merge is shown in the right column. White arrows mark fusion points. (d) Quantification of syncytia 48 hours posttransfection by hemacolor stain. (e) Cell viability was evaluated at 24, 48, and 120 hours posttransfection and was normalized against nontransfected cells. Graphs correspond to average ± standard error of three independent experiments. Statistical analyses were performed using the Mann-Whitney test ( ∗ p

    Journal: BioMed Research International

    Article Title: Chitosan-Based Delivery of Avian Reovirus Fusogenic Protein p10 Gene: In Vitro and In Vivo Studies towards a New Vaccine against Melanoma

    doi: 10.1155/2020/4045760

    Figure Lengend Snippet: ARV-p10 protein expression in B16 melanoma cells using NP-ARV. (a) The expression of the ARV-p10 protein (upper panel) and housekeeping GAPDH (lower panel) transcripts was determined by RT-PCR 48 hours posttransfection. A representative gel containing DNA ladder (L, lane 1), PCR blank control (control, lane 2), nontransfected cells (parental, lane 3), Lipofectamine pIRES-ARV-transfected cells (Lipo-ARV, lane 4), and NP-ARV-transfected cells (lane 5). (b) Expression of ARV-p10 protein determined by immunofluorescence. B16 (upper panel), Lipo-ARV-transfected B16 cells (middle panel), and NP-ARV-transfected B16 cells (lower panel) stained with DAPI (left column) and with an antibody against ARV-p10 protein (middle column). Merge is shown in the right column. (c) Syncytium formation 48 h posttransfection of B16 cells (upper panel), Lipo-ARV-transfected B16 cells (middle panel), and NP-ARV-transfected B16 cells (lower panel) stained with DAPI (left column) and CellMask (middle column). Merge is shown in the right column. White arrows mark fusion points. (d) Quantification of syncytia 48 hours posttransfection by hemacolor stain. (e) Cell viability was evaluated at 24, 48, and 120 hours posttransfection and was normalized against nontransfected cells. Graphs correspond to average ± standard error of three independent experiments. Statistical analyses were performed using the Mann-Whitney test ( ∗ p

    Article Snippet: ARV-p10 Protein ExpressionFor ARV-p10 detection, B16 cells at a confluence of 40-60% were transfected with NPs of chitosan and pIRES-ARV (N/P 20) and Lipofectamine (Invitrogen, 11668027).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Transfection, Immunofluorescence, Staining, MANN-WHITNEY

    Transfection efficiency and stability of the mimics or inhibitor and effects of miR-140-5p in A549 cells on the Smad/TGF-β1 and Wnt1/β-catenin signaling pathways. miR-140-5p mimics, miR-140-5p mimic-NC, miR-140-5p inhibitor, and miR-140-5p inhibitor-NC were individually mixed with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) and placed into the cell culture to transfect A549 cells. After 48 h of transfection, (a) fluorescence expression of transfected cells after miR-140-5p mimics, miR-140-5p mimic-NC, miR-140-5p inhibitor, and miR-140-5p inhibitor-NC transfection (×50); (b) transfection efficiency of miR-140-5p mimics, miR-140-5p mimic-NC, miR-140-5p inhibitor, and miR-140-5p inhibitor-NC; (c) and (d) relative miR-140-5p expression levels were determined by qRT-PCR; (e)–(h) Wnt1, β-catenin, p-Smad3, and TGF-β1 expression levels were measured by Western blot analysis. Data from three independent experiments are presented as mean ± SD. * P

    Journal: International Journal of Immunopathology and Pharmacology

    Article Title: Amelioration of paraquat-induced pulmonary fibrosis in mice by regulating miR-140-5p expression with the fibrogenic inhibitor Xuebijing

    doi: 10.1177/2058738420923911

    Figure Lengend Snippet: Transfection efficiency and stability of the mimics or inhibitor and effects of miR-140-5p in A549 cells on the Smad/TGF-β1 and Wnt1/β-catenin signaling pathways. miR-140-5p mimics, miR-140-5p mimic-NC, miR-140-5p inhibitor, and miR-140-5p inhibitor-NC were individually mixed with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) and placed into the cell culture to transfect A549 cells. After 48 h of transfection, (a) fluorescence expression of transfected cells after miR-140-5p mimics, miR-140-5p mimic-NC, miR-140-5p inhibitor, and miR-140-5p inhibitor-NC transfection (×50); (b) transfection efficiency of miR-140-5p mimics, miR-140-5p mimic-NC, miR-140-5p inhibitor, and miR-140-5p inhibitor-NC; (c) and (d) relative miR-140-5p expression levels were determined by qRT-PCR; (e)–(h) Wnt1, β-catenin, p-Smad3, and TGF-β1 expression levels were measured by Western blot analysis. Data from three independent experiments are presented as mean ± SD. * P

    Article Snippet: For transfection, miR-140-5p mimic, miR-140-5p mimic-negative control (NC), miR-140-5p inhibitor, and miR-140-5p inhibitor-NC were mixed individually with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA).

    Techniques: Transfection, Cell Culture, Fluorescence, Expressing, Quantitative RT-PCR, Western Blot

    NO 2 -FAs suppress STING signaling and release of type I IFN. ( A and B ) THP-1 cells and ( C and D ) BMMs (WT mice) were treated with indicated NO 2 -FAs (5–10 µM) or OA/LA (10 µM) 15 min before stimulation with dsDNA (4 µg/mL) or infection with HSV-2 (MOI 1) or left untreated (Ut). After 20 h, supernatants were harvested and analyzed for type I IFN. Data represent one of two independent experiments and are presented as mean ± SEM. ( E – G ) THP-1 cells were treated with NO 2 -FAs (10 µM) or OA/LA (10 µM) 15 min before stimulation with cGAMP (4 µg/mL) or dsDNA (4 µg/mL) using Lipofectamine2000 (Lipo). After 3 h, lysates were separated by SDS/PAGE, and indicated proteins were detected by Western blotting using specific antibodies. STING and IRF3 dimers were detected using nondenaturing and nonreducing conditions. Vinculin was used as loading control.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Nitro-fatty acids are formed in response to virus infection and are potent inhibitors of STING palmitoylation and signaling

    doi: 10.1073/pnas.1806239115

    Figure Lengend Snippet: NO 2 -FAs suppress STING signaling and release of type I IFN. ( A and B ) THP-1 cells and ( C and D ) BMMs (WT mice) were treated with indicated NO 2 -FAs (5–10 µM) or OA/LA (10 µM) 15 min before stimulation with dsDNA (4 µg/mL) or infection with HSV-2 (MOI 1) or left untreated (Ut). After 20 h, supernatants were harvested and analyzed for type I IFN. Data represent one of two independent experiments and are presented as mean ± SEM. ( E – G ) THP-1 cells were treated with NO 2 -FAs (10 µM) or OA/LA (10 µM) 15 min before stimulation with cGAMP (4 µg/mL) or dsDNA (4 µg/mL) using Lipofectamine2000 (Lipo). After 3 h, lysates were separated by SDS/PAGE, and indicated proteins were detected by Western blotting using specific antibodies. STING and IRF3 dimers were detected using nondenaturing and nonreducing conditions. Vinculin was used as loading control.

    Article Snippet: For transfection setups, 4 µg/mL dsDNA (HSV-60; InvivoGen) and 4 µL/mL Lipofectamine2000 (Invitrogen) were used according to the manufacturer’s instructions.

    Techniques: Mouse Assay, Infection, SDS Page, Western Blot

    Induction of IRF-10, IRF-4, IRF-8, cIRF-3, IRF-1, IRF-2, and c- rel expression by dsRNA (dsR). Fibroblasts cultivated for 2 weeks after explantation from chicken embryos were treated with pI · pC (10 μg/ml) (lanes 1 to 6) by using LipofectAMIN 2000 (LF) as described in Materials and Methods. Parallel cultures were simultaneously treated with cycloheximide (CHX; 10 μg/ml) (lanes 7 to 9). The control cells were treated with cycloheximide (lanes 10 to 12) from Sigma or LipofectAMIN 2000 (lanes 13 to 15) alone. RNA was isolated from these cells at the time points indicated. Total RNA (10 μg per lane) was subjected to Northern analysis and hybridized with probes described in Materials and Methods. The intensity of the rRNA staining with ethidium bromide is shown at the bottom (rRNA).

    Journal: Molecular and Cellular Biology

    Article Title: A Novel Interferon Regulatory Factor (IRF), IRF-10, Has a Unique Role in Immune Defense and Is Induced by the v-Rel Oncoprotein

    doi: 10.1128/MCB.22.11.3942-3957.2002

    Figure Lengend Snippet: Induction of IRF-10, IRF-4, IRF-8, cIRF-3, IRF-1, IRF-2, and c- rel expression by dsRNA (dsR). Fibroblasts cultivated for 2 weeks after explantation from chicken embryos were treated with pI · pC (10 μg/ml) (lanes 1 to 6) by using LipofectAMIN 2000 (LF) as described in Materials and Methods. Parallel cultures were simultaneously treated with cycloheximide (CHX; 10 μg/ml) (lanes 7 to 9). The control cells were treated with cycloheximide (lanes 10 to 12) from Sigma or LipofectAMIN 2000 (lanes 13 to 15) alone. RNA was isolated from these cells at the time points indicated. Total RNA (10 μg per lane) was subjected to Northern analysis and hybridized with probes described in Materials and Methods. The intensity of the rRNA staining with ethidium bromide is shown at the bottom (rRNA).

    Article Snippet: The cells were washed with Opti-MEM I medium (Gibco BRL Life Technologies) and overlaid with 10 μg of pI · pC (Sigma Chemical Co.) per ml and 10 μl of LipofectAMIN 2000 (Gibco BRL Life Technologies) per ml in 8 ml of Opti-MEM I per plate.

    Techniques: Expressing, Isolation, Northern Blot, Staining

    The effects of Tg737 over expression on cell adhesion, invasion, and migration in hypoxia-treated HCC cells.  HepG2 and MHCC97-H cells were treated as detailed in the legend to Figure   4 . ( A ) An adhesion assay was used to evaluate the effects of Tg737 on adhesion. The values of the cells incubated with medium supplemented with 10% FBS under normoxia were set at 1. ( B, C ) The stained membrane after cell invasion demonstrated that Tg737 over expression in HepG2 and MHCC97-H cells led to significantly attenuated cell invasion under hypoxic conditions compared to cells without plasmid transfection under hypoxic conditions. The data are presented as the number of invading cells for each group. ( D, E ) The effects of Tg737 over expression on the migration capacity of hypoxia-treated HCC cells were investigated using a transwell migration assay. The data are presented as the number of migrated cells for each group. I: cells without plasmid transfection; II: cells transfected with pcDNA3.1 (−); III: cells incubated with LipofectamineTM 2000; IV: cells transfected with pcDNA3.1-Tg737.  * ,  P

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    Article Title: Tg737 signaling is required for hypoxia-enhanced invasion and migration of hepatoma cells

    doi: 10.1186/1756-9966-31-75

    Figure Lengend Snippet: The effects of Tg737 over expression on cell adhesion, invasion, and migration in hypoxia-treated HCC cells. HepG2 and MHCC97-H cells were treated as detailed in the legend to Figure  4 . ( A ) An adhesion assay was used to evaluate the effects of Tg737 on adhesion. The values of the cells incubated with medium supplemented with 10% FBS under normoxia were set at 1. ( B, C ) The stained membrane after cell invasion demonstrated that Tg737 over expression in HepG2 and MHCC97-H cells led to significantly attenuated cell invasion under hypoxic conditions compared to cells without plasmid transfection under hypoxic conditions. The data are presented as the number of invading cells for each group. ( D, E ) The effects of Tg737 over expression on the migration capacity of hypoxia-treated HCC cells were investigated using a transwell migration assay. The data are presented as the number of migrated cells for each group. I: cells without plasmid transfection; II: cells transfected with pcDNA3.1 (−); III: cells incubated with LipofectamineTM 2000; IV: cells transfected with pcDNA3.1-Tg737. * , P

    Article Snippet: Transient transfection and cell adhesion, invasion and migration assays The pcDNA3.1-Tg737 plasmid was transiently transfected into HepG2 and MHCC97-H cells using LipofectamineTM 2000 (Invitrogen).

    Techniques: Over Expression, Migration, Cell Adhesion Assay, Incubation, Staining, Plasmid Preparation, Transfection, Transwell Migration Assay

    ( A) The cells were harvested with ice-cold PBS and lysed, and polycystin-1 levels were determined using western blot analysis.  The expression levels of polycystin-1 in HepG2 and MHCC97-H cells were decreased in response to hypoxia. ( B ) The cells were subjected to ELISA for analysis of the secretion of polycystin-1, IL-8 and TGF-β1. I: cells incubated with medium supplemented with 10% FBS under normoxia; II: cells incubated with medium supplemented with 1% FBS under normoxia; III: cells incubated with medium supplemented with 1% FBS under hypoxia. The values of the cells incubated with medium supplemented with 10% FBS under normoxia were set at 100%. ( C ) Western blot assays showed increased polycystin-1 protein expression levels in hypoxia-cultured HepG2 and MHCC97-H cells transfected with pcDNA3.1-Tg737. ( D ) ELISA revealed increased polycystin-1 secretion and decreased IL-8 secretion and decreased active and total TGF-β1 levels in hypoxia-cultured HepG2 and MHCC97-H cells transfected with pcDNA3.1-Tg737. The values of cells without plasmid transfection were set at 100%. I: cells without plasmid transfection; II: cells transfected with pcDNA3.1 (−); III: cells incubated with LipofectamineTM 2000; IV: cells transfected with pcDNA3.1-Tg737.  * ,  P

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    Article Title: Tg737 signaling is required for hypoxia-enhanced invasion and migration of hepatoma cells

    doi: 10.1186/1756-9966-31-75

    Figure Lengend Snippet: ( A) The cells were harvested with ice-cold PBS and lysed, and polycystin-1 levels were determined using western blot analysis. The expression levels of polycystin-1 in HepG2 and MHCC97-H cells were decreased in response to hypoxia. ( B ) The cells were subjected to ELISA for analysis of the secretion of polycystin-1, IL-8 and TGF-β1. I: cells incubated with medium supplemented with 10% FBS under normoxia; II: cells incubated with medium supplemented with 1% FBS under normoxia; III: cells incubated with medium supplemented with 1% FBS under hypoxia. The values of the cells incubated with medium supplemented with 10% FBS under normoxia were set at 100%. ( C ) Western blot assays showed increased polycystin-1 protein expression levels in hypoxia-cultured HepG2 and MHCC97-H cells transfected with pcDNA3.1-Tg737. ( D ) ELISA revealed increased polycystin-1 secretion and decreased IL-8 secretion and decreased active and total TGF-β1 levels in hypoxia-cultured HepG2 and MHCC97-H cells transfected with pcDNA3.1-Tg737. The values of cells without plasmid transfection were set at 100%. I: cells without plasmid transfection; II: cells transfected with pcDNA3.1 (−); III: cells incubated with LipofectamineTM 2000; IV: cells transfected with pcDNA3.1-Tg737. * , P

    Article Snippet: Transient transfection and cell adhesion, invasion and migration assays The pcDNA3.1-Tg737 plasmid was transiently transfected into HepG2 and MHCC97-H cells using LipofectamineTM 2000 (Invitrogen).

    Techniques: Western Blot, Expressing, Enzyme-linked Immunosorbent Assay, Incubation, Cell Culture, Transfection, Plasmid Preparation

    Western blot assay was performed to determine the expression levels of Tg737 in the different cells. The HepG2 and MHCC97-H cells were transiently transfected with the pcDNA3.1-Tg737 plasmid. To exclude liposome/vector-related effects, HepG2 and MHCC97-H cells transfected with pcDNA3.1 (−) or incubated with LipofectamineTM 2000 alone were used as controls. HepG2 and MHCC97-H cells without plasmid transfection also served as blank controls. The cells were incubated with fresh DMEM (1% FBS) for 12 h under hypoxia, then lysed and subjected to immunoblot analysis.

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    Article Title: Tg737 signaling is required for hypoxia-enhanced invasion and migration of hepatoma cells

    doi: 10.1186/1756-9966-31-75

    Figure Lengend Snippet: Western blot assay was performed to determine the expression levels of Tg737 in the different cells. The HepG2 and MHCC97-H cells were transiently transfected with the pcDNA3.1-Tg737 plasmid. To exclude liposome/vector-related effects, HepG2 and MHCC97-H cells transfected with pcDNA3.1 (−) or incubated with LipofectamineTM 2000 alone were used as controls. HepG2 and MHCC97-H cells without plasmid transfection also served as blank controls. The cells were incubated with fresh DMEM (1% FBS) for 12 h under hypoxia, then lysed and subjected to immunoblot analysis.

    Article Snippet: Transient transfection and cell adhesion, invasion and migration assays The pcDNA3.1-Tg737 plasmid was transiently transfected into HepG2 and MHCC97-H cells using LipofectamineTM 2000 (Invitrogen).

    Techniques: Western Blot, Expressing, Transfection, Plasmid Preparation, Incubation

    (A, B) HepG2 and MHCC97-H cells were treated as detailed in the legend to Figure 4 . Annexin V assays revealed that the cell viability of HepG2 and MHCC97-H cells transfected with pcDNA3.1-Tg737 and further incubated with fresh DMEM (1% FBS) for 12 h under hypoxia were not significantly different from cells without plasmid transfection. The data from HepG2 and MHCC97-H cells transfected with pcDNA3.1 (−) or incubated with LipofectamineTM 2000 excluded any liposome/pEGFP-C1-related effects on cell viability.I: cells without plasmid transfection; II: cells transfected with pcDNA3.1 (−); III: cells incubated with LipofectamineTM 2000; IV: cells transfected with pcDNA3.1-Tg737.

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    Article Title: Tg737 signaling is required for hypoxia-enhanced invasion and migration of hepatoma cells

    doi: 10.1186/1756-9966-31-75

    Figure Lengend Snippet: (A, B) HepG2 and MHCC97-H cells were treated as detailed in the legend to Figure 4 . Annexin V assays revealed that the cell viability of HepG2 and MHCC97-H cells transfected with pcDNA3.1-Tg737 and further incubated with fresh DMEM (1% FBS) for 12 h under hypoxia were not significantly different from cells without plasmid transfection. The data from HepG2 and MHCC97-H cells transfected with pcDNA3.1 (−) or incubated with LipofectamineTM 2000 excluded any liposome/pEGFP-C1-related effects on cell viability.I: cells without plasmid transfection; II: cells transfected with pcDNA3.1 (−); III: cells incubated with LipofectamineTM 2000; IV: cells transfected with pcDNA3.1-Tg737.

    Article Snippet: Transient transfection and cell adhesion, invasion and migration assays The pcDNA3.1-Tg737 plasmid was transiently transfected into HepG2 and MHCC97-H cells using LipofectamineTM 2000 (Invitrogen).

    Techniques: Transfection, Incubation, Plasmid Preparation

    Transfection efficiency of PEI-Fe 3 O 4 /siRNA complexes. (A) Fluorescence microscopy image of LX-2 cells transfected with PEI-Fe 3 O 4 /siRNA complexes (original magnification, ×200). Red fluorescence indicates Cy3-labeled siRNA, while blue fluorescence represents DAPI-stained nuclei. The scale bar represents 100 µm. (B) Transfection efficiency (percentage of cells transfected) of LX-2 cells transfected with PEI-Fe 3 O 4 /siRNA complexes and Lipo 2000/siRNA. PEI-Fe 3 O 4 , polyethyleneimine-functionalized magnetic iron oxide; siRNA, small interfering RNA; cy3, Cyanine 3; Lipo 2000, Lipofectamine 2000.

    Journal: Molecular Medicine Reports

    Article Title: Antifibrotic effects of specific siRNA targeting connective tissue growth factor delivered by polyethyleneimine-functionalized magnetic iron oxide nanoparticles on LX-2 cells

    doi: 10.3892/mmr.2019.10834

    Figure Lengend Snippet: Transfection efficiency of PEI-Fe 3 O 4 /siRNA complexes. (A) Fluorescence microscopy image of LX-2 cells transfected with PEI-Fe 3 O 4 /siRNA complexes (original magnification, ×200). Red fluorescence indicates Cy3-labeled siRNA, while blue fluorescence represents DAPI-stained nuclei. The scale bar represents 100 µm. (B) Transfection efficiency (percentage of cells transfected) of LX-2 cells transfected with PEI-Fe 3 O 4 /siRNA complexes and Lipo 2000/siRNA. PEI-Fe 3 O 4 , polyethyleneimine-functionalized magnetic iron oxide; siRNA, small interfering RNA; cy3, Cyanine 3; Lipo 2000, Lipofectamine 2000.

    Article Snippet: The transfection efficiency of PEI-Fe3 O4 NPs was measured and compared with that of the naked siRNA and the standard transfection reagent Lipofectamine® 2000 (Lipo 2000; Invitrogen; Thermo Fisher Scientific, Inc.).

    Techniques: Transfection, Fluorescence, Microscopy, Labeling, Staining, Small Interfering RNA

    Upregulation of Cx43 rescues rMC-1 from HG-induced apoptosis. Western blot analysis shows Cx43 plasmid transfection upregulates Cx43 expression in rMC-1 grown in HG. ( A ) Representative WB image shows Cx43 expression is increased through Cx43p plasmid

    Journal: Investigative Ophthalmology & Visual Science

    Article Title: High Glucose Alters Cx43 Expression and Gap Junction Intercellular Communication in Retinal Müller Cells: Promotes Müller Cell and Pericyte Apoptosis

    doi: 10.1167/iovs.14-14606

    Figure Lengend Snippet: Upregulation of Cx43 rescues rMC-1 from HG-induced apoptosis. Western blot analysis shows Cx43 plasmid transfection upregulates Cx43 expression in rMC-1 grown in HG. ( A ) Representative WB image shows Cx43 expression is increased through Cx43p plasmid

    Article Snippet: To determine whether Cx43 upregulation rescues cells from HG-induced apoptosis, rMC-1 were grown for 7 days in HG medium and transfected with plasmid pEGFPN1 containing full-length Cx43 cDNA or empty vector as control using transfection reagent (Lipofectamine 2000; Invitrogen) at a ratio of 1 μL of transfection reagent (Invitrogen) for every 1 μg plasmid DNA.

    Techniques: Western Blot, Plasmid Preparation, Transfection, Expressing

    IRF3 is phosphorylated, translocates to the nucleus, and binds the CXCL10 promoter in HT29 cells in response to addition of poly(I:C). A , Western blots of HT29 cells were stimulated with poly(I:C) alone ( Poly(I:C) , 2.5 μg/ml) or transfected with poly(I:C) using Lipofectamine RNAimax ( LF + Poly(I:C) , 0–1200 min) and stained with antibodies against phospho-IRF3 Ser-396 , total IRF3, phosphor-p65 Ser-536 , total p65, or GAPDH. The results are representative of two independent experiments. MW , molecular weight. B and C , nuclear accumulation of IRF3 ( B ) and IRF1 ( C ) in HT29 cells left untreated ( 0 ), stimulated with poly(I:C) (5–2 μg/ml), or transfected with poly(I:C) complexed with Lipofectamine RNAimax (2 μg/ml) for 3 h or overnight ( o/n ). Stimulated cells were fixed and immunostained for IRF3 or IRF1, and cell nuclei were stained with Hoechst 3342. Cells were visualized by automated imaging, and analysis was done using ScanR. The results show the percentage of cells with positive staining of IRF3 and IRF1 in the nucleus. The results show mean ± S.D. of triplicate samples with a minimum of 1300 cells assayed and are representative of three independent experiments. D , CXCL10 promotor occupancy by IRF3 in HT29 cells after poly(I:C) (2 μg/ml) stimulation for 3 h. IRF3 binding to the CXCL10 promoter was investigated by ChIP followed by qPCR of the CXCL10 promoter region. RNA polymerase II occupancy was measured as a control. E and F , CXCL10 production ( left panels ) and IRF mRNA expression ( right panels ) in HT29 cells left untreated ( No add ), treated with siRNA against IRF3 ( E ) or IRF7 ( F ) (10 n m ), NS RNA (10 n m ), or transfection reagent alone ( LF ) for 24 h. Cells were subsequently stimulated with poly(I:C) (2.5 μg/ml) for 6 h. CXCL10 release was assessed by ELISA, whereas silencing of IRF3 and 7 was confirmed by assessing mRNA expression by qPCR using GAPDH as a reference control. The results show mean ± S.D. of triplicate samples.

    Journal: The Journal of Biological Chemistry

    Article Title: Surface Toll-like receptor 3 expression in metastatic intestinal epithelial cells induces inflammatory cytokine production and promotes invasiveness

    doi: 10.1074/jbc.M117.784090

    Figure Lengend Snippet: IRF3 is phosphorylated, translocates to the nucleus, and binds the CXCL10 promoter in HT29 cells in response to addition of poly(I:C). A , Western blots of HT29 cells were stimulated with poly(I:C) alone ( Poly(I:C) , 2.5 μg/ml) or transfected with poly(I:C) using Lipofectamine RNAimax ( LF + Poly(I:C) , 0–1200 min) and stained with antibodies against phospho-IRF3 Ser-396 , total IRF3, phosphor-p65 Ser-536 , total p65, or GAPDH. The results are representative of two independent experiments. MW , molecular weight. B and C , nuclear accumulation of IRF3 ( B ) and IRF1 ( C ) in HT29 cells left untreated ( 0 ), stimulated with poly(I:C) (5–2 μg/ml), or transfected with poly(I:C) complexed with Lipofectamine RNAimax (2 μg/ml) for 3 h or overnight ( o/n ). Stimulated cells were fixed and immunostained for IRF3 or IRF1, and cell nuclei were stained with Hoechst 3342. Cells were visualized by automated imaging, and analysis was done using ScanR. The results show the percentage of cells with positive staining of IRF3 and IRF1 in the nucleus. The results show mean ± S.D. of triplicate samples with a minimum of 1300 cells assayed and are representative of three independent experiments. D , CXCL10 promotor occupancy by IRF3 in HT29 cells after poly(I:C) (2 μg/ml) stimulation for 3 h. IRF3 binding to the CXCL10 promoter was investigated by ChIP followed by qPCR of the CXCL10 promoter region. RNA polymerase II occupancy was measured as a control. E and F , CXCL10 production ( left panels ) and IRF mRNA expression ( right panels ) in HT29 cells left untreated ( No add ), treated with siRNA against IRF3 ( E ) or IRF7 ( F ) (10 n m ), NS RNA (10 n m ), or transfection reagent alone ( LF ) for 24 h. Cells were subsequently stimulated with poly(I:C) (2.5 μg/ml) for 6 h. CXCL10 release was assessed by ELISA, whereas silencing of IRF3 and 7 was confirmed by assessing mRNA expression by qPCR using GAPDH as a reference control. The results show mean ± S.D. of triplicate samples.

    Article Snippet: Silencing of TLR3 and TRIF SW620 or HT29 cells were transfected for 24–48 h with 10–20 nm siRNA against TLR3 (TLR3_5, Qiagen, SI02630768; TLR3_8, Qiagen, SI02655156) or non-silencing control siRNA (Qiagen, SI03650325) using Lipofectamine RNAiMAX (Invitrogen) for TLR3 knockdown or with siRNA against TICAM-1/TRIF (Ambion, s45115) for TICAM/TRIF knockdown using Lipofectamine RNAiMAX. siRNA and transfection reagent (ratio, 1:2) were preincubated for 15 min in RPMI medium before being added to newly seeded cells.

    Techniques: Western Blot, Transfection, Staining, Molecular Weight, Imaging, Binding Assay, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Expressing, Enzyme-linked Immunosorbent Assay

    IFNβ is induced in IECs in response to transfection with poly(I:C) but not in response to poly(I:C) addition. A , HT29 cells were left untreated ( 0 ) or stimulated with poly(I:C) (50, 25, 10, 5, 2.5, 1.25, 0.63, 0.31, and 0.15 μg/ml) for 20 h before CXCL10 in the supernatant was assessed by ELISA. B , kinetics of CXCL10 release assessed by ELISA in supernatant from HT29 cells stimulated with poly(I:C) (2.5 μg/ml) for 0, 3, 5, 12, 20, and 24 h. The results are presented as mean ± S.D. of triplicates. C , IFNβ mRNA induction in HT29, HCT116, SW620, SW480, and Caco-2 cells treated with poly(I:C) (2 μg/ml) alone ( Poly(I:C) ), transfected with poly(I:C) complexed with Lipofectamine RNAimax ( LF + Poly(I:C) , 2 μg/ml), or treated with only Lipofectamine RNAimax ( LF ) for 20 h. IFNβ mRNA induction was determined by qPCR. The results are presented as relative induction compared with medium-treated Caco-2 cells. GAPDH served as an internal control. Results show mean -fold induction ± S.D. of triplicates. D , IFNβ protein production in HT29, HCT116, SW620, SW480, and Caco-2 cells treated with poly(I:C) (2 μg/ml) alone, transfected with poly(I:C) complexed with Lipofectamine RNAimax (2 μg/ml), or treated with only Lipofectamine RNAimax for 20 h. IFNβ in the supernatant was assessed by ELISA, and the results show mean ± S.D. of three samples. E , HT29 cells were stimulated with poly(I:C) (2.5 μg/ml) for 0, 3, 6, 12, 20, or 24 h before CXCL10 and IFNβ mRNA induction was determined by qPCR. The results show relative induction with a non-treated sample as reference. GAPDH served as an internal control. The results show mean -fold induction ± S.D. of triplicates. F , CXCL10 mRNA induction in HT29 cells pretreated with cycloheximide (0, 15, or 30 μg/ml) for 30 min prior to stimulation with poly(I:C) (2.5 μg/ml) for 8 h. CXCL10 mRNA was determined by qPCR (normalized to medium control and the endogenous control TBP). G , viability in HT29 cells left untreated ( 0 ) or stimulated with poly(I:C) (50, 25, 10, 5, 2.5, 1.25, 0.63, 0.31, and 0.15 μg/ml) for 20 h before viability was assessed using the MTT assay. The MTT assay results were normalized to an untreated sample. H , viability in IECs left untreated ( 0 ), stimulated with poly(I:C) alone (2 μg/ml), transfected with poly(I:C) using Lipofectamine RNAimax (2 μg/ml), or treated with only Lipofectamine RNAimax for 43 h before the viability of the cells was assessed using the MTT assay. The MTT assay results were normalized to an untreated sample. The results show mean ± S.D. of five samples. All results are representative of at least two independent experiments.

    Journal: The Journal of Biological Chemistry

    Article Title: Surface Toll-like receptor 3 expression in metastatic intestinal epithelial cells induces inflammatory cytokine production and promotes invasiveness

    doi: 10.1074/jbc.M117.784090

    Figure Lengend Snippet: IFNβ is induced in IECs in response to transfection with poly(I:C) but not in response to poly(I:C) addition. A , HT29 cells were left untreated ( 0 ) or stimulated with poly(I:C) (50, 25, 10, 5, 2.5, 1.25, 0.63, 0.31, and 0.15 μg/ml) for 20 h before CXCL10 in the supernatant was assessed by ELISA. B , kinetics of CXCL10 release assessed by ELISA in supernatant from HT29 cells stimulated with poly(I:C) (2.5 μg/ml) for 0, 3, 5, 12, 20, and 24 h. The results are presented as mean ± S.D. of triplicates. C , IFNβ mRNA induction in HT29, HCT116, SW620, SW480, and Caco-2 cells treated with poly(I:C) (2 μg/ml) alone ( Poly(I:C) ), transfected with poly(I:C) complexed with Lipofectamine RNAimax ( LF + Poly(I:C) , 2 μg/ml), or treated with only Lipofectamine RNAimax ( LF ) for 20 h. IFNβ mRNA induction was determined by qPCR. The results are presented as relative induction compared with medium-treated Caco-2 cells. GAPDH served as an internal control. Results show mean -fold induction ± S.D. of triplicates. D , IFNβ protein production in HT29, HCT116, SW620, SW480, and Caco-2 cells treated with poly(I:C) (2 μg/ml) alone, transfected with poly(I:C) complexed with Lipofectamine RNAimax (2 μg/ml), or treated with only Lipofectamine RNAimax for 20 h. IFNβ in the supernatant was assessed by ELISA, and the results show mean ± S.D. of three samples. E , HT29 cells were stimulated with poly(I:C) (2.5 μg/ml) for 0, 3, 6, 12, 20, or 24 h before CXCL10 and IFNβ mRNA induction was determined by qPCR. The results show relative induction with a non-treated sample as reference. GAPDH served as an internal control. The results show mean -fold induction ± S.D. of triplicates. F , CXCL10 mRNA induction in HT29 cells pretreated with cycloheximide (0, 15, or 30 μg/ml) for 30 min prior to stimulation with poly(I:C) (2.5 μg/ml) for 8 h. CXCL10 mRNA was determined by qPCR (normalized to medium control and the endogenous control TBP). G , viability in HT29 cells left untreated ( 0 ) or stimulated with poly(I:C) (50, 25, 10, 5, 2.5, 1.25, 0.63, 0.31, and 0.15 μg/ml) for 20 h before viability was assessed using the MTT assay. The MTT assay results were normalized to an untreated sample. H , viability in IECs left untreated ( 0 ), stimulated with poly(I:C) alone (2 μg/ml), transfected with poly(I:C) using Lipofectamine RNAimax (2 μg/ml), or treated with only Lipofectamine RNAimax for 43 h before the viability of the cells was assessed using the MTT assay. The MTT assay results were normalized to an untreated sample. The results show mean ± S.D. of five samples. All results are representative of at least two independent experiments.

    Article Snippet: Silencing of TLR3 and TRIF SW620 or HT29 cells were transfected for 24–48 h with 10–20 nm siRNA against TLR3 (TLR3_5, Qiagen, SI02630768; TLR3_8, Qiagen, SI02655156) or non-silencing control siRNA (Qiagen, SI03650325) using Lipofectamine RNAiMAX (Invitrogen) for TLR3 knockdown or with siRNA against TICAM-1/TRIF (Ambion, s45115) for TICAM/TRIF knockdown using Lipofectamine RNAiMAX. siRNA and transfection reagent (ratio, 1:2) were preincubated for 15 min in RPMI medium before being added to newly seeded cells.

    Techniques: Transfection, Enzyme-linked Immunosorbent Assay, Real-time Polymerase Chain Reaction, MTT Assay

    Functional characteristics of miR-548aq-3p as anti-angiogenic miRNAs. ( A ) Healthy ECFCs were transduced with mock lentivirus (M) or lentivirus overexpressing miR-548aq-3p (OE). 48 hours after transduction, total RNA was extracted and the expression levels of miR-548aq-3p were quantified by RT-qPCR. ( B ) Representative images from the tube formation assays of non-transduced controls treated with or without 10 nM vinblastine (VB), mock infected (M) and miR-548aq-3p overexpressed (OE) healthy ECFCs (original magnification 10×, scale bar 300 μm). ( C ) Quantitative data of total tube length (left panel), number of tubes ( > 30 μm) (middle panel) and number of branched cells (right panel) in ( B ). ( D ) CAD ECFCs were transfected with mock (M) or miR-548aq-3p inhibitor (KD) using Lipofectamine RNAiMAX. 48 hours after transfection, total RNA was extracted and the expression levels of miR-548aq-3p were quantified by RT-qPCR. ( E ) Representative images from the tube formation assay of CAD ECFCs treated with or without 10 nM vinblastine (VB), mock transfected (M) and miR-548aq-3p knockdown (KD) (original magnification 10×, scale bar 300 μm). ( F ) Quantitative data of total tube length (left panel), number of tubes ( > 30 μm) (middle panel) and number of branched cells (right panel) in ( E ).

    Journal: Scientific Reports

    Article Title: miR-548aq-3p is a novel target of Far infrared radiation which predicts coronary artery disease endothelial colony forming cell responsiveness

    doi: 10.1038/s41598-020-63311-1

    Figure Lengend Snippet: Functional characteristics of miR-548aq-3p as anti-angiogenic miRNAs. ( A ) Healthy ECFCs were transduced with mock lentivirus (M) or lentivirus overexpressing miR-548aq-3p (OE). 48 hours after transduction, total RNA was extracted and the expression levels of miR-548aq-3p were quantified by RT-qPCR. ( B ) Representative images from the tube formation assays of non-transduced controls treated with or without 10 nM vinblastine (VB), mock infected (M) and miR-548aq-3p overexpressed (OE) healthy ECFCs (original magnification 10×, scale bar 300 μm). ( C ) Quantitative data of total tube length (left panel), number of tubes ( > 30 μm) (middle panel) and number of branched cells (right panel) in ( B ). ( D ) CAD ECFCs were transfected with mock (M) or miR-548aq-3p inhibitor (KD) using Lipofectamine RNAiMAX. 48 hours after transfection, total RNA was extracted and the expression levels of miR-548aq-3p were quantified by RT-qPCR. ( E ) Representative images from the tube formation assay of CAD ECFCs treated with or without 10 nM vinblastine (VB), mock transfected (M) and miR-548aq-3p knockdown (KD) (original magnification 10×, scale bar 300 μm). ( F ) Quantitative data of total tube length (left panel), number of tubes ( > 30 μm) (middle panel) and number of branched cells (right panel) in ( E ).

    Article Snippet: To knockdown miR-548aq-3p in ECFCs, a commercial synthetic miRIDIAN microRNA Hairpin Inhibitor (hsa-miR-548aq-3p, IH-302531-01-0005) (Dharmacon, Lafayette, CO, USA) was added to the culture medium at a final concentration of 20 nM at 70~80% cell confluence using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen, CA, USA).

    Techniques: Functional Assay, Transduction, Expressing, Quantitative RT-PCR, Infection, Transfection, Tube Formation Assay

    Intracellular amount of emodin in K562/ADM and K562 cells. Both cells were incubated with various concentrations of emodin (0.1–10 μM) at 37°C or 4°C for 2 h (A); K562/ADM cells were co-treated with 0, 1, 3, 10 μM of verapamil or 0, 2, 4, 10 μM of cyclosporine A and emodin (5 μM) for 2 h (B). RNAi of P-gp (C). A-: K562/ADM cells transfected with negative control siRNA; AL: K562/ADM cells transfected with Lipofectamine RNAiMAX Reagent; AP: K562/ADM cells transfected with P-gp siRNA; A: K562/ADM cells; S: K562 cells. After transfection with P-gp siRNA, intracellular amount of emodin (5 μM) was enhanced compared with other control groups (D). Data were represented as the mean ± S.D. of three independent experiments. * P

    Journal: PLoS ONE

    Article Title: Emodin reverses leukemia multidrug resistance by competitive inhibition and downregulation of P-glycoprotein

    doi: 10.1371/journal.pone.0187971

    Figure Lengend Snippet: Intracellular amount of emodin in K562/ADM and K562 cells. Both cells were incubated with various concentrations of emodin (0.1–10 μM) at 37°C or 4°C for 2 h (A); K562/ADM cells were co-treated with 0, 1, 3, 10 μM of verapamil or 0, 2, 4, 10 μM of cyclosporine A and emodin (5 μM) for 2 h (B). RNAi of P-gp (C). A-: K562/ADM cells transfected with negative control siRNA; AL: K562/ADM cells transfected with Lipofectamine RNAiMAX Reagent; AP: K562/ADM cells transfected with P-gp siRNA; A: K562/ADM cells; S: K562 cells. After transfection with P-gp siRNA, intracellular amount of emodin (5 μM) was enhanced compared with other control groups (D). Data were represented as the mean ± S.D. of three independent experiments. * P

    Article Snippet: The Lipofectamine RNAiMAX Reagent was purchased from Invitrogen Trading Co., Ltd (Shanghai, China).

    Techniques: Incubation, Transfection, Negative Control

    Novel PKC silencing reverses CM-PA mediated drop in insulin-stimulated phosphorylation of Akt and AS160. L6-GLUT4myc myoblasts were incubated with non-related siRNA (NR), siRNA to PKCθ (PKCθ siRNA), siRNA to PKCε (PKCε siRNA) or a combination of both (PKCθ+ε) using lipofectamine RNAi-max reagent. A and C , knockdown efficiency PKCθ and PKCε, respectively. B , L6-GLUT4myc myoblasts were treated for 24 h with RM, CM-BSA, CM-PA or CM-PA supplemented with siRNA to PKCθ (PKCθ siRNA). After 24 h, cells were lysed and each sample was immunoblotted with specific antibodies against phospho-PKCε (Ser729) and total-PKCε. Results are the means ± SE of three separate experiments *Significantly different from CM-BSA, P

    Journal: PLoS ONE

    Article Title: Palmitate-Activated Macrophages Confer Insulin Resistance to Muscle Cells by a Mechanism Involving Protein Kinase C ? and ?

    doi: 10.1371/journal.pone.0026947

    Figure Lengend Snippet: Novel PKC silencing reverses CM-PA mediated drop in insulin-stimulated phosphorylation of Akt and AS160. L6-GLUT4myc myoblasts were incubated with non-related siRNA (NR), siRNA to PKCθ (PKCθ siRNA), siRNA to PKCε (PKCε siRNA) or a combination of both (PKCθ+ε) using lipofectamine RNAi-max reagent. A and C , knockdown efficiency PKCθ and PKCε, respectively. B , L6-GLUT4myc myoblasts were treated for 24 h with RM, CM-BSA, CM-PA or CM-PA supplemented with siRNA to PKCθ (PKCθ siRNA). After 24 h, cells were lysed and each sample was immunoblotted with specific antibodies against phospho-PKCε (Ser729) and total-PKCε. Results are the means ± SE of three separate experiments *Significantly different from CM-BSA, P

    Article Snippet: For PKCθ and PKCε knockdown, L6GLUT4myc myoblasts were treated with 100 nM siRNA to PKCθ (PKCθ siRNA) ( AACCTCAAGGCCGAATGCTAA ) or siRNA to PKCε (PKCε siRNA) ( CACGATGAGTTCGTCACTGAT ) or a combination of both at 100 nM each using lipofectamine RNAi-max reagent (Invitrogen).

    Techniques: Incubation

    Generation of GalNAc-T-knockout P19 cells. (A) Target sequence derived from the genomic sequence of B4galnt1 exon 1 was inserted into the GeneArt CRISPR nuclease vector. P19 cells were transfected with the vector using the Lipofectamine 3000 reagent. (B) Sequencing of the neighboring target region in exon 1 of the B4galnt1 gene of CRIPR/Cas9 vector-transfected P19 cells. Parts of the B4galnt1 gene from 3 different subcloned cells were amplified by PCR and subcloned into a TOPO cloning vector. Eight TOPO vectors derived from 3 subcloned cells (subclones 1 to 3) were sequenced. All target sites in the vectors contained the 14-nucleotide deletion, and neither other deletions nor original sequence were detected. Gray squares indicate the target sequences. (C) P19 neurons were fixed and stained with an Alexa Fluor 647-labeled CTB (magenta) or anti-GT1b mAb and Alexa Fluor 488-labeled anti-mouse IgG antibody (green). DAPI was used to stain the nuclei (blue). Differential interference contrast (DIC) and fluorescence images were collected using confocal microscopy. Neither CTB, which binds GM1, nor GT1b (using an anti-GT1b mAb) were detected on GalNAc-T-knockout P19 cells. WT and KO indicate wild-type and GalNAc-T-knockout cells, respectively. Scale bars indicate 10 μm.

    Journal: PLoS ONE

    Article Title: CRISPR/Cas9-Mediated Genomic Deletion of the Beta-1, 4 N-acetylgalactosaminyltransferase 1 Gene in Murine P19 Embryonal Carcinoma Cells Results in Low Sensitivity to Botulinum Neurotoxin Type C

    doi: 10.1371/journal.pone.0132363

    Figure Lengend Snippet: Generation of GalNAc-T-knockout P19 cells. (A) Target sequence derived from the genomic sequence of B4galnt1 exon 1 was inserted into the GeneArt CRISPR nuclease vector. P19 cells were transfected with the vector using the Lipofectamine 3000 reagent. (B) Sequencing of the neighboring target region in exon 1 of the B4galnt1 gene of CRIPR/Cas9 vector-transfected P19 cells. Parts of the B4galnt1 gene from 3 different subcloned cells were amplified by PCR and subcloned into a TOPO cloning vector. Eight TOPO vectors derived from 3 subcloned cells (subclones 1 to 3) were sequenced. All target sites in the vectors contained the 14-nucleotide deletion, and neither other deletions nor original sequence were detected. Gray squares indicate the target sequences. (C) P19 neurons were fixed and stained with an Alexa Fluor 647-labeled CTB (magenta) or anti-GT1b mAb and Alexa Fluor 488-labeled anti-mouse IgG antibody (green). DAPI was used to stain the nuclei (blue). Differential interference contrast (DIC) and fluorescence images were collected using confocal microscopy. Neither CTB, which binds GM1, nor GT1b (using an anti-GT1b mAb) were detected on GalNAc-T-knockout P19 cells. WT and KO indicate wild-type and GalNAc-T-knockout cells, respectively. Scale bars indicate 10 μm.

    Article Snippet: Generation of GalNAc-T-depleted P19 cells Undifferentiated P19 cells were transfected with the CRISPR/Cas9 vector and Lipofectamine 3000 (Life Technologies) according to the manufacturer’s instructions.

    Techniques: Knock-Out, Sequencing, Derivative Assay, CRISPR, Plasmid Preparation, Transfection, Amplification, Polymerase Chain Reaction, Clone Assay, Staining, Labeling, CtB Assay, Fluorescence, Confocal Microscopy

    siRNA-mediated silencing of PCGF isoforms increases  E. chaffeensis  infection. THP-1 cells were transfected with isoform-specific siRNA and then infected with  E. chaffeensis  at 24 h posttransfection. (A) Alexa Fluor 488-conjugated siRNA-transfected cell, showing high efficiency of RNA transfection using Lipofectamine 3000. (B) Western blot analysis of the total cell lysate from control and siRNA-transfected THP-1 cells confirmed the decrease in PCGF2, PCGF3, PCGF4, and PCGF5 48 h posttransfection. GAPDH was used as the loading control. The relative abundance of PCGF isoforms in siRNA-transfected cells was determined after normalization to the loading control and then represented as the percentage remaining after the knockdown. (C) Table representing the percentage increase in ehrlichial morulae and the average number of morulae/cell for each PCGF isoform-specific knockdown. The average morula counts were determined by counting the number of morula present in each field of view and then dividing that by the number of cells counted. The experiment was repeated three times in duplicate, and the values shown are means ± standard deviations (Stdev). (D) The fold change in ehrlichial infection was determined by comparing the ehrlichial  dsb  to the host cell  gapdh  in individual PCGF knockdown using real-time qPCR at 48 hpi ( n  = 3; *,  P  ≤ 0.05).

    Journal: Infection and Immunity

    Article Title: Ehrlichia chaffeensis TRP120 Effector Targets and Recruits Host Polycomb Group Proteins for Degradation To Promote Intracellular Infection

    doi: 10.1128/IAI.00845-17

    Figure Lengend Snippet: siRNA-mediated silencing of PCGF isoforms increases E. chaffeensis infection. THP-1 cells were transfected with isoform-specific siRNA and then infected with E. chaffeensis at 24 h posttransfection. (A) Alexa Fluor 488-conjugated siRNA-transfected cell, showing high efficiency of RNA transfection using Lipofectamine 3000. (B) Western blot analysis of the total cell lysate from control and siRNA-transfected THP-1 cells confirmed the decrease in PCGF2, PCGF3, PCGF4, and PCGF5 48 h posttransfection. GAPDH was used as the loading control. The relative abundance of PCGF isoforms in siRNA-transfected cells was determined after normalization to the loading control and then represented as the percentage remaining after the knockdown. (C) Table representing the percentage increase in ehrlichial morulae and the average number of morulae/cell for each PCGF isoform-specific knockdown. The average morula counts were determined by counting the number of morula present in each field of view and then dividing that by the number of cells counted. The experiment was repeated three times in duplicate, and the values shown are means ± standard deviations (Stdev). (D) The fold change in ehrlichial infection was determined by comparing the ehrlichial dsb to the host cell gapdh in individual PCGF knockdown using real-time qPCR at 48 hpi ( n = 3; *, P ≤ 0.05).

    Article Snippet: Briefly, specific siRNA (3 μl) and Lipofectamine 3000 reagent (7.5 μl) were added to Opti-MEM medium (250 μl) (Invitrogen), incubated for 5 min at room temperature, and then added to the cell suspension in a 6-well plate.

    Techniques: Infection, Transfection, Western Blot, Real-time Polymerase Chain Reaction

    MiR-181d-5p targets KLF6 to ameliorate H/R injury. HK-2 cells were co-transfected with the KLF6 plasmid and miR-181d-5p mimic with Lipofectamine 3000 and, 72 h later, were treated with hypoxia (l% oxygen) for 24 h/reoxygenation for 3 h. (A,B) Quantitative analysis of HIF1-α, KIM-1, and caspase-3 expression in HK-2 cells treated with or without miR-181d-5p and KLF6 ( n = 4 or 5 per group). (C) ELISAs were used to measure 1L-6 and TNF-α expression levels in the cell supernatant ( n = 4 per group). The data are presented as the means ± SDs. ∗ P

    Journal: Frontiers in Physiology

    Article Title: MiR-181d-5p Targets KLF6 to Improve Ischemia/Reperfusion-Induced AKI Through Effects on Renal Function, Apoptosis, and Inflammation

    doi: 10.3389/fphys.2020.00510

    Figure Lengend Snippet: MiR-181d-5p targets KLF6 to ameliorate H/R injury. HK-2 cells were co-transfected with the KLF6 plasmid and miR-181d-5p mimic with Lipofectamine 3000 and, 72 h later, were treated with hypoxia (l% oxygen) for 24 h/reoxygenation for 3 h. (A,B) Quantitative analysis of HIF1-α, KIM-1, and caspase-3 expression in HK-2 cells treated with or without miR-181d-5p and KLF6 ( n = 4 or 5 per group). (C) ELISAs were used to measure 1L-6 and TNF-α expression levels in the cell supernatant ( n = 4 per group). The data are presented as the means ± SDs. ∗ P

    Article Snippet: After 24 h, 293T cells were co-transfected with the miR-181d mimic or a scrambled miRNA sequence and PGL3-KLF6-wt or PFL3-KLF6-mut using Lipofectamine 3000 transfection reagent (L3000015, Thermo Fisher Scientific, Waltham, MA, United States).

    Techniques: Transfection, Plasmid Preparation, Expressing

    KLF6 overexpression exacerbated the hypoxia-induced decline in renal function, renal tubular cell apoptosis, and inflammatory response. HK-2 cells were transfected with KLF6 plasmid and KLF6 shRNA plasmid or scrambled plasmid with Lipofectamine 3000 and, 72 h later, were incubated in normoxia (control) or treated with hypoxia (1% oxygen) for 24 h/reoxygenation for 3 h. (A) KLF6 protein expression in HK-2 cells treated with or without KLF6 ( n = 3 per group). (B,C) qRT-PCR was used to measure miR-181d-5p, KIM-1 and HIF1-α levels after KLF6 transfection ( n = 5 per group). (D) Annexin V-FITC/PI double staining was utilized to evaluate apoptosis after KLF6 transfection. This experiment was repeated three times. (E) KLF6 increased NF-KB expression. HK-2 cells were transfected with or without the KLF6 plasmid. The results shown are from Western blot analysis of NF-KB and I-KB. β-Actin and Lamin-A were used as internal controls for I-KB and NF-KB, respectively ( n = 3 per group). (F) ELISAs were used to measure 1L-6 and TNF-α expression levels in the cell supernatant ( n = 3 per group). The data are presented as the means ± SDs. * P

    Journal: Frontiers in Physiology

    Article Title: MiR-181d-5p Targets KLF6 to Improve Ischemia/Reperfusion-Induced AKI Through Effects on Renal Function, Apoptosis, and Inflammation

    doi: 10.3389/fphys.2020.00510

    Figure Lengend Snippet: KLF6 overexpression exacerbated the hypoxia-induced decline in renal function, renal tubular cell apoptosis, and inflammatory response. HK-2 cells were transfected with KLF6 plasmid and KLF6 shRNA plasmid or scrambled plasmid with Lipofectamine 3000 and, 72 h later, were incubated in normoxia (control) or treated with hypoxia (1% oxygen) for 24 h/reoxygenation for 3 h. (A) KLF6 protein expression in HK-2 cells treated with or without KLF6 ( n = 3 per group). (B,C) qRT-PCR was used to measure miR-181d-5p, KIM-1 and HIF1-α levels after KLF6 transfection ( n = 5 per group). (D) Annexin V-FITC/PI double staining was utilized to evaluate apoptosis after KLF6 transfection. This experiment was repeated three times. (E) KLF6 increased NF-KB expression. HK-2 cells were transfected with or without the KLF6 plasmid. The results shown are from Western blot analysis of NF-KB and I-KB. β-Actin and Lamin-A were used as internal controls for I-KB and NF-KB, respectively ( n = 3 per group). (F) ELISAs were used to measure 1L-6 and TNF-α expression levels in the cell supernatant ( n = 3 per group). The data are presented as the means ± SDs. * P

    Article Snippet: After 24 h, 293T cells were co-transfected with the miR-181d mimic or a scrambled miRNA sequence and PGL3-KLF6-wt or PFL3-KLF6-mut using Lipofectamine 3000 transfection reagent (L3000015, Thermo Fisher Scientific, Waltham, MA, United States).

    Techniques: Over Expression, Transfection, Plasmid Preparation, shRNA, Incubation, Expressing, Quantitative RT-PCR, Double Staining, Western Blot

    Schematic illustration and characterization of pCMV-T7-HH-EV71-HDV dual-promoter EV-A71 infectious clone. (A) To construct the dual-promoter infectious clone, a T7 promoter was inserted right after the transcription start site of the CMV promoter and upstream of the HH ribozyme sequence. Arrows indicate transcription start sites for CMV and T7 promoters. CMV promoter-derived transcripts carry the T7 promoter sequence and will be removed by HH ribozyme to ensure a precise 5’ end. T7 promoter-derived transcripts carry the HH ribozyme upstream of the EV-A71 5’ UTR to ensure removal of non-viral nucleotides. (B) The plaque morphologies of the pCMV-EV71 and pCMV-T7-HH-EV71-HDV at 72 hours post-infection. The virus titers at 72 hours post-transfection of the (C) DNA and (D) in vitro synthesized RNA into RD cells using Lipofectamine LTX and TransIT-mRNA, respectively. Error bars indicate standard deviations of the mean values.

    Journal: PLoS ONE

    Article Title: Enterovirus A71 DNA-Launched Infectious Clone as a Robust Reverse Genetic Tool

    doi: 10.1371/journal.pone.0162771

    Figure Lengend Snippet: Schematic illustration and characterization of pCMV-T7-HH-EV71-HDV dual-promoter EV-A71 infectious clone. (A) To construct the dual-promoter infectious clone, a T7 promoter was inserted right after the transcription start site of the CMV promoter and upstream of the HH ribozyme sequence. Arrows indicate transcription start sites for CMV and T7 promoters. CMV promoter-derived transcripts carry the T7 promoter sequence and will be removed by HH ribozyme to ensure a precise 5’ end. T7 promoter-derived transcripts carry the HH ribozyme upstream of the EV-A71 5’ UTR to ensure removal of non-viral nucleotides. (B) The plaque morphologies of the pCMV-EV71 and pCMV-T7-HH-EV71-HDV at 72 hours post-infection. The virus titers at 72 hours post-transfection of the (C) DNA and (D) in vitro synthesized RNA into RD cells using Lipofectamine LTX and TransIT-mRNA, respectively. Error bars indicate standard deviations of the mean values.

    Article Snippet: For transfection of the DNA-launched infectious clone, 2 μg of plasmid DNA was transfected into 5 × 105 RD cells in a 6-well plate using Lipofectamine LTX with PLUS Reagent (Invitrogen, USA) according to the manufacturer’s instructions.

    Techniques: Construct, Sequencing, Derivative Assay, Infection, Transfection, In Vitro, Synthesized

    Induction of apoptosis in MCF-7 cells by recombinant hemagglutinin-neuraminidase (HN) gene. MCF-7 cells were transfected with various amounts of recombinant of pDisplay/HN and cells were analyzed using flow cytometry at 48 h post transfection. Apoptosis induction was found to be dose-dependent. MCF-7 cells were also transfected with LTX reagent only and with pDisplay vector only. NTC, non-transfected MCF-7 cells. LTX, Lipofectamine ® LTX transfectant reagent. VEC, transfection with vector only. rHN, recombinant pDisplay/HN. Each bar represents the results of 3 independent experiments. Error bars indicate the standard of deviation.

    Journal: Oncology Reports

    Article Title: Induction of apoptosis in MCF-7 cells by the hemagglutinin-neuraminidase glycoprotein of Newcastle disease virus Malaysian strain AF2240

    doi: 10.3892/or.2013.2573

    Figure Lengend Snippet: Induction of apoptosis in MCF-7 cells by recombinant hemagglutinin-neuraminidase (HN) gene. MCF-7 cells were transfected with various amounts of recombinant of pDisplay/HN and cells were analyzed using flow cytometry at 48 h post transfection. Apoptosis induction was found to be dose-dependent. MCF-7 cells were also transfected with LTX reagent only and with pDisplay vector only. NTC, non-transfected MCF-7 cells. LTX, Lipofectamine ® LTX transfectant reagent. VEC, transfection with vector only. rHN, recombinant pDisplay/HN. Each bar represents the results of 3 independent experiments. Error bars indicate the standard of deviation.

    Article Snippet: For each transfection, 0.3–1.2 μg of the recombinant pDisplay-HN diluted in 100 μl of Opti-MEM® I reduced serum medium was transfected into MCF-7 cells using 1.25–10 μl of Lipofectamine® LTX Reagent according to the manufacturer’s instructions (both from Invitrogen Life Technologies).

    Techniques: Recombinant, Transfection, Flow Cytometry, Cytometry, Plasmid Preparation, Standard Deviation

    Interactions of ATF-2 with JunD in vitro as measured by glutathionine S -transferase (GST)-ATF-2 pull-down assays. A : human ATF-2 amino acid sequence. The basic region and leucine-zipper area were indicated by green and red colors, respectively. B : GST-ATF-2 fusion proteins: schematic diagram depicting various GST-ATF-2 constructs( a ); and GST-ATF-2 fusion proteins as measured by Coomassie blue staining assays( b ). Constructs were transformed into Eschericia coli BL21, and their expression was induced by treatment with isopropyl-b-d-thiogalactopyranoside (IPTG) at the concentration of 0.5 mM. Expressed GST (without ATF-2) or GST-ATF-2 fusion proteins were harvested and purified by equilibrated MagneGST particles. These fusion proteins were monitored by SDS-PAGE analysis and shown by Coomassie blue staining. C : ATF-2 association with JunD in cells overexpressing JunD. Cells were transfected by using the expression vector containing human junD cDNA by LipofectAMINE technique; whole cell lysates were harvested 48 h after the transfection. The magnetic particles bound to GST or GST-ATF-2 fusion proteins were incubated with cell lysate for 30 min, dissolved in 1× SDS loading buffer, and then subjected to SDS-PAGE. Levels of JunD in the complexes pull-down by using GST or GST-ATF-2 fusion proteins were measured by Western blot analysis with the antibody against JunD ( top ), whereas input GST or GST-ATF-2 fusion proteins were examined by using anti-GST antibody ( bottom ). Three experiments were performed that showed similar results. D : levels of JunD protein in the complexes pull-down by GST-ATF-2 fusion proteins GST-505 ( a ) and GST-176 ( b ) from control cells and cells treated with DFMO alone or DFMO plus Put for 6 days.

    Journal: American Journal of Physiology - Cell Physiology

    Article Title: Induced ATF-2 represses CDK4 transcription through dimerization with JunD inhibiting intestinal epithelial cell growth after polyamine depletion

    doi: 10.1152/ajpcell.00021.2010

    Figure Lengend Snippet: Interactions of ATF-2 with JunD in vitro as measured by glutathionine S -transferase (GST)-ATF-2 pull-down assays. A : human ATF-2 amino acid sequence. The basic region and leucine-zipper area were indicated by green and red colors, respectively. B : GST-ATF-2 fusion proteins: schematic diagram depicting various GST-ATF-2 constructs( a ); and GST-ATF-2 fusion proteins as measured by Coomassie blue staining assays( b ). Constructs were transformed into Eschericia coli BL21, and their expression was induced by treatment with isopropyl-b-d-thiogalactopyranoside (IPTG) at the concentration of 0.5 mM. Expressed GST (without ATF-2) or GST-ATF-2 fusion proteins were harvested and purified by equilibrated MagneGST particles. These fusion proteins were monitored by SDS-PAGE analysis and shown by Coomassie blue staining. C : ATF-2 association with JunD in cells overexpressing JunD. Cells were transfected by using the expression vector containing human junD cDNA by LipofectAMINE technique; whole cell lysates were harvested 48 h after the transfection. The magnetic particles bound to GST or GST-ATF-2 fusion proteins were incubated with cell lysate for 30 min, dissolved in 1× SDS loading buffer, and then subjected to SDS-PAGE. Levels of JunD in the complexes pull-down by using GST or GST-ATF-2 fusion proteins were measured by Western blot analysis with the antibody against JunD ( top ), whereas input GST or GST-ATF-2 fusion proteins were examined by using anti-GST antibody ( bottom ). Three experiments were performed that showed similar results. D : levels of JunD protein in the complexes pull-down by GST-ATF-2 fusion proteins GST-505 ( a ) and GST-176 ( b ) from control cells and cells treated with DFMO alone or DFMO plus Put for 6 days.

    Article Snippet: Transient transfection was performed with Lipofectamine Reagent from Invitrogen (Carlsbad, CA).

    Techniques: In Vitro, Sequencing, Construct, Staining, Transformation Assay, Expressing, Concentration Assay, Purification, SDS Page, Transfection, Plasmid Preparation, Incubation, Western Blot

    NGB reduces cyclin D1 expression and inhibits cell growth via merlin. (A) Protein and mRNA levels of cyclin D1 are inhibited by NGB. JS1 cells were transfected with increasing amounts of Flag-NGB and immunoblotted with indicated antibodies (panels 1 to 3). Total RNA was isolated from the cells and subjected to semiquantitative reverse transcription-PCR using primers specific for cyclin D1 and β-actin (panels 4 and 5). (B) Knockdown of NGB increases cyclin D1 level. HeLa cells were transfected with NGB-RNAi using Lipofectamine. Following 72 h of incubation, cells were lysed and immunoblotted with anti-NGB (top), -cyclin D1 (middle), and -actin (bottom) antibodies. (C) NGB-reduced cyclin D1 is abrogated by knockdown of merlin. JS1/NGB-59 cells were infected with lentivirus pLKO.1-shRNA/Nf2 and pLKO.1-puro vector and immunoblotted with indicated antibodies. (D and E) Merlin mediates NGB-inhibited cell growth and tumorigenicity. Indicated cells were seeded in 48-well plates at 0.2 × 10 5 /well. The cell number was counted daily for 3 days. The experiment was performed in triplicate (D). The cells were subcutaneously injected into nude mice (3 × 10 6 cells/mouse). Tumor volume was measured every 2 days. Data shown are representative of results from two independent experiments carried out with 16 mice each (8 mice/cell line) (E).

    Journal: Molecular and Cellular Biology

    Article Title: Identification and Characterization of Putative Tumor Suppressor NGB, a GTP-Binding Protein That Interacts with the Neurofibromatosis 2 Protein ▿

    doi: 10.1128/MCB.00572-06

    Figure Lengend Snippet: NGB reduces cyclin D1 expression and inhibits cell growth via merlin. (A) Protein and mRNA levels of cyclin D1 are inhibited by NGB. JS1 cells were transfected with increasing amounts of Flag-NGB and immunoblotted with indicated antibodies (panels 1 to 3). Total RNA was isolated from the cells and subjected to semiquantitative reverse transcription-PCR using primers specific for cyclin D1 and β-actin (panels 4 and 5). (B) Knockdown of NGB increases cyclin D1 level. HeLa cells were transfected with NGB-RNAi using Lipofectamine. Following 72 h of incubation, cells were lysed and immunoblotted with anti-NGB (top), -cyclin D1 (middle), and -actin (bottom) antibodies. (C) NGB-reduced cyclin D1 is abrogated by knockdown of merlin. JS1/NGB-59 cells were infected with lentivirus pLKO.1-shRNA/Nf2 and pLKO.1-puro vector and immunoblotted with indicated antibodies. (D and E) Merlin mediates NGB-inhibited cell growth and tumorigenicity. Indicated cells were seeded in 48-well plates at 0.2 × 10 5 /well. The cell number was counted daily for 3 days. The experiment was performed in triplicate (D). The cells were subcutaneously injected into nude mice (3 × 10 6 cells/mouse). Tumor volume was measured every 2 days. Data shown are representative of results from two independent experiments carried out with 16 mice each (8 mice/cell line) (E).

    Article Snippet: Cell culture media, protein A/G beads, and Lipofectamine Plus were from Invitrogen (Carlsbad, CA).

    Techniques: Expressing, Transfection, Isolation, Polymerase Chain Reaction, Incubation, Infection, shRNA, Plasmid Preparation, Injection, Mouse Assay

    SOD2 knockdown inhibits both the migration and invasion abilities of TSCC To characterize the role of SOD2 in aiding metastasis, the plasmid containing SOD2 shRNA was transiently transfected into UM1 cells using Lipofectamine Plus reagent. Cells were tested 24 h post-transfection. (A) Significant reduction of SOD2 protein levels and activities were observed in the SOD2 shRNA-transfected UM1 cells compared to the vector control transfected cells. *: P

    Journal: Free radical biology & medicine

    Article Title: Manganese superoxide dismutase induces migration and invasion of tongue squamous cell carcinoma via H2O2-dependent Snail signaling

    doi: 10.1016/j.freeradbiomed.2012.04.031

    Figure Lengend Snippet: SOD2 knockdown inhibits both the migration and invasion abilities of TSCC To characterize the role of SOD2 in aiding metastasis, the plasmid containing SOD2 shRNA was transiently transfected into UM1 cells using Lipofectamine Plus reagent. Cells were tested 24 h post-transfection. (A) Significant reduction of SOD2 protein levels and activities were observed in the SOD2 shRNA-transfected UM1 cells compared to the vector control transfected cells. *: P

    Article Snippet: The constructed plasmids were transiently transfected into UM1 cells using Lipofectamine Plus reagent (Invitrogen, CA, USA), according to the manufacturer's instructions[ ].

    Techniques: Migration, Plasmid Preparation, shRNA, Transfection

    Snail signaling contributes to SOD2-induced migration and invasion of TSCC To characterize the role of Snail signaling in SOD2-induced metastasis of TSCC, western blot analysis was used with actin as the loading control. Plasmids containing SOD2 shRNA were transiently transfected into UM1 cells using Lipofectamine Plus reagent. Cells were tested 24 h post-transfection. The UM2 cells or SOD2 shRNA-transfected UM1 cells were treated with 100μM H 2 O 2 for 24 h. (A) UM1 cells displayed an increase in Snai1, Snai2, MMP-1, ERK1/2 and pERK1/2 protein levels, and decreased protein levels of E-cadtherin compared to UM2 cells. (B) UM1 cells displayed decreased snai1, snai2, MMP-1, ERK1/2 and pERK1/2 protein levels and increased E-cadtherin protein levels upon SOD2 knockdown. (C, D) The addition of H 2 O 2 increased the protein levels of Snai1, Snai2, MMP-1, ERK1/2 and pERK1/2 and decreased protein levels of E-cadtherin in both UM2 cells and the SOD2 shRNA-transfected UMl cells.

    Journal: Free radical biology & medicine

    Article Title: Manganese superoxide dismutase induces migration and invasion of tongue squamous cell carcinoma via H2O2-dependent Snail signaling

    doi: 10.1016/j.freeradbiomed.2012.04.031

    Figure Lengend Snippet: Snail signaling contributes to SOD2-induced migration and invasion of TSCC To characterize the role of Snail signaling in SOD2-induced metastasis of TSCC, western blot analysis was used with actin as the loading control. Plasmids containing SOD2 shRNA were transiently transfected into UM1 cells using Lipofectamine Plus reagent. Cells were tested 24 h post-transfection. The UM2 cells or SOD2 shRNA-transfected UM1 cells were treated with 100μM H 2 O 2 for 24 h. (A) UM1 cells displayed an increase in Snai1, Snai2, MMP-1, ERK1/2 and pERK1/2 protein levels, and decreased protein levels of E-cadtherin compared to UM2 cells. (B) UM1 cells displayed decreased snai1, snai2, MMP-1, ERK1/2 and pERK1/2 protein levels and increased E-cadtherin protein levels upon SOD2 knockdown. (C, D) The addition of H 2 O 2 increased the protein levels of Snai1, Snai2, MMP-1, ERK1/2 and pERK1/2 and decreased protein levels of E-cadtherin in both UM2 cells and the SOD2 shRNA-transfected UMl cells.

    Article Snippet: The constructed plasmids were transiently transfected into UM1 cells using Lipofectamine Plus reagent (Invitrogen, CA, USA), according to the manufacturer's instructions[ ].

    Techniques: Migration, Western Blot, shRNA, Transfection

    Comparison of intracellular uptake of plasmids in different formats. Second from left: I-plasmid labeled with Cy5, third: I-plasmid labeled with Cy5 complexed with lipofectamine, fourth: shRNA labeled with Cy5, fifth: shRNA labeled with Cy5 complexed with lipofectamine and the last: I-gel labeled with Cy5. Scale bar: 20 μm

    Journal: Nature Communications

    Article Title: A RNA producing DNA hydrogel as a platform for a high performance RNA interference system

    doi: 10.1038/s41467-018-06864-0

    Figure Lengend Snippet: Comparison of intracellular uptake of plasmids in different formats. Second from left: I-plasmid labeled with Cy5, third: I-plasmid labeled with Cy5 complexed with lipofectamine, fourth: shRNA labeled with Cy5, fifth: shRNA labeled with Cy5 complexed with lipofectamine and the last: I-gel labeled with Cy5. Scale bar: 20 μm

    Article Snippet: The MDCK expressing GFP (MDCK-GFP) cells were prepared by transfecting pEGFP-N1 vector into the cells with the use of Lipofectamine reagents (Thermo Fisher Scientific) according to the manufacturer’s protocol.

    Techniques: Plasmid Preparation, Labeling, shRNA

    Gene-silencing effect by I-gel i n a cellular level. a Fluorescence images of MDCK-GFP-expressing (MDCK-GFP) cells coincubated with I-plasmid, I-plasmid complexed with lipofectamine, and I-gel. Scale bar: 20 μm. b Fluorescence-activated cell sorter analysis of GFP-expressing cell line, MDCK-GFP cells after treatment of sample/polymerase complexes in serum-deficient medium. The number means the percentage of GFP-overexpressing cells sorted within a prefixed gate region as indicated by a bar. c , d The relative amounts of ( c ) GFP mRNA and ( d ) shRNA from GFP-expressing MDCK cells after incubation in various conditions. ( † concentration of these conditions were 102-fold increased in consideration of the template to RNA transcription rate of the I-gel) ( c : * P

    Journal: Nature Communications

    Article Title: A RNA producing DNA hydrogel as a platform for a high performance RNA interference system

    doi: 10.1038/s41467-018-06864-0

    Figure Lengend Snippet: Gene-silencing effect by I-gel i n a cellular level. a Fluorescence images of MDCK-GFP-expressing (MDCK-GFP) cells coincubated with I-plasmid, I-plasmid complexed with lipofectamine, and I-gel. Scale bar: 20 μm. b Fluorescence-activated cell sorter analysis of GFP-expressing cell line, MDCK-GFP cells after treatment of sample/polymerase complexes in serum-deficient medium. The number means the percentage of GFP-overexpressing cells sorted within a prefixed gate region as indicated by a bar. c , d The relative amounts of ( c ) GFP mRNA and ( d ) shRNA from GFP-expressing MDCK cells after incubation in various conditions. ( † concentration of these conditions were 102-fold increased in consideration of the template to RNA transcription rate of the I-gel) ( c : * P

    Article Snippet: The MDCK expressing GFP (MDCK-GFP) cells were prepared by transfecting pEGFP-N1 vector into the cells with the use of Lipofectamine reagents (Thermo Fisher Scientific) according to the manufacturer’s protocol.

    Techniques: Fluorescence, Expressing, Plasmid Preparation, shRNA, Incubation, Concentration Assay

    Pex13 deficiency disrupts protein import into peroxisomes. (A) Peroxisomal protein import in cultured skin fibroblasts from wild-type (+/+) and Pex13-deficient (−/−) mice. PTS1 protein import assessed by indirect immunofluorescence using an anti-SKL antibody (SKL panels), PTS2 protein import assessed by GFP autofluorescence in cells transfected with a plasmid that expresses a PTS2-EGFP fusion protein (GFP panels), and peroxisomal membranes detected by indirect immunofluorescence using an antibody to the peroxisomal integral membrane protein PMP70 (PMP panels) are shown. Note that GFP fluorescence and PMP70 immunofluorescence are from the same cell in each case. Bars, 10 μm. (B) Transfection of Pex13 −/− cells with a plasmid that expresses wild-type, myc-tagged Pex13 rescues import of PTS1 and PTS2-EGFP protein import. myc and SKL immunofluorescence in the same cell (top) and GFP fluorescence and SKL immunofluorescence in the same cell (bottom) are shown. (C) Western blot analysis of liver homogenates to determine the levels of the peroxisomal proteins catalase, peroxisomal bifunctional protein (PBP), and PMP70. Actin levels indicate protein loading. Liver homogenates from wild-type (+/+) and heterozygous (+/−) and homozygous (−/−) knockout animals were used. (D) Electron microscopic analysis of DAB-stained liver for detection of peroxisomes (PO) in wild-type and Pex13 −/− mice. Bars, 1 μm.

    Journal: Molecular and Cellular Biology

    Article Title: Pex13 Inactivation in the Mouse Disrupts Peroxisome Biogenesis and Leads to a Zellweger Syndrome Phenotype

    doi: 10.1128/MCB.23.16.5947-5957.2003

    Figure Lengend Snippet: Pex13 deficiency disrupts protein import into peroxisomes. (A) Peroxisomal protein import in cultured skin fibroblasts from wild-type (+/+) and Pex13-deficient (−/−) mice. PTS1 protein import assessed by indirect immunofluorescence using an anti-SKL antibody (SKL panels), PTS2 protein import assessed by GFP autofluorescence in cells transfected with a plasmid that expresses a PTS2-EGFP fusion protein (GFP panels), and peroxisomal membranes detected by indirect immunofluorescence using an antibody to the peroxisomal integral membrane protein PMP70 (PMP panels) are shown. Note that GFP fluorescence and PMP70 immunofluorescence are from the same cell in each case. Bars, 10 μm. (B) Transfection of Pex13 −/− cells with a plasmid that expresses wild-type, myc-tagged Pex13 rescues import of PTS1 and PTS2-EGFP protein import. myc and SKL immunofluorescence in the same cell (top) and GFP fluorescence and SKL immunofluorescence in the same cell (bottom) are shown. (C) Western blot analysis of liver homogenates to determine the levels of the peroxisomal proteins catalase, peroxisomal bifunctional protein (PBP), and PMP70. Actin levels indicate protein loading. Liver homogenates from wild-type (+/+) and heterozygous (+/−) and homozygous (−/−) knockout animals were used. (D) Electron microscopic analysis of DAB-stained liver for detection of peroxisomes (PO) in wild-type and Pex13 −/− mice. Bars, 1 μm.

    Article Snippet: Cell transfection, using Lipofectamine 2000 (Invitrogen) and 3 μg of relevant plasmid, and indirect immunofluorescence were performed as previously described for human skin fibroblasts ( , ).

    Techniques: Cell Culture, Mouse Assay, Immunofluorescence, Transfection, Plasmid Preparation, Fluorescence, Western Blot, Knock-Out, Staining

    BRD4-NUT blocks NMC cellular differentiation by inhibiting c- fos transcription. A, HCC2429 cells were transfected with control siRNA or NUT siRNA#1 by Lipofectamine RNAi Max. Cells were harvested and lysed at indicated times post-transfection. Total cell lysates were resolved on SDS-PAGE and analyzed using indicated antibodies in Western blot. B, HCC2429 cells were transfected with control siRNA or NUT siRNA#1. Total RNA was extracted at 24 h post-transfection. Relative mRNA levels of selected genes were measured by RT-qPCR and normalized to the GAPDH mRNA level. Values represent the average of three independent experiments with error bars indicating standard deviation. C, HCC2429 cells were treated with siRNAs described in B . RNA extraction and RT-qPCR were performed at indicated times post-transfection. The mRNAs of BRD4-NUT and c- fos were normalized to GAPDH mRNA levels and presented as the ratio of transcript in knockdown sample relative to control sample at each time point. Values represent the average of three independent experiments with error bars indicating standard deviation.

    Journal: The Journal of Biological Chemistry

    Article Title: Perturbation of BRD4 Protein Function by BRD4-NUT Protein Abrogates Cellular Differentiation in NUT Midline Carcinoma *

    doi: 10.1074/jbc.M111.246975

    Figure Lengend Snippet: BRD4-NUT blocks NMC cellular differentiation by inhibiting c- fos transcription. A, HCC2429 cells were transfected with control siRNA or NUT siRNA#1 by Lipofectamine RNAi Max. Cells were harvested and lysed at indicated times post-transfection. Total cell lysates were resolved on SDS-PAGE and analyzed using indicated antibodies in Western blot. B, HCC2429 cells were transfected with control siRNA or NUT siRNA#1. Total RNA was extracted at 24 h post-transfection. Relative mRNA levels of selected genes were measured by RT-qPCR and normalized to the GAPDH mRNA level. Values represent the average of three independent experiments with error bars indicating standard deviation. C, HCC2429 cells were treated with siRNAs described in B . RNA extraction and RT-qPCR were performed at indicated times post-transfection. The mRNAs of BRD4-NUT and c- fos were normalized to GAPDH mRNA levels and presented as the ratio of transcript in knockdown sample relative to control sample at each time point. Values represent the average of three independent experiments with error bars indicating standard deviation.

    Article Snippet: For siRNA transfections, either Dharmafect 1 (Dharmacon) or Lipofectamine RNAi Max (Invitrogen) was used to transfect HCC2429 cells at about 40% confluency following the manufacturer's instructions.

    Techniques: Cell Differentiation, Transfection, SDS Page, Western Blot, Quantitative RT-PCR, Standard Deviation, RNA Extraction

    Properties of N-BLR. a ISH of the tissue microarray (described in Additional file 3 : Figure S5) shows differential expression of N-BLR in colon cancer (Adenocarcinoma) and normal colon (Normal tissue). Hematoxylin and eosin (H E) staining of matched tissues was added to distinguish tissue morphology. Increasing magnifications were provide to evaluate the distribution of N-BLR in the nucleus and in the cytoplasm of cells (5X, 20X, and 60X). b Image analysis of ISH was conducted to measure the expression levels of N-BLR in the different tissues. Adenocarcinoma and metastatic colon cancer tissues expressed higher levels of N-BLR compared with normal colon tissue. There were not significant differences between normal tissue and benign/polyp and colitis tissues. c ISH data on cytoplasmic/nuclear localization of N-BLR. The full arrows point to cytoplasm and the dashed arrows to nucleus. Those two cellular compartments were identified using H E staining. The H E staining and ISH for N-BLR were done on serial sections; therefore, perfect overlapping of tissue morphology did not occur between the two images that show the same tissue area. d PARP-1 expression following transfection of Colo320 and SW620 cells with siRNAs (N-BLR siRNA1 + 3 pool) against N-BLR. Profiling was carried out at 96 and 120 h of siRNA transfection. e left Expression of survivin, c-IAP-1, XIAP after 96 h following transfection of Colo320 and SW620 cells with siRNAs (N-BLR siRNA1 + 3 pool) against N-BLR. right Quantification of survivin, c-IAP-1, XIAP in Colo320 cells. f Activity of Caspase 3/7, Caspase 8, and Caspase 9 following transfection of Colo320 and SW620 cells with siRNAs (N-BLR siRNA1 + 3 pool) against N-BLR. Profiling was carried out after 96 and 120 h (siR = N-BLR siRNA 1 + 3 pool; Ctr = scramble control siRNA; N = lipofectamine only; GAPDH was used as loading control). (Student’s t-test; * p

    Journal: Genome Biology

    Article Title: N-BLR, a primate-specific non-coding transcript leads to colorectal cancer invasion and migration

    doi: 10.1186/s13059-017-1224-0

    Figure Lengend Snippet: Properties of N-BLR. a ISH of the tissue microarray (described in Additional file 3 : Figure S5) shows differential expression of N-BLR in colon cancer (Adenocarcinoma) and normal colon (Normal tissue). Hematoxylin and eosin (H E) staining of matched tissues was added to distinguish tissue morphology. Increasing magnifications were provide to evaluate the distribution of N-BLR in the nucleus and in the cytoplasm of cells (5X, 20X, and 60X). b Image analysis of ISH was conducted to measure the expression levels of N-BLR in the different tissues. Adenocarcinoma and metastatic colon cancer tissues expressed higher levels of N-BLR compared with normal colon tissue. There were not significant differences between normal tissue and benign/polyp and colitis tissues. c ISH data on cytoplasmic/nuclear localization of N-BLR. The full arrows point to cytoplasm and the dashed arrows to nucleus. Those two cellular compartments were identified using H E staining. The H E staining and ISH for N-BLR were done on serial sections; therefore, perfect overlapping of tissue morphology did not occur between the two images that show the same tissue area. d PARP-1 expression following transfection of Colo320 and SW620 cells with siRNAs (N-BLR siRNA1 + 3 pool) against N-BLR. Profiling was carried out at 96 and 120 h of siRNA transfection. e left Expression of survivin, c-IAP-1, XIAP after 96 h following transfection of Colo320 and SW620 cells with siRNAs (N-BLR siRNA1 + 3 pool) against N-BLR. right Quantification of survivin, c-IAP-1, XIAP in Colo320 cells. f Activity of Caspase 3/7, Caspase 8, and Caspase 9 following transfection of Colo320 and SW620 cells with siRNAs (N-BLR siRNA1 + 3 pool) against N-BLR. Profiling was carried out after 96 and 120 h (siR = N-BLR siRNA 1 + 3 pool; Ctr = scramble control siRNA; N = lipofectamine only; GAPDH was used as loading control). (Student’s t-test; * p

    Article Snippet: Transfections were performed using the Lipofectamine 2000 kit (Invitrogen) according to the manufacturer’s instructions.

    Techniques: In Situ Hybridization, Microarray, Expressing, Staining, Transfection, Activity Assay