lentiviral vector Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    ATCC lentiviral vector
    Detection of the retrotranscribed HIV-1 DNA in infected cells. (A) Schema of the HIV-1 ANCHOR system based on <t>lentiviral</t> vectors carrying on the OR-GFP cDNA under the control of CMV promoter (LV OR-GFP) and HIV-1 containing the ANCH3, the target sequence of OR proteins (HIV-1 ΔEnv IN HA ΔNef ANCH3/VSV-G). (B) HeLa P4R5 cells were transduced with LV OR-GFP. The efficiency of OR-GFP expression was monitored by Western blotting using antibody against GFP. As a loading control, samples were also blotted using antibody against actin. HeLa cells stably expressing OR-GFP infected or not with HIV-1 ΔEnv IN HA ΔNef ANCH3/VSV-G (MOI of 50) were imaged by fluorescence microscopy at 24 h postinfection using a water immersion objective in epifluorescence. The number of proviruses was detected by Alu-PCR on HeLa P4R5 OR-GFP cells infected with HIV-1 or HIV-1 ANCH3.
    Lentiviral Vector, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 233 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/ATCC
    Average 98 stars, based on 233 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-11
    98/100 stars
      Buy from Supplier

    99
    Thermo Fisher lentiviral vectors
    Knockodwn of EGFP expression using shRNA haipin and miR-21 hairpin-based shRNA-miR structures A: <t>Lentiviral</t> knockdown vectors: I) miR-21 hairpin based lentiviral vector and hairpin structure against luciferase. II) human polymerase III promoter U6-driven lentiviral shRNA vector and EGFP shRNA hairpin structure. III) mouse miR-21 hairpin based lentiviral vector and shRNA-miR hairpin against EGFP gene. B. dose response of miR21-based EGFP gene knockdown. pcFUW-miR21LUCkd-Pgk-puro was co-transfected with EGFP expression vector pcFUW-EGFP at ratio of 5:1(I), or pcFUW-miR21EGFPkd-pgk-puro was co-transfected-pcFUW-EGFP with 2:1 (II), 3:1 (III) and 5:1 (IV) ratios. EGFP expression was detected by Western Blot analysis using anti-GFP antibody. β-actin was blotted as a loading control. C. Comparison of EGFP knockdown efficiency by shRNA and miR21-based shRNA-miR system. Up panel: EGFP fluoresence was visualized in 293FT cells transfected with control vector pcFUW-miR-21LUCkd –pgk-puro(I), pcFU6W- EGFPkd-pgk-puro (II) and pcFUW-miR21EGFPkd-pgk-puro (III) with EGFP expression vector pcFUW-EGFP. Down panel: EGFP expression was detected by Western blot analysis from uppanel. D. Knockdown of EGFP expression using miR21 hairpin-based shRNA-miR directly followed CMV promoter. I: pcDNA3.1-miR-21LUCkd, as a control. II: pcDNA3.1-miR-21-EGFPkd.
    Lentiviral Vectors, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 3904 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vectors/product/Thermo Fisher
    Average 99 stars, based on 3904 article reviews
    Price from $9.99 to $1999.99
    lentiviral vectors - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    93
    Addgene inc lentiviral vector
    Genetic and site-specific display of unnatural amino acids (UAAs) on the envelope of <t>lentiviral</t> vectors. ( A ) The structure of lentiviral VSVg protein. Total 33 residues, marked in red, within VSVg were mutated in this study. ( B ) Schematic representative of lentiviral vector engineering via genetic code expansion for site-specific incorporation of UAAs (NAEK or DiZPK) on the vector surface. ( C ) Schematic representation of genetic code expansion for site-specific incorporation of UAAs. The UAAs were incorporated into VSVg protein via UAG-code and an orthogonal aaRS/tRNA.
    Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 2021 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Addgene inc
    Average 93 stars, based on 2021 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-11
    93/100 stars
      Buy from Supplier

    94
    Addgene inc lentiviral vectors
    Binding of <t>lentiviral</t> vectors mediated by soluble PtdSer-recognizing molecules. (A) Schematic representation of chimeric Sindbis virus Envs. The Sindbis virus Env is first synthesized as a polypeptide and subsequently cleaved by cellular proteases to generate E3, E2, 6K, and E1 proteins. E1 and E2 are incorporated into the viral envelope. Both the 2.2 and 2.2 1L1L pseudotypes are derived from the wild-type Sindbis virus Env with four mutations (red lines) to reduce their binding to original receptors while maintaining fusion activity. In addition, 2.2 1L1L has two flexible linkers (Gly-Gly-Gly-Gly-Ser) at amino acid (a.a.) 70 of the E2 protein, and 2.2 contains the IgG-binding domain of protein A (ZZ), which was inserted into the E2 region at amino acid 70. (B) Expression levels of Axl (red line), integrin αVβ3 (blue line), and integrin αVβ5 (green line) were analyzed by flow cytometry after staining with antibodies specific to each antigen. The isotype of all antibodies was IgG1; thus, an IgG1 isotype control antibody was used for negative-control staining (black line). (C) Schematic representation of recombinant hGas6, hMFG-E8, mMFG-E8, and D89E, a mutant of MFG-E8 that cannot bind integrins. Gla, γ-carboxyglutamic acid domain; EGF, E1, and E2, epidermal growth factor-like domains; SHBG, sex hormone-binding globulin domain; C1 and C2, discoid domains; P/T, proline/threonine-enriched motif. The γ-carboxyglutamic acid domain of Gas6 and the C2 domain of MFG-E8 bind PtdSer. (D) Staining of HMVECs with an APC-conjugated anti-Flag tag antibody after incubation with hGas6 (red line), mMFG-E8 (blue line), or D89E (green line). The black line represents staining without prior incubation with any ligand. (E) Binding of the EGFP-labeled 2.2 1L1L pseudotype to HMVECs after incubation with hGas6, hMFG-E8, or mMFG-E8. Black line, HMVECs without virus; red line, HMVECs with virus with or without the bridging molecules indicated in the figure. The MFI values correspond to those for EGFP signals, which increase upon binding of EGFP-labeled virus. This experiment was repeated twice in singlicate and once in triplicate, and the MFI values shown are the averages and standard deviations of the triplicate experiment; representative flow cytometry histograms are shown. Significance was calculated by comparing the value of virus binding without a bridging molecule to the value of virus binding in the presence of the bridging molecules indicated in the figure using a two-sample Student t test (**, P
    Lentiviral Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1906 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vectors/product/Addgene inc
    Average 94 stars, based on 1906 article reviews
    Price from $9.99 to $1999.99
    lentiviral vectors - by Bioz Stars, 2020-11
    94/100 stars
      Buy from Supplier

    94
    Thermo Fisher lentiviral vector
    Generation of PC-3 prostate cancer cells expressing varying levels of PTHrP. PTHrP expression was reduced in PC- 3 Luc cells via <t>lentiviral</t> shRNA. (A) PTHrP protein levels were measured from the culture supernatant by IRMA. Data are average of two measurements ± S.D. Assays were repeated more than three times, and one set of representative data is shown. (B) In vitro doubling time of the PC-3 clones expressing varying levels of PTHrP was calculated by enumeration of viable cells at 24, 48, 72, and 96 h time points ( n = 3 each). Data are mean ± S.D. NS, not significant. (C) In vivo tumor size was measured by bioluminescence imaging. Subcutaneous tumors were grown for 20 days ( n = 10 per group). Five representative mice are shown. Tumor incidence was 100% in all three groups, determined by microscopic examination of tumor cells upon necropsy.
    Lentiviral Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 2886 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Thermo Fisher
    Average 94 stars, based on 2886 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-11
    94/100 stars
      Buy from Supplier

    93
    Genechem lentiviral vectors
    XIST sponged hsa-miR-214-3p in EOC . (A) Schematic drawing was demonstrated for the predictive binding site for hsa-miR-214-3p on XIST. Also, the DNA sequence was mutated at the hsa-miR-214-3p binding site on XIST. (B) Human HEK293T cells were co-transfected with luciferase plasmids of Luc-XIST or Luc-XIST(m), and synthetic miRNA mimics of miR-214-3p or miR-NC. A dual-luciferase reporter assay was then performed to measure relative luciferase activities in co-transfected HEK293T cells. (C) qRT-PCR was applied to compare hsa-miR-214-3p expressions between CAVO3 and OVCAR3 cells transduced with L/NS and those transduced with L/XIST. EOC, epithelial ovarian cancer; L/NS, a non-specific empty <t>lentiviral</t> vector; L/XIST, lentiviral vectors expressing the full-length human XIST; qRT-PCR, quantitative reverse transcription polymerase chain reaction; XIST, X-inactive specific transcript. * p
    Lentiviral Vectors, supplied by Genechem, used in various techniques. Bioz Stars score: 93/100, based on 976 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vectors/product/Genechem
    Average 93 stars, based on 976 article reviews
    Price from $9.99 to $1999.99
    lentiviral vectors - by Bioz Stars, 2020-11
    93/100 stars
      Buy from Supplier

    92
    Shanghai Genechem lentiviral vectors
    Overexpression of CSF-1R in 6–10B cells. (A) Transfection efficiency was detected using an inverted fluorescence microscope (magnification, ×100). (B) The mRNA expression level of CSF-1R in human nasopharyngeal carcinoma 6–10B cells following transfection with a CSF-1R <t>lentiviral</t> vector. (C) The protein expression of CSF-1R in human nasopharyngeal carcinoma 6–10B cells following lentiviral transfection. (D) The relative protein expression levels of CSF-1R in the transfection group and the control group were assessed. GADPH was used as the loading control for the western blot analyses. **P
    Lentiviral Vectors, supplied by Shanghai Genechem, used in various techniques. Bioz Stars score: 92/100, based on 976 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vectors/product/Shanghai Genechem
    Average 92 stars, based on 976 article reviews
    Price from $9.99 to $1999.99
    lentiviral vectors - by Bioz Stars, 2020-11
    92/100 stars
      Buy from Supplier

    92
    Genechem lentiviral vector
    PCR and Southern blot analysis of genomic DNA from the blood of G1 transgenic quails. (A) PCR analysis of G1 offspring obtained by microinjection to the subgerminal cavity of blastodermal embryos. Lanes 1–4 represent the transgenic quails. (B) PCR analysis of five G1 offspring produced by microinjection into the blood vessels of HH13–15 embryos. Lanes 1–6 represent transgenic quails 1–6; MW, DNA size markers; P, positive control; N, negative control; PCR product size is indicated on the right. (C) Southern blot results. N, nontransgenic quail; Lanes 1–4 indicate G1 transgenic quails 1–4 (as in A). (D) Genomic DNA (10 µg) was digested with Pst I and Eco RI and hybridized with the eGFP probe. P, 80 pg of pGCL-eGFP vector; N, negative control without injection of <t>lentiviral</t> vector; Lanes 1–6 indicate G1 transgenic quails 1–6 (as in B).
    Lentiviral Vector, supplied by Genechem, used in various techniques. Bioz Stars score: 92/100, based on 882 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Genechem
    Average 92 stars, based on 882 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-11
    92/100 stars
      Buy from Supplier

    92
    Shanghai Genechem lentiviral vector
    (A) Detection of EWS-FLI1 fusion gene expression in RD-ES and A673 cell lines using reverse transcription-polymerase chain reaction. (B) Expression levels of the fusion gene were downregulated in RD-ES and A-673 cells following siRNA transfection. (C) miR-34b expression in A673 cells was downregulated following siRNA transfection. (D) miR-34b expression in RD-ES cells was downregulated following siRNA transfection. (E) miR-34b expression was upregulated by the precursor of miR-34b in RD-ES and A-673 cells. (F) miR-34b expression was downregulated by the inhibitor of miR-34b in RD-ES and A-673 cells. BC, cell lines that were treated with <t>lentiviral</t> vector alone; NC(+), normal cell lines that were not transfected with siRNA; NS, cells transfected with non-targeting siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA targeting the EWS-FLI1 fusion gene; Micro-up, NC(−) cell lines treated with precursor miR-34b sequences; Micro-down, NC(+) cell lines treated with complementary sequences of miR-34b. **P
    Lentiviral Vector, supplied by Shanghai Genechem, used in various techniques. Bioz Stars score: 92/100, based on 882 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Shanghai Genechem
    Average 92 stars, based on 882 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-11
    92/100 stars
      Buy from Supplier

    93
    System Biosciences Inc lentiviral vector
    p38α unleashes KMT1A via phosphorylation from MyoD during differentiation. a Control IgG or anti-MyoD immunoprecipitates retrieved from cell extracts of C2C12 cells grown GM or DM with or without SB were divided equally and evaluated one part for western blot analysis, probed with antibodies against KMT1A and MyoD. Another part was subjected to HMT activity assay. Methylated and input H3(N) were detected by fluorography and Commassie, respectively. b Control IgG or anti-KMT1A immunoprecipitates retrieved from cell extracts used in a were subjected to western blot analysis, probed with antibodies against MyoD and KMT1A. c Control IgG, anti-KMT1A, or anti-MyoD immunoprecipitates were retrieved from cell extracts of C2C12 cells expressing vector control (Em), MKK6EE or MKK6DN via <t>lentiviral</t> delivery grown in GM or DM. Subsequently, IgG and KMT1A immunoprecipitates were subjected to western blot analysis, probed with antibodies against MyoD and KMT1A. Separately, IgG and MyoD immunoprecipitates were subjected to HMT activity assay. Methylated and input H3(N) were detected by fluorography and Commassie, respectively
    Lentiviral Vector, supplied by System Biosciences Inc, used in various techniques. Bioz Stars score: 93/100, based on 817 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/System Biosciences Inc
    Average 93 stars, based on 817 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-11
    93/100 stars
      Buy from Supplier

    92
    GenePharma Company lentiviral vectors
    MAPK signaling participated in regulating the MCM7–cyclin D1 signaling in HCC cells. ( a ) Correlation of MCM7 with CCND1 gene expression in three HCC cell lines. ( b ) Correlation of MCM7 with 12 MAPK pathway member gene expression. ( c ) Heat map of changes in the expression of 12 MAPK pathway member genes after <t>lentiviral</t> vector transduction. Western blot analysis ( d ) and corresponding bar graphs ( e ) validated the alteration in the activity of three major MAPK members (ERK, JNK and p38) in HCC cells. ( f ) Correlation of CCND1 with 12 MAPK pathway member gene expression. ( g ) Heat map of changes in the expression of CCND1 after pretreatment with SB203580 (p38 inhibitor) or U0126 (ERK inhibitor) at different time points (3, 6, 12 and 24 h).; ( h ) Western blot analysis for cyclin D1 expression level in HCC cells pretreated with SB203580 (for 6 h) or U0126 (for 24 h). Data are represented as mean±S.E.M. from three independent experiments. * P
    Lentiviral Vectors, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 92/100, based on 360 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vectors/product/GenePharma Company
    Average 92 stars, based on 360 article reviews
    Price from $9.99 to $1999.99
    lentiviral vectors - by Bioz Stars, 2020-11
    92/100 stars
      Buy from Supplier

    92
    Genechem lentivirus vector
    Knockdown cpg15 expression in primary cultured astrocytes via <t>lentivirus-delivered</t> shRNA depresses the neurite outgrowth recovery and neuronal network reestablishment of OGD-injured primary cultured neurons. A , Phase-contrast and fluorescent microscopy images of the primary cultured hippocampal astrocytes infected with cpg15 shRNA-delivering lentivirus (LV-CMV-cpg15-shRNA), showing the infection efficiency. Cells with GFP expression under fluorescent microscope were those infected by lentivirus. The phase-contrast microscope image of the same field shows the total cells. Scale bars, 100 μm. B , Representative Western blot image showing significantly inhibited expression of cpg15 protein by LV-CMV-cpg15-shRNA (abbreviated to LV-cpg15-sh) lentivirus infection in astrocytes at reoxygenation 12 h after 4 h OGD treatment. Scramble shRNA-delivering lentivirus (LV-CMV-Control-shRNA, abbreviated to LV-Ctrl-sh) was used as the negative control. C , Relative amount of cpg15 calculated from B . β-Actin as the loading control. n = 6 for each group. *** p
    Lentivirus Vector, supplied by Genechem, used in various techniques. Bioz Stars score: 92/100, based on 387 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentivirus vector/product/Genechem
    Average 92 stars, based on 387 article reviews
    Price from $9.99 to $1999.99
    lentivirus vector - by Bioz Stars, 2020-11
    92/100 stars
      Buy from Supplier

    92
    System Biosciences Inc lentiviral vectors
    Ectopic expression of the miRNAs specifically suppresses expression of the reporter vector containing miRNA targets in 293T cells. (A) Map of transcriptional units of the reporter vector used in this study. CMVmini: CMV minimal promoter. UbiC: ubiquitin C promoter. CCR5 target: siRNA against CCR5 target sequence ( 5′-GAGCAAGCTCAGTTTACACC-3′ ) [59] . (B) 293T cells were infected with <t>lentiviral</t> vectors encoding various reporters shown in (A). Expression levels of EGFP and mCherry were analyzed by flow cytometry 2 days post-infection. 293T cells infected with a lentiviral vector encoding EGFP miR-T/mCherry miR-T were super-infected by a lentiviral vector encoding either miR-302a , miR-302b , miR-302c , and miR-302d (miR-302 a-d) or miR-155 2 days post-infection. Cells were then further cultured for 4 days and analyzed for EGFP and mCherry expression by flow cytometry. The number (%) in each quadrant is listed on each plot.
    Lentiviral Vectors, supplied by System Biosciences Inc, used in various techniques. Bioz Stars score: 92/100, based on 368 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vectors/product/System Biosciences Inc
    Average 92 stars, based on 368 article reviews
    Price from $9.99 to $1999.99
    lentiviral vectors - by Bioz Stars, 2020-11
    92/100 stars
      Buy from Supplier

    92
    Genecopoeia lentiviral vector
    Insulin overexpression in the PVN of adult mice prevents acute RS–induced reduction in pituitary GH gene expression and secretion. ( A ) Time course study of Gh mRNA levels in the pituitary of adult mice after acute RS. ( B – L ) <t>Lentiviral</t> vector expressing GFP (empty control vector, mock) or GFP and Ins2 (LV-insulin) was injected into the PVN of adult mice. Two weeks after the injection, mice were exposed to acute RS for 8 hours (RS 8 h). qRT-PCR data showing the efficiency of PVN insulin overexpression ( B ). Relative hypothalamic Crh mRNA levels ( C ). Relative pituitary Gh mRNA levels ( D ). Serum GH concentrations ( E ). Immunoblot analysis of p-Akt (Ser473), Akt, and GAPDH levels ( F ). Quantification of p-Akt levels normalized to Akt ( G ). Relative pituitary Pit-1 mRNA levels ( H ). Relative hypothalamic Ghrh ( I ) and Sst ( J ) mRNA levels. Serum corticosterone ( K ) and insulin ( L ) concentrations. Changes in body weight ( M ) and food consumption ( N ) for 2 weeks after the injection. Data are shown as mean ± SEM, 2-way ANOVA with Bonferroni’s post hoc tests. *, # , and $ P
    Lentiviral Vector, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 92/100, based on 405 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Genecopoeia
    Average 92 stars, based on 405 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-11
    92/100 stars
      Buy from Supplier

    93
    Genecopoeia lentiviral vectors
    GHB decreases 5-hydroxymethylcytosine levels via inhibition of TET2 activity. a GHB does not reduce expression of TET isoforms. Q-PCR assay. Mean ± SD, n = 4 (TG1) and 3 (TP54) independent biological samples. b Doxycycline-dependent TET2 expression in the leukemic UT7 cell line. UT7 cells were treated for 12 h with doxycycline (Dox) at a final concentration of 1 µg/mL. TET2 mRNA levels were assayed using Q-PCR. Dox-treated versus -untreated UT7, mean ± SD, n = 3 independent biological samples. c GHB inhibits TET2 activity in the leukemic UT7 cell line expressing TET2 in a doxycycline-dependent manner. 12 h 10 mM GHB. 5-hmC levels determined by DNA dot immunoblotting. GHB-treated vs control UT7, mean ± SD, n = 3 independent biological samples. d Doxycycline-dependent TET2 expression in GBM stem-like cells (TG1) stably overexpressing TET2 in a doxycycline-dependent manner following <t>lentiviral</t> transduction. Q-PCR assays, mean ± SD, n = 5 biological samples. e Inhibitory GHB effects on TET2-mediated 5-hmC formation in GMB stem-like TG1 cells overexpressing TET2 in a doxycycline-dependent manner, mean ± SD, n = 4 biological samples. f – h In silico analysis of α-KG ( f ) and GHB ( g ) binding pockets within the TET2 protein. α-KG and GHB are colored in white and their oxygens in red . Ribbon representation of TET2 C-terminal domain. Progression from the N- to C- parts of the C-terminal domain are colored from blue to orange . h TET2 amino acid residues in contact with α-KG or GHB
    Lentiviral Vectors, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 93/100, based on 467 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vectors/product/Genecopoeia
    Average 93 stars, based on 467 article reviews
    Price from $9.99 to $1999.99
    lentiviral vectors - by Bioz Stars, 2020-11
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher pgipz lentiviral vector
    GHB decreases 5-hydroxymethylcytosine levels via inhibition of TET2 activity. a GHB does not reduce expression of TET isoforms. Q-PCR assay. Mean ± SD, n = 4 (TG1) and 3 (TP54) independent biological samples. b Doxycycline-dependent TET2 expression in the leukemic UT7 cell line. UT7 cells were treated for 12 h with doxycycline (Dox) at a final concentration of 1 µg/mL. TET2 mRNA levels were assayed using Q-PCR. Dox-treated versus -untreated UT7, mean ± SD, n = 3 independent biological samples. c GHB inhibits TET2 activity in the leukemic UT7 cell line expressing TET2 in a doxycycline-dependent manner. 12 h 10 mM GHB. 5-hmC levels determined by DNA dot immunoblotting. GHB-treated vs control UT7, mean ± SD, n = 3 independent biological samples. d Doxycycline-dependent TET2 expression in GBM stem-like cells (TG1) stably overexpressing TET2 in a doxycycline-dependent manner following <t>lentiviral</t> transduction. Q-PCR assays, mean ± SD, n = 5 biological samples. e Inhibitory GHB effects on TET2-mediated 5-hmC formation in GMB stem-like TG1 cells overexpressing TET2 in a doxycycline-dependent manner, mean ± SD, n = 4 biological samples. f – h In silico analysis of α-KG ( f ) and GHB ( g ) binding pockets within the TET2 protein. α-KG and GHB are colored in white and their oxygens in red . Ribbon representation of TET2 C-terminal domain. Progression from the N- to C- parts of the C-terminal domain are colored from blue to orange . h TET2 amino acid residues in contact with α-KG or GHB
    Pgipz Lentiviral Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 518 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgipz lentiviral vector/product/Thermo Fisher
    Average 99 stars, based on 518 article reviews
    Price from $9.99 to $1999.99
    pgipz lentiviral vector - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    94
    GenePharma Company lentiviral vector
    BCL9 was upregulated in HCC tissues and cell lines and is a direct miR-1301 target. ( a ) The levels of BCL9 expression were analyzed in 60-paired HCC and adjacent normal tissues by qPCR. ( b ) The levels of BCL9 expression in HCC cell lines and normal L02 cells. ( c ) BCL9 protein levels in HCC specimens and adjacent normal tissues as analyzed by immunohistochemistry. ( d ) The potential miR-1301 binding site in the BCL9 3′-UTR was computationally predicted by TargetScan. ( e ) The level of BCL9 expression in cells after transfecting pre-miR-1301 or miR-1301-inhibitor as detected by qPCR; cells transfected with empty <t>lentiviral</t> vectors were used as a negative control. ( f ) BCL9 and β -catenin protein levels in HCC cells transfected with miR-1301 inhibitor or miR-1301 overexpression lentivirus. ( g ) Dual-luciferase reporter assay analysis of the effects of miR-1301 expression on the activities of wild type and mutant BCL9 3′-UTR in 293 T cells. ( h ) A negative correlation between the levels of miR-1301 and BCL9 expression in HCC specimens ( P
    Lentiviral Vector, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 94/100, based on 453 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/GenePharma Company
    Average 94 stars, based on 453 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-11
    94/100 stars
      Buy from Supplier

    92
    Genechem lentivirus vectors
    Expression of Nrf2 and p62 in breast cancer. (A) Immunohistochemical assay of Nrf2 and p62 protein levels in pairs of matched breast carcinoma tissues (T) and adjacent normal breast tissues (N). (B) Western blot analysis of Nrf2 and p62 protein levels in T47D, BT 549, MDA ‐ MB ‐231, and MCF ‐7 breast cancer cell lines and MCF ‐10A benign breast epithelial cell line. (C) Quantitation of Nrf2 and p62 protein levels in breast cancer cells and benign epithelial cell. (D) Western blot analysis of p62 protein level in T47D and BT 549 after infecting Nrf2 sh RNA <t>lentivirus.</t> (E) Quantitation of Nrf2 and p62 protein levels in T47D and BT 549 after infecting Nrf2 sh RNA lentivirus. (F) Western blot analysis of Nrf2 protein level in T47D and BT 549 after infecting p62 sh RNA lentivirus. (G) Quantitation of Nrf2 and p62 protein levels in T47D and BT 549 after infecting p62 sh RNA lentivirus. Data are presented as mean ± SD , n = 3, * P
    Lentivirus Vectors, supplied by Genechem, used in various techniques. Bioz Stars score: 92/100, based on 299 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentivirus vectors/product/Genechem
    Average 92 stars, based on 299 article reviews
    Price from $9.99 to $1999.99
    lentivirus vectors - by Bioz Stars, 2020-11
    92/100 stars
      Buy from Supplier

    90
    Addgene inc plko 1 lentiviral vector
    PKR is responsible for TMEV-induced eIF2α phosphorylation and stress granule assembly. (A) Western blot analysis of PKR expression in HeLa cells transduced with an empty <t>pLKO-1</t> <t>lentiviral</t> vector (control) or with lentiviral vectors (FB52, FB53, and FB54) expressing shRNA1, shRNA2, or shRNA3, directed against PKR. Transduced cells were selected for 1 week with puromycin before being assessed for PKR expression. (B) Control HeLa cells and HeLa cells transduced with FB54 (shRNA3) were infected for 10 h with wild-type (L WT ) or L-mutant (L Zn and L M60V ) viruses. Mock-infected and L M60V -infected cell samples were treated for 30 min with sodium arsenite prior to cell lysis. Lysates were harvested at 10 hpi, and PKR expression and eIF2α phosphorylation were analyzed by Western blotting. (C) Confocal microscopy images showing the coimmunostaining of eIF3 (green) and the viral capsid (red) in control and PKR knockdown HeLa cells infected or treated as described for panel B.
    Plko 1 Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 257 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 lentiviral vector/product/Addgene inc
    Average 90 stars, based on 257 article reviews
    Price from $9.99 to $1999.99
    plko 1 lentiviral vector - by Bioz Stars, 2020-11
    90/100 stars
      Buy from Supplier

    88
    System Biosciences Inc lentiviral vector pcdh cmv mcs ef1 copgfp
    PKR is responsible for TMEV-induced eIF2α phosphorylation and stress granule assembly. (A) Western blot analysis of PKR expression in HeLa cells transduced with an empty <t>pLKO-1</t> <t>lentiviral</t> vector (control) or with lentiviral vectors (FB52, FB53, and FB54) expressing shRNA1, shRNA2, or shRNA3, directed against PKR. Transduced cells were selected for 1 week with puromycin before being assessed for PKR expression. (B) Control HeLa cells and HeLa cells transduced with FB54 (shRNA3) were infected for 10 h with wild-type (L WT ) or L-mutant (L Zn and L M60V ) viruses. Mock-infected and L M60V -infected cell samples were treated for 30 min with sodium arsenite prior to cell lysis. Lysates were harvested at 10 hpi, and PKR expression and eIF2α phosphorylation were analyzed by Western blotting. (C) Confocal microscopy images showing the coimmunostaining of eIF3 (green) and the viral capsid (red) in control and PKR knockdown HeLa cells infected or treated as described for panel B.
    Lentiviral Vector Pcdh Cmv Mcs Ef1 Copgfp, supplied by System Biosciences Inc, used in various techniques. Bioz Stars score: 88/100, based on 174 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector pcdh cmv mcs ef1 copgfp/product/System Biosciences Inc
    Average 88 stars, based on 174 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector pcdh cmv mcs ef1 copgfp - by Bioz Stars, 2020-11
    88/100 stars
      Buy from Supplier

    92
    Addgene inc lentivirus vector
    In vitro consequences of cyclin D1 silencing ASPC-1 and BxPC3 cells that were either not infected (parental cells: P) or infected with the mock-infected <t>lentivirus</t> pll37 (E), or pll37 containing sequences encoding luciferase (L), or cyclin D1 specific shRNA 8 (8) or 10 (10), or their combination (K). (a) Anchorage-dependent growth was determined by the MTT assay. Data are the means ± SE of triplicate determinations from three independent experiments. *p
    Lentivirus Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 169 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentivirus vector/product/Addgene inc
    Average 92 stars, based on 169 article reviews
    Price from $9.99 to $1999.99
    lentivirus vector - by Bioz Stars, 2020-11
    92/100 stars
      Buy from Supplier

    99
    Thermo Fisher lentivirus vector
    In vitro consequences of cyclin D1 silencing ASPC-1 and BxPC3 cells that were either not infected (parental cells: P) or infected with the mock-infected <t>lentivirus</t> pll37 (E), or pll37 containing sequences encoding luciferase (L), or cyclin D1 specific shRNA 8 (8) or 10 (10), or their combination (K). (a) Anchorage-dependent growth was determined by the MTT assay. Data are the means ± SE of triplicate determinations from three independent experiments. *p
    Lentivirus Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 531 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentivirus vector/product/Thermo Fisher
    Average 99 stars, based on 531 article reviews
    Price from $9.99 to $1999.99
    lentivirus vector - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    Millipore lentiviral shrna vectors
    In vitro consequences of cyclin D1 silencing ASPC-1 and BxPC3 cells that were either not infected (parental cells: P) or infected with the mock-infected <t>lentivirus</t> pll37 (E), or pll37 containing sequences encoding luciferase (L), or cyclin D1 specific shRNA 8 (8) or 10 (10), or their combination (K). (a) Anchorage-dependent growth was determined by the MTT assay. Data are the means ± SE of triplicate determinations from three independent experiments. *p
    Lentiviral Shrna Vectors, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 232 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral shrna vectors/product/Millipore
    Average 99 stars, based on 232 article reviews
    Price from $9.99 to $1999.99
    lentiviral shrna vectors - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    Image Search Results


    Detection of the retrotranscribed HIV-1 DNA in infected cells. (A) Schema of the HIV-1 ANCHOR system based on lentiviral vectors carrying on the OR-GFP cDNA under the control of CMV promoter (LV OR-GFP) and HIV-1 containing the ANCH3, the target sequence of OR proteins (HIV-1 ΔEnv IN HA ΔNef ANCH3/VSV-G). (B) HeLa P4R5 cells were transduced with LV OR-GFP. The efficiency of OR-GFP expression was monitored by Western blotting using antibody against GFP. As a loading control, samples were also blotted using antibody against actin. HeLa cells stably expressing OR-GFP infected or not with HIV-1 ΔEnv IN HA ΔNef ANCH3/VSV-G (MOI of 50) were imaged by fluorescence microscopy at 24 h postinfection using a water immersion objective in epifluorescence. The number of proviruses was detected by Alu-PCR on HeLa P4R5 OR-GFP cells infected with HIV-1 or HIV-1 ANCH3.

    Journal: Journal of Virology

    Article Title: Remodeling of the Core Leads HIV-1 Preintegration Complex into the Nucleus of Human Lymphocytes

    doi: 10.1128/JVI.00135-20

    Figure Lengend Snippet: Detection of the retrotranscribed HIV-1 DNA in infected cells. (A) Schema of the HIV-1 ANCHOR system based on lentiviral vectors carrying on the OR-GFP cDNA under the control of CMV promoter (LV OR-GFP) and HIV-1 containing the ANCH3, the target sequence of OR proteins (HIV-1 ΔEnv IN HA ΔNef ANCH3/VSV-G). (B) HeLa P4R5 cells were transduced with LV OR-GFP. The efficiency of OR-GFP expression was monitored by Western blotting using antibody against GFP. As a loading control, samples were also blotted using antibody against actin. HeLa cells stably expressing OR-GFP infected or not with HIV-1 ΔEnv IN HA ΔNef ANCH3/VSV-G (MOI of 50) were imaged by fluorescence microscopy at 24 h postinfection using a water immersion objective in epifluorescence. The number of proviruses was detected by Alu-PCR on HeLa P4R5 OR-GFP cells infected with HIV-1 or HIV-1 ANCH3.

    Article Snippet: 293T cells (ATCC) are human embryonic kidney cells used to produce lentiviral vectors and HIV-1 viruses; HeLa cells (ATCC) are derived from cervical cancer cells.

    Techniques: Infection, Sequencing, Transduction, Expressing, Western Blot, Stable Transfection, Fluorescence, Microscopy, Polymerase Chain Reaction

    Knockodwn of EGFP expression using shRNA haipin and miR-21 hairpin-based shRNA-miR structures A: Lentiviral knockdown vectors: I) miR-21 hairpin based lentiviral vector and hairpin structure against luciferase. II) human polymerase III promoter U6-driven lentiviral shRNA vector and EGFP shRNA hairpin structure. III) mouse miR-21 hairpin based lentiviral vector and shRNA-miR hairpin against EGFP gene. B. dose response of miR21-based EGFP gene knockdown. pcFUW-miR21LUCkd-Pgk-puro was co-transfected with EGFP expression vector pcFUW-EGFP at ratio of 5:1(I), or pcFUW-miR21EGFPkd-pgk-puro was co-transfected-pcFUW-EGFP with 2:1 (II), 3:1 (III) and 5:1 (IV) ratios. EGFP expression was detected by Western Blot analysis using anti-GFP antibody. β-actin was blotted as a loading control. C. Comparison of EGFP knockdown efficiency by shRNA and miR21-based shRNA-miR system. Up panel: EGFP fluoresence was visualized in 293FT cells transfected with control vector pcFUW-miR-21LUCkd –pgk-puro(I), pcFU6W- EGFPkd-pgk-puro (II) and pcFUW-miR21EGFPkd-pgk-puro (III) with EGFP expression vector pcFUW-EGFP. Down panel: EGFP expression was detected by Western blot analysis from uppanel. D. Knockdown of EGFP expression using miR21 hairpin-based shRNA-miR directly followed CMV promoter. I: pcDNA3.1-miR-21LUCkd, as a control. II: pcDNA3.1-miR-21-EGFPkd.

    Journal: Biochemical and biophysical research communications

    Article Title: A miR-21 hairpin structure-based gene knockdown vector

    doi: 10.1016/j.bbrc.2010.03.047

    Figure Lengend Snippet: Knockodwn of EGFP expression using shRNA haipin and miR-21 hairpin-based shRNA-miR structures A: Lentiviral knockdown vectors: I) miR-21 hairpin based lentiviral vector and hairpin structure against luciferase. II) human polymerase III promoter U6-driven lentiviral shRNA vector and EGFP shRNA hairpin structure. III) mouse miR-21 hairpin based lentiviral vector and shRNA-miR hairpin against EGFP gene. B. dose response of miR21-based EGFP gene knockdown. pcFUW-miR21LUCkd-Pgk-puro was co-transfected with EGFP expression vector pcFUW-EGFP at ratio of 5:1(I), or pcFUW-miR21EGFPkd-pgk-puro was co-transfected-pcFUW-EGFP with 2:1 (II), 3:1 (III) and 5:1 (IV) ratios. EGFP expression was detected by Western Blot analysis using anti-GFP antibody. β-actin was blotted as a loading control. C. Comparison of EGFP knockdown efficiency by shRNA and miR21-based shRNA-miR system. Up panel: EGFP fluoresence was visualized in 293FT cells transfected with control vector pcFUW-miR-21LUCkd –pgk-puro(I), pcFU6W- EGFPkd-pgk-puro (II) and pcFUW-miR21EGFPkd-pgk-puro (III) with EGFP expression vector pcFUW-EGFP. Down panel: EGFP expression was detected by Western blot analysis from uppanel. D. Knockdown of EGFP expression using miR21 hairpin-based shRNA-miR directly followed CMV promoter. I: pcDNA3.1-miR-21LUCkd, as a control. II: pcDNA3.1-miR-21-EGFPkd.

    Article Snippet: The lentiviral vectors were produced in 293FT cells by cotransfection of the lentiviral vectors with ViraPower Packaging Mix (Invitrogen).

    Techniques: Expressing, shRNA, Plasmid Preparation, Luciferase, Transfection, Western Blot

    Determination of the impact of miR-21 gene flanking sequences on miR-21 expression A. Mouse miR-21 genes with two different flanking sequences (−400 bp to +135 bp and −160 bp to +65bp) were cloned into upstream of the reporter gene EGFP and co-expressed under the control of human UbC promoter in lentiviral vector pCFUW-EGFP, respectively. Meanwhile, the pre-miR-21 with a 160bp upstream and 65bp downstream flanking sequence was cloned into the 3′ UTR of the EGFP reporter gene. B. Mouse pre-miR-21 hairpin structure. C. The relative expressions of pri-miR-21 and mature miR-21 against non-coding small RNA U6 were detected by SYBR-Green real-time PCR in 293FT cells transfected with the control vector pcFUW-EGFP (I), miR-21 expression vector pcFUW-400-miR-21-EGFP (II), pcFUW-160-miR-21-EGFP (III), and pcFUW-EGFP-160-miR-21 (IV). D. EGFP gene expressions were detected using Western blot in control vector pcFUW-EGFP (I) and three different miR-21 lentiviral expression vectors, pcFUW-400-miR-21-EGFP (II), pcFUW-160-miR-21-EGFP (III), and pcFUW-EGFP-160-miR-21 (IV). β-actin was blotted as a loading control.

    Journal: Biochemical and biophysical research communications

    Article Title: A miR-21 hairpin structure-based gene knockdown vector

    doi: 10.1016/j.bbrc.2010.03.047

    Figure Lengend Snippet: Determination of the impact of miR-21 gene flanking sequences on miR-21 expression A. Mouse miR-21 genes with two different flanking sequences (−400 bp to +135 bp and −160 bp to +65bp) were cloned into upstream of the reporter gene EGFP and co-expressed under the control of human UbC promoter in lentiviral vector pCFUW-EGFP, respectively. Meanwhile, the pre-miR-21 with a 160bp upstream and 65bp downstream flanking sequence was cloned into the 3′ UTR of the EGFP reporter gene. B. Mouse pre-miR-21 hairpin structure. C. The relative expressions of pri-miR-21 and mature miR-21 against non-coding small RNA U6 were detected by SYBR-Green real-time PCR in 293FT cells transfected with the control vector pcFUW-EGFP (I), miR-21 expression vector pcFUW-400-miR-21-EGFP (II), pcFUW-160-miR-21-EGFP (III), and pcFUW-EGFP-160-miR-21 (IV). D. EGFP gene expressions were detected using Western blot in control vector pcFUW-EGFP (I) and three different miR-21 lentiviral expression vectors, pcFUW-400-miR-21-EGFP (II), pcFUW-160-miR-21-EGFP (III), and pcFUW-EGFP-160-miR-21 (IV). β-actin was blotted as a loading control.

    Article Snippet: The lentiviral vectors were produced in 293FT cells by cotransfection of the lentiviral vectors with ViraPower Packaging Mix (Invitrogen).

    Techniques: Expressing, Clone Assay, Plasmid Preparation, Sequencing, SYBR Green Assay, Real-time Polymerase Chain Reaction, Transfection, Western Blot

    Knockdown of endogenous lamin A/C using miR-21 hairpin-based lentiviral knockdown vector A. miR-21 hairpin-based lamin A/C knockdown lentiviral vector and shRNA-miR hairpin against human lamin A/C. B. Lamin A/C expression was detected in individual cells by indirect immunostaining using lamin A/C antibody. C. Lamin A/C knockdown was detected by Western blot following transduction using 10 MOI of lamin A/C knockdown virus and puromycin selection.

    Journal: Biochemical and biophysical research communications

    Article Title: A miR-21 hairpin structure-based gene knockdown vector

    doi: 10.1016/j.bbrc.2010.03.047

    Figure Lengend Snippet: Knockdown of endogenous lamin A/C using miR-21 hairpin-based lentiviral knockdown vector A. miR-21 hairpin-based lamin A/C knockdown lentiviral vector and shRNA-miR hairpin against human lamin A/C. B. Lamin A/C expression was detected in individual cells by indirect immunostaining using lamin A/C antibody. C. Lamin A/C knockdown was detected by Western blot following transduction using 10 MOI of lamin A/C knockdown virus and puromycin selection.

    Article Snippet: The lentiviral vectors were produced in 293FT cells by cotransfection of the lentiviral vectors with ViraPower Packaging Mix (Invitrogen).

    Techniques: Plasmid Preparation, shRNA, Expressing, Immunostaining, Western Blot, Transduction, Selection

    Genetic and site-specific display of unnatural amino acids (UAAs) on the envelope of lentiviral vectors. ( A ) The structure of lentiviral VSVg protein. Total 33 residues, marked in red, within VSVg were mutated in this study. ( B ) Schematic representative of lentiviral vector engineering via genetic code expansion for site-specific incorporation of UAAs (NAEK or DiZPK) on the vector surface. ( C ) Schematic representation of genetic code expansion for site-specific incorporation of UAAs. The UAAs were incorporated into VSVg protein via UAG-code and an orthogonal aaRS/tRNA.

    Journal: Nucleic Acids Research

    Article Title: Broadening the versatility of lentiviral vectors as a tool in nucleic acid research via genetic code expansion

    doi: 10.1093/nar/gkv202

    Figure Lengend Snippet: Genetic and site-specific display of unnatural amino acids (UAAs) on the envelope of lentiviral vectors. ( A ) The structure of lentiviral VSVg protein. Total 33 residues, marked in red, within VSVg were mutated in this study. ( B ) Schematic representative of lentiviral vector engineering via genetic code expansion for site-specific incorporation of UAAs (NAEK or DiZPK) on the vector surface. ( C ) Schematic representation of genetic code expansion for site-specific incorporation of UAAs. The UAAs were incorporated into VSVg protein via UAG-code and an orthogonal aaRS/tRNA.

    Article Snippet: Exploring the compatibility of site-specific incorporation of a diazirine-bearing amino acid in lentiviral vector Having established the approach to genetically incorporate an azide moiety into a lentiviral vector, we next determined whether other chemical moieties synthesized in laboratories with unique properties could also be site-specifically incorporated using this approach.

    Techniques: Plasmid Preparation

    Site-specific display of NAEK on the surface of lentiviral vectors. ( A ) Test of the infectivity of the lentiviral vector containing NAEK at site Y77 or I339, respectively, by luciferase assay using HeLa cells as the host. The infectivity of lentiviral vectors was quantified by luminescence measurement and normalized to that of the wild-type lentiviral vectors (WT). ( B ) Verification of NAEK expression on lentiviral vectors by their capability to conjugate with the DIBO-Alexa 488 probe via click reaction, which made NAEK-bearing protein visible by fluorescence upon conjugation with Alexa 488. The wild-type (WT), acting as a negative control, and mutant lentiviral vectors were separately incubated with (+) or without (–) DIBO-Alexa 488 and then analyzed by fluorescence scanning (upper bands) and western blotting (lower bands) via 9% SDS-PAGE. ( C ) Generation of highly infectious NAEK-containing lentiviral vectors with (+) or without (–) Alexa 488 at site K242 and R249, respectively, which were analyzed by fluorescent scanning (upper bands) and western blotting(lower bands). ( D ) Characterizations of the infectivity of lentiviral vectors with (+) or without (–) Alexa 488 at site K242 and R249, respectively by luciferase assay. All quantitative data shown are average values with standard deviations from triplicate experiments. These lentiviral vectors produced from the same transfection were split, treated and compared in parallel.

    Journal: Nucleic Acids Research

    Article Title: Broadening the versatility of lentiviral vectors as a tool in nucleic acid research via genetic code expansion

    doi: 10.1093/nar/gkv202

    Figure Lengend Snippet: Site-specific display of NAEK on the surface of lentiviral vectors. ( A ) Test of the infectivity of the lentiviral vector containing NAEK at site Y77 or I339, respectively, by luciferase assay using HeLa cells as the host. The infectivity of lentiviral vectors was quantified by luminescence measurement and normalized to that of the wild-type lentiviral vectors (WT). ( B ) Verification of NAEK expression on lentiviral vectors by their capability to conjugate with the DIBO-Alexa 488 probe via click reaction, which made NAEK-bearing protein visible by fluorescence upon conjugation with Alexa 488. The wild-type (WT), acting as a negative control, and mutant lentiviral vectors were separately incubated with (+) or without (–) DIBO-Alexa 488 and then analyzed by fluorescence scanning (upper bands) and western blotting (lower bands) via 9% SDS-PAGE. ( C ) Generation of highly infectious NAEK-containing lentiviral vectors with (+) or without (–) Alexa 488 at site K242 and R249, respectively, which were analyzed by fluorescent scanning (upper bands) and western blotting(lower bands). ( D ) Characterizations of the infectivity of lentiviral vectors with (+) or without (–) Alexa 488 at site K242 and R249, respectively by luciferase assay. All quantitative data shown are average values with standard deviations from triplicate experiments. These lentiviral vectors produced from the same transfection were split, treated and compared in parallel.

    Article Snippet: Exploring the compatibility of site-specific incorporation of a diazirine-bearing amino acid in lentiviral vector Having established the approach to genetically incorporate an azide moiety into a lentiviral vector, we next determined whether other chemical moieties synthesized in laboratories with unique properties could also be site-specifically incorporated using this approach.

    Techniques: Infection, Plasmid Preparation, Luciferase, Expressing, Fluorescence, Conjugation Assay, Negative Control, Mutagenesis, Incubation, Western Blot, SDS Page, Produced, Transfection

    Development of a NAEK-containing lentiviral vector as a tool for single-virus tracking. ( A ) Characterization of the visibility of NAEK-containing lentiviral vectors at K242 upon treatment with DIBO-Alexa 488. The wild-type vectors (WT) treated by DIBO-Alexa 488 and NAEK-containing lentiviral vector without treating by DIBO-Alexa 488 act as the negative control. ( B ) Real-time monitoring of the dynamic process of entry and transport of Alexa 488-conjugated lentiviral vector. HeLa cells were stained with Hoechst 33342 and DiI, respectively, to label host nucleic acids and the plasma membrane. After incubation of HeLa cells with lentiviral vector at 4°C for 30 min to synchronize binding, the infected HeLa cells were placed at 37°C in a CO 2 online culture system and tracked using a spinning-disk confocal microscope platform. The Alexa 488 was detected at 488 nm, and DiI was detected at 555 nm. A series of images were selected from 1 to 18 min that reflect the dynamic process of endocytosis of lentiviral vectors.

    Journal: Nucleic Acids Research

    Article Title: Broadening the versatility of lentiviral vectors as a tool in nucleic acid research via genetic code expansion

    doi: 10.1093/nar/gkv202

    Figure Lengend Snippet: Development of a NAEK-containing lentiviral vector as a tool for single-virus tracking. ( A ) Characterization of the visibility of NAEK-containing lentiviral vectors at K242 upon treatment with DIBO-Alexa 488. The wild-type vectors (WT) treated by DIBO-Alexa 488 and NAEK-containing lentiviral vector without treating by DIBO-Alexa 488 act as the negative control. ( B ) Real-time monitoring of the dynamic process of entry and transport of Alexa 488-conjugated lentiviral vector. HeLa cells were stained with Hoechst 33342 and DiI, respectively, to label host nucleic acids and the plasma membrane. After incubation of HeLa cells with lentiviral vector at 4°C for 30 min to synchronize binding, the infected HeLa cells were placed at 37°C in a CO 2 online culture system and tracked using a spinning-disk confocal microscope platform. The Alexa 488 was detected at 488 nm, and DiI was detected at 555 nm. A series of images were selected from 1 to 18 min that reflect the dynamic process of endocytosis of lentiviral vectors.

    Article Snippet: Exploring the compatibility of site-specific incorporation of a diazirine-bearing amino acid in lentiviral vector Having established the approach to genetically incorporate an azide moiety into a lentiviral vector, we next determined whether other chemical moieties synthesized in laboratories with unique properties could also be site-specifically incorporated using this approach.

    Techniques: Plasmid Preparation, Activated Clotting Time Assay, Negative Control, Staining, Incubation, Binding Assay, Infection, Microscopy

    Comparisons of the effect of UAA incorporation at different sites on expression of VSVg protein and propagation/infectivity of progeny vectors. The expression levels of VSVg, which reflect the efficiency of UAA incorporation, were analyzed by western blotting (Supplementary Figure S2), quantitated by scanning the VSVg band and then normalized to that of wild-type VSVg. The infectivity of lentiviral vectors containing NAEK was detected by luciferase assay and normalized to that of the wild-type lentiviral vector. All quantitative data shown are average values with standard deviations from triplicate experiments.

    Journal: Nucleic Acids Research

    Article Title: Broadening the versatility of lentiviral vectors as a tool in nucleic acid research via genetic code expansion

    doi: 10.1093/nar/gkv202

    Figure Lengend Snippet: Comparisons of the effect of UAA incorporation at different sites on expression of VSVg protein and propagation/infectivity of progeny vectors. The expression levels of VSVg, which reflect the efficiency of UAA incorporation, were analyzed by western blotting (Supplementary Figure S2), quantitated by scanning the VSVg band and then normalized to that of wild-type VSVg. The infectivity of lentiviral vectors containing NAEK was detected by luciferase assay and normalized to that of the wild-type lentiviral vector. All quantitative data shown are average values with standard deviations from triplicate experiments.

    Article Snippet: Exploring the compatibility of site-specific incorporation of a diazirine-bearing amino acid in lentiviral vector Having established the approach to genetically incorporate an azide moiety into a lentiviral vector, we next determined whether other chemical moieties synthesized in laboratories with unique properties could also be site-specifically incorporated using this approach.

    Techniques: Expressing, Infection, Western Blot, Luciferase, Plasmid Preparation

    Development of a NAEK-containing lentiviral vector as a vehicle for the selective delivery of nucleic acid macromolecules into cells with high expression of integrins. ( A ) Expression of integrin α v β 3 in MDA-MB-435S vs. MCF-7 cells as detected by flow cytometry. The trypsinized cells, after sequential blocking by 10% BSA and washing, were incubated with monoclonal integrin α v β 3 antibody (red line) and an isotype control IgG antibody (green line) overnight in parallel and then incubated with Alexa 488 labeled secondary antibody for 1 h. After washing three times with PBST, the treated cells were analyzed by Guava EasyCyte Plus. The level of integrin α v β 3 expression on the cell surface of MDA-MB-435S cells is almost 3-fold higher than that on MCF-7 cells according to flow cytometry. ( B ) Characterization of the enhanced infectivity of NAEK-containing lentiviral vectors (Vector) and vectors upon conjugation with RGD (Vector-RGD) or RAD (Vector-RAD) at different sites towards MDA-MB-435S cells. The significance was confirmed by one-way ANOVA test (* P

    Journal: Nucleic Acids Research

    Article Title: Broadening the versatility of lentiviral vectors as a tool in nucleic acid research via genetic code expansion

    doi: 10.1093/nar/gkv202

    Figure Lengend Snippet: Development of a NAEK-containing lentiviral vector as a vehicle for the selective delivery of nucleic acid macromolecules into cells with high expression of integrins. ( A ) Expression of integrin α v β 3 in MDA-MB-435S vs. MCF-7 cells as detected by flow cytometry. The trypsinized cells, after sequential blocking by 10% BSA and washing, were incubated with monoclonal integrin α v β 3 antibody (red line) and an isotype control IgG antibody (green line) overnight in parallel and then incubated with Alexa 488 labeled secondary antibody for 1 h. After washing three times with PBST, the treated cells were analyzed by Guava EasyCyte Plus. The level of integrin α v β 3 expression on the cell surface of MDA-MB-435S cells is almost 3-fold higher than that on MCF-7 cells according to flow cytometry. ( B ) Characterization of the enhanced infectivity of NAEK-containing lentiviral vectors (Vector) and vectors upon conjugation with RGD (Vector-RGD) or RAD (Vector-RAD) at different sites towards MDA-MB-435S cells. The significance was confirmed by one-way ANOVA test (* P

    Article Snippet: Exploring the compatibility of site-specific incorporation of a diazirine-bearing amino acid in lentiviral vector Having established the approach to genetically incorporate an azide moiety into a lentiviral vector, we next determined whether other chemical moieties synthesized in laboratories with unique properties could also be site-specifically incorporated using this approach.

    Techniques: Plasmid Preparation, Expressing, Multiple Displacement Amplification, Flow Cytometry, Cytometry, Blocking Assay, Incubation, Labeling, Infection, Conjugation Assay

    Binding of lentiviral vectors mediated by soluble PtdSer-recognizing molecules. (A) Schematic representation of chimeric Sindbis virus Envs. The Sindbis virus Env is first synthesized as a polypeptide and subsequently cleaved by cellular proteases to generate E3, E2, 6K, and E1 proteins. E1 and E2 are incorporated into the viral envelope. Both the 2.2 and 2.2 1L1L pseudotypes are derived from the wild-type Sindbis virus Env with four mutations (red lines) to reduce their binding to original receptors while maintaining fusion activity. In addition, 2.2 1L1L has two flexible linkers (Gly-Gly-Gly-Gly-Ser) at amino acid (a.a.) 70 of the E2 protein, and 2.2 contains the IgG-binding domain of protein A (ZZ), which was inserted into the E2 region at amino acid 70. (B) Expression levels of Axl (red line), integrin αVβ3 (blue line), and integrin αVβ5 (green line) were analyzed by flow cytometry after staining with antibodies specific to each antigen. The isotype of all antibodies was IgG1; thus, an IgG1 isotype control antibody was used for negative-control staining (black line). (C) Schematic representation of recombinant hGas6, hMFG-E8, mMFG-E8, and D89E, a mutant of MFG-E8 that cannot bind integrins. Gla, γ-carboxyglutamic acid domain; EGF, E1, and E2, epidermal growth factor-like domains; SHBG, sex hormone-binding globulin domain; C1 and C2, discoid domains; P/T, proline/threonine-enriched motif. The γ-carboxyglutamic acid domain of Gas6 and the C2 domain of MFG-E8 bind PtdSer. (D) Staining of HMVECs with an APC-conjugated anti-Flag tag antibody after incubation with hGas6 (red line), mMFG-E8 (blue line), or D89E (green line). The black line represents staining without prior incubation with any ligand. (E) Binding of the EGFP-labeled 2.2 1L1L pseudotype to HMVECs after incubation with hGas6, hMFG-E8, or mMFG-E8. Black line, HMVECs without virus; red line, HMVECs with virus with or without the bridging molecules indicated in the figure. The MFI values correspond to those for EGFP signals, which increase upon binding of EGFP-labeled virus. This experiment was repeated twice in singlicate and once in triplicate, and the MFI values shown are the averages and standard deviations of the triplicate experiment; representative flow cytometry histograms are shown. Significance was calculated by comparing the value of virus binding without a bridging molecule to the value of virus binding in the presence of the bridging molecules indicated in the figure using a two-sample Student t test (**, P

    Journal: Journal of Virology

    Article Title: Role of Phosphatidylserine Receptors in Enveloped Virus Infection

    doi: 10.1128/JVI.03287-13

    Figure Lengend Snippet: Binding of lentiviral vectors mediated by soluble PtdSer-recognizing molecules. (A) Schematic representation of chimeric Sindbis virus Envs. The Sindbis virus Env is first synthesized as a polypeptide and subsequently cleaved by cellular proteases to generate E3, E2, 6K, and E1 proteins. E1 and E2 are incorporated into the viral envelope. Both the 2.2 and 2.2 1L1L pseudotypes are derived from the wild-type Sindbis virus Env with four mutations (red lines) to reduce their binding to original receptors while maintaining fusion activity. In addition, 2.2 1L1L has two flexible linkers (Gly-Gly-Gly-Gly-Ser) at amino acid (a.a.) 70 of the E2 protein, and 2.2 contains the IgG-binding domain of protein A (ZZ), which was inserted into the E2 region at amino acid 70. (B) Expression levels of Axl (red line), integrin αVβ3 (blue line), and integrin αVβ5 (green line) were analyzed by flow cytometry after staining with antibodies specific to each antigen. The isotype of all antibodies was IgG1; thus, an IgG1 isotype control antibody was used for negative-control staining (black line). (C) Schematic representation of recombinant hGas6, hMFG-E8, mMFG-E8, and D89E, a mutant of MFG-E8 that cannot bind integrins. Gla, γ-carboxyglutamic acid domain; EGF, E1, and E2, epidermal growth factor-like domains; SHBG, sex hormone-binding globulin domain; C1 and C2, discoid domains; P/T, proline/threonine-enriched motif. The γ-carboxyglutamic acid domain of Gas6 and the C2 domain of MFG-E8 bind PtdSer. (D) Staining of HMVECs with an APC-conjugated anti-Flag tag antibody after incubation with hGas6 (red line), mMFG-E8 (blue line), or D89E (green line). The black line represents staining without prior incubation with any ligand. (E) Binding of the EGFP-labeled 2.2 1L1L pseudotype to HMVECs after incubation with hGas6, hMFG-E8, or mMFG-E8. Black line, HMVECs without virus; red line, HMVECs with virus with or without the bridging molecules indicated in the figure. The MFI values correspond to those for EGFP signals, which increase upon binding of EGFP-labeled virus. This experiment was repeated twice in singlicate and once in triplicate, and the MFI values shown are the averages and standard deviations of the triplicate experiment; representative flow cytometry histograms are shown. Significance was calculated by comparing the value of virus binding without a bridging molecule to the value of virus binding in the presence of the bridging molecules indicated in the figure using a two-sample Student t test (**, P

    Article Snippet: Enhanced green fluorescent protein (EGFP)-expressing lentiviral vectors pseudotyped with various Envs were produced by transfecting 293T cells with an Env expression vector (Sindbis, 2.2, 2.2 1L1L, VSV envelope G protein [VSV-G], gp64, or RRV), the packaging plasmid PAX2 (Addgene), and a lentiviral vector (cppt2e) containing EGFP as its transgene ( ).

    Techniques: Binding Assay, Synthesized, Derivative Assay, Activity Assay, Expressing, Flow Cytometry, Cytometry, Staining, Negative Control, Recombinant, Mutagenesis, FLAG-tag, Incubation, Labeling

    Lentiviral transduction mediated by MFG-E8. (A) Enhancement of HMVEC transduction with the 2.2 1L1L pseudotype (100 ng p24/ml) after incubation with hGas6, hMFG-E8, mMFG-E8, or D89E at the concentrations shown on the x axis. The fold enhancement was calculated by the following formula: percentage of EGFP-expressing cells preincubated with each ligand divided by percentage of EGFP-expressing cells preincubated with buffer only. This experiment was repeated twice in singlicate and twice in triplicate, and the results shown are the averages and standard deviations of one representative triplicate experiment. The proportion of EGFP-expressing cells preincubated with buffer only was 0.12% ± 0.05% (average ± standard deviation). Significance was calculated by comparing the value for the no-protein samples to the value for the samples with 10 μg/ml proteins, using a two-sample Student t test ( * , P

    Journal: Journal of Virology

    Article Title: Role of Phosphatidylserine Receptors in Enveloped Virus Infection

    doi: 10.1128/JVI.03287-13

    Figure Lengend Snippet: Lentiviral transduction mediated by MFG-E8. (A) Enhancement of HMVEC transduction with the 2.2 1L1L pseudotype (100 ng p24/ml) after incubation with hGas6, hMFG-E8, mMFG-E8, or D89E at the concentrations shown on the x axis. The fold enhancement was calculated by the following formula: percentage of EGFP-expressing cells preincubated with each ligand divided by percentage of EGFP-expressing cells preincubated with buffer only. This experiment was repeated twice in singlicate and twice in triplicate, and the results shown are the averages and standard deviations of one representative triplicate experiment. The proportion of EGFP-expressing cells preincubated with buffer only was 0.12% ± 0.05% (average ± standard deviation). Significance was calculated by comparing the value for the no-protein samples to the value for the samples with 10 μg/ml proteins, using a two-sample Student t test ( * , P

    Article Snippet: Enhanced green fluorescent protein (EGFP)-expressing lentiviral vectors pseudotyped with various Envs were produced by transfecting 293T cells with an Env expression vector (Sindbis, 2.2, 2.2 1L1L, VSV envelope G protein [VSV-G], gp64, or RRV), the packaging plasmid PAX2 (Addgene), and a lentiviral vector (cppt2e) containing EGFP as its transgene ( ).

    Techniques: Transduction, Incubation, Expressing, Standard Deviation

    Role of viral envelope PtdSer in TIM-1- and TIM-4-mediated lentiviral transduction. (A) Blocking of TIM-1-mediated 2.2 1L1L pseudotype transduction by ANX V or D89E. The 2.2 1L1L pseudotype (50 ng p24/ml) was incubated with ANX V or D89E for 1 h prior to transduction at the concentrations indicated in the figure. The vectors were then used for transduction of 293T and TIM-1 293T cells. (B) Blocking of TIM-4-mediated gp64 pseudotype transduction by ANX V or D89E. The gp64 pseudotype (25 ng p24/ml) was incubated with ANX V or D89E for 1 h prior to transduction at the concentrations indicated in the figure. The vectors were then used for the transduction of 293T and TIM-4 293T cells. (C) Blocking of TIM-1-mediated 2.2 1L1L pseudotype transduction by liposomes. TIM-1 293T cells were incubated for 1 h with the liposomes indicated in the figure. The cells were then transduced with the 2.2 1L1L pseudotype (50 ng p24/ml) for 2 h in the presence of the same liposomes. (D) Blocking of TIM-4-mediated gp64 pseudotype transduction by liposomes. TIM-4 293T cells were incubated for 1 h with the liposomes indicated in the figure. The cells were then transduced with the gp64 pseudotype (25 ng p24/ml) for 2 h in the presence of the same liposomes. (E) Blocking by D89E of HLA class I-mediated transduction of 293T cells with the 2.2 pseudotype. The 2.2 pseudotype (100 ng p24/ml) was conjugated with an anti-HLA class I antibody (Ab), followed by 1 h of incubation with D89E at the concentrations indicated in the figure. The vectors were then used for transduction of 293T cells. The experiments whose results are presented in panels A, B, and E were repeated twice in singlicate and twice in triplicate, and the results shown are the averages and standard deviations of one representative triplicate experiment. The experiments whose results are presented in panels C and D were repeated twice in triplicate, and the results shown are the averages and standard deviations of one representative triplicate experiment. For panels A to D, significance was calculated by comparing the results of TIM-1- or TIM-4-mediated transduction without blocking reagents to those with blocking reagents using a two-sample Student t test ( * , P

    Journal: Journal of Virology

    Article Title: Role of Phosphatidylserine Receptors in Enveloped Virus Infection

    doi: 10.1128/JVI.03287-13

    Figure Lengend Snippet: Role of viral envelope PtdSer in TIM-1- and TIM-4-mediated lentiviral transduction. (A) Blocking of TIM-1-mediated 2.2 1L1L pseudotype transduction by ANX V or D89E. The 2.2 1L1L pseudotype (50 ng p24/ml) was incubated with ANX V or D89E for 1 h prior to transduction at the concentrations indicated in the figure. The vectors were then used for transduction of 293T and TIM-1 293T cells. (B) Blocking of TIM-4-mediated gp64 pseudotype transduction by ANX V or D89E. The gp64 pseudotype (25 ng p24/ml) was incubated with ANX V or D89E for 1 h prior to transduction at the concentrations indicated in the figure. The vectors were then used for the transduction of 293T and TIM-4 293T cells. (C) Blocking of TIM-1-mediated 2.2 1L1L pseudotype transduction by liposomes. TIM-1 293T cells were incubated for 1 h with the liposomes indicated in the figure. The cells were then transduced with the 2.2 1L1L pseudotype (50 ng p24/ml) for 2 h in the presence of the same liposomes. (D) Blocking of TIM-4-mediated gp64 pseudotype transduction by liposomes. TIM-4 293T cells were incubated for 1 h with the liposomes indicated in the figure. The cells were then transduced with the gp64 pseudotype (25 ng p24/ml) for 2 h in the presence of the same liposomes. (E) Blocking by D89E of HLA class I-mediated transduction of 293T cells with the 2.2 pseudotype. The 2.2 pseudotype (100 ng p24/ml) was conjugated with an anti-HLA class I antibody (Ab), followed by 1 h of incubation with D89E at the concentrations indicated in the figure. The vectors were then used for transduction of 293T cells. The experiments whose results are presented in panels A, B, and E were repeated twice in singlicate and twice in triplicate, and the results shown are the averages and standard deviations of one representative triplicate experiment. The experiments whose results are presented in panels C and D were repeated twice in triplicate, and the results shown are the averages and standard deviations of one representative triplicate experiment. For panels A to D, significance was calculated by comparing the results of TIM-1- or TIM-4-mediated transduction without blocking reagents to those with blocking reagents using a two-sample Student t test ( * , P

    Article Snippet: Enhanced green fluorescent protein (EGFP)-expressing lentiviral vectors pseudotyped with various Envs were produced by transfecting 293T cells with an Env expression vector (Sindbis, 2.2, 2.2 1L1L, VSV envelope G protein [VSV-G], gp64, or RRV), the packaging plasmid PAX2 (Addgene), and a lentiviral vector (cppt2e) containing EGFP as its transgene ( ).

    Techniques: Transduction, Blocking Assay, Incubation

    Role of viral envelope PtdSer in MFG-E8-mediated lentiviral transduction. (A) Blocking of MFG-E8-mediated transduction of HMVECs with the 2.2 1L1L pseudotype by ANX V or D89E. HMVECs were incubated with hMFG-E8 (3 μg/ml) for 4 h prior to transduction. The 2.2 1L1L pseudotype (500 ng p24/ml) was preincubated with ANX V or D89E for 1 h at the concentrations shown in the figure prior to transduction. HMVECs were incubated for 2 h with the 2.2 1L1L pseudotype in the presence of ANX V or D89E. This experiment was repeated twice in singlicate and twice in triplicate, and the results shown are the averages and standard deviations of one representative triplicate experiment. (B) Blocking of MFG-E8-mediated transduction of HMVECs with the 2.2 1L1L pseudotype (100 ng p24/ml) by liposomes. HMVECs were incubated with hMFG-E8 (3 μg/ml) for 4 h, followed by incubation for 1 h with liposomes consisting of either PtdChl only (PtdChl), 75% PtdChl and 25% PtdSer (PtdSer), or 75% PtdChl and 25% PtdEtr (PtdEtr). The cells were then transduced with the 2.2 1L1L pseudotype for 2 h in the presence of the same liposomes. This experiment was repeated twice in singlicate and twice in triplicate, and the results shown are the averages and standard deviations of one representative triplicate experiment. For panels A and B, significance was calculated using a two-sample Student t test by comparing the MFG-E8-mediated transduction without blocking reagents to that with the blocking reagents indicated in the figure ( * , P

    Journal: Journal of Virology

    Article Title: Role of Phosphatidylserine Receptors in Enveloped Virus Infection

    doi: 10.1128/JVI.03287-13

    Figure Lengend Snippet: Role of viral envelope PtdSer in MFG-E8-mediated lentiviral transduction. (A) Blocking of MFG-E8-mediated transduction of HMVECs with the 2.2 1L1L pseudotype by ANX V or D89E. HMVECs were incubated with hMFG-E8 (3 μg/ml) for 4 h prior to transduction. The 2.2 1L1L pseudotype (500 ng p24/ml) was preincubated with ANX V or D89E for 1 h at the concentrations shown in the figure prior to transduction. HMVECs were incubated for 2 h with the 2.2 1L1L pseudotype in the presence of ANX V or D89E. This experiment was repeated twice in singlicate and twice in triplicate, and the results shown are the averages and standard deviations of one representative triplicate experiment. (B) Blocking of MFG-E8-mediated transduction of HMVECs with the 2.2 1L1L pseudotype (100 ng p24/ml) by liposomes. HMVECs were incubated with hMFG-E8 (3 μg/ml) for 4 h, followed by incubation for 1 h with liposomes consisting of either PtdChl only (PtdChl), 75% PtdChl and 25% PtdSer (PtdSer), or 75% PtdChl and 25% PtdEtr (PtdEtr). The cells were then transduced with the 2.2 1L1L pseudotype for 2 h in the presence of the same liposomes. This experiment was repeated twice in singlicate and twice in triplicate, and the results shown are the averages and standard deviations of one representative triplicate experiment. For panels A and B, significance was calculated using a two-sample Student t test by comparing the MFG-E8-mediated transduction without blocking reagents to that with the blocking reagents indicated in the figure ( * , P

    Article Snippet: Enhanced green fluorescent protein (EGFP)-expressing lentiviral vectors pseudotyped with various Envs were produced by transfecting 293T cells with an Env expression vector (Sindbis, 2.2, 2.2 1L1L, VSV envelope G protein [VSV-G], gp64, or RRV), the packaging plasmid PAX2 (Addgene), and a lentiviral vector (cppt2e) containing EGFP as its transgene ( ).

    Techniques: Transduction, Blocking Assay, Incubation

    Lentiviral transduction mediated by PtdSer receptors. Percentage of EGFP-expressing 293T cells; Axl 293T cells preincubated with hGas6, and TIM-1, -3, or -4, CD300a, BAI1, stabilin-1 or -2, STAB 2-15, STAB 2-17, or STAB 2-20 293T cells after transduction with lentiviral vectors pseudotyped with 2.2 1L1L (50 ng p24/ml) (A), Sindbis (20 ng p24/ml) (B), RRV (40 ng p24/ml) (C), gp64 (25 ng p24/ml) (D), or VSV-G (10 ng p24/ml) (E). EGFP expression was analyzed at 3 days postransduction. The results are the averages of triplicate experiments and are shown with standard deviations. (F) Percentage of EGFP-expressing 293T cells and Flag − TIM-1, -3, or -4, Flag − CD300a, Flag − BAI1, Flag − stabilin-1 or -2, STAB 2-5, and STAB 2-8 293T cells after transduction with the 2.2 1L1L pseudotype (50 ng p24/ml). (G) Titers (EGFP transduction units [TU]/ml) of various pseudotypes with 293T cells, Axl 293T cells preincubated with hGas6, and TIM-1 293T cells as target cells. The titers came from concentrated virus stocks that contained 60 μg p24/ml. The experiments whose results are presented in panels A and F were repeated three times in singlicate and twice in triplicate, and the results shown are the averages and standard deviations of one representative triplicate experiment. The experiments whose results are presented in panels B to E were repeated twice in triplicate, and the results shown are the averages and standard deviations of one representative triplicate experiment. For panels A to F, significance was calculated by comparing the transduction efficiencies of 293T cells to those of PtdSer receptor-expressing cells using a two-sample Student t test ( * , P

    Journal: Journal of Virology

    Article Title: Role of Phosphatidylserine Receptors in Enveloped Virus Infection

    doi: 10.1128/JVI.03287-13

    Figure Lengend Snippet: Lentiviral transduction mediated by PtdSer receptors. Percentage of EGFP-expressing 293T cells; Axl 293T cells preincubated with hGas6, and TIM-1, -3, or -4, CD300a, BAI1, stabilin-1 or -2, STAB 2-15, STAB 2-17, or STAB 2-20 293T cells after transduction with lentiviral vectors pseudotyped with 2.2 1L1L (50 ng p24/ml) (A), Sindbis (20 ng p24/ml) (B), RRV (40 ng p24/ml) (C), gp64 (25 ng p24/ml) (D), or VSV-G (10 ng p24/ml) (E). EGFP expression was analyzed at 3 days postransduction. The results are the averages of triplicate experiments and are shown with standard deviations. (F) Percentage of EGFP-expressing 293T cells and Flag − TIM-1, -3, or -4, Flag − CD300a, Flag − BAI1, Flag − stabilin-1 or -2, STAB 2-5, and STAB 2-8 293T cells after transduction with the 2.2 1L1L pseudotype (50 ng p24/ml). (G) Titers (EGFP transduction units [TU]/ml) of various pseudotypes with 293T cells, Axl 293T cells preincubated with hGas6, and TIM-1 293T cells as target cells. The titers came from concentrated virus stocks that contained 60 μg p24/ml. The experiments whose results are presented in panels A and F were repeated three times in singlicate and twice in triplicate, and the results shown are the averages and standard deviations of one representative triplicate experiment. The experiments whose results are presented in panels B to E were repeated twice in triplicate, and the results shown are the averages and standard deviations of one representative triplicate experiment. For panels A to F, significance was calculated by comparing the transduction efficiencies of 293T cells to those of PtdSer receptor-expressing cells using a two-sample Student t test ( * , P

    Article Snippet: Enhanced green fluorescent protein (EGFP)-expressing lentiviral vectors pseudotyped with various Envs were produced by transfecting 293T cells with an Env expression vector (Sindbis, 2.2, 2.2 1L1L, VSV envelope G protein [VSV-G], gp64, or RRV), the packaging plasmid PAX2 (Addgene), and a lentiviral vector (cppt2e) containing EGFP as its transgene ( ).

    Techniques: Transduction, Expressing

    Ectopic expression of PtdSer receptors on 293T cells. (A) Schematic representation of lentiviral vectors expressing TIM-1, -3, and -4, CD300a, or BAI1 and plasmid vectors expressing stabilin-1 and -2. SIN LTR, self-inactivating long terminal repeat; Ubc pro, ubiquitin C promoter; SV40 pro, SV40 promoter; TK, thymidine kinase. (B) Expression of Axl, TIM-1, -3, and -4, CD300a, BAI1, and stabilin-1 and -2 on 293T cells ectopically expressing each of these receptors analyzed by the use of antibodies specific to each receptor. Black line, staining by control antibodies; red line, staining by antibodies specific to each PtdSer receptors. (C) (Left column and top four panels of right column) Expression of TIM-1, -3, and -4, CD300a, BAI1, and stabilin-1 and -2 on 293T cells ectopically expressing each of these receptors and parental 293T cells analyzed by the antibody specific to the Flag tag. Black line, staining by APC-conjugated isotype control antibody; red line, staining by APC-conjugated anti-Flag tag antibody. (Bottom two panels of right column) Expression of Axl was analyzed by incubating 293T and Axl 293T cells with hGas6, followed by staining with the anti-Flag tag antibody. Black line, staining by APC-conjugated anti-Flag tag antibody without preincubation with hGas6; red line, staining by APC-conjugated anti-Flag tag antibody after incubation with hGas6.

    Journal: Journal of Virology

    Article Title: Role of Phosphatidylserine Receptors in Enveloped Virus Infection

    doi: 10.1128/JVI.03287-13

    Figure Lengend Snippet: Ectopic expression of PtdSer receptors on 293T cells. (A) Schematic representation of lentiviral vectors expressing TIM-1, -3, and -4, CD300a, or BAI1 and plasmid vectors expressing stabilin-1 and -2. SIN LTR, self-inactivating long terminal repeat; Ubc pro, ubiquitin C promoter; SV40 pro, SV40 promoter; TK, thymidine kinase. (B) Expression of Axl, TIM-1, -3, and -4, CD300a, BAI1, and stabilin-1 and -2 on 293T cells ectopically expressing each of these receptors analyzed by the use of antibodies specific to each receptor. Black line, staining by control antibodies; red line, staining by antibodies specific to each PtdSer receptors. (C) (Left column and top four panels of right column) Expression of TIM-1, -3, and -4, CD300a, BAI1, and stabilin-1 and -2 on 293T cells ectopically expressing each of these receptors and parental 293T cells analyzed by the antibody specific to the Flag tag. Black line, staining by APC-conjugated isotype control antibody; red line, staining by APC-conjugated anti-Flag tag antibody. (Bottom two panels of right column) Expression of Axl was analyzed by incubating 293T and Axl 293T cells with hGas6, followed by staining with the anti-Flag tag antibody. Black line, staining by APC-conjugated anti-Flag tag antibody without preincubation with hGas6; red line, staining by APC-conjugated anti-Flag tag antibody after incubation with hGas6.

    Article Snippet: Enhanced green fluorescent protein (EGFP)-expressing lentiviral vectors pseudotyped with various Envs were produced by transfecting 293T cells with an Env expression vector (Sindbis, 2.2, 2.2 1L1L, VSV envelope G protein [VSV-G], gp64, or RRV), the packaging plasmid PAX2 (Addgene), and a lentiviral vector (cppt2e) containing EGFP as its transgene ( ).

    Techniques: Expressing, Plasmid Preparation, Staining, FLAG-tag, Incubation

    Generation of PC-3 prostate cancer cells expressing varying levels of PTHrP. PTHrP expression was reduced in PC- 3 Luc cells via lentiviral shRNA. (A) PTHrP protein levels were measured from the culture supernatant by IRMA. Data are average of two measurements ± S.D. Assays were repeated more than three times, and one set of representative data is shown. (B) In vitro doubling time of the PC-3 clones expressing varying levels of PTHrP was calculated by enumeration of viable cells at 24, 48, 72, and 96 h time points ( n = 3 each). Data are mean ± S.D. NS, not significant. (C) In vivo tumor size was measured by bioluminescence imaging. Subcutaneous tumors were grown for 20 days ( n = 10 per group). Five representative mice are shown. Tumor incidence was 100% in all three groups, determined by microscopic examination of tumor cells upon necropsy.

    Journal: Endocrine-related cancer

    Article Title: Nuclear localization of parathyroid hormone-related peptide confers resistance to anoikis in prostate cancer cells

    doi: 10.1530/ERC-11-0278

    Figure Lengend Snippet: Generation of PC-3 prostate cancer cells expressing varying levels of PTHrP. PTHrP expression was reduced in PC- 3 Luc cells via lentiviral shRNA. (A) PTHrP protein levels were measured from the culture supernatant by IRMA. Data are average of two measurements ± S.D. Assays were repeated more than three times, and one set of representative data is shown. (B) In vitro doubling time of the PC-3 clones expressing varying levels of PTHrP was calculated by enumeration of viable cells at 24, 48, 72, and 96 h time points ( n = 3 each). Data are mean ± S.D. NS, not significant. (C) In vivo tumor size was measured by bioluminescence imaging. Subcutaneous tumors were grown for 20 days ( n = 10 per group). Five representative mice are shown. Tumor incidence was 100% in all three groups, determined by microscopic examination of tumor cells upon necropsy.

    Article Snippet: In addition, PTHLH (NCBI reference number: ) gene expression was reduced in PC-3Luc cells via a lentiviral vector (pLenti4/Block-iT DEST vector; Invitrogen) expressing short hairpin RNA targeting 5′-GGGCAGATACCTAACTCAGGA-3′.

    Techniques: Expressing, shRNA, In Vitro, Clone Assay, In Vivo, Imaging, Mouse Assay

    XIST sponged hsa-miR-214-3p in EOC . (A) Schematic drawing was demonstrated for the predictive binding site for hsa-miR-214-3p on XIST. Also, the DNA sequence was mutated at the hsa-miR-214-3p binding site on XIST. (B) Human HEK293T cells were co-transfected with luciferase plasmids of Luc-XIST or Luc-XIST(m), and synthetic miRNA mimics of miR-214-3p or miR-NC. A dual-luciferase reporter assay was then performed to measure relative luciferase activities in co-transfected HEK293T cells. (C) qRT-PCR was applied to compare hsa-miR-214-3p expressions between CAVO3 and OVCAR3 cells transduced with L/NS and those transduced with L/XIST. EOC, epithelial ovarian cancer; L/NS, a non-specific empty lentiviral vector; L/XIST, lentiviral vectors expressing the full-length human XIST; qRT-PCR, quantitative reverse transcription polymerase chain reaction; XIST, X-inactive specific transcript. * p

    Journal: Journal of Gynecologic Oncology

    Article Title: Upregulation of long non-coding RNA XIST has anticancer effects on epithelial ovarian cancer cells through inverse downregulation of hsa-miR-214-3p

    doi: 10.3802/jgo.2018.29.e99

    Figure Lengend Snippet: XIST sponged hsa-miR-214-3p in EOC . (A) Schematic drawing was demonstrated for the predictive binding site for hsa-miR-214-3p on XIST. Also, the DNA sequence was mutated at the hsa-miR-214-3p binding site on XIST. (B) Human HEK293T cells were co-transfected with luciferase plasmids of Luc-XIST or Luc-XIST(m), and synthetic miRNA mimics of miR-214-3p or miR-NC. A dual-luciferase reporter assay was then performed to measure relative luciferase activities in co-transfected HEK293T cells. (C) qRT-PCR was applied to compare hsa-miR-214-3p expressions between CAVO3 and OVCAR3 cells transduced with L/NS and those transduced with L/XIST. EOC, epithelial ovarian cancer; L/NS, a non-specific empty lentiviral vector; L/XIST, lentiviral vectors expressing the full-length human XIST; qRT-PCR, quantitative reverse transcription polymerase chain reaction; XIST, X-inactive specific transcript. * p

    Article Snippet: Lentiviral vectors containing hsa-miR-214-3p mimics (L/miR214), and a non-specific miRNA mimics (L/miR) were purchased from Genechem Company.

    Techniques: Binding Assay, Sequencing, Transfection, Luciferase, Reporter Assay, Quantitative RT-PCR, Transduction, Plasmid Preparation, Expressing, Reverse Transcription Polymerase Chain Reaction

    Effects of XIST upregulation on EOC chemosensitivity and in vivo tumor growth. (A) Lentiviral transduced CAOV3 and OVCAR3 cells were tested with cisplatin at concentrations (μM) of 0, 0.25, 0.5, 1, 4, 8 and 16 for 24 hours. A viability assay was then performed to compare cisplatin sensitivity between EOC cells transduced with L/NS and EOC cells transduced with L/XIST. (B) Lentiviral transduced CAOV3 cells were subcutaneously injected into carrier mice. The in vivo growth of CAOV3 xenograft was monitored by weekly measurement on in vivo tumor volumes. (C) After 5 weeks, L/NS-transduced and L/XIST-transduced CAOV3 xenografts were extracted and compared. EOC, epithelial ovarian cancer; L/NS, a non-specific empty lentiviral vector; L/XIST, lentiviral vectors expressing the full-length human XIST; XIST, X-inactive specific transcript. * p

    Journal: Journal of Gynecologic Oncology

    Article Title: Upregulation of long non-coding RNA XIST has anticancer effects on epithelial ovarian cancer cells through inverse downregulation of hsa-miR-214-3p

    doi: 10.3802/jgo.2018.29.e99

    Figure Lengend Snippet: Effects of XIST upregulation on EOC chemosensitivity and in vivo tumor growth. (A) Lentiviral transduced CAOV3 and OVCAR3 cells were tested with cisplatin at concentrations (μM) of 0, 0.25, 0.5, 1, 4, 8 and 16 for 24 hours. A viability assay was then performed to compare cisplatin sensitivity between EOC cells transduced with L/NS and EOC cells transduced with L/XIST. (B) Lentiviral transduced CAOV3 cells were subcutaneously injected into carrier mice. The in vivo growth of CAOV3 xenograft was monitored by weekly measurement on in vivo tumor volumes. (C) After 5 weeks, L/NS-transduced and L/XIST-transduced CAOV3 xenografts were extracted and compared. EOC, epithelial ovarian cancer; L/NS, a non-specific empty lentiviral vector; L/XIST, lentiviral vectors expressing the full-length human XIST; XIST, X-inactive specific transcript. * p

    Article Snippet: Lentiviral vectors containing hsa-miR-214-3p mimics (L/miR214), and a non-specific miRNA mimics (L/miR) were purchased from Genechem Company.

    Techniques: In Vivo, Viability Assay, Transduction, Injection, Mouse Assay, Plasmid Preparation, Expressing

    Effects of XIST upregulation on EOC proliferation and invasion. (A) CAOV3 and OVCAR3 cells were stably transduced with lentivirus. qRT-PCR was then applied to compare XIST expressions between EOC cells transduced with L/NS and EOC cells transduced with L/XIST. (B) A proliferation assay was performed for 96 hours to compare cancer proliferation between EOC cells transduced with L/NS and EOC cells transduced with L/XIST. Every 24-hour, absorbance was measured at 570 nm. (C) A transwell assay was performed. 24 hours later, lentiviral transduced EOC cells that invaded onto the bottoms of wells were stained by 0.1% crystal violet. (D) The numbers of invading cells were compared between EOC cells transduced with L/NS and EOC cells transduced with L/XIST. EOC, epithelial ovarian cancer; L/NS, a non-specific empty lentiviral vector; L/XIST, lentiviral vectors expressing the full-length human XIST; qRT-PCR, quantitative reverse transcription polymerase chain reaction; XIST, X-inactive specific transcript. * p

    Journal: Journal of Gynecologic Oncology

    Article Title: Upregulation of long non-coding RNA XIST has anticancer effects on epithelial ovarian cancer cells through inverse downregulation of hsa-miR-214-3p

    doi: 10.3802/jgo.2018.29.e99

    Figure Lengend Snippet: Effects of XIST upregulation on EOC proliferation and invasion. (A) CAOV3 and OVCAR3 cells were stably transduced with lentivirus. qRT-PCR was then applied to compare XIST expressions between EOC cells transduced with L/NS and EOC cells transduced with L/XIST. (B) A proliferation assay was performed for 96 hours to compare cancer proliferation between EOC cells transduced with L/NS and EOC cells transduced with L/XIST. Every 24-hour, absorbance was measured at 570 nm. (C) A transwell assay was performed. 24 hours later, lentiviral transduced EOC cells that invaded onto the bottoms of wells were stained by 0.1% crystal violet. (D) The numbers of invading cells were compared between EOC cells transduced with L/NS and EOC cells transduced with L/XIST. EOC, epithelial ovarian cancer; L/NS, a non-specific empty lentiviral vector; L/XIST, lentiviral vectors expressing the full-length human XIST; qRT-PCR, quantitative reverse transcription polymerase chain reaction; XIST, X-inactive specific transcript. * p

    Article Snippet: Lentiviral vectors containing hsa-miR-214-3p mimics (L/miR214), and a non-specific miRNA mimics (L/miR) were purchased from Genechem Company.

    Techniques: Stable Transfection, Transduction, Quantitative RT-PCR, Proliferation Assay, Transwell Assay, Staining, Plasmid Preparation, Expressing, Reverse Transcription Polymerase Chain Reaction

    Effects of hsa-miR-214-3p upregulation on XIST-mediated EOC proliferation and invasion. (A) CAOV3 and OVCAR3 cells, which were previously transduced with L/XIST, were then double transduced with L/miR or L/MIR214. qRT-PCR was applied to compare hsa-miR-214-3p expressions between EOC cells transduced with L/XIST+L/miR and EOC cells transduced with L/XIST+L/miR214. (B) A proliferation assay was performed for 96 hours to compare cancer proliferation between EOC cells transduced with L/XIST+L/miR and EOC cells transduced with L/XIST+L/miR214. Every 24-hour, absorbance was measured at 570 nm. (C) A transwell assay was also performed. 24 hours later, double-transduced EOC cells that invaded onto the bottoms of wells were stained by 0.1% crystal violet. (D) The numbers of invading cells were compared between EOC cells transduced with L/XIST+L/miR and EOC cells transduced with L/XIST+L/miR214. EOC, epithelial ovarian cancer; L/XIST, lentiviral vectors expressing the full-length human XIST; qRT-PCR, quantitative reverse transcription polymerase chain reaction; XIST, X-inactive specific transcript. * p

    Journal: Journal of Gynecologic Oncology

    Article Title: Upregulation of long non-coding RNA XIST has anticancer effects on epithelial ovarian cancer cells through inverse downregulation of hsa-miR-214-3p

    doi: 10.3802/jgo.2018.29.e99

    Figure Lengend Snippet: Effects of hsa-miR-214-3p upregulation on XIST-mediated EOC proliferation and invasion. (A) CAOV3 and OVCAR3 cells, which were previously transduced with L/XIST, were then double transduced with L/miR or L/MIR214. qRT-PCR was applied to compare hsa-miR-214-3p expressions between EOC cells transduced with L/XIST+L/miR and EOC cells transduced with L/XIST+L/miR214. (B) A proliferation assay was performed for 96 hours to compare cancer proliferation between EOC cells transduced with L/XIST+L/miR and EOC cells transduced with L/XIST+L/miR214. Every 24-hour, absorbance was measured at 570 nm. (C) A transwell assay was also performed. 24 hours later, double-transduced EOC cells that invaded onto the bottoms of wells were stained by 0.1% crystal violet. (D) The numbers of invading cells were compared between EOC cells transduced with L/XIST+L/miR and EOC cells transduced with L/XIST+L/miR214. EOC, epithelial ovarian cancer; L/XIST, lentiviral vectors expressing the full-length human XIST; qRT-PCR, quantitative reverse transcription polymerase chain reaction; XIST, X-inactive specific transcript. * p

    Article Snippet: Lentiviral vectors containing hsa-miR-214-3p mimics (L/miR214), and a non-specific miRNA mimics (L/miR) were purchased from Genechem Company.

    Techniques: Transduction, Quantitative RT-PCR, Proliferation Assay, Transwell Assay, Staining, Expressing, Reverse Transcription Polymerase Chain Reaction

    Effects of hsa-miR-214-3p upregulation on XIST-mediated EOC chemosensitivity. (A, B) Double-transduced CAOV3 (A) and OVCAR3 (B) cells were tested with cisplatin at concentrations (μM) of 0, 0.25, 0.5, 1, 4, 8 and 16 for 24 hours. A viability assay was then performed to compare cisplatin sensitivity between EOC cells transduced with L/XIST+L/miR and EOC cells transduced with L/XIST+L/miR214. EOC, epithelial ovarian cancer; L/XIST, lentiviral vectors expressing the full-length human XIST; XIST, X-inactive specific transcript. * p

    Journal: Journal of Gynecologic Oncology

    Article Title: Upregulation of long non-coding RNA XIST has anticancer effects on epithelial ovarian cancer cells through inverse downregulation of hsa-miR-214-3p

    doi: 10.3802/jgo.2018.29.e99

    Figure Lengend Snippet: Effects of hsa-miR-214-3p upregulation on XIST-mediated EOC chemosensitivity. (A, B) Double-transduced CAOV3 (A) and OVCAR3 (B) cells were tested with cisplatin at concentrations (μM) of 0, 0.25, 0.5, 1, 4, 8 and 16 for 24 hours. A viability assay was then performed to compare cisplatin sensitivity between EOC cells transduced with L/XIST+L/miR and EOC cells transduced with L/XIST+L/miR214. EOC, epithelial ovarian cancer; L/XIST, lentiviral vectors expressing the full-length human XIST; XIST, X-inactive specific transcript. * p

    Article Snippet: Lentiviral vectors containing hsa-miR-214-3p mimics (L/miR214), and a non-specific miRNA mimics (L/miR) were purchased from Genechem Company.

    Techniques: Viability Assay, Transduction, Expressing

    Overexpression of CSF-1R in 6–10B cells. (A) Transfection efficiency was detected using an inverted fluorescence microscope (magnification, ×100). (B) The mRNA expression level of CSF-1R in human nasopharyngeal carcinoma 6–10B cells following transfection with a CSF-1R lentiviral vector. (C) The protein expression of CSF-1R in human nasopharyngeal carcinoma 6–10B cells following lentiviral transfection. (D) The relative protein expression levels of CSF-1R in the transfection group and the control group were assessed. GADPH was used as the loading control for the western blot analyses. **P

    Journal: Oncology Letters

    Article Title: Colony stimulating factor-1 receptor promotes proliferation, migration and invasion in the human nasopharyngeal carcinoma 6–10B cell line via the phosphoinositide 3-kinase/Akt pathway

    doi: 10.3892/ol.2018.8750

    Figure Lengend Snippet: Overexpression of CSF-1R in 6–10B cells. (A) Transfection efficiency was detected using an inverted fluorescence microscope (magnification, ×100). (B) The mRNA expression level of CSF-1R in human nasopharyngeal carcinoma 6–10B cells following transfection with a CSF-1R lentiviral vector. (C) The protein expression of CSF-1R in human nasopharyngeal carcinoma 6–10B cells following lentiviral transfection. (D) The relative protein expression levels of CSF-1R in the transfection group and the control group were assessed. GADPH was used as the loading control for the western blot analyses. **P

    Article Snippet: Lentiviral vectors were constructed by Shanghai GeneChem Co., Ltd. (Shanghai, China).

    Techniques: Over Expression, Transfection, Fluorescence, Microscopy, Expressing, Plasmid Preparation, Western Blot

    PCR and Southern blot analysis of genomic DNA from the blood of G1 transgenic quails. (A) PCR analysis of G1 offspring obtained by microinjection to the subgerminal cavity of blastodermal embryos. Lanes 1–4 represent the transgenic quails. (B) PCR analysis of five G1 offspring produced by microinjection into the blood vessels of HH13–15 embryos. Lanes 1–6 represent transgenic quails 1–6; MW, DNA size markers; P, positive control; N, negative control; PCR product size is indicated on the right. (C) Southern blot results. N, nontransgenic quail; Lanes 1–4 indicate G1 transgenic quails 1–4 (as in A). (D) Genomic DNA (10 µg) was digested with Pst I and Eco RI and hybridized with the eGFP probe. P, 80 pg of pGCL-eGFP vector; N, negative control without injection of lentiviral vector; Lanes 1–6 indicate G1 transgenic quails 1–6 (as in B).

    Journal: PLoS ONE

    Article Title: Transgenic Quail Production by Microinjection of Lentiviral Vector into the Early Embryo Blood Vessels

    doi: 10.1371/journal.pone.0050817

    Figure Lengend Snippet: PCR and Southern blot analysis of genomic DNA from the blood of G1 transgenic quails. (A) PCR analysis of G1 offspring obtained by microinjection to the subgerminal cavity of blastodermal embryos. Lanes 1–4 represent the transgenic quails. (B) PCR analysis of five G1 offspring produced by microinjection into the blood vessels of HH13–15 embryos. Lanes 1–6 represent transgenic quails 1–6; MW, DNA size markers; P, positive control; N, negative control; PCR product size is indicated on the right. (C) Southern blot results. N, nontransgenic quail; Lanes 1–4 indicate G1 transgenic quails 1–4 (as in A). (D) Genomic DNA (10 µg) was digested with Pst I and Eco RI and hybridized with the eGFP probe. P, 80 pg of pGCL-eGFP vector; N, negative control without injection of lentiviral vector; Lanes 1–6 indicate G1 transgenic quails 1–6 (as in B).

    Article Snippet: Lentiviral vector The lentiviral suspension was purchased from GeneChem Biotechnology Co. Ltd (Shanghai, China).

    Techniques: Polymerase Chain Reaction, Southern Blot, Transgenic Assay, Produced, Positive Control, Negative Control, Plasmid Preparation, Injection

    Expression of eGFP in the ovary. Lentiviral vector was injected beneath the subgerminal cavity of blastodermal embryos. Newly hatched quails were observed by fluorescence microscopy. (A, C) Ovary of a 3 day-old female quail. (B, D) Enlargement of part of the ovary. (C, D) are non-transgenic control.

    Journal: PLoS ONE

    Article Title: Transgenic Quail Production by Microinjection of Lentiviral Vector into the Early Embryo Blood Vessels

    doi: 10.1371/journal.pone.0050817

    Figure Lengend Snippet: Expression of eGFP in the ovary. Lentiviral vector was injected beneath the subgerminal cavity of blastodermal embryos. Newly hatched quails were observed by fluorescence microscopy. (A, C) Ovary of a 3 day-old female quail. (B, D) Enlargement of part of the ovary. (C, D) are non-transgenic control.

    Article Snippet: Lentiviral vector The lentiviral suspension was purchased from GeneChem Biotechnology Co. Ltd (Shanghai, China).

    Techniques: Expressing, Plasmid Preparation, Injection, Fluorescence, Microscopy, Transgenic Assay

    Expression of eGFP in the gonads. Lentiviral vector was injected into the blood vessels of HH13–15 embryos. Newly hatched quails were observed by fluorescence microscopy. (A, B, C, D) Gonads of a 3 day-old male quail left and right. (E, F) Enlargement of part of the gonads. (B, D, F) are bright-field images.

    Journal: PLoS ONE

    Article Title: Transgenic Quail Production by Microinjection of Lentiviral Vector into the Early Embryo Blood Vessels

    doi: 10.1371/journal.pone.0050817

    Figure Lengend Snippet: Expression of eGFP in the gonads. Lentiviral vector was injected into the blood vessels of HH13–15 embryos. Newly hatched quails were observed by fluorescence microscopy. (A, B, C, D) Gonads of a 3 day-old male quail left and right. (E, F) Enlargement of part of the gonads. (B, D, F) are bright-field images.

    Article Snippet: Lentiviral vector The lentiviral suspension was purchased from GeneChem Biotechnology Co. Ltd (Shanghai, China).

    Techniques: Expressing, Plasmid Preparation, Injection, Fluorescence, Microscopy

    Expression of eGFP in tissues of hatched transgenic chimeric quail by fluorescence microscopy. Lentiviral vector was injected into the blood vessels of HH13–15 embryos. eGFP expression in (A) the vitelline membrane of 4 day-old embryo; and in (B) the beak, (C) feather, (D) liver, (E) kidney, (F) mesenterium, (G) glandular stomach, (H) small intestine, (I) large intestine, (J) blood vessel, (K) breast muscle, (L) spleen, (M) heart, (N) oviduct, (O) eye, and (P) brain of newly hatched G0 quails; and in (Q) the follicle of sexually matured G0 quail, (R) the skeletal muscle of G1 progeny.

    Journal: PLoS ONE

    Article Title: Transgenic Quail Production by Microinjection of Lentiviral Vector into the Early Embryo Blood Vessels

    doi: 10.1371/journal.pone.0050817

    Figure Lengend Snippet: Expression of eGFP in tissues of hatched transgenic chimeric quail by fluorescence microscopy. Lentiviral vector was injected into the blood vessels of HH13–15 embryos. eGFP expression in (A) the vitelline membrane of 4 day-old embryo; and in (B) the beak, (C) feather, (D) liver, (E) kidney, (F) mesenterium, (G) glandular stomach, (H) small intestine, (I) large intestine, (J) blood vessel, (K) breast muscle, (L) spleen, (M) heart, (N) oviduct, (O) eye, and (P) brain of newly hatched G0 quails; and in (Q) the follicle of sexually matured G0 quail, (R) the skeletal muscle of G1 progeny.

    Article Snippet: Lentiviral vector The lentiviral suspension was purchased from GeneChem Biotechnology Co. Ltd (Shanghai, China).

    Techniques: Expressing, Transgenic Assay, Fluorescence, Microscopy, Plasmid Preparation, Injection

    PCR analysis of genomic DNA extracted from semen of transgenic germ line chimeric (G0) quail. (A) PCR product of eGFP; (B) PCR product of housekeeping gene GAPDH; (1–5) PCR products of sexually matured G0 males produced by microinjection to blood vessels of embryo at HH Stage 13–15 (6–8). PCR analysis of three sexually mature males produced by microinjection beneath the subgerminal cavity of the blastodermal embryo. (M) Standard DNA markers. (P) Positive control. (N) negative control without microinjection of lentiviral vector. PCR product size is indicated on the right.

    Journal: PLoS ONE

    Article Title: Transgenic Quail Production by Microinjection of Lentiviral Vector into the Early Embryo Blood Vessels

    doi: 10.1371/journal.pone.0050817

    Figure Lengend Snippet: PCR analysis of genomic DNA extracted from semen of transgenic germ line chimeric (G0) quail. (A) PCR product of eGFP; (B) PCR product of housekeeping gene GAPDH; (1–5) PCR products of sexually matured G0 males produced by microinjection to blood vessels of embryo at HH Stage 13–15 (6–8). PCR analysis of three sexually mature males produced by microinjection beneath the subgerminal cavity of the blastodermal embryo. (M) Standard DNA markers. (P) Positive control. (N) negative control without microinjection of lentiviral vector. PCR product size is indicated on the right.

    Article Snippet: Lentiviral vector The lentiviral suspension was purchased from GeneChem Biotechnology Co. Ltd (Shanghai, China).

    Techniques: Polymerase Chain Reaction, Transgenic Assay, Produced, Positive Control, Negative Control, Plasmid Preparation

    (A) Detection of EWS-FLI1 fusion gene expression in RD-ES and A673 cell lines using reverse transcription-polymerase chain reaction. (B) Expression levels of the fusion gene were downregulated in RD-ES and A-673 cells following siRNA transfection. (C) miR-34b expression in A673 cells was downregulated following siRNA transfection. (D) miR-34b expression in RD-ES cells was downregulated following siRNA transfection. (E) miR-34b expression was upregulated by the precursor of miR-34b in RD-ES and A-673 cells. (F) miR-34b expression was downregulated by the inhibitor of miR-34b in RD-ES and A-673 cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; NS, cells transfected with non-targeting siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA targeting the EWS-FLI1 fusion gene; Micro-up, NC(−) cell lines treated with precursor miR-34b sequences; Micro-down, NC(+) cell lines treated with complementary sequences of miR-34b. **P

    Journal: Molecular Medicine Reports

    Article Title: MicroRNA-34b promotes proliferation, migration and invasion of Ewing's sarcoma cells by downregulating Notch1

    doi: 10.3892/mmr.2018.9365

    Figure Lengend Snippet: (A) Detection of EWS-FLI1 fusion gene expression in RD-ES and A673 cell lines using reverse transcription-polymerase chain reaction. (B) Expression levels of the fusion gene were downregulated in RD-ES and A-673 cells following siRNA transfection. (C) miR-34b expression in A673 cells was downregulated following siRNA transfection. (D) miR-34b expression in RD-ES cells was downregulated following siRNA transfection. (E) miR-34b expression was upregulated by the precursor of miR-34b in RD-ES and A-673 cells. (F) miR-34b expression was downregulated by the inhibitor of miR-34b in RD-ES and A-673 cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; NS, cells transfected with non-targeting siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA targeting the EWS-FLI1 fusion gene; Micro-up, NC(−) cell lines treated with precursor miR-34b sequences; Micro-down, NC(+) cell lines treated with complementary sequences of miR-34b. **P

    Article Snippet: The lentiviral vector with complementary sequences of miR-34b was infected into normal cells to downregulate miR-34b expression, whereas the lentiviral vector with precursor sequences of miR-34b was infected into siRNA-transfected cells to upregulate miR-34b expression.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Transfection, Plasmid Preparation

    Protein expression levels of Notch1, Hes-1 and Hey-1 demonstrated the negative association with EWS-FLI1 and miR-34b in RD-ES and A673 cells. (A) The protein expression levels of Notch-1, Hes-1 and Hey-1 were increased following EWS-FLI1 repression in RD-ES cells. (B) The expression of Notch-1, Hes-1 and Hey-1 were decreased after miR-34b was upregulated in RD-ES cells in which EWS-FLI1 is repressed. (C) The expression of Notch-1, Hes-1 and Hey-1 were increased after miR-34b was downregulated in RD-ES cells. (D) The protein expression levels of Notch-1, Hes-1 and Hey-1 were increased following EWS-FLI1 repression in A673 cells. (E) The expression of Notch-1, Hes-1 and Hey-1 were decreased following miR-34b was upregulated in A673 cells in which EWS-FLI1 is repressed. (F) The expression of Notch-1, Hes-1 and Hey-1 were increased after miR-34b was downregulated in A673 cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; NS, cells transfected with non-targeting siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; MU, cell lines treated with precursor miR-34b sequences; MD, cell lines treated with complementary sequences of miR-34b. EWS, Ewing's sarcoma breakpoint region 1; FLI1, friend leukemia integration 1 transcription factor; Hes1, Hes family BHLH transcription factor 1; Hey1, Hes-related family BHLH transcription factor with YRPW motif 1; miR, microRNA; siRNA, small interfering RNA.

    Journal: Molecular Medicine Reports

    Article Title: MicroRNA-34b promotes proliferation, migration and invasion of Ewing's sarcoma cells by downregulating Notch1

    doi: 10.3892/mmr.2018.9365

    Figure Lengend Snippet: Protein expression levels of Notch1, Hes-1 and Hey-1 demonstrated the negative association with EWS-FLI1 and miR-34b in RD-ES and A673 cells. (A) The protein expression levels of Notch-1, Hes-1 and Hey-1 were increased following EWS-FLI1 repression in RD-ES cells. (B) The expression of Notch-1, Hes-1 and Hey-1 were decreased after miR-34b was upregulated in RD-ES cells in which EWS-FLI1 is repressed. (C) The expression of Notch-1, Hes-1 and Hey-1 were increased after miR-34b was downregulated in RD-ES cells. (D) The protein expression levels of Notch-1, Hes-1 and Hey-1 were increased following EWS-FLI1 repression in A673 cells. (E) The expression of Notch-1, Hes-1 and Hey-1 were decreased following miR-34b was upregulated in A673 cells in which EWS-FLI1 is repressed. (F) The expression of Notch-1, Hes-1 and Hey-1 were increased after miR-34b was downregulated in A673 cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; NS, cells transfected with non-targeting siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; MU, cell lines treated with precursor miR-34b sequences; MD, cell lines treated with complementary sequences of miR-34b. EWS, Ewing's sarcoma breakpoint region 1; FLI1, friend leukemia integration 1 transcription factor; Hes1, Hes family BHLH transcription factor 1; Hey1, Hes-related family BHLH transcription factor with YRPW motif 1; miR, microRNA; siRNA, small interfering RNA.

    Article Snippet: The lentiviral vector with complementary sequences of miR-34b was infected into normal cells to downregulate miR-34b expression, whereas the lentiviral vector with precursor sequences of miR-34b was infected into siRNA-transfected cells to upregulate miR-34b expression.

    Techniques: Expressing, Plasmid Preparation, Transfection, Small Interfering RNA

    Effects of miR-34b on the migration and invasion of RD-ES cells in vitro . Magnification, ×200 (A) Migratory and (B) invasive ability of normal RD-ES cells was inhibited when miR-34b expression was downregulated (top panel). However, miR-34b overexpression improved the migratory and invasive ability of siRNA-transfected-RD-ES cells (bottom panel). Quantification of (C) EWS-FLI1 (−) and (D) EWS-FLI1 (+) cells. The number of cells that passed through the membrane was counted. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; Micro-up, cell lines treated with precursor miR-34b sequences; Micro-down, cell lines treated with complementary sequences of miR-34b; EWS-FLI1 (+), cells that were not transfected with EWS-FLI1 fusion gene siRNA; EWS-FLI1 (−), cells that were transfected with EWS-FLI1 fusion gene siRNA against EWS-FLI1 gene. **P

    Journal: Molecular Medicine Reports

    Article Title: MicroRNA-34b promotes proliferation, migration and invasion of Ewing's sarcoma cells by downregulating Notch1

    doi: 10.3892/mmr.2018.9365

    Figure Lengend Snippet: Effects of miR-34b on the migration and invasion of RD-ES cells in vitro . Magnification, ×200 (A) Migratory and (B) invasive ability of normal RD-ES cells was inhibited when miR-34b expression was downregulated (top panel). However, miR-34b overexpression improved the migratory and invasive ability of siRNA-transfected-RD-ES cells (bottom panel). Quantification of (C) EWS-FLI1 (−) and (D) EWS-FLI1 (+) cells. The number of cells that passed through the membrane was counted. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; Micro-up, cell lines treated with precursor miR-34b sequences; Micro-down, cell lines treated with complementary sequences of miR-34b; EWS-FLI1 (+), cells that were not transfected with EWS-FLI1 fusion gene siRNA; EWS-FLI1 (−), cells that were transfected with EWS-FLI1 fusion gene siRNA against EWS-FLI1 gene. **P

    Article Snippet: The lentiviral vector with complementary sequences of miR-34b was infected into normal cells to downregulate miR-34b expression, whereas the lentiviral vector with precursor sequences of miR-34b was infected into siRNA-transfected cells to upregulate miR-34b expression.

    Techniques: Migration, In Vitro, Expressing, Over Expression, Transfection, Plasmid Preparation

    Proliferation and adhesion of RD-ES and A673 cells were detected using an MTT assay. (A) When miR-34b expression was upregulated, the siRNA-transfected RD-ES cells exhibited significantly increased proliferative capacity compared with cells in the control groups. (B) When miR-34b expression was upregulated, the siRNA-transfected A673 cells exhibited significantly increased proliferative capacity. (C) Proliferative ability of normal RD-ES cells was significantly inhibited when miR-34b expression was downregulated. (D) Proliferative of normal A673 cells was significantly inhibited when miR-34b expression was downregulated. (E) Overexpression of miR-34b significantly improved the adhesion of RD-ES cells, but had little effect on A673 cells. (F) Knockdown of miR-34b reduced the adhesive ability of RD-ES cells, but had little effect on A673 cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; Micro-up, cell lines treated with precursor miR-34b sequences; Micro-down, cell lines treated with complementary sequences of miR-34b. *P

    Journal: Molecular Medicine Reports

    Article Title: MicroRNA-34b promotes proliferation, migration and invasion of Ewing's sarcoma cells by downregulating Notch1

    doi: 10.3892/mmr.2018.9365

    Figure Lengend Snippet: Proliferation and adhesion of RD-ES and A673 cells were detected using an MTT assay. (A) When miR-34b expression was upregulated, the siRNA-transfected RD-ES cells exhibited significantly increased proliferative capacity compared with cells in the control groups. (B) When miR-34b expression was upregulated, the siRNA-transfected A673 cells exhibited significantly increased proliferative capacity. (C) Proliferative ability of normal RD-ES cells was significantly inhibited when miR-34b expression was downregulated. (D) Proliferative of normal A673 cells was significantly inhibited when miR-34b expression was downregulated. (E) Overexpression of miR-34b significantly improved the adhesion of RD-ES cells, but had little effect on A673 cells. (F) Knockdown of miR-34b reduced the adhesive ability of RD-ES cells, but had little effect on A673 cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; Micro-up, cell lines treated with precursor miR-34b sequences; Micro-down, cell lines treated with complementary sequences of miR-34b. *P

    Article Snippet: The lentiviral vector with complementary sequences of miR-34b was infected into normal cells to downregulate miR-34b expression, whereas the lentiviral vector with precursor sequences of miR-34b was infected into siRNA-transfected cells to upregulate miR-34b expression.

    Techniques: MTT Assay, Expressing, Transfection, Over Expression, Plasmid Preparation

    mRNA expression levels of Notch1, Hes-1 and Hey-1 demonstrated the negative association with that of EWS-FLI1 and miR-34b in RD-ES and A673 cells. (A) mRNA expression levels of Notch-1, Hes-1 and Hey-1 were increased when the expression of the EWS-FLI1 fusion gene was downregulated by siRNA in RD-ES and A673 cells. (B) Conversely, mRNA expression levels were inhibited after the siRNA-transfected cells were treated with miR-34b precursor sequences. (C) Notch-1, Hes-1 and Hey-1 mRNA expression was increased after miR-34b was downregulated in normal cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; NS, cells transfected with non-targeting siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; MU, cell lines treated with precursor miR-34b sequences; MD, cell lines treated with complementary sequences of miR-34b. **P

    Journal: Molecular Medicine Reports

    Article Title: MicroRNA-34b promotes proliferation, migration and invasion of Ewing's sarcoma cells by downregulating Notch1

    doi: 10.3892/mmr.2018.9365

    Figure Lengend Snippet: mRNA expression levels of Notch1, Hes-1 and Hey-1 demonstrated the negative association with that of EWS-FLI1 and miR-34b in RD-ES and A673 cells. (A) mRNA expression levels of Notch-1, Hes-1 and Hey-1 were increased when the expression of the EWS-FLI1 fusion gene was downregulated by siRNA in RD-ES and A673 cells. (B) Conversely, mRNA expression levels were inhibited after the siRNA-transfected cells were treated with miR-34b precursor sequences. (C) Notch-1, Hes-1 and Hey-1 mRNA expression was increased after miR-34b was downregulated in normal cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; NS, cells transfected with non-targeting siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; MU, cell lines treated with precursor miR-34b sequences; MD, cell lines treated with complementary sequences of miR-34b. **P

    Article Snippet: The lentiviral vector with complementary sequences of miR-34b was infected into normal cells to downregulate miR-34b expression, whereas the lentiviral vector with precursor sequences of miR-34b was infected into siRNA-transfected cells to upregulate miR-34b expression.

    Techniques: Expressing, Transfection, Plasmid Preparation

    p38α unleashes KMT1A via phosphorylation from MyoD during differentiation. a Control IgG or anti-MyoD immunoprecipitates retrieved from cell extracts of C2C12 cells grown GM or DM with or without SB were divided equally and evaluated one part for western blot analysis, probed with antibodies against KMT1A and MyoD. Another part was subjected to HMT activity assay. Methylated and input H3(N) were detected by fluorography and Commassie, respectively. b Control IgG or anti-KMT1A immunoprecipitates retrieved from cell extracts used in a were subjected to western blot analysis, probed with antibodies against MyoD and KMT1A. c Control IgG, anti-KMT1A, or anti-MyoD immunoprecipitates were retrieved from cell extracts of C2C12 cells expressing vector control (Em), MKK6EE or MKK6DN via lentiviral delivery grown in GM or DM. Subsequently, IgG and KMT1A immunoprecipitates were subjected to western blot analysis, probed with antibodies against MyoD and KMT1A. Separately, IgG and MyoD immunoprecipitates were subjected to HMT activity assay. Methylated and input H3(N) were detected by fluorography and Commassie, respectively

    Journal: Skeletal Muscle

    Article Title: p38α MAPK disables KMT1A-mediated repression of myogenic differentiation program

    doi: 10.1186/s13395-016-0100-z

    Figure Lengend Snippet: p38α unleashes KMT1A via phosphorylation from MyoD during differentiation. a Control IgG or anti-MyoD immunoprecipitates retrieved from cell extracts of C2C12 cells grown GM or DM with or without SB were divided equally and evaluated one part for western blot analysis, probed with antibodies against KMT1A and MyoD. Another part was subjected to HMT activity assay. Methylated and input H3(N) were detected by fluorography and Commassie, respectively. b Control IgG or anti-KMT1A immunoprecipitates retrieved from cell extracts used in a were subjected to western blot analysis, probed with antibodies against MyoD and KMT1A. c Control IgG, anti-KMT1A, or anti-MyoD immunoprecipitates were retrieved from cell extracts of C2C12 cells expressing vector control (Em), MKK6EE or MKK6DN via lentiviral delivery grown in GM or DM. Subsequently, IgG and KMT1A immunoprecipitates were subjected to western blot analysis, probed with antibodies against MyoD and KMT1A. Separately, IgG and MyoD immunoprecipitates were subjected to HMT activity assay. Methylated and input H3(N) were detected by fluorography and Commassie, respectively

    Article Snippet: Briefly, cells were transfected with lentiviral vector along with packaging vectors using Pure-Fection transfection reagent (System Biosciences).

    Techniques: Western Blot, HMT Assay, Activity Assay, Methylation, Expressing, Plasmid Preparation

    Inhibition of p38α activation retains KMT1A on chromatin of the myogenin promoter during differentiation. a ChIP analysis of E box-containing regions within the Myog and MyHCIIB promoters was performed on chromatin of C2C12 cells gown in GM or DM treated with or without SB. Schematic diagram represents E box-containing regions of these genes promoters and arrows indicate primers used for PCR reaction. ChIP was performed with antibodies against proteins as indicated, where no antibodies or IgG were used as controls. b ChIP analysis of same regions of Myog promoter was performed on chromatin of C2C12 cells expressing vector control (Em) or MKK6EE vial lentiviral delivery grown in GM in the presence or absence of SB. ChIP was performed with anti-H3K9me3 or anti-KMT1A antibodies, where no antibodies or IgG were used as controls

    Journal: Skeletal Muscle

    Article Title: p38α MAPK disables KMT1A-mediated repression of myogenic differentiation program

    doi: 10.1186/s13395-016-0100-z

    Figure Lengend Snippet: Inhibition of p38α activation retains KMT1A on chromatin of the myogenin promoter during differentiation. a ChIP analysis of E box-containing regions within the Myog and MyHCIIB promoters was performed on chromatin of C2C12 cells gown in GM or DM treated with or without SB. Schematic diagram represents E box-containing regions of these genes promoters and arrows indicate primers used for PCR reaction. ChIP was performed with antibodies against proteins as indicated, where no antibodies or IgG were used as controls. b ChIP analysis of same regions of Myog promoter was performed on chromatin of C2C12 cells expressing vector control (Em) or MKK6EE vial lentiviral delivery grown in GM in the presence or absence of SB. ChIP was performed with anti-H3K9me3 or anti-KMT1A antibodies, where no antibodies or IgG were used as controls

    Article Snippet: Briefly, cells were transfected with lentiviral vector along with packaging vectors using Pure-Fection transfection reagent (System Biosciences).

    Techniques: Inhibition, Activation Assay, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Expressing, Plasmid Preparation

    Pharmacological blockade of p38α signaling precludes unleashing of MyoD-associated HMT activity during myoblasts differentiation. a MyoD or control IgG immunoprecipitates retrieved from cell extracts of C2C12 grown in GM or DM with or without SB or LY were subjected to HMT activity assay. Methylated and input H3(N) were detected by fluorography and Commassie, respectively. b Luciferase activity was assessed in C2-4RE-luc reporter cells grown in GM or DM without or with SB or LY. Luciferase activity was expressed after protein normalization as fold activation. Error bar, ±SEM ( n = 3). c Western blot analysis of primary HsMB cells expressing shRNA of scramble control shRNA (Ctrl) or p38α via lentiviral delivery grown in GM or DM with or without SB, probed with antibodies for indicated proteins. β-actin served as loading control

    Journal: Skeletal Muscle

    Article Title: p38α MAPK disables KMT1A-mediated repression of myogenic differentiation program

    doi: 10.1186/s13395-016-0100-z

    Figure Lengend Snippet: Pharmacological blockade of p38α signaling precludes unleashing of MyoD-associated HMT activity during myoblasts differentiation. a MyoD or control IgG immunoprecipitates retrieved from cell extracts of C2C12 grown in GM or DM with or without SB or LY were subjected to HMT activity assay. Methylated and input H3(N) were detected by fluorography and Commassie, respectively. b Luciferase activity was assessed in C2-4RE-luc reporter cells grown in GM or DM without or with SB or LY. Luciferase activity was expressed after protein normalization as fold activation. Error bar, ±SEM ( n = 3). c Western blot analysis of primary HsMB cells expressing shRNA of scramble control shRNA (Ctrl) or p38α via lentiviral delivery grown in GM or DM with or without SB, probed with antibodies for indicated proteins. β-actin served as loading control

    Article Snippet: Briefly, cells were transfected with lentiviral vector along with packaging vectors using Pure-Fection transfection reagent (System Biosciences).

    Techniques: HMT Assay, Activity Assay, Methylation, Luciferase, Activation Assay, Western Blot, Expressing, shRNA

    MKK6EE-p38α activation can abolish KMT1A inhibited gene activation by MyoD. a C2-4RE-luc/KMT1A-F cells were generated by overexpression of Flag-KMT1A in C2-4Re-luc reporter cells by lentiviral delivery. Subsequently, luciferase activity was assessed in C2-4RE-luc and C2-4RE-luc/KMT1A-F cells in GM or DM and expressed protein after normalization as fold activation. Western blot analysis of these reporter cells extracts probed with antibodies to detect MyoD and β-actin for loading control. b Luciferase activity was assessed in C2-4RE-luc/KMT1A-F cells following expression of MKK6EE, MKK6DN or vector control (Em) via lentiviral delivery grown in GM and expressed after protein normalization as fold activation. c C2-4RE-luc/KMT1A-F cells expressing vector control (Em) or MKK6EE via lentiviral delivery were grown in GM or DM and MKK6EE-transduced cells treated with or without SB. Afterward, luciferase activity was assessed in these cells and values expressed after protein normalization. Where appropriate, error bar, ±SEM ( n = 3)

    Journal: Skeletal Muscle

    Article Title: p38α MAPK disables KMT1A-mediated repression of myogenic differentiation program

    doi: 10.1186/s13395-016-0100-z

    Figure Lengend Snippet: MKK6EE-p38α activation can abolish KMT1A inhibited gene activation by MyoD. a C2-4RE-luc/KMT1A-F cells were generated by overexpression of Flag-KMT1A in C2-4Re-luc reporter cells by lentiviral delivery. Subsequently, luciferase activity was assessed in C2-4RE-luc and C2-4RE-luc/KMT1A-F cells in GM or DM and expressed protein after normalization as fold activation. Western blot analysis of these reporter cells extracts probed with antibodies to detect MyoD and β-actin for loading control. b Luciferase activity was assessed in C2-4RE-luc/KMT1A-F cells following expression of MKK6EE, MKK6DN or vector control (Em) via lentiviral delivery grown in GM and expressed after protein normalization as fold activation. c C2-4RE-luc/KMT1A-F cells expressing vector control (Em) or MKK6EE via lentiviral delivery were grown in GM or DM and MKK6EE-transduced cells treated with or without SB. Afterward, luciferase activity was assessed in these cells and values expressed after protein normalization. Where appropriate, error bar, ±SEM ( n = 3)

    Article Snippet: Briefly, cells were transfected with lentiviral vector along with packaging vectors using Pure-Fection transfection reagent (System Biosciences).

    Techniques: Activation Assay, Generated, Over Expression, Luciferase, Activity Assay, Western Blot, Expressing, Plasmid Preparation

    p38α mediates phosphorylation of KMT1A during myoblasts differentiation. a Western blot analysis of cell extracts from C2-4RE-luc/KMT1A-F expressing control vector (Em), MKK6EE or MKK6DN via lentiviral delivery grown in GM, and C2C12 grown in DM as positive control of differentiation, probed with antibodies for indicated proteins, and β-actin as for loading control. Phosphorylated KMT1A was detected C2-4RE-luc cells expressing only MKK6EE in GM and C2C12 cells in DM. b Western blot analysis of cell extracts from C2C12 grown in GM or DM at various time points, probed with antibodies for detecting indicated proteins, GAPDH as loading control. An increased level of phosphorylated KMT1A was observed with increased activated p38 status during the differentiation of C2C12 myoblasts. c Western blot analysis of cell extracts from C2C12 grown in GM or DM in the presence or absence of SB, probed with antibodies against indicated proteins. GAPDH served as loading control. Inhibition of KMT1A phosphorylation was observed by SB-treatment-induced blockade of p38a activation in cells under DM conditions. d Western blot analysis of cell extracts from C2C12 cells expressing scramble control shRNA (Ctrl) or p38αshRNA via lentiviral delivery grown as specified in GM or DM, probed with antibodies for indicated proteins, where GAPDH for loading control. Inhibition of KMT1A phosphorylation was observed by p38α knockdown. e Control IgG or anti-Flag (M2) immunoprecipitates were retrieved as indicated from extracts of 293A cells expressing with or without Flag-KMT1A via lentiviral delivery. These immunoprecipitates were then subjected to in vitro kinase assay in the presence of purified p38α with or without SB. Subsequently, the reaction mixture was divided equally and evaluated one part for autoradiography and another part for western blot analysis. Phosphorylation of KMT1A directly by p38α was observed

    Journal: Skeletal Muscle

    Article Title: p38α MAPK disables KMT1A-mediated repression of myogenic differentiation program

    doi: 10.1186/s13395-016-0100-z

    Figure Lengend Snippet: p38α mediates phosphorylation of KMT1A during myoblasts differentiation. a Western blot analysis of cell extracts from C2-4RE-luc/KMT1A-F expressing control vector (Em), MKK6EE or MKK6DN via lentiviral delivery grown in GM, and C2C12 grown in DM as positive control of differentiation, probed with antibodies for indicated proteins, and β-actin as for loading control. Phosphorylated KMT1A was detected C2-4RE-luc cells expressing only MKK6EE in GM and C2C12 cells in DM. b Western blot analysis of cell extracts from C2C12 grown in GM or DM at various time points, probed with antibodies for detecting indicated proteins, GAPDH as loading control. An increased level of phosphorylated KMT1A was observed with increased activated p38 status during the differentiation of C2C12 myoblasts. c Western blot analysis of cell extracts from C2C12 grown in GM or DM in the presence or absence of SB, probed with antibodies against indicated proteins. GAPDH served as loading control. Inhibition of KMT1A phosphorylation was observed by SB-treatment-induced blockade of p38a activation in cells under DM conditions. d Western blot analysis of cell extracts from C2C12 cells expressing scramble control shRNA (Ctrl) or p38αshRNA via lentiviral delivery grown as specified in GM or DM, probed with antibodies for indicated proteins, where GAPDH for loading control. Inhibition of KMT1A phosphorylation was observed by p38α knockdown. e Control IgG or anti-Flag (M2) immunoprecipitates were retrieved as indicated from extracts of 293A cells expressing with or without Flag-KMT1A via lentiviral delivery. These immunoprecipitates were then subjected to in vitro kinase assay in the presence of purified p38α with or without SB. Subsequently, the reaction mixture was divided equally and evaluated one part for autoradiography and another part for western blot analysis. Phosphorylation of KMT1A directly by p38α was observed

    Article Snippet: Briefly, cells were transfected with lentiviral vector along with packaging vectors using Pure-Fection transfection reagent (System Biosciences).

    Techniques: Western Blot, Expressing, Plasmid Preparation, Positive Control, Inhibition, Activation Assay, shRNA, In Vitro, Kinase Assay, Purification, Autoradiography

    MKK6EE-p38α activation can rescue KMT1A suppressed muscle differentiation. a Western blot analysis of cell extracts from vector control C2-Em and Flag-KMT1A overexpressing C2-KMT1A-F cells generated via lentiviral delivery and the same cells after MKK6EE expression by same delivery system grown in GM or DM with or without SB. Probed with antibodies for indicated proteins where β-actin served as loading control. b Same as a except for western blot analysis, cells were fixed and evaluated for morphology by phase contrast microscopy and immunostained with anti-MyHC antibody (MF20)

    Journal: Skeletal Muscle

    Article Title: p38α MAPK disables KMT1A-mediated repression of myogenic differentiation program

    doi: 10.1186/s13395-016-0100-z

    Figure Lengend Snippet: MKK6EE-p38α activation can rescue KMT1A suppressed muscle differentiation. a Western blot analysis of cell extracts from vector control C2-Em and Flag-KMT1A overexpressing C2-KMT1A-F cells generated via lentiviral delivery and the same cells after MKK6EE expression by same delivery system grown in GM or DM with or without SB. Probed with antibodies for indicated proteins where β-actin served as loading control. b Same as a except for western blot analysis, cells were fixed and evaluated for morphology by phase contrast microscopy and immunostained with anti-MyHC antibody (MF20)

    Article Snippet: Briefly, cells were transfected with lentiviral vector along with packaging vectors using Pure-Fection transfection reagent (System Biosciences).

    Techniques: Activation Assay, Western Blot, Plasmid Preparation, Generated, Expressing, Microscopy

    WNT10B is a direct target of miR-148a in endometrial fibroblasts, ( a ) Schematic representation of WNT10B 3′UTR with putative miR-148a-binding site. The seed region is boxed and mutated reporter construct has seed region deleted, ( b ) Luciferase activity of HeLa cells co-transfected with reporter vector containing either wild-type or mutant WNT10B 3′-UTR and miR-148a or non-targeting control. Results are mean ± s.d. of triplicate measurements. ( c ) miR-148a suppresses SuperTopFlash reporter activity. CAFs stably expressing empty vector (EV) or lentiviral miR-148a construct were electroporated with the SuperTOPFIash and Renilla-TK. Luciferase activity was measured after 24 h. Results are mean ± s.d. of triplicate measurements, ( d ) Western blot analysis of WNT10B in CAF cell lysates after stable transfection with miR-148a construct or empty vector. Transfection and immunoblotting were performed with CAFs from two patients (CAF2 and CAF4). β-actin blot served as loading control, ( e ) Western blot analysis of WNT10B in NF cell lysates after stable transfection with anti-miR-148a construct or empty vector.

    Journal: Oncogene

    Article Title: Silencing of miR-148a in cancer-associated fibroblasts results in WNT10B-mediated stimulation of tumor cell motility

    doi: 10.1038/onc.2012.351

    Figure Lengend Snippet: WNT10B is a direct target of miR-148a in endometrial fibroblasts, ( a ) Schematic representation of WNT10B 3′UTR with putative miR-148a-binding site. The seed region is boxed and mutated reporter construct has seed region deleted, ( b ) Luciferase activity of HeLa cells co-transfected with reporter vector containing either wild-type or mutant WNT10B 3′-UTR and miR-148a or non-targeting control. Results are mean ± s.d. of triplicate measurements. ( c ) miR-148a suppresses SuperTopFlash reporter activity. CAFs stably expressing empty vector (EV) or lentiviral miR-148a construct were electroporated with the SuperTOPFIash and Renilla-TK. Luciferase activity was measured after 24 h. Results are mean ± s.d. of triplicate measurements, ( d ) Western blot analysis of WNT10B in CAF cell lysates after stable transfection with miR-148a construct or empty vector. Transfection and immunoblotting were performed with CAFs from two patients (CAF2 and CAF4). β-actin blot served as loading control, ( e ) Western blot analysis of WNT10B in NF cell lysates after stable transfection with anti-miR-148a construct or empty vector.

    Article Snippet: The lentiviral expression vector for miR-148a (pMIF-cGFP-Zeo-miR148a) and the control vector (pMIF-cGFP-Zeo), as well as the anti-miR-148a construct and its control (pGreenPuro Scramble Hairpin Control) were purchased from System Biosciences (SBI, Mountain View, CA, USA).

    Techniques: Binding Assay, Construct, Luciferase, Activity Assay, Transfection, Plasmid Preparation, Mutagenesis, Stable Transfection, Expressing, Western Blot

    Effect of miR-148a overexpression in fibroblasts on endometrial tumor cell motility and growth, ( a ) Transwell migration of five endometrial cancer cell lines towards CAFs expressing empty lentiviral vector (circles) or miR-148a (squares). Results are the means with 95% confidence interval of migrated cells/field. P -value was calculated using unpaired two-tailed t -test. All experiments were performed in triplicate, with three fields analyzed/replicate, and repeated at least two times, ( b ) Transwell migration of endometrial cancer cell lines towards NFs expressing empty lentiviral vector (circles) or anti-miR-148a (squares). The data are analyzed as in ( a ), ( c ) CAFs expressing empty lentiviral vector or miR-148a were co-cultured with luciferase-expressing endometrial cancer cell lines during 5-day time course. The luciferase activity was measured every day in three replicate experiments. White circles: CAF-EV; black circles: CAF-miR-148a. Results are means ± s.e.m.

    Journal: Oncogene

    Article Title: Silencing of miR-148a in cancer-associated fibroblasts results in WNT10B-mediated stimulation of tumor cell motility

    doi: 10.1038/onc.2012.351

    Figure Lengend Snippet: Effect of miR-148a overexpression in fibroblasts on endometrial tumor cell motility and growth, ( a ) Transwell migration of five endometrial cancer cell lines towards CAFs expressing empty lentiviral vector (circles) or miR-148a (squares). Results are the means with 95% confidence interval of migrated cells/field. P -value was calculated using unpaired two-tailed t -test. All experiments were performed in triplicate, with three fields analyzed/replicate, and repeated at least two times, ( b ) Transwell migration of endometrial cancer cell lines towards NFs expressing empty lentiviral vector (circles) or anti-miR-148a (squares). The data are analyzed as in ( a ), ( c ) CAFs expressing empty lentiviral vector or miR-148a were co-cultured with luciferase-expressing endometrial cancer cell lines during 5-day time course. The luciferase activity was measured every day in three replicate experiments. White circles: CAF-EV; black circles: CAF-miR-148a. Results are means ± s.e.m.

    Article Snippet: The lentiviral expression vector for miR-148a (pMIF-cGFP-Zeo-miR148a) and the control vector (pMIF-cGFP-Zeo), as well as the anti-miR-148a construct and its control (pGreenPuro Scramble Hairpin Control) were purchased from System Biosciences (SBI, Mountain View, CA, USA).

    Techniques: Over Expression, Migration, Expressing, Plasmid Preparation, Two Tailed Test, Cell Culture, Luciferase, Activity Assay

    MAPK signaling participated in regulating the MCM7–cyclin D1 signaling in HCC cells. ( a ) Correlation of MCM7 with CCND1 gene expression in three HCC cell lines. ( b ) Correlation of MCM7 with 12 MAPK pathway member gene expression. ( c ) Heat map of changes in the expression of 12 MAPK pathway member genes after lentiviral vector transduction. Western blot analysis ( d ) and corresponding bar graphs ( e ) validated the alteration in the activity of three major MAPK members (ERK, JNK and p38) in HCC cells. ( f ) Correlation of CCND1 with 12 MAPK pathway member gene expression. ( g ) Heat map of changes in the expression of CCND1 after pretreatment with SB203580 (p38 inhibitor) or U0126 (ERK inhibitor) at different time points (3, 6, 12 and 24 h).; ( h ) Western blot analysis for cyclin D1 expression level in HCC cells pretreated with SB203580 (for 6 h) or U0126 (for 24 h). Data are represented as mean±S.E.M. from three independent experiments. * P

    Journal: Cell Death & Disease

    Article Title: MCM7 promotes cancer progression through cyclin D1-dependent signaling and serves as a prognostic marker for patients with hepatocellular carcinoma

    doi: 10.1038/cddis.2016.352

    Figure Lengend Snippet: MAPK signaling participated in regulating the MCM7–cyclin D1 signaling in HCC cells. ( a ) Correlation of MCM7 with CCND1 gene expression in three HCC cell lines. ( b ) Correlation of MCM7 with 12 MAPK pathway member gene expression. ( c ) Heat map of changes in the expression of 12 MAPK pathway member genes after lentiviral vector transduction. Western blot analysis ( d ) and corresponding bar graphs ( e ) validated the alteration in the activity of three major MAPK members (ERK, JNK and p38) in HCC cells. ( f ) Correlation of CCND1 with 12 MAPK pathway member gene expression. ( g ) Heat map of changes in the expression of CCND1 after pretreatment with SB203580 (p38 inhibitor) or U0126 (ERK inhibitor) at different time points (3, 6, 12 and 24 h).; ( h ) Western blot analysis for cyclin D1 expression level in HCC cells pretreated with SB203580 (for 6 h) or U0126 (for 24 h). Data are represented as mean±S.E.M. from three independent experiments. * P

    Article Snippet: Transduction of lentiviral vectors Two HCC cell lines (HepG2 and SMMC-7721) were transfected using lentiviral vectors (Lv-shRNA-MCM7 and Lv-shRNA-Control) according to the manufacture's instruction (GenePharma Co., Shanghai, China).

    Techniques: Expressing, Plasmid Preparation, Transduction, Western Blot, Activity Assay

    Downregulation of MCM7 restrains cell cycle progression by suppressing cyclin D1 expression. ( a and b ) Cell cycle analysis of HCC cells transfected by Lv-shRNA-MCM7 or Lv-shRNA-Control. ( c ) A total of 16 cell cycle-related genes were screened after lentiviral vector transduction. ( d ) Western blot analysis of cyclin D1, CDK4, p27, p21, total RB and p-RB in HCC cells after lentiviral vector transduction. Data are represented as mean±S.E.M. from three independent experiments. * P

    Journal: Cell Death & Disease

    Article Title: MCM7 promotes cancer progression through cyclin D1-dependent signaling and serves as a prognostic marker for patients with hepatocellular carcinoma

    doi: 10.1038/cddis.2016.352

    Figure Lengend Snippet: Downregulation of MCM7 restrains cell cycle progression by suppressing cyclin D1 expression. ( a and b ) Cell cycle analysis of HCC cells transfected by Lv-shRNA-MCM7 or Lv-shRNA-Control. ( c ) A total of 16 cell cycle-related genes were screened after lentiviral vector transduction. ( d ) Western blot analysis of cyclin D1, CDK4, p27, p21, total RB and p-RB in HCC cells after lentiviral vector transduction. Data are represented as mean±S.E.M. from three independent experiments. * P

    Article Snippet: Transduction of lentiviral vectors Two HCC cell lines (HepG2 and SMMC-7721) were transfected using lentiviral vectors (Lv-shRNA-MCM7 and Lv-shRNA-Control) according to the manufacture's instruction (GenePharma Co., Shanghai, China).

    Techniques: Expressing, Cell Cycle Assay, Transfection, shRNA, Plasmid Preparation, Transduction, Western Blot

    Knockdown cpg15 expression in primary cultured astrocytes via lentivirus-delivered shRNA depresses the neurite outgrowth recovery and neuronal network reestablishment of OGD-injured primary cultured neurons. A , Phase-contrast and fluorescent microscopy images of the primary cultured hippocampal astrocytes infected with cpg15 shRNA-delivering lentivirus (LV-CMV-cpg15-shRNA), showing the infection efficiency. Cells with GFP expression under fluorescent microscope were those infected by lentivirus. The phase-contrast microscope image of the same field shows the total cells. Scale bars, 100 μm. B , Representative Western blot image showing significantly inhibited expression of cpg15 protein by LV-CMV-cpg15-shRNA (abbreviated to LV-cpg15-sh) lentivirus infection in astrocytes at reoxygenation 12 h after 4 h OGD treatment. Scramble shRNA-delivering lentivirus (LV-CMV-Control-shRNA, abbreviated to LV-Ctrl-sh) was used as the negative control. C , Relative amount of cpg15 calculated from B . β-Actin as the loading control. n = 6 for each group. *** p

    Journal: The Journal of Neuroscience

    Article Title: Soluble cpg15 from Astrocytes Ameliorates Neurite Outgrowth Recovery of Hippocampal Neurons after Mouse Cerebral Ischemia

    doi: 10.1523/JNEUROSCI.1611-16.2016

    Figure Lengend Snippet: Knockdown cpg15 expression in primary cultured astrocytes via lentivirus-delivered shRNA depresses the neurite outgrowth recovery and neuronal network reestablishment of OGD-injured primary cultured neurons. A , Phase-contrast and fluorescent microscopy images of the primary cultured hippocampal astrocytes infected with cpg15 shRNA-delivering lentivirus (LV-CMV-cpg15-shRNA), showing the infection efficiency. Cells with GFP expression under fluorescent microscope were those infected by lentivirus. The phase-contrast microscope image of the same field shows the total cells. Scale bars, 100 μm. B , Representative Western blot image showing significantly inhibited expression of cpg15 protein by LV-CMV-cpg15-shRNA (abbreviated to LV-cpg15-sh) lentivirus infection in astrocytes at reoxygenation 12 h after 4 h OGD treatment. Scramble shRNA-delivering lentivirus (LV-CMV-Control-shRNA, abbreviated to LV-Ctrl-sh) was used as the negative control. C , Relative amount of cpg15 calculated from B . β-Actin as the loading control. n = 6 for each group. *** p

    Article Snippet: Lentivirus vector containing the shRNA targeting cpg15 downstream of the CMV promoter was constructed by GeneChem using miR30-based shRNA system.

    Techniques: Expressing, Cell Culture, shRNA, Microscopy, Infection, Western Blot, Negative Control

    Astrocyte-specific knockdown of cpg15 expression in cultured cells and in mouse hippocampus by LV-GFAP-cpg15-shRNA lentivirus. A , Representative fluorescent images showing the cpg15 knockdown by LV-GFAP-cpg15-shRNA lentivirus (cpg15-sh) in cultured astrocytic cells 12 h after 4 h OGD treatment. Astrocytes infected with LV-GFAP-Control-shRNA lentivirus (Control-sh) as the control. Scale bar, 75 μm. B , Representative fluorescent images of lentivirus-expressed GFP (green) in the mouse hippocampal CA1 and DG regions at reperfusion 14 d after TGI, indicating that the LV-GFAP-cpg15-sh lentivirus (and its control, LV-GFAP-Control-sh lentivirus)-delivered GFP were expressed specifically in the astrocytes. Astrocytes were labeled by GFAP immunofluorescent staining (red). Scale bars, 25 μm. C , Lentivirus-mediated astrocyte-specific cpg15 knockdown in mouse hippocampal CA1 regions at reperfusion 14 d after TGI. Immunofluorescent staining of cpg15 (red) and the fluorescence of lentivirus-expressed G FP (green) were analyzed. The cpg15 expression was significantly reduced in the GFP-positive cells in the LV-GFAP-cpg15-sh lentivirus-injected hippocampus (cpg15-sh), but not in the LV-GFAP-control-sh lentivirus-injected hippocampus (Control-sh), as indicated by the arrows. Scale bars, 75 μm. D , Western blot analysis of cpg15 expression in the hippocampus of LV-GFAP-cpg15-sh lentivirus-injected mouse showing the efficiency of cpg15 knockdown. LV-GFAP-Control-sh lentivirus-injected hippocampus as the control. * p

    Journal: The Journal of Neuroscience

    Article Title: Soluble cpg15 from Astrocytes Ameliorates Neurite Outgrowth Recovery of Hippocampal Neurons after Mouse Cerebral Ischemia

    doi: 10.1523/JNEUROSCI.1611-16.2016

    Figure Lengend Snippet: Astrocyte-specific knockdown of cpg15 expression in cultured cells and in mouse hippocampus by LV-GFAP-cpg15-shRNA lentivirus. A , Representative fluorescent images showing the cpg15 knockdown by LV-GFAP-cpg15-shRNA lentivirus (cpg15-sh) in cultured astrocytic cells 12 h after 4 h OGD treatment. Astrocytes infected with LV-GFAP-Control-shRNA lentivirus (Control-sh) as the control. Scale bar, 75 μm. B , Representative fluorescent images of lentivirus-expressed GFP (green) in the mouse hippocampal CA1 and DG regions at reperfusion 14 d after TGI, indicating that the LV-GFAP-cpg15-sh lentivirus (and its control, LV-GFAP-Control-sh lentivirus)-delivered GFP were expressed specifically in the astrocytes. Astrocytes were labeled by GFAP immunofluorescent staining (red). Scale bars, 25 μm. C , Lentivirus-mediated astrocyte-specific cpg15 knockdown in mouse hippocampal CA1 regions at reperfusion 14 d after TGI. Immunofluorescent staining of cpg15 (red) and the fluorescence of lentivirus-expressed G FP (green) were analyzed. The cpg15 expression was significantly reduced in the GFP-positive cells in the LV-GFAP-cpg15-sh lentivirus-injected hippocampus (cpg15-sh), but not in the LV-GFAP-control-sh lentivirus-injected hippocampus (Control-sh), as indicated by the arrows. Scale bars, 75 μm. D , Western blot analysis of cpg15 expression in the hippocampus of LV-GFAP-cpg15-sh lentivirus-injected mouse showing the efficiency of cpg15 knockdown. LV-GFAP-Control-sh lentivirus-injected hippocampus as the control. * p

    Article Snippet: Lentivirus vector containing the shRNA targeting cpg15 downstream of the CMV promoter was constructed by GeneChem using miR30-based shRNA system.

    Techniques: Expressing, Cell Culture, shRNA, Infection, Labeling, Staining, Fluorescence, Injection, Western Blot

    Lentivirus-delivered astrocyte-specific knockdown of cpg15 expression in mouse hippocampus decreases the dendritic branches and exacerbates injury of neurons in hippocampal CA1 region at reperfusion 14 d after TGI. A , B , Immunofluorescent staining of dentritic marker MAP2 (red), the fluorescence of lentivirus-expressed GFP (green) in mouse hippocampus at reperfusion 14 d after TGI. DAPI (blue) is used for nucleic staining. The results show that the neuronal neurites of CA1 region are significantly decreased by injection of LV-GFAP-cpg15-sh lentivirus (cpg15-sh). Scale bars: A , 100 μm; B , 25 μm. C , D , Lentivirus-mediated astrocyte-specific cpg15 knockdown (LV-GFAP-cpg15-sh, cpg15-sh) causes more severe damage in mouse hippocampus at reperfusion 14 d after TGI, as indicated by CV staining of mouse hippocampus ( C ) and the statistical hippocampal damage severity ( D ). LV-GFAP-Control-sh lentivirus-injected hippocampus (Control-sh) as the control. Scale bar, 100 μm. n = 10 per group. ** p

    Journal: The Journal of Neuroscience

    Article Title: Soluble cpg15 from Astrocytes Ameliorates Neurite Outgrowth Recovery of Hippocampal Neurons after Mouse Cerebral Ischemia

    doi: 10.1523/JNEUROSCI.1611-16.2016

    Figure Lengend Snippet: Lentivirus-delivered astrocyte-specific knockdown of cpg15 expression in mouse hippocampus decreases the dendritic branches and exacerbates injury of neurons in hippocampal CA1 region at reperfusion 14 d after TGI. A , B , Immunofluorescent staining of dentritic marker MAP2 (red), the fluorescence of lentivirus-expressed GFP (green) in mouse hippocampus at reperfusion 14 d after TGI. DAPI (blue) is used for nucleic staining. The results show that the neuronal neurites of CA1 region are significantly decreased by injection of LV-GFAP-cpg15-sh lentivirus (cpg15-sh). Scale bars: A , 100 μm; B , 25 μm. C , D , Lentivirus-mediated astrocyte-specific cpg15 knockdown (LV-GFAP-cpg15-sh, cpg15-sh) causes more severe damage in mouse hippocampus at reperfusion 14 d after TGI, as indicated by CV staining of mouse hippocampus ( C ) and the statistical hippocampal damage severity ( D ). LV-GFAP-Control-sh lentivirus-injected hippocampus (Control-sh) as the control. Scale bar, 100 μm. n = 10 per group. ** p

    Article Snippet: Lentivirus vector containing the shRNA targeting cpg15 downstream of the CMV promoter was constructed by GeneChem using miR30-based shRNA system.

    Techniques: Expressing, Staining, Marker, Fluorescence, Injection

    LV-CMV-cpg15 shRNA lentivirus-delivered knockdown of cpg15 expression in mouse hippocampal decreases the dendritic branches and exacerbates injury of neurons in hippocampal CA1 and DG regions at reperfusion 21 d after TGI. A , Representative fluorescent image of lentivirus-expressed GFP protein showing the injection trace (indicated by the white arrows) of lentivirus in the mouse hippocampal CA1 region. CTX, Cerebral cortex; CA1, cornus ammonis sector 1; DG, dentate gyrus. Scale bars, 50 μm. B , Lentivirus-mediated expression of GFP protein (green), indicating the distribution of injected lentivirus. GFAP (red) immunofluorescent staining was used for labeling astrocytes. C , Immunofluorescent staining of cpg15 (red) and the fluorescence of lentivirus-expressed GFP (green). D , Western blot analysis of cpg15 expression in the hippocampus of cpg15-shRNA-delivering lentivirus (LV-CMV-cpg15 shRNA, abbreviated to cpg15-sh)-injected mouse showing the efficiency of cpg15 silencing. Lentivirus mediating the scrambled shRNA (LV-CMV-Control shRNA, abbreviated to Control-sh) as the control. E , Immunofluorescent double staining of neuronal marker NeuN (blue) and dentritic marker MAP2 (red), and the fluorescence of lentivirus-expressed GFP (green) in mouse hippocampus at reperfusion 21 d after TGI. White boxes represent that the neuronal neurites in the hippocampus are significantly decreased by infection of cpg15 shRNA-delivering lentivirus. Scale bar, 50 μm. F , Immunofluorescent double staining of MAP2 (red) and NeuN (blue), and the fluorescence of lentivirus-expressed GFP (green) in sham and ischemic mouse hippocampal DG regions injected with cpg15 shRNA-delivering lentivirus. Scale bar, 25 μm. G , H , Lentivirus-mediated cpg15 knockdown (cpg15-sh) causes more severe damage in mouse hippocampus at reperfusion 21 d after TGI, as indicated by CV staining of mouse hippocampus ( G ) and the statistical hippocampal damage severity ( H ). Lentivirus delivering the scrambled shRNA as the control (Control-sh). Scale bar, 50 μm. n = 12 per group. ** p

    Journal: The Journal of Neuroscience

    Article Title: Soluble cpg15 from Astrocytes Ameliorates Neurite Outgrowth Recovery of Hippocampal Neurons after Mouse Cerebral Ischemia

    doi: 10.1523/JNEUROSCI.1611-16.2016

    Figure Lengend Snippet: LV-CMV-cpg15 shRNA lentivirus-delivered knockdown of cpg15 expression in mouse hippocampal decreases the dendritic branches and exacerbates injury of neurons in hippocampal CA1 and DG regions at reperfusion 21 d after TGI. A , Representative fluorescent image of lentivirus-expressed GFP protein showing the injection trace (indicated by the white arrows) of lentivirus in the mouse hippocampal CA1 region. CTX, Cerebral cortex; CA1, cornus ammonis sector 1; DG, dentate gyrus. Scale bars, 50 μm. B , Lentivirus-mediated expression of GFP protein (green), indicating the distribution of injected lentivirus. GFAP (red) immunofluorescent staining was used for labeling astrocytes. C , Immunofluorescent staining of cpg15 (red) and the fluorescence of lentivirus-expressed GFP (green). D , Western blot analysis of cpg15 expression in the hippocampus of cpg15-shRNA-delivering lentivirus (LV-CMV-cpg15 shRNA, abbreviated to cpg15-sh)-injected mouse showing the efficiency of cpg15 silencing. Lentivirus mediating the scrambled shRNA (LV-CMV-Control shRNA, abbreviated to Control-sh) as the control. E , Immunofluorescent double staining of neuronal marker NeuN (blue) and dentritic marker MAP2 (red), and the fluorescence of lentivirus-expressed GFP (green) in mouse hippocampus at reperfusion 21 d after TGI. White boxes represent that the neuronal neurites in the hippocampus are significantly decreased by infection of cpg15 shRNA-delivering lentivirus. Scale bar, 50 μm. F , Immunofluorescent double staining of MAP2 (red) and NeuN (blue), and the fluorescence of lentivirus-expressed GFP (green) in sham and ischemic mouse hippocampal DG regions injected with cpg15 shRNA-delivering lentivirus. Scale bar, 25 μm. G , H , Lentivirus-mediated cpg15 knockdown (cpg15-sh) causes more severe damage in mouse hippocampus at reperfusion 21 d after TGI, as indicated by CV staining of mouse hippocampus ( G ) and the statistical hippocampal damage severity ( H ). Lentivirus delivering the scrambled shRNA as the control (Control-sh). Scale bar, 50 μm. n = 12 per group. ** p

    Article Snippet: Lentivirus vector containing the shRNA targeting cpg15 downstream of the CMV promoter was constructed by GeneChem using miR30-based shRNA system.

    Techniques: shRNA, Expressing, Injection, Staining, Labeling, Fluorescence, Western Blot, Double Staining, Marker, Infection

    Ectopic expression of the miRNAs specifically suppresses expression of the reporter vector containing miRNA targets in 293T cells. (A) Map of transcriptional units of the reporter vector used in this study. CMVmini: CMV minimal promoter. UbiC: ubiquitin C promoter. CCR5 target: siRNA against CCR5 target sequence ( 5′-GAGCAAGCTCAGTTTACACC-3′ ) [59] . (B) 293T cells were infected with lentiviral vectors encoding various reporters shown in (A). Expression levels of EGFP and mCherry were analyzed by flow cytometry 2 days post-infection. 293T cells infected with a lentiviral vector encoding EGFP miR-T/mCherry miR-T were super-infected by a lentiviral vector encoding either miR-302a , miR-302b , miR-302c , and miR-302d (miR-302 a-d) or miR-155 2 days post-infection. Cells were then further cultured for 4 days and analyzed for EGFP and mCherry expression by flow cytometry. The number (%) in each quadrant is listed on each plot.

    Journal: PLoS ONE

    Article Title: Live Cell Monitoring of hiPSC Generation and Differentiation Using Differential Expression of Endogenous microRNAs

    doi: 10.1371/journal.pone.0011834

    Figure Lengend Snippet: Ectopic expression of the miRNAs specifically suppresses expression of the reporter vector containing miRNA targets in 293T cells. (A) Map of transcriptional units of the reporter vector used in this study. CMVmini: CMV minimal promoter. UbiC: ubiquitin C promoter. CCR5 target: siRNA against CCR5 target sequence ( 5′-GAGCAAGCTCAGTTTACACC-3′ ) [59] . (B) 293T cells were infected with lentiviral vectors encoding various reporters shown in (A). Expression levels of EGFP and mCherry were analyzed by flow cytometry 2 days post-infection. 293T cells infected with a lentiviral vector encoding EGFP miR-T/mCherry miR-T were super-infected by a lentiviral vector encoding either miR-302a , miR-302b , miR-302c , and miR-302d (miR-302 a-d) or miR-155 2 days post-infection. Cells were then further cultured for 4 days and analyzed for EGFP and mCherry expression by flow cytometry. The number (%) in each quadrant is listed on each plot.

    Article Snippet: For ectopic expression of miRNAs, we purchased miRNA expressing lentiviral vectors for miR-302a, miR-302b, miR-302c, and miR302-d (PMIRH302abcdPA-2) and miR-155 (PMIRH155PA-1) from System biosciences (Mountain View, CA).

    Techniques: Expressing, Plasmid Preparation, Sequencing, Infection, Flow Cytometry, Cytometry, Cell Culture

    The reporter vectors containing miRNA targets show the lineage-specific expression. (A) U937 cells were infected with lentiviral vectors encoding various reporters showed in Fig. 1 A. Expression levels of EGFP and mCherry were analyzed by flow cytometry 2 days post-infection. (B and C) CEM and Ramos cells (B) and CD34+ HPSCs derived from 3 independent donors (C) were infected with a lentiviral vector encoding EGFP miR-T/mCherry miR-T. Expression levels of EGFP and mCherry were analyzed by flow cytometry 2 days post-infection. (D) hESCs (H1) were infected with a lentiviral vector encoding EGFP miR-T/mCherry miR-T. Single cell clone was isolated by culturing transduced cells in the presence of 10 µM Y27632 for 14 days. Expression levels of EGFP and mCherry were analyzed by fluorescence microscopy and by flow cytometry. The number (%) in each quadrant is listed on each plot.

    Journal: PLoS ONE

    Article Title: Live Cell Monitoring of hiPSC Generation and Differentiation Using Differential Expression of Endogenous microRNAs

    doi: 10.1371/journal.pone.0011834

    Figure Lengend Snippet: The reporter vectors containing miRNA targets show the lineage-specific expression. (A) U937 cells were infected with lentiviral vectors encoding various reporters showed in Fig. 1 A. Expression levels of EGFP and mCherry were analyzed by flow cytometry 2 days post-infection. (B and C) CEM and Ramos cells (B) and CD34+ HPSCs derived from 3 independent donors (C) were infected with a lentiviral vector encoding EGFP miR-T/mCherry miR-T. Expression levels of EGFP and mCherry were analyzed by flow cytometry 2 days post-infection. (D) hESCs (H1) were infected with a lentiviral vector encoding EGFP miR-T/mCherry miR-T. Single cell clone was isolated by culturing transduced cells in the presence of 10 µM Y27632 for 14 days. Expression levels of EGFP and mCherry were analyzed by fluorescence microscopy and by flow cytometry. The number (%) in each quadrant is listed on each plot.

    Article Snippet: For ectopic expression of miRNAs, we purchased miRNA expressing lentiviral vectors for miR-302a, miR-302b, miR-302c, and miR302-d (PMIRH302abcdPA-2) and miR-155 (PMIRH155PA-1) from System biosciences (Mountain View, CA).

    Techniques: Expressing, Infection, Flow Cytometry, Cytometry, Derivative Assay, Plasmid Preparation, Isolation, Fluorescence, Microscopy

    Transduction of the reporter vector containing miRNA targets does not grossly affect expression of hESC-specific markers. (A and B) Single-cell suspensions of hESC (H1), hiPSCs transduced with a lentiviral vector encoding EGFP miR-T/mCherry miR-T (E/m#1, E/m#5, and E/m#101) or untransduced (hiPSC#19) were analyzed for the expression of EGFP and mCherry (A) and that of hESC-specific markers (SSEA1, SSEA3, TRA1-60, and TRA-1-81) (B) by flow cytometry. The number (%) in each quadrant is listed on each plot. (C) hESCs (H1), hiPSCs transduced with a lentiviral vector encoding EGFP miR-T/mCherry miR-T (E/m#1, E/m#5, and E/m#101) or untransduced (hiPSC#19) were plated on poly-L-lysine and Matrigel coated glass coverslips and expanded for a week. Cells were then fixed with 1% formaldehyde, permeabilized with 0.2% Triton X-100 for 5 min on ice, and stained with anti-Nanog antibody and DyLight488 conjugated anti-rabbit IgGs. 7-amino-actinomycin D (7-AAD) was used for nuclear staining.

    Journal: PLoS ONE

    Article Title: Live Cell Monitoring of hiPSC Generation and Differentiation Using Differential Expression of Endogenous microRNAs

    doi: 10.1371/journal.pone.0011834

    Figure Lengend Snippet: Transduction of the reporter vector containing miRNA targets does not grossly affect expression of hESC-specific markers. (A and B) Single-cell suspensions of hESC (H1), hiPSCs transduced with a lentiviral vector encoding EGFP miR-T/mCherry miR-T (E/m#1, E/m#5, and E/m#101) or untransduced (hiPSC#19) were analyzed for the expression of EGFP and mCherry (A) and that of hESC-specific markers (SSEA1, SSEA3, TRA1-60, and TRA-1-81) (B) by flow cytometry. The number (%) in each quadrant is listed on each plot. (C) hESCs (H1), hiPSCs transduced with a lentiviral vector encoding EGFP miR-T/mCherry miR-T (E/m#1, E/m#5, and E/m#101) or untransduced (hiPSC#19) were plated on poly-L-lysine and Matrigel coated glass coverslips and expanded for a week. Cells were then fixed with 1% formaldehyde, permeabilized with 0.2% Triton X-100 for 5 min on ice, and stained with anti-Nanog antibody and DyLight488 conjugated anti-rabbit IgGs. 7-amino-actinomycin D (7-AAD) was used for nuclear staining.

    Article Snippet: For ectopic expression of miRNAs, we purchased miRNA expressing lentiviral vectors for miR-302a, miR-302b, miR-302c, and miR302-d (PMIRH302abcdPA-2) and miR-155 (PMIRH155PA-1) from System biosciences (Mountain View, CA).

    Techniques: Transduction, Plasmid Preparation, Expressing, Flow Cytometry, Cytometry, Staining

    Reprogramming state specific expression of the reporter vector containing miRNA targets during hiPSC formation from human fetal fibroblasts (HFFs). (A) HFFs were infected with lentiviral vectors encoding various reporters shown in Fig. 1A . Expression levels of EGFP and mCherry were analyzed by flow cytometry 2 days post-infection. (B and C) HFFs were infected with lentiviral vectors encoding 4 different hiPSC factors ( OCT4, SOX2, KLF4, and cMYC ) and with or without a lentiviral vector encoding EGFP miR-T/mCherry miR-T. Cells were then cultured for 3 days and replated on irradiated mouse embryonic fibroblast (iMEF) feeder cells at 5×10 4 cells/60 mm plate. Expression levels of EGFP and mCherry were analyzed by flow cytometry on days 0, 7, 14, 21, and 28 (B), and by fluorescence microscopy on days 0, 7, 14, and 21 (C). iMEF feeder cells were labeled with PE-Cy7 conjugated mouse CD29 antibody and excluded from the flow cytometry analysis in (B). (D) hiPSC colonies expressing mCherry were picked on Matrigel coated plate on days 21–25 and propagated in mTeSR medium. Expression levels of EGFP and mCherry were analyzed by fluorescence microscopy and by flow cytometry. The number (%) in each quadrant is listed on each plot. hiPSC #1: hiPSC clone without transduction of EGFP miR-T/mCherry miR-T reporter vector. E/m#8: hiPSC clone with transduction of EGFP miR-T/mCherry miR-T reporter vector.

    Journal: PLoS ONE

    Article Title: Live Cell Monitoring of hiPSC Generation and Differentiation Using Differential Expression of Endogenous microRNAs

    doi: 10.1371/journal.pone.0011834

    Figure Lengend Snippet: Reprogramming state specific expression of the reporter vector containing miRNA targets during hiPSC formation from human fetal fibroblasts (HFFs). (A) HFFs were infected with lentiviral vectors encoding various reporters shown in Fig. 1A . Expression levels of EGFP and mCherry were analyzed by flow cytometry 2 days post-infection. (B and C) HFFs were infected with lentiviral vectors encoding 4 different hiPSC factors ( OCT4, SOX2, KLF4, and cMYC ) and with or without a lentiviral vector encoding EGFP miR-T/mCherry miR-T. Cells were then cultured for 3 days and replated on irradiated mouse embryonic fibroblast (iMEF) feeder cells at 5×10 4 cells/60 mm plate. Expression levels of EGFP and mCherry were analyzed by flow cytometry on days 0, 7, 14, 21, and 28 (B), and by fluorescence microscopy on days 0, 7, 14, and 21 (C). iMEF feeder cells were labeled with PE-Cy7 conjugated mouse CD29 antibody and excluded from the flow cytometry analysis in (B). (D) hiPSC colonies expressing mCherry were picked on Matrigel coated plate on days 21–25 and propagated in mTeSR medium. Expression levels of EGFP and mCherry were analyzed by fluorescence microscopy and by flow cytometry. The number (%) in each quadrant is listed on each plot. hiPSC #1: hiPSC clone without transduction of EGFP miR-T/mCherry miR-T reporter vector. E/m#8: hiPSC clone with transduction of EGFP miR-T/mCherry miR-T reporter vector.

    Article Snippet: For ectopic expression of miRNAs, we purchased miRNA expressing lentiviral vectors for miR-302a, miR-302b, miR-302c, and miR302-d (PMIRH302abcdPA-2) and miR-155 (PMIRH155PA-1) from System biosciences (Mountain View, CA).

    Techniques: Expressing, Plasmid Preparation, Infection, Flow Cytometry, Cytometry, Cell Culture, Irradiation, Fluorescence, Microscopy, Labeling, Transduction

    Insulin overexpression in the PVN of adult mice prevents acute RS–induced reduction in pituitary GH gene expression and secretion. ( A ) Time course study of Gh mRNA levels in the pituitary of adult mice after acute RS. ( B – L ) Lentiviral vector expressing GFP (empty control vector, mock) or GFP and Ins2 (LV-insulin) was injected into the PVN of adult mice. Two weeks after the injection, mice were exposed to acute RS for 8 hours (RS 8 h). qRT-PCR data showing the efficiency of PVN insulin overexpression ( B ). Relative hypothalamic Crh mRNA levels ( C ). Relative pituitary Gh mRNA levels ( D ). Serum GH concentrations ( E ). Immunoblot analysis of p-Akt (Ser473), Akt, and GAPDH levels ( F ). Quantification of p-Akt levels normalized to Akt ( G ). Relative pituitary Pit-1 mRNA levels ( H ). Relative hypothalamic Ghrh ( I ) and Sst ( J ) mRNA levels. Serum corticosterone ( K ) and insulin ( L ) concentrations. Changes in body weight ( M ) and food consumption ( N ) for 2 weeks after the injection. Data are shown as mean ± SEM, 2-way ANOVA with Bonferroni’s post hoc tests. *, # , and $ P

    Journal: JCI Insight

    Article Title: Insulin synthesized in the paraventricular nucleus of the hypothalamus regulates pituitary growth hormone production

    doi: 10.1172/jci.insight.135412

    Figure Lengend Snippet: Insulin overexpression in the PVN of adult mice prevents acute RS–induced reduction in pituitary GH gene expression and secretion. ( A ) Time course study of Gh mRNA levels in the pituitary of adult mice after acute RS. ( B – L ) Lentiviral vector expressing GFP (empty control vector, mock) or GFP and Ins2 (LV-insulin) was injected into the PVN of adult mice. Two weeks after the injection, mice were exposed to acute RS for 8 hours (RS 8 h). qRT-PCR data showing the efficiency of PVN insulin overexpression ( B ). Relative hypothalamic Crh mRNA levels ( C ). Relative pituitary Gh mRNA levels ( D ). Serum GH concentrations ( E ). Immunoblot analysis of p-Akt (Ser473), Akt, and GAPDH levels ( F ). Quantification of p-Akt levels normalized to Akt ( G ). Relative pituitary Pit-1 mRNA levels ( H ). Relative hypothalamic Ghrh ( I ) and Sst ( J ) mRNA levels. Serum corticosterone ( K ) and insulin ( L ) concentrations. Changes in body weight ( M ) and food consumption ( N ) for 2 weeks after the injection. Data are shown as mean ± SEM, 2-way ANOVA with Bonferroni’s post hoc tests. *, # , and $ P

    Article Snippet: Preparation of lentiviral shRNAs and Ins2 -overexpressing lentiviral vector GIPZ nonsilencing lentiviral shRNA control (Dharmacon, RHS4346), 4 different mouse Ins2 shRNAs (Dharmacon, V3LMM 471259, 471262, 471263, and 471364) that were cloned into the GIPZ lentiviral vector, and an Ins2 -overexpressing lentiviral vector (GeneCopoeia, EX-Mn03325-LV205) were used for gene delivery.

    Techniques: Over Expression, Mouse Assay, Expressing, Plasmid Preparation, Injection, Quantitative RT-PCR

    Insulin knockdown in the PVN of adult mice reduces pituitary GH gene expression and secretion. GFP lentiviral vector carrying nonsilencing shRNA control (shNon-silencing) or Ins2 shR NA (shRNA Ins2 ) was injected into the PVN of adult mice. ( A ) A confocal image showing colocalization of the GFP-infected cells with proinsulin in the PVN 2 weeks after the lentiviral injection. ( B ) qRT-PCR data showing the efficient knockdown of Ins2 , but not Crh , by Ins2 shRNA in the microdissected PVN. ( C and D ) Confocal images of C-peptide–immunoreactive nerve terminals in the ME ( C ) and quantification of the fluorescence intensity ( D ). ( E ) Relative levels of the mRNA for anterior pituitary hormones in the pituitary. ( F ) Serum GH concentrations in tail vein samples taken 4 times a day. ( G and H ) Immunoblot analysis of p-Akt (Ser473), Akt, and GAPDH levels in the pituitary ( G ). Quantification of p-Akt levels normalized to Akt ( H ). ( I ) Relative pituitary Pit-1 mRNA levels. ( J ) Relative hypothalamic GH–releasing hormone ( Ghrh ) or Sst mRNA levels. ( K and L ) Serum corticosterone ( K ) and insulin ( L ) concentrations. ( M and N ) Changes in body weight ( M ) and food consumption ( N ) for 2 weeks after the injection. Data are shown as mean ± SEM, 2-tailed unpaired Student’s t test. * P

    Journal: JCI Insight

    Article Title: Insulin synthesized in the paraventricular nucleus of the hypothalamus regulates pituitary growth hormone production

    doi: 10.1172/jci.insight.135412

    Figure Lengend Snippet: Insulin knockdown in the PVN of adult mice reduces pituitary GH gene expression and secretion. GFP lentiviral vector carrying nonsilencing shRNA control (shNon-silencing) or Ins2 shR NA (shRNA Ins2 ) was injected into the PVN of adult mice. ( A ) A confocal image showing colocalization of the GFP-infected cells with proinsulin in the PVN 2 weeks after the lentiviral injection. ( B ) qRT-PCR data showing the efficient knockdown of Ins2 , but not Crh , by Ins2 shRNA in the microdissected PVN. ( C and D ) Confocal images of C-peptide–immunoreactive nerve terminals in the ME ( C ) and quantification of the fluorescence intensity ( D ). ( E ) Relative levels of the mRNA for anterior pituitary hormones in the pituitary. ( F ) Serum GH concentrations in tail vein samples taken 4 times a day. ( G and H ) Immunoblot analysis of p-Akt (Ser473), Akt, and GAPDH levels in the pituitary ( G ). Quantification of p-Akt levels normalized to Akt ( H ). ( I ) Relative pituitary Pit-1 mRNA levels. ( J ) Relative hypothalamic GH–releasing hormone ( Ghrh ) or Sst mRNA levels. ( K and L ) Serum corticosterone ( K ) and insulin ( L ) concentrations. ( M and N ) Changes in body weight ( M ) and food consumption ( N ) for 2 weeks after the injection. Data are shown as mean ± SEM, 2-tailed unpaired Student’s t test. * P

    Article Snippet: Preparation of lentiviral shRNAs and Ins2 -overexpressing lentiviral vector GIPZ nonsilencing lentiviral shRNA control (Dharmacon, RHS4346), 4 different mouse Ins2 shRNAs (Dharmacon, V3LMM 471259, 471262, 471263, and 471364) that were cloned into the GIPZ lentiviral vector, and an Ins2 -overexpressing lentiviral vector (GeneCopoeia, EX-Mn03325-LV205) were used for gene delivery.

    Techniques: Mouse Assay, Expressing, Plasmid Preparation, shRNA, Injection, Infection, Quantitative RT-PCR, Fluorescence

    Insulin knockdown in the PVN of young mice causes growth retardation. Lentiviral vector carrying nonsilencing shRNA control (shNon-silencing) or Ins2 shRNA (shRNA Ins2 ) was injected into the PVN of young mice. ( A ) Relative hypothalamic Ins2 mRNA levels 6 weeks after the injection. ( B ) Body length from nose to rump immediately before the injection and 6 weeks after the injection. ( C and D ) Time course study of body weight ( C ) and accumulated food consumption ( D ). ( E ) Relative pituitary Gh mRNA levels. ( F ) Serum GH concentrations. ( G ) Relative pituitary Pit-1 mRNA levels. Data are shown as mean ± SEM, 2-tailed unpaired Student’s t test. ** P

    Journal: JCI Insight

    Article Title: Insulin synthesized in the paraventricular nucleus of the hypothalamus regulates pituitary growth hormone production

    doi: 10.1172/jci.insight.135412

    Figure Lengend Snippet: Insulin knockdown in the PVN of young mice causes growth retardation. Lentiviral vector carrying nonsilencing shRNA control (shNon-silencing) or Ins2 shRNA (shRNA Ins2 ) was injected into the PVN of young mice. ( A ) Relative hypothalamic Ins2 mRNA levels 6 weeks after the injection. ( B ) Body length from nose to rump immediately before the injection and 6 weeks after the injection. ( C and D ) Time course study of body weight ( C ) and accumulated food consumption ( D ). ( E ) Relative pituitary Gh mRNA levels. ( F ) Serum GH concentrations. ( G ) Relative pituitary Pit-1 mRNA levels. Data are shown as mean ± SEM, 2-tailed unpaired Student’s t test. ** P

    Article Snippet: Preparation of lentiviral shRNAs and Ins2 -overexpressing lentiviral vector GIPZ nonsilencing lentiviral shRNA control (Dharmacon, RHS4346), 4 different mouse Ins2 shRNAs (Dharmacon, V3LMM 471259, 471262, 471263, and 471364) that were cloned into the GIPZ lentiviral vector, and an Ins2 -overexpressing lentiviral vector (GeneCopoeia, EX-Mn03325-LV205) were used for gene delivery.

    Techniques: Mouse Assay, Plasmid Preparation, shRNA, Injection

    GHB decreases 5-hydroxymethylcytosine levels via inhibition of TET2 activity. a GHB does not reduce expression of TET isoforms. Q-PCR assay. Mean ± SD, n = 4 (TG1) and 3 (TP54) independent biological samples. b Doxycycline-dependent TET2 expression in the leukemic UT7 cell line. UT7 cells were treated for 12 h with doxycycline (Dox) at a final concentration of 1 µg/mL. TET2 mRNA levels were assayed using Q-PCR. Dox-treated versus -untreated UT7, mean ± SD, n = 3 independent biological samples. c GHB inhibits TET2 activity in the leukemic UT7 cell line expressing TET2 in a doxycycline-dependent manner. 12 h 10 mM GHB. 5-hmC levels determined by DNA dot immunoblotting. GHB-treated vs control UT7, mean ± SD, n = 3 independent biological samples. d Doxycycline-dependent TET2 expression in GBM stem-like cells (TG1) stably overexpressing TET2 in a doxycycline-dependent manner following lentiviral transduction. Q-PCR assays, mean ± SD, n = 5 biological samples. e Inhibitory GHB effects on TET2-mediated 5-hmC formation in GMB stem-like TG1 cells overexpressing TET2 in a doxycycline-dependent manner, mean ± SD, n = 4 biological samples. f – h In silico analysis of α-KG ( f ) and GHB ( g ) binding pockets within the TET2 protein. α-KG and GHB are colored in white and their oxygens in red . Ribbon representation of TET2 C-terminal domain. Progression from the N- to C- parts of the C-terminal domain are colored from blue to orange . h TET2 amino acid residues in contact with α-KG or GHB

    Journal: Acta Neuropathologica

    Article Title: A driver role for GABA metabolism in controlling stem and proliferative cell state through GHB production in glioma

    doi: 10.1007/s00401-016-1659-5

    Figure Lengend Snippet: GHB decreases 5-hydroxymethylcytosine levels via inhibition of TET2 activity. a GHB does not reduce expression of TET isoforms. Q-PCR assay. Mean ± SD, n = 4 (TG1) and 3 (TP54) independent biological samples. b Doxycycline-dependent TET2 expression in the leukemic UT7 cell line. UT7 cells were treated for 12 h with doxycycline (Dox) at a final concentration of 1 µg/mL. TET2 mRNA levels were assayed using Q-PCR. Dox-treated versus -untreated UT7, mean ± SD, n = 3 independent biological samples. c GHB inhibits TET2 activity in the leukemic UT7 cell line expressing TET2 in a doxycycline-dependent manner. 12 h 10 mM GHB. 5-hmC levels determined by DNA dot immunoblotting. GHB-treated vs control UT7, mean ± SD, n = 3 independent biological samples. d Doxycycline-dependent TET2 expression in GBM stem-like cells (TG1) stably overexpressing TET2 in a doxycycline-dependent manner following lentiviral transduction. Q-PCR assays, mean ± SD, n = 5 biological samples. e Inhibitory GHB effects on TET2-mediated 5-hmC formation in GMB stem-like TG1 cells overexpressing TET2 in a doxycycline-dependent manner, mean ± SD, n = 4 biological samples. f – h In silico analysis of α-KG ( f ) and GHB ( g ) binding pockets within the TET2 protein. α-KG and GHB are colored in white and their oxygens in red . Ribbon representation of TET2 C-terminal domain. Progression from the N- to C- parts of the C-terminal domain are colored from blue to orange . h TET2 amino acid residues in contact with α-KG or GHB

    Article Snippet: TG1, 6240**, 5706** and TP54 stem-like cells were transduced with lentiviral vectors encoding a control or an ALDH5A1 shRNA construct (GeneCopeia, Tebu, France).

    Techniques: Inhibition, Activity Assay, Expressing, Polymerase Chain Reaction, Concentration Assay, Stable Transfection, Transduction, In Silico, Binding Assay

    BCL9 was upregulated in HCC tissues and cell lines and is a direct miR-1301 target. ( a ) The levels of BCL9 expression were analyzed in 60-paired HCC and adjacent normal tissues by qPCR. ( b ) The levels of BCL9 expression in HCC cell lines and normal L02 cells. ( c ) BCL9 protein levels in HCC specimens and adjacent normal tissues as analyzed by immunohistochemistry. ( d ) The potential miR-1301 binding site in the BCL9 3′-UTR was computationally predicted by TargetScan. ( e ) The level of BCL9 expression in cells after transfecting pre-miR-1301 or miR-1301-inhibitor as detected by qPCR; cells transfected with empty lentiviral vectors were used as a negative control. ( f ) BCL9 and β -catenin protein levels in HCC cells transfected with miR-1301 inhibitor or miR-1301 overexpression lentivirus. ( g ) Dual-luciferase reporter assay analysis of the effects of miR-1301 expression on the activities of wild type and mutant BCL9 3′-UTR in 293 T cells. ( h ) A negative correlation between the levels of miR-1301 and BCL9 expression in HCC specimens ( P

    Journal: Cell Death & Disease

    Article Title: miR-1301 inhibits hepatocellular carcinoma cell migration, invasion, and angiogenesis by decreasing Wnt/β-catenin signaling through targeting BCL9

    doi: 10.1038/cddis.2017.356

    Figure Lengend Snippet: BCL9 was upregulated in HCC tissues and cell lines and is a direct miR-1301 target. ( a ) The levels of BCL9 expression were analyzed in 60-paired HCC and adjacent normal tissues by qPCR. ( b ) The levels of BCL9 expression in HCC cell lines and normal L02 cells. ( c ) BCL9 protein levels in HCC specimens and adjacent normal tissues as analyzed by immunohistochemistry. ( d ) The potential miR-1301 binding site in the BCL9 3′-UTR was computationally predicted by TargetScan. ( e ) The level of BCL9 expression in cells after transfecting pre-miR-1301 or miR-1301-inhibitor as detected by qPCR; cells transfected with empty lentiviral vectors were used as a negative control. ( f ) BCL9 and β -catenin protein levels in HCC cells transfected with miR-1301 inhibitor or miR-1301 overexpression lentivirus. ( g ) Dual-luciferase reporter assay analysis of the effects of miR-1301 expression on the activities of wild type and mutant BCL9 3′-UTR in 293 T cells. ( h ) A negative correlation between the levels of miR-1301 and BCL9 expression in HCC specimens ( P

    Article Snippet: Vector and lentivirus production and transfection We modified the commercially available LV3-has-miR-1301-pre-microRNA vector, the lentiviral vector containing the BCL9 DNA sequence (pre-miR-1301 and LV-BCL9), LV3-has-miR-1301-sponge inhibitor vector and the lentiviral vector containing BCL9 siRNA hairpin sequence (miR-1301 inhibitor and BCL9-shRNA) constructs (Genepharma, Shanghai, China).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Immunohistochemistry, Binding Assay, Transfection, Negative Control, Over Expression, Luciferase, Reporter Assay, Mutagenesis

    miR-1301 inhibits migration, invasion, and EMT in HCC cells. HCC SMMC-7721 and Huh-7 cells were transfected with LV3-has-miR-1301-pre-microRNA (pre-miR-1301) and LV3-has-miR-1301-sponge inhibitor (miR-1301 inhibitor) lentiviral constructs. An LV3 scrambled lentiviral construct (miR-NC) was used as a control. ( a – d ) Transwell assays were performed to determine cell migration and invasion and ( e ) wound healing assays corroborated these results. ( f ) Western blotting was used to examine the levels of EMT-related protein. Cell migration and invasion capability were quantified as cell numbers. All experiments were performed three times, and data are represented as mean±S.D. values. * P

    Journal: Cell Death & Disease

    Article Title: miR-1301 inhibits hepatocellular carcinoma cell migration, invasion, and angiogenesis by decreasing Wnt/β-catenin signaling through targeting BCL9

    doi: 10.1038/cddis.2017.356

    Figure Lengend Snippet: miR-1301 inhibits migration, invasion, and EMT in HCC cells. HCC SMMC-7721 and Huh-7 cells were transfected with LV3-has-miR-1301-pre-microRNA (pre-miR-1301) and LV3-has-miR-1301-sponge inhibitor (miR-1301 inhibitor) lentiviral constructs. An LV3 scrambled lentiviral construct (miR-NC) was used as a control. ( a – d ) Transwell assays were performed to determine cell migration and invasion and ( e ) wound healing assays corroborated these results. ( f ) Western blotting was used to examine the levels of EMT-related protein. Cell migration and invasion capability were quantified as cell numbers. All experiments were performed three times, and data are represented as mean±S.D. values. * P

    Article Snippet: Vector and lentivirus production and transfection We modified the commercially available LV3-has-miR-1301-pre-microRNA vector, the lentiviral vector containing the BCL9 DNA sequence (pre-miR-1301 and LV-BCL9), LV3-has-miR-1301-sponge inhibitor vector and the lentiviral vector containing BCL9 siRNA hairpin sequence (miR-1301 inhibitor and BCL9-shRNA) constructs (Genepharma, Shanghai, China).

    Techniques: Migration, Transfection, Construct, Western Blot

    miR-1301 was downregulated in HCC tissues and cell lines. ( a ) The levels of miR-1301 expression in 60-paired human HCC and adjacent normal tissues by qPCR. ( b ) The levels of miR-1301 expression in HCC cell lines and normal L02 cells. ( c ) The expression of miR-1301 in HCC specimens and adjacent normal tissues was detected by FISH assay (scale bars, 50 μ m). ( d and e ) SMMC-7721 and Huh-7 cells were transfected with specific pre-miR-1301 or miR-1301 inhibitor, respectively. Cells transfected with empty lentiviral vectors served as a negative control (NC). miR-1301 expression was analyzed by miRNA RT-PCR after transfection; cells transfected with empty lentiviral vectors were used as NC. * P

    Journal: Cell Death & Disease

    Article Title: miR-1301 inhibits hepatocellular carcinoma cell migration, invasion, and angiogenesis by decreasing Wnt/β-catenin signaling through targeting BCL9

    doi: 10.1038/cddis.2017.356

    Figure Lengend Snippet: miR-1301 was downregulated in HCC tissues and cell lines. ( a ) The levels of miR-1301 expression in 60-paired human HCC and adjacent normal tissues by qPCR. ( b ) The levels of miR-1301 expression in HCC cell lines and normal L02 cells. ( c ) The expression of miR-1301 in HCC specimens and adjacent normal tissues was detected by FISH assay (scale bars, 50 μ m). ( d and e ) SMMC-7721 and Huh-7 cells were transfected with specific pre-miR-1301 or miR-1301 inhibitor, respectively. Cells transfected with empty lentiviral vectors served as a negative control (NC). miR-1301 expression was analyzed by miRNA RT-PCR after transfection; cells transfected with empty lentiviral vectors were used as NC. * P

    Article Snippet: Vector and lentivirus production and transfection We modified the commercially available LV3-has-miR-1301-pre-microRNA vector, the lentiviral vector containing the BCL9 DNA sequence (pre-miR-1301 and LV-BCL9), LV3-has-miR-1301-sponge inhibitor vector and the lentiviral vector containing BCL9 siRNA hairpin sequence (miR-1301 inhibitor and BCL9-shRNA) constructs (Genepharma, Shanghai, China).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Fluorescence In Situ Hybridization, Transfection, Negative Control, miRNA RT, Polymerase Chain Reaction

    Expression of Nrf2 and p62 in breast cancer. (A) Immunohistochemical assay of Nrf2 and p62 protein levels in pairs of matched breast carcinoma tissues (T) and adjacent normal breast tissues (N). (B) Western blot analysis of Nrf2 and p62 protein levels in T47D, BT 549, MDA ‐ MB ‐231, and MCF ‐7 breast cancer cell lines and MCF ‐10A benign breast epithelial cell line. (C) Quantitation of Nrf2 and p62 protein levels in breast cancer cells and benign epithelial cell. (D) Western blot analysis of p62 protein level in T47D and BT 549 after infecting Nrf2 sh RNA lentivirus. (E) Quantitation of Nrf2 and p62 protein levels in T47D and BT 549 after infecting Nrf2 sh RNA lentivirus. (F) Western blot analysis of Nrf2 protein level in T47D and BT 549 after infecting p62 sh RNA lentivirus. (G) Quantitation of Nrf2 and p62 protein levels in T47D and BT 549 after infecting p62 sh RNA lentivirus. Data are presented as mean ± SD , n = 3, * P

    Journal: Cancer Medicine

    Article Title: PA‐MSHA inhibits the growth of doxorubicin‐resistant MCF‐7/ADR human breast cancer cells by downregulating Nrf2/p62

    doi: 10.1002/cam4.938

    Figure Lengend Snippet: Expression of Nrf2 and p62 in breast cancer. (A) Immunohistochemical assay of Nrf2 and p62 protein levels in pairs of matched breast carcinoma tissues (T) and adjacent normal breast tissues (N). (B) Western blot analysis of Nrf2 and p62 protein levels in T47D, BT 549, MDA ‐ MB ‐231, and MCF ‐7 breast cancer cell lines and MCF ‐10A benign breast epithelial cell line. (C) Quantitation of Nrf2 and p62 protein levels in breast cancer cells and benign epithelial cell. (D) Western blot analysis of p62 protein level in T47D and BT 549 after infecting Nrf2 sh RNA lentivirus. (E) Quantitation of Nrf2 and p62 protein levels in T47D and BT 549 after infecting Nrf2 sh RNA lentivirus. (F) Western blot analysis of Nrf2 protein level in T47D and BT 549 after infecting p62 sh RNA lentivirus. (G) Quantitation of Nrf2 and p62 protein levels in T47D and BT 549 after infecting p62 sh RNA lentivirus. Data are presented as mean ± SD , n = 3, * P

    Article Snippet: The negative control small hairpin RNA (shNC, 5′‐TTCTCCGAACGTGT CACGT‐3′), and p62shRNA two oligo DNAs (5′‐CGAGGAATTGACAATGGCCAT‐3′; 5′‐CCTCTGGGCATTGAAGTTGAT‐3′) were designed, synthesized, and cloned into lentivirus vectors (GV115) to form constructed GV115‐shRNA plasmids by Genechem (Shanghai, China).

    Techniques: Expressing, Immunohistochemistry, Western Blot, Multiple Displacement Amplification, Quantitation Assay

    The sensitivity of breast cancer cells to doxorubicin regulated by Nrf2 and p62. (A) The protein levels of Nrf2 and p62 were determined by western blot in MCF ‐7 cells after pretreated with 40 μ mol/L tBHQ for 24 h. (B) The tBHQ ‐pretreated cells were treated with the indicated doses of doxorubicin for 24 h, followed by the CCK 8 assay. (C) Protein levels of Nrf2 and p62 were determined by western blot in T47D cells infected with Nrf2 sh RNA or p62 sh RNA lentivirus. (D) T47D cells infected with Nrf2 sh RNA or p62 sh RNA lentivirus were treated with the indicated doses of doxorubicin for 24 h, followed by the CCK 8 assay. (E) Protein levels of Nrf2 and p62 were determined by western blot in BT 459 cells infected with Nrf2 sh RNA or p62 sh RNA lentivirus. (D) BT 549 cells infected with Nrf2 sh RNA or p62 sh RNA lentivirus were treated with the indicated doses of doxorubicin for 24 h, followed by the CCK 8 assay. Data are presented as mean ± SD , n = 3, * P

    Journal: Cancer Medicine

    Article Title: PA‐MSHA inhibits the growth of doxorubicin‐resistant MCF‐7/ADR human breast cancer cells by downregulating Nrf2/p62

    doi: 10.1002/cam4.938

    Figure Lengend Snippet: The sensitivity of breast cancer cells to doxorubicin regulated by Nrf2 and p62. (A) The protein levels of Nrf2 and p62 were determined by western blot in MCF ‐7 cells after pretreated with 40 μ mol/L tBHQ for 24 h. (B) The tBHQ ‐pretreated cells were treated with the indicated doses of doxorubicin for 24 h, followed by the CCK 8 assay. (C) Protein levels of Nrf2 and p62 were determined by western blot in T47D cells infected with Nrf2 sh RNA or p62 sh RNA lentivirus. (D) T47D cells infected with Nrf2 sh RNA or p62 sh RNA lentivirus were treated with the indicated doses of doxorubicin for 24 h, followed by the CCK 8 assay. (E) Protein levels of Nrf2 and p62 were determined by western blot in BT 459 cells infected with Nrf2 sh RNA or p62 sh RNA lentivirus. (D) BT 549 cells infected with Nrf2 sh RNA or p62 sh RNA lentivirus were treated with the indicated doses of doxorubicin for 24 h, followed by the CCK 8 assay. Data are presented as mean ± SD , n = 3, * P

    Article Snippet: The negative control small hairpin RNA (shNC, 5′‐TTCTCCGAACGTGT CACGT‐3′), and p62shRNA two oligo DNAs (5′‐CGAGGAATTGACAATGGCCAT‐3′; 5′‐CCTCTGGGCATTGAAGTTGAT‐3′) were designed, synthesized, and cloned into lentivirus vectors (GV115) to form constructed GV115‐shRNA plasmids by Genechem (Shanghai, China).

    Techniques: Western Blot, CCK-8 Assay, Infection

    Nrf2 and p62 overexpressed in MCF ‐7/ ADR breast cancer cells. (A) The inhibitory effect of doxorubicin on MCF ‐7 and MCF ‐7/ ADR cells proliferation. Cells were treated with various concentrations of doxorubicin for 24 h, and then cell viability was determined by the CCK 8 assay. (B) MCF ‐7 and MCF ‐7/ ADR cells treated with PBS or doxorubicin (3 μ g/mL) for 24 h were visualized by light microscopy. (C) The protein levels of Nrf2 and p62 were assessed by western blot in MCF ‐7 and MCF ‐7/ ADR cells. (D) The mRNA expression of Nrf2 and p62 was assessed by RT ‐ qPCR in MCF ‐7 and MCF ‐7/ ADR cells. (E) Western blot analysis for the protein levels of Nrf2 and p62 in MCF ‐7 and MCF ‐7/ ADR cells treated with 3 μ g/mL doxorubicin. (F) MCF ‐7/ ADR cells were performed infected with Nrf2 sh RNA or p62 sh RNA lentivirus. Protein levels of Nrf2 and p62 were determined by western blot. (G) MCF ‐7/ ADR cells infected with Nrf2 sh RNA or p62 sh RNA lentivirus were treated with the indicated doses of doxorubicin for 24 h, followed by the CCK 8 assay. Data are presented as mean ± SD , n = 3, * P

    Journal: Cancer Medicine

    Article Title: PA‐MSHA inhibits the growth of doxorubicin‐resistant MCF‐7/ADR human breast cancer cells by downregulating Nrf2/p62

    doi: 10.1002/cam4.938

    Figure Lengend Snippet: Nrf2 and p62 overexpressed in MCF ‐7/ ADR breast cancer cells. (A) The inhibitory effect of doxorubicin on MCF ‐7 and MCF ‐7/ ADR cells proliferation. Cells were treated with various concentrations of doxorubicin for 24 h, and then cell viability was determined by the CCK 8 assay. (B) MCF ‐7 and MCF ‐7/ ADR cells treated with PBS or doxorubicin (3 μ g/mL) for 24 h were visualized by light microscopy. (C) The protein levels of Nrf2 and p62 were assessed by western blot in MCF ‐7 and MCF ‐7/ ADR cells. (D) The mRNA expression of Nrf2 and p62 was assessed by RT ‐ qPCR in MCF ‐7 and MCF ‐7/ ADR cells. (E) Western blot analysis for the protein levels of Nrf2 and p62 in MCF ‐7 and MCF ‐7/ ADR cells treated with 3 μ g/mL doxorubicin. (F) MCF ‐7/ ADR cells were performed infected with Nrf2 sh RNA or p62 sh RNA lentivirus. Protein levels of Nrf2 and p62 were determined by western blot. (G) MCF ‐7/ ADR cells infected with Nrf2 sh RNA or p62 sh RNA lentivirus were treated with the indicated doses of doxorubicin for 24 h, followed by the CCK 8 assay. Data are presented as mean ± SD , n = 3, * P

    Article Snippet: The negative control small hairpin RNA (shNC, 5′‐TTCTCCGAACGTGT CACGT‐3′), and p62shRNA two oligo DNAs (5′‐CGAGGAATTGACAATGGCCAT‐3′; 5′‐CCTCTGGGCATTGAAGTTGAT‐3′) were designed, synthesized, and cloned into lentivirus vectors (GV115) to form constructed GV115‐shRNA plasmids by Genechem (Shanghai, China).

    Techniques: CCK-8 Assay, Light Microscopy, Western Blot, Expressing, Quantitative RT-PCR, Infection

    PKR is responsible for TMEV-induced eIF2α phosphorylation and stress granule assembly. (A) Western blot analysis of PKR expression in HeLa cells transduced with an empty pLKO-1 lentiviral vector (control) or with lentiviral vectors (FB52, FB53, and FB54) expressing shRNA1, shRNA2, or shRNA3, directed against PKR. Transduced cells were selected for 1 week with puromycin before being assessed for PKR expression. (B) Control HeLa cells and HeLa cells transduced with FB54 (shRNA3) were infected for 10 h with wild-type (L WT ) or L-mutant (L Zn and L M60V ) viruses. Mock-infected and L M60V -infected cell samples were treated for 30 min with sodium arsenite prior to cell lysis. Lysates were harvested at 10 hpi, and PKR expression and eIF2α phosphorylation were analyzed by Western blotting. (C) Confocal microscopy images showing the coimmunostaining of eIF3 (green) and the viral capsid (red) in control and PKR knockdown HeLa cells infected or treated as described for panel B.

    Journal: Journal of Virology

    Article Title: The Leader Protein of Theiler's Virus Prevents the Activation of PKR

    doi: 10.1128/JVI.01010-19

    Figure Lengend Snippet: PKR is responsible for TMEV-induced eIF2α phosphorylation and stress granule assembly. (A) Western blot analysis of PKR expression in HeLa cells transduced with an empty pLKO-1 lentiviral vector (control) or with lentiviral vectors (FB52, FB53, and FB54) expressing shRNA1, shRNA2, or shRNA3, directed against PKR. Transduced cells were selected for 1 week with puromycin before being assessed for PKR expression. (B) Control HeLa cells and HeLa cells transduced with FB54 (shRNA3) were infected for 10 h with wild-type (L WT ) or L-mutant (L Zn and L M60V ) viruses. Mock-infected and L M60V -infected cell samples were treated for 30 min with sodium arsenite prior to cell lysis. Lysates were harvested at 10 hpi, and PKR expression and eIF2α phosphorylation were analyzed by Western blotting. (C) Confocal microscopy images showing the coimmunostaining of eIF3 (green) and the viral capsid (red) in control and PKR knockdown HeLa cells infected or treated as described for panel B.

    Article Snippet: Three different shRNAs targeting PKR were selected from the Sigma mission collection (reference code TRCN0000001379, shRNA1; TRCN0000001381, shRNA2; TRCN000019400, shRNA3) and cloned in the pLKO.1 lentiviral vector by following Addgene instructions (Addgene plasmid 10878, protocol version 1.0).

    Techniques: Western Blot, Expressing, Transduction, Plasmid Preparation, Infection, Mutagenesis, Lysis, Confocal Microscopy

    In vitro consequences of cyclin D1 silencing ASPC-1 and BxPC3 cells that were either not infected (parental cells: P) or infected with the mock-infected lentivirus pll37 (E), or pll37 containing sequences encoding luciferase (L), or cyclin D1 specific shRNA 8 (8) or 10 (10), or their combination (K). (a) Anchorage-dependent growth was determined by the MTT assay. Data are the means ± SE of triplicate determinations from three independent experiments. *p

    Journal: Cancer gene therapy

    Article Title: Intra-Tumoral Delivery of shRNA Targeting Cyclin D1 Attenuates Pancreatic Cancer Growth

    doi: 10.1038/cgt.2009.75

    Figure Lengend Snippet: In vitro consequences of cyclin D1 silencing ASPC-1 and BxPC3 cells that were either not infected (parental cells: P) or infected with the mock-infected lentivirus pll37 (E), or pll37 containing sequences encoding luciferase (L), or cyclin D1 specific shRNA 8 (8) or 10 (10), or their combination (K). (a) Anchorage-dependent growth was determined by the MTT assay. Data are the means ± SE of triplicate determinations from three independent experiments. *p

    Article Snippet: Oligonucleotides corresponding to the shRNA sequence of interest were annealed and cloned into the lentivirus vector, pLentiLox 3.7 (pll3.7) (Addgene, Cambridge, MA).

    Techniques: In Vitro, Infection, Luciferase, shRNA, MTT Assay

    Effects of cyclin D1-directed shRNA on cell proliferation and angiogenesis in BxPC3-derived tumors (a) Immunohistochemical analysis. Representative immunostaining for Ki-67, CD31 and VEGF in tumors BxPC3-derived tumors that were injected in vivo with buffer (Control), a luciferase-directed shRNA-lentivirus (sh-Luc), or a cyclin D1-directed shRNA-lentivirus (sh-D1). Original magnification, x 20. (b) Quantitative morphometry for Ki-67, CD31, and VEGF immunoreactivity. Data are the means ± SEM from three tumors/cell line/group. * P

    Journal: Cancer gene therapy

    Article Title: Intra-Tumoral Delivery of shRNA Targeting Cyclin D1 Attenuates Pancreatic Cancer Growth

    doi: 10.1038/cgt.2009.75

    Figure Lengend Snippet: Effects of cyclin D1-directed shRNA on cell proliferation and angiogenesis in BxPC3-derived tumors (a) Immunohistochemical analysis. Representative immunostaining for Ki-67, CD31 and VEGF in tumors BxPC3-derived tumors that were injected in vivo with buffer (Control), a luciferase-directed shRNA-lentivirus (sh-Luc), or a cyclin D1-directed shRNA-lentivirus (sh-D1). Original magnification, x 20. (b) Quantitative morphometry for Ki-67, CD31, and VEGF immunoreactivity. Data are the means ± SEM from three tumors/cell line/group. * P

    Article Snippet: Oligonucleotides corresponding to the shRNA sequence of interest were annealed and cloned into the lentivirus vector, pLentiLox 3.7 (pll3.7) (Addgene, Cambridge, MA).

    Techniques: shRNA, Derivative Assay, Immunohistochemistry, Immunostaining, Injection, In Vivo, Luciferase

    Cyclin D1 silencing ASPC-1 (a) and BxPC3 (b) cells that were either not infected (parental cells: P) or infected with the mock-infected lentivirus pll37 (M), or with pll37 containing sequences encoding luciferase (L), cyclin D1 specific shRNA 8 (8) or 10 (10), or their combination (K). Cell lysates, prepared 72 h after infection, were subjected to immunoblotting using anti-cyclin D1 antibodies. Membranes were re-probed with anti-tubulin antibody to assess equivalent lane loading.

    Journal: Cancer gene therapy

    Article Title: Intra-Tumoral Delivery of shRNA Targeting Cyclin D1 Attenuates Pancreatic Cancer Growth

    doi: 10.1038/cgt.2009.75

    Figure Lengend Snippet: Cyclin D1 silencing ASPC-1 (a) and BxPC3 (b) cells that were either not infected (parental cells: P) or infected with the mock-infected lentivirus pll37 (M), or with pll37 containing sequences encoding luciferase (L), cyclin D1 specific shRNA 8 (8) or 10 (10), or their combination (K). Cell lysates, prepared 72 h after infection, were subjected to immunoblotting using anti-cyclin D1 antibodies. Membranes were re-probed with anti-tubulin antibody to assess equivalent lane loading.

    Article Snippet: Oligonucleotides corresponding to the shRNA sequence of interest were annealed and cloned into the lentivirus vector, pLentiLox 3.7 (pll3.7) (Addgene, Cambridge, MA).

    Techniques: Infection, Luciferase, shRNA

    Effects of cyclin D1-directed shRNA on tumor growth ASPC-1 or BxPC3 cells were injected subcutaneously in athymic nude mice. After tumors reached a volume of 30–40 mm 3 , they were either injected with buffer (ASPC-1) or with luciferase-directed (sh-Luc) or cyclin D1-directed (sh-D1) shRNA-lentiviruses. Tumor volumes were calculated in mm 3 as described in the Methods section. Data are expressed as means ± SEM from 8 mice in each group at each time point. *p

    Journal: Cancer gene therapy

    Article Title: Intra-Tumoral Delivery of shRNA Targeting Cyclin D1 Attenuates Pancreatic Cancer Growth

    doi: 10.1038/cgt.2009.75

    Figure Lengend Snippet: Effects of cyclin D1-directed shRNA on tumor growth ASPC-1 or BxPC3 cells were injected subcutaneously in athymic nude mice. After tumors reached a volume of 30–40 mm 3 , they were either injected with buffer (ASPC-1) or with luciferase-directed (sh-Luc) or cyclin D1-directed (sh-D1) shRNA-lentiviruses. Tumor volumes were calculated in mm 3 as described in the Methods section. Data are expressed as means ± SEM from 8 mice in each group at each time point. *p

    Article Snippet: Oligonucleotides corresponding to the shRNA sequence of interest were annealed and cloned into the lentivirus vector, pLentiLox 3.7 (pll3.7) (Addgene, Cambridge, MA).

    Techniques: shRNA, Injection, Mouse Assay, Luciferase

    Effects of cyclin D1-directed shRNA on proliferation and angiogenesis in ASPC-1-derived tumors (a) Immunohistochemical analysis. Representative immunostaining for Ki-67, CD31 and VEGF in ASPC-1-derived tumors that were injected in vivo with buffer (Control), a luciferase-directed shRNA-lentivirus (sh-Luc), or a cyclin D1-directed shRNA-lentivirus (sh-D1). Original magnification, x 20. (b) Quantitative morphometry for Ki-67, CD31, and VEGF immunoreactivity from the tumors shown in (a). Data are the means ± SEM from three tumors/group, with 10 random fields analyzed for each tumor. * P

    Journal: Cancer gene therapy

    Article Title: Intra-Tumoral Delivery of shRNA Targeting Cyclin D1 Attenuates Pancreatic Cancer Growth

    doi: 10.1038/cgt.2009.75

    Figure Lengend Snippet: Effects of cyclin D1-directed shRNA on proliferation and angiogenesis in ASPC-1-derived tumors (a) Immunohistochemical analysis. Representative immunostaining for Ki-67, CD31 and VEGF in ASPC-1-derived tumors that were injected in vivo with buffer (Control), a luciferase-directed shRNA-lentivirus (sh-Luc), or a cyclin D1-directed shRNA-lentivirus (sh-D1). Original magnification, x 20. (b) Quantitative morphometry for Ki-67, CD31, and VEGF immunoreactivity from the tumors shown in (a). Data are the means ± SEM from three tumors/group, with 10 random fields analyzed for each tumor. * P

    Article Snippet: Oligonucleotides corresponding to the shRNA sequence of interest were annealed and cloned into the lentivirus vector, pLentiLox 3.7 (pll3.7) (Addgene, Cambridge, MA).

    Techniques: shRNA, Derivative Assay, Immunohistochemistry, Immunostaining, Injection, In Vivo, Luciferase