lentiviral vector Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Addgene inc lentivirus infection lentiviral vector
    Lentivirus Infection Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentivirus infection lentiviral vector/product/Addgene inc
    Average 94 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    lentivirus infection lentiviral vector - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    92
    Cellecta lentiviral vector
    Lentiviral Vector, supplied by Cellecta, used in various techniques. Bioz Stars score: 92/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Cellecta
    Average 92 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    94
    Thermo Fisher lentiviral vector
    <t>Lentiviral</t> introduction of SV40 large T antigen and human telomerase reverse transcriptase ( hTERT ) genes significantly elongated the life span of the conjunctival epithelial cells from a gelatinous drop-like corneal dystrophy (GDLD) patient. Top, Plasmid
    Lentiviral Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 2886 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Thermo Fisher
    Average 94 stars, based on 2886 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    93
    Millipore lentiviral vector
    Lactate influx in C3H10T½ cells is attenuated by stable knockdown of MCT1. MCT1 was stably knocked down in C3H10T½ cells by <t>lentiviral</t> shRNA transduction as described in Materials and Methods. ( a ) Relative MCT1 protein levels in C3H10T½ cells expressing empty control plasmid (pLKO.1) or MCT1 shRNA (KD), at day 0 (undifferentiated) and day 8 after differentiation induction. β-actin is shown as loading control. Membranes were cut horizontally before blotting and edges slightly cropped for presentation. The bar chart shows mean data from 3 independent experiments, normalized to control values at day 0 and day 8. ( b ) Tracer measurements of lactate influx were carried out as described in the legend to Fig. 4 , and net influx calculated as nmol lactate ·well −1 before ( b ) and after ( c ) differentiation. The figure shows means with SEM error bars of 3 independent biological replicates for pLKO.1 (black symbols) and MCT1 KD (gray symbols) cells. *, **p
    Lentiviral Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 1401 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Millipore
    Average 93 stars, based on 1401 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    93
    Addgene inc lentiviral vector
    Endothelial cell association with -BD11 cells in vivo required matrix Galectin-1 expression. A: RT-PCR analysis of LGALS1 gene expression in pooled populations of -BD11 cells transfected with shRNA <t>lentiviral</t> vectors targeting a scrambled sequence (Control shRNA) or Galectin-1 (LGALS1 shRNA). B–J: Histomorphology of -BD11 transfectant tumour sections immunohistochemically stained (brown) for B: Galectin-1 in cells transfected with control shRNA or C: Galectin-1 in cells transfected with LGALS1 shRNA. D: CD34 immunohistochemical staining targeted murine endothelial cells in a parallel serial section equivalent to C. E: Whole tumour section of -BD11 cells transfected with LGALS1 shRNA with neighbouring subregion immunohistochemically stained for CD34 (arrow). F–H: Higher power magnification of arrow region in E, stained for F: CD34, G: Human-specific CD99, H: Galectin-1. Higher power magnification of Galectin-1 staining in regions in H that were I: CD99+/CD34− and J: CD99+/CD34+. Scale bar, 100 µm.
    Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 2022 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Addgene inc
    Average 93 stars, based on 2022 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    92
    Shanghai Genechem lentiviral vector
    (A) Detection of EWS-FLI1 fusion gene expression in RD-ES and A673 cell lines using reverse transcription-polymerase chain reaction. (B) Expression levels of the fusion gene were downregulated in RD-ES and A-673 cells following siRNA transfection. (C) miR-34b expression in A673 cells was downregulated following siRNA transfection. (D) miR-34b expression in RD-ES cells was downregulated following siRNA transfection. (E) miR-34b expression was upregulated by the precursor of miR-34b in RD-ES and A-673 cells. (F) miR-34b expression was downregulated by the inhibitor of miR-34b in RD-ES and A-673 cells. BC, cell lines that were treated with <t>lentiviral</t> vector alone; NC(+), normal cell lines that were not transfected with siRNA; NS, cells transfected with non-targeting siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA targeting the EWS-FLI1 fusion gene; Micro-up, NC(−) cell lines treated with precursor miR-34b sequences; Micro-down, NC(+) cell lines treated with complementary sequences of miR-34b. **P
    Lentiviral Vector, supplied by Shanghai Genechem, used in various techniques. Bioz Stars score: 92/100, based on 882 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Shanghai Genechem
    Average 92 stars, based on 882 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    Genechem lentiviral vector
    Levels of FasL in NP cells culture supernatants. FasL expression in normal NP cells supernatant is higher than that in the degenerate NP cells supernatant. After transfection of <t>lentiviral</t> vector encoding FasL, the FasL production of NP cells increases. Transfection with lentiviral vector encoded scrambled sequence shows low FasL expression. Data are representative of three experiments; error bars represent SEM. * p
    Lentiviral Vector, supplied by Genechem, used in various techniques. Bioz Stars score: 92/100, based on 891 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Genechem
    Average 92 stars, based on 891 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    93
    System Biosciences Inc lentiviral vector
    SUMOylation of TARBP2 controls miRNA/siRNA efficiency. ( a , b ) SUMOylation of TARBP2 is required for efficient RNA-induced gene silencing by recruiting more Ago2. A549 luc cell lines stably expressing pri-miRNA21 and Flag-TARBP2-WT or -K52R ( a , named as miR21-WT or miR21-K52R, respectively), or pri-miR130b and Flag-TARBP2-WT or -K52R ( b , named as miR130b-WT and miR130b-K52R, respectively) were generated by the <t>lentiviral</t> system. Cell lysates were used for IP with anti-Flag antibody and then detected with anti-Ago2 antibody. Cell lysates were used for immunoblotting with anti-Ago2, -GAPDH, -Flag and -PTEN ( a ) or -ZEB1 ( b ) antibodies. For full scans of western blots, see Supplementary Fig. 8 . ( c ) The SUMO-site mutation K52R of TARBP2 dominant-negatively abolishes inhibition of cell migration mediated by miR130b-ZEB1. Cell motilities of stable A549 luc cell lines including Control, miR130b-con, miR130b-WT and miR130b-K52R were analysed by a wound-healing assay with μ-Dish. ( d ) RIP assay was performed with 293T cells transfected with pri-miR21, myc-Ago2 and Flag-TARBP2-WT or -K52R. Thirty-six hours after transfection, cells were lysed for IP with anti-myc antibody to pull down RNA. Ago2-bound mature miR21 was extracted and analysed by real-time quantitative PCR. ( e – g ) SUMOylation of TARBP2 influences the efficiency of miRNA or siRNA mimic duplexes via the formation of the functional RISC. TARBP2-WT or -K52R with/without Ago2, together with miR21 ( e ), miR130b ( f ), mimic duplexes or siPTEN (siRNA for PTEN; g ) were co-transfected into HeLa cells, and the expression levels of the corresponding targets PTEN, ZEB1 and PTEN were determined. Immunoblotting was performed with anti-PTEN, anti-ZEB1, anti-Myc, anti-Flag and anti-GAPDH antibodies. ( h ) A model for SUMOylation of TARBP2 controls the efficiency of RNA-induced gene silencing by increasing its interaction with Ago2 and precursor miRNAs/siRNAs. ‘S'—SUMOylation; ‘P'—Phosphorylation.
    Lentiviral Vector, supplied by System Biosciences Inc, used in various techniques. Bioz Stars score: 93/100, based on 809 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/System Biosciences Inc
    Average 93 stars, based on 809 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    92
    Genecopoeia lentiviral vector
    Effects of ectopic microRNA-18a expression on gene expression and cell growth in MB231RN-LM cells. (A) Expression levels of microRNA-18a (miR-18a) in cells transduced with <t>lentiviral</t> vector expressing miR-18a green fluorescent protein (GFP) (LM-miR-18a) and or control cells transduced with lentiviral vector expressing GFP only (LM-GFP). (B) Effect of miR-18a on expression levels of predicted target mRNAs. mRNA levels were examined by quantitative PCR (qPCR) and normalized to ACTB . The expression levels of all the presented genes were significantly reduced by miR-18a expression ( n = 3, P
    Lentiviral Vector, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 92/100, based on 405 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Genecopoeia
    Average 92 stars, based on 405 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    TaKaRa lentiviral vector
    Establishment of vaccine cell lines by <t>lentiviral</t> transduction. ( A ) Lentiviral constructs used in this study. LTR, long terminal repeat. Ψ, packaging signal. RRE, Rev response element. cPPT, central polypurine tract. CMVp, CMV promoter. IRES, internal ribosome entry site. Bsd, blasticidin resistance gene. WPRE, woodchuck hepatitis virus posttranscriptional regulatory element. Sp, Signal peptide of IL-7. FA, furin cleavage site and P2A peptide. ( B ) Western blot analysis of secreted IL-21 and IL-7 in vaccine cell-conditioned media. Note that the two bands of IL-21 in the 21/7 CM lane represented two possible cleavage products: cleavage at furin site resulted in IL-21 + 4AA, while cleavage at P2A site resulted in IL-21 + 25AA. CM, conditioned medium. AA, amino acids. ( C ) Western blot analysis of STAT proteins activated in response to secreted IL-21 and IL-7. SC, splenocytes. MC, medium control. Full-length blots are presented in Supplementary Figure S1 .
    Lentiviral Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 571 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/TaKaRa
    Average 92 stars, based on 571 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    90
    Horizon Discovery lentiviral vector
    Establishment of vaccine cell lines by <t>lentiviral</t> transduction. ( A ) Lentiviral constructs used in this study. LTR, long terminal repeat. Ψ, packaging signal. RRE, Rev response element. cPPT, central polypurine tract. CMVp, CMV promoter. IRES, internal ribosome entry site. Bsd, blasticidin resistance gene. WPRE, woodchuck hepatitis virus posttranscriptional regulatory element. Sp, Signal peptide of IL-7. FA, furin cleavage site and P2A peptide. ( B ) Western blot analysis of secreted IL-21 and IL-7 in vaccine cell-conditioned media. Note that the two bands of IL-21 in the 21/7 CM lane represented two possible cleavage products: cleavage at furin site resulted in IL-21 + 4AA, while cleavage at P2A site resulted in IL-21 + 25AA. CM, conditioned medium. AA, amino acids. ( C ) Western blot analysis of STAT proteins activated in response to secreted IL-21 and IL-7. SC, splenocytes. MC, medium control. Full-length blots are presented in Supplementary Figure S1 .
    Lentiviral Vector, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 90/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Horizon Discovery
    Average 90 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    94
    GenePharma Company lentiviral vector
    Inhibition of BTG2 expression accounted for function of miR-25-3p in TNBC. a . BTG2 protein expression level was measured by western blot. b , c . cell proliferation of Sum-1315 and ZR-751 cells transfected with GV272 empty construct (miR-NC), miR-25-3p inhibitor lentivirus (miR-inhibitor) and BTG2 interfering RNA (siBTG2),miR-25-3p mimics lentivirus (miR-mimics) and BTG2 <t>lentiviral</t> vector(lv-BTG2) was determined by CCK-8 and colony formation assay. d . The cell apoptosis of Sum-1315 and ZR-751 cells after cotransfection was measured in flow cytometry analysis. * p
    Lentiviral Vector, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 94/100, based on 453 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/GenePharma Company
    Average 94 stars, based on 453 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    92
    Santa Cruz Biotechnology lentiviral vector
    Inhibition of BTG2 expression accounted for function of miR-25-3p in TNBC. a . BTG2 protein expression level was measured by western blot. b , c . cell proliferation of Sum-1315 and ZR-751 cells transfected with GV272 empty construct (miR-NC), miR-25-3p inhibitor lentivirus (miR-inhibitor) and BTG2 interfering RNA (siBTG2),miR-25-3p mimics lentivirus (miR-mimics) and BTG2 <t>lentiviral</t> vector(lv-BTG2) was determined by CCK-8 and colony formation assay. d . The cell apoptosis of Sum-1315 and ZR-751 cells after cotransfection was measured in flow cytometry analysis. * p
    Lentiviral Vector, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 123 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Santa Cruz Biotechnology
    Average 92 stars, based on 123 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    91
    Lentigen lentiviral vector
    Vector construction and restriction endonuclease analysis. ( A ) The iCAR19 construct (upper) consisted of the Tet-on sequence and the CD19-CAR fragment. The iGFP construct (lower) consisted of the Tet-on sequence and the GFP sequence. ( B ) Constructs in ( A ) were respectively cloned into the pCDH-CMV-MCS-EF1α-copGFP <t>lentiviral</t> backbone between SnaBI and SalI sites. ( C − E ) the restriction endonuclease analysis results of pCDH-induce ( C ), iGFP ( D ), and iCAR19 ( E ) transfer vector plasmid. SnaBI-SalI digestion was used for pCDH-induce vector. SalI digestion was used for iGFP and iCAR19 vectors.
    Lentiviral Vector, supplied by Lentigen, used in various techniques. Bioz Stars score: 91/100, based on 115 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Lentigen
    Average 91 stars, based on 115 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    92
    OriGene lentiviral vector
    Expression of MYCN in ATRX -mutant cells leads to ROS production, DNA damage, and replicative stress. a Bar plot (mean±SD) of ROS levels on Day 6 ± doxycycline. P value was calculated using two-tailed Student t test. b Immunoblots on Day 4 ± doxycycline. The experiment was repeated with the same results. c Immunofluorescent detection of γH2AX (red) and nuclei (blue) in SKNMM MYCN cells on Day 4 ± doxycycline. The experiment was repeated with the same results. d Spectral karyotype analysis (SKY) of SKNMM MYCN cells ± DOX on Day 8. Chromosomes are shown adjacent to the pseudo-colored representation. Arrows indicate translocations. The pie charts show the proportion of cells with DNA fragmentation ( n = 50). P value was calculated using Chi-square test. e , f Micrographs of single-cell electrophoresis of individual nuclei (dashed circles) and their COMET tail (arrows) ± doxycycline on Day 5. g Mean±SD of the COMET assay scoring. The number of analyzed cells are presented on the graph. h Photograph of cresyl violet-stained colonies from SKNMM MYCN cells ± doxycycline, with increasing concentrations of retinoic acid (RA). i Immunoblots of SKNMM MYCN cells ± doxycycline, with or without 5 μ m RA. The level of MYCN protein was reduced by 30% (0.7×) in the presence of RA. j ChromHMM and ChIP-seq for MYCN, H3K4me3, and H3K27me3 for the CUX2 promoter for a MYCN -amplified neuroblastoma (SJNBL012407_X1) xenograft and SKNMM MYCN cells in the presence or absence of doxycycline after 4 days in culture. The gene expression (FPKM) is indicated, and the dashed line indicates the start of transcription. k Line plot of SKNMM MYCN cells in the presence or absence of doxycycline after 4, 6, 8, and 10 days in culture with or without ectopic expression of CUX2 or the GFP control from <t>lentiviral</t> infection. Each point is the mean and standard deviation of triplicate experiments, and the asterisks indicate statistical significance ( P = 0.005, 0.001, and 0.008 at days 6, 8, and 10, respectively, two-tailed Student's t test). Scale bars e , f , 10 μm. DOX doxycycline, RA retinoic acid, ROS reactive-oxygen species, m marker chromosome fragments that could not be definitively identified.
    Lentiviral Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 204 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/OriGene
    Average 92 stars, based on 204 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    93
    ABM Inc lentiviral vector
    Expression of MYCN in ATRX -mutant cells leads to ROS production, DNA damage, and replicative stress. a Bar plot (mean±SD) of ROS levels on Day 6 ± doxycycline. P value was calculated using two-tailed Student t test. b Immunoblots on Day 4 ± doxycycline. The experiment was repeated with the same results. c Immunofluorescent detection of γH2AX (red) and nuclei (blue) in SKNMM MYCN cells on Day 4 ± doxycycline. The experiment was repeated with the same results. d Spectral karyotype analysis (SKY) of SKNMM MYCN cells ± DOX on Day 8. Chromosomes are shown adjacent to the pseudo-colored representation. Arrows indicate translocations. The pie charts show the proportion of cells with DNA fragmentation ( n = 50). P value was calculated using Chi-square test. e , f Micrographs of single-cell electrophoresis of individual nuclei (dashed circles) and their COMET tail (arrows) ± doxycycline on Day 5. g Mean±SD of the COMET assay scoring. The number of analyzed cells are presented on the graph. h Photograph of cresyl violet-stained colonies from SKNMM MYCN cells ± doxycycline, with increasing concentrations of retinoic acid (RA). i Immunoblots of SKNMM MYCN cells ± doxycycline, with or without 5 μ m RA. The level of MYCN protein was reduced by 30% (0.7×) in the presence of RA. j ChromHMM and ChIP-seq for MYCN, H3K4me3, and H3K27me3 for the CUX2 promoter for a MYCN -amplified neuroblastoma (SJNBL012407_X1) xenograft and SKNMM MYCN cells in the presence or absence of doxycycline after 4 days in culture. The gene expression (FPKM) is indicated, and the dashed line indicates the start of transcription. k Line plot of SKNMM MYCN cells in the presence or absence of doxycycline after 4, 6, 8, and 10 days in culture with or without ectopic expression of CUX2 or the GFP control from <t>lentiviral</t> infection. Each point is the mean and standard deviation of triplicate experiments, and the asterisks indicate statistical significance ( P = 0.005, 0.001, and 0.008 at days 6, 8, and 10, respectively, two-tailed Student's t test). Scale bars e , f , 10 μm. DOX doxycycline, RA retinoic acid, ROS reactive-oxygen species, m marker chromosome fragments that could not be definitively identified.
    Lentiviral Vector, supplied by ABM Inc, used in various techniques. Bioz Stars score: 93/100, based on 144 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/ABM Inc
    Average 93 stars, based on 144 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    92
    Macrogen lentiviral vector
    Expression of MYCN in ATRX -mutant cells leads to ROS production, DNA damage, and replicative stress. a Bar plot (mean±SD) of ROS levels on Day 6 ± doxycycline. P value was calculated using two-tailed Student t test. b Immunoblots on Day 4 ± doxycycline. The experiment was repeated with the same results. c Immunofluorescent detection of γH2AX (red) and nuclei (blue) in SKNMM MYCN cells on Day 4 ± doxycycline. The experiment was repeated with the same results. d Spectral karyotype analysis (SKY) of SKNMM MYCN cells ± DOX on Day 8. Chromosomes are shown adjacent to the pseudo-colored representation. Arrows indicate translocations. The pie charts show the proportion of cells with DNA fragmentation ( n = 50). P value was calculated using Chi-square test. e , f Micrographs of single-cell electrophoresis of individual nuclei (dashed circles) and their COMET tail (arrows) ± doxycycline on Day 5. g Mean±SD of the COMET assay scoring. The number of analyzed cells are presented on the graph. h Photograph of cresyl violet-stained colonies from SKNMM MYCN cells ± doxycycline, with increasing concentrations of retinoic acid (RA). i Immunoblots of SKNMM MYCN cells ± doxycycline, with or without 5 μ m RA. The level of MYCN protein was reduced by 30% (0.7×) in the presence of RA. j ChromHMM and ChIP-seq for MYCN, H3K4me3, and H3K27me3 for the CUX2 promoter for a MYCN -amplified neuroblastoma (SJNBL012407_X1) xenograft and SKNMM MYCN cells in the presence or absence of doxycycline after 4 days in culture. The gene expression (FPKM) is indicated, and the dashed line indicates the start of transcription. k Line plot of SKNMM MYCN cells in the presence or absence of doxycycline after 4, 6, 8, and 10 days in culture with or without ectopic expression of CUX2 or the GFP control from <t>lentiviral</t> infection. Each point is the mean and standard deviation of triplicate experiments, and the asterisks indicate statistical significance ( P = 0.005, 0.001, and 0.008 at days 6, 8, and 10, respectively, two-tailed Student's t test). Scale bars e , f , 10 μm. DOX doxycycline, RA retinoic acid, ROS reactive-oxygen species, m marker chromosome fragments that could not be definitively identified.
    Lentiviral Vector, supplied by Macrogen, used in various techniques. Bioz Stars score: 92/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector/product/Macrogen
    Average 92 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    91
    Genechem lentivirus vector the lentiviral vector
    Expression of MYCN in ATRX -mutant cells leads to ROS production, DNA damage, and replicative stress. a Bar plot (mean±SD) of ROS levels on Day 6 ± doxycycline. P value was calculated using two-tailed Student t test. b Immunoblots on Day 4 ± doxycycline. The experiment was repeated with the same results. c Immunofluorescent detection of γH2AX (red) and nuclei (blue) in SKNMM MYCN cells on Day 4 ± doxycycline. The experiment was repeated with the same results. d Spectral karyotype analysis (SKY) of SKNMM MYCN cells ± DOX on Day 8. Chromosomes are shown adjacent to the pseudo-colored representation. Arrows indicate translocations. The pie charts show the proportion of cells with DNA fragmentation ( n = 50). P value was calculated using Chi-square test. e , f Micrographs of single-cell electrophoresis of individual nuclei (dashed circles) and their COMET tail (arrows) ± doxycycline on Day 5. g Mean±SD of the COMET assay scoring. The number of analyzed cells are presented on the graph. h Photograph of cresyl violet-stained colonies from SKNMM MYCN cells ± doxycycline, with increasing concentrations of retinoic acid (RA). i Immunoblots of SKNMM MYCN cells ± doxycycline, with or without 5 μ m RA. The level of MYCN protein was reduced by 30% (0.7×) in the presence of RA. j ChromHMM and ChIP-seq for MYCN, H3K4me3, and H3K27me3 for the CUX2 promoter for a MYCN -amplified neuroblastoma (SJNBL012407_X1) xenograft and SKNMM MYCN cells in the presence or absence of doxycycline after 4 days in culture. The gene expression (FPKM) is indicated, and the dashed line indicates the start of transcription. k Line plot of SKNMM MYCN cells in the presence or absence of doxycycline after 4, 6, 8, and 10 days in culture with or without ectopic expression of CUX2 or the GFP control from <t>lentiviral</t> infection. Each point is the mean and standard deviation of triplicate experiments, and the asterisks indicate statistical significance ( P = 0.005, 0.001, and 0.008 at days 6, 8, and 10, respectively, two-tailed Student's t test). Scale bars e , f , 10 μm. DOX doxycycline, RA retinoic acid, ROS reactive-oxygen species, m marker chromosome fragments that could not be definitively identified.
    Lentivirus Vector The Lentiviral Vector, supplied by Genechem, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentivirus vector the lentiviral vector/product/Genechem
    Average 91 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    lentivirus vector the lentiviral vector - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    93
    TaKaRa plvsin lentiviral vector
    Expression of MYCN in ATRX -mutant cells leads to ROS production, DNA damage, and replicative stress. a Bar plot (mean±SD) of ROS levels on Day 6 ± doxycycline. P value was calculated using two-tailed Student t test. b Immunoblots on Day 4 ± doxycycline. The experiment was repeated with the same results. c Immunofluorescent detection of γH2AX (red) and nuclei (blue) in SKNMM MYCN cells on Day 4 ± doxycycline. The experiment was repeated with the same results. d Spectral karyotype analysis (SKY) of SKNMM MYCN cells ± DOX on Day 8. Chromosomes are shown adjacent to the pseudo-colored representation. Arrows indicate translocations. The pie charts show the proportion of cells with DNA fragmentation ( n = 50). P value was calculated using Chi-square test. e , f Micrographs of single-cell electrophoresis of individual nuclei (dashed circles) and their COMET tail (arrows) ± doxycycline on Day 5. g Mean±SD of the COMET assay scoring. The number of analyzed cells are presented on the graph. h Photograph of cresyl violet-stained colonies from SKNMM MYCN cells ± doxycycline, with increasing concentrations of retinoic acid (RA). i Immunoblots of SKNMM MYCN cells ± doxycycline, with or without 5 μ m RA. The level of MYCN protein was reduced by 30% (0.7×) in the presence of RA. j ChromHMM and ChIP-seq for MYCN, H3K4me3, and H3K27me3 for the CUX2 promoter for a MYCN -amplified neuroblastoma (SJNBL012407_X1) xenograft and SKNMM MYCN cells in the presence or absence of doxycycline after 4 days in culture. The gene expression (FPKM) is indicated, and the dashed line indicates the start of transcription. k Line plot of SKNMM MYCN cells in the presence or absence of doxycycline after 4, 6, 8, and 10 days in culture with or without ectopic expression of CUX2 or the GFP control from <t>lentiviral</t> infection. Each point is the mean and standard deviation of triplicate experiments, and the asterisks indicate statistical significance ( P = 0.005, 0.001, and 0.008 at days 6, 8, and 10, respectively, two-tailed Student's t test). Scale bars e , f , 10 μm. DOX doxycycline, RA retinoic acid, ROS reactive-oxygen species, m marker chromosome fragments that could not be definitively identified.
    Plvsin Lentiviral Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plvsin lentiviral vector/product/TaKaRa
    Average 93 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    plvsin lentiviral vector - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    89
    Millipore lentiviral vector plko
    Expression of MYCN in ATRX -mutant cells leads to ROS production, DNA damage, and replicative stress. a Bar plot (mean±SD) of ROS levels on Day 6 ± doxycycline. P value was calculated using two-tailed Student t test. b Immunoblots on Day 4 ± doxycycline. The experiment was repeated with the same results. c Immunofluorescent detection of γH2AX (red) and nuclei (blue) in SKNMM MYCN cells on Day 4 ± doxycycline. The experiment was repeated with the same results. d Spectral karyotype analysis (SKY) of SKNMM MYCN cells ± DOX on Day 8. Chromosomes are shown adjacent to the pseudo-colored representation. Arrows indicate translocations. The pie charts show the proportion of cells with DNA fragmentation ( n = 50). P value was calculated using Chi-square test. e , f Micrographs of single-cell electrophoresis of individual nuclei (dashed circles) and their COMET tail (arrows) ± doxycycline on Day 5. g Mean±SD of the COMET assay scoring. The number of analyzed cells are presented on the graph. h Photograph of cresyl violet-stained colonies from SKNMM MYCN cells ± doxycycline, with increasing concentrations of retinoic acid (RA). i Immunoblots of SKNMM MYCN cells ± doxycycline, with or without 5 μ m RA. The level of MYCN protein was reduced by 30% (0.7×) in the presence of RA. j ChromHMM and ChIP-seq for MYCN, H3K4me3, and H3K27me3 for the CUX2 promoter for a MYCN -amplified neuroblastoma (SJNBL012407_X1) xenograft and SKNMM MYCN cells in the presence or absence of doxycycline after 4 days in culture. The gene expression (FPKM) is indicated, and the dashed line indicates the start of transcription. k Line plot of SKNMM MYCN cells in the presence or absence of doxycycline after 4, 6, 8, and 10 days in culture with or without ectopic expression of CUX2 or the GFP control from <t>lentiviral</t> infection. Each point is the mean and standard deviation of triplicate experiments, and the asterisks indicate statistical significance ( P = 0.005, 0.001, and 0.008 at days 6, 8, and 10, respectively, two-tailed Student's t test). Scale bars e , f , 10 μm. DOX doxycycline, RA retinoic acid, ROS reactive-oxygen species, m marker chromosome fragments that could not be definitively identified.
    Lentiviral Vector Plko, supplied by Millipore, used in various techniques. Bioz Stars score: 89/100, based on 92 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector plko/product/Millipore
    Average 89 stars, based on 92 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector plko - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    90
    Addgene inc lentiviral vector pwpxld
    Expression of MYCN in ATRX -mutant cells leads to ROS production, DNA damage, and replicative stress. a Bar plot (mean±SD) of ROS levels on Day 6 ± doxycycline. P value was calculated using two-tailed Student t test. b Immunoblots on Day 4 ± doxycycline. The experiment was repeated with the same results. c Immunofluorescent detection of γH2AX (red) and nuclei (blue) in SKNMM MYCN cells on Day 4 ± doxycycline. The experiment was repeated with the same results. d Spectral karyotype analysis (SKY) of SKNMM MYCN cells ± DOX on Day 8. Chromosomes are shown adjacent to the pseudo-colored representation. Arrows indicate translocations. The pie charts show the proportion of cells with DNA fragmentation ( n = 50). P value was calculated using Chi-square test. e , f Micrographs of single-cell electrophoresis of individual nuclei (dashed circles) and their COMET tail (arrows) ± doxycycline on Day 5. g Mean±SD of the COMET assay scoring. The number of analyzed cells are presented on the graph. h Photograph of cresyl violet-stained colonies from SKNMM MYCN cells ± doxycycline, with increasing concentrations of retinoic acid (RA). i Immunoblots of SKNMM MYCN cells ± doxycycline, with or without 5 μ m RA. The level of MYCN protein was reduced by 30% (0.7×) in the presence of RA. j ChromHMM and ChIP-seq for MYCN, H3K4me3, and H3K27me3 for the CUX2 promoter for a MYCN -amplified neuroblastoma (SJNBL012407_X1) xenograft and SKNMM MYCN cells in the presence or absence of doxycycline after 4 days in culture. The gene expression (FPKM) is indicated, and the dashed line indicates the start of transcription. k Line plot of SKNMM MYCN cells in the presence or absence of doxycycline after 4, 6, 8, and 10 days in culture with or without ectopic expression of CUX2 or the GFP control from <t>lentiviral</t> infection. Each point is the mean and standard deviation of triplicate experiments, and the asterisks indicate statistical significance ( P = 0.005, 0.001, and 0.008 at days 6, 8, and 10, respectively, two-tailed Student's t test). Scale bars e , f , 10 μm. DOX doxycycline, RA retinoic acid, ROS reactive-oxygen species, m marker chromosome fragments that could not be definitively identified.
    Lentiviral Vector Pwpxld, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector pwpxld/product/Addgene inc
    Average 90 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector pwpxld - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    88
    Thermo Fisher plko lentiviral vector
    Expression of MYCN in ATRX -mutant cells leads to ROS production, DNA damage, and replicative stress. a Bar plot (mean±SD) of ROS levels on Day 6 ± doxycycline. P value was calculated using two-tailed Student t test. b Immunoblots on Day 4 ± doxycycline. The experiment was repeated with the same results. c Immunofluorescent detection of γH2AX (red) and nuclei (blue) in SKNMM MYCN cells on Day 4 ± doxycycline. The experiment was repeated with the same results. d Spectral karyotype analysis (SKY) of SKNMM MYCN cells ± DOX on Day 8. Chromosomes are shown adjacent to the pseudo-colored representation. Arrows indicate translocations. The pie charts show the proportion of cells with DNA fragmentation ( n = 50). P value was calculated using Chi-square test. e , f Micrographs of single-cell electrophoresis of individual nuclei (dashed circles) and their COMET tail (arrows) ± doxycycline on Day 5. g Mean±SD of the COMET assay scoring. The number of analyzed cells are presented on the graph. h Photograph of cresyl violet-stained colonies from SKNMM MYCN cells ± doxycycline, with increasing concentrations of retinoic acid (RA). i Immunoblots of SKNMM MYCN cells ± doxycycline, with or without 5 μ m RA. The level of MYCN protein was reduced by 30% (0.7×) in the presence of RA. j ChromHMM and ChIP-seq for MYCN, H3K4me3, and H3K27me3 for the CUX2 promoter for a MYCN -amplified neuroblastoma (SJNBL012407_X1) xenograft and SKNMM MYCN cells in the presence or absence of doxycycline after 4 days in culture. The gene expression (FPKM) is indicated, and the dashed line indicates the start of transcription. k Line plot of SKNMM MYCN cells in the presence or absence of doxycycline after 4, 6, 8, and 10 days in culture with or without ectopic expression of CUX2 or the GFP control from <t>lentiviral</t> infection. Each point is the mean and standard deviation of triplicate experiments, and the asterisks indicate statistical significance ( P = 0.005, 0.001, and 0.008 at days 6, 8, and 10, respectively, two-tailed Student's t test). Scale bars e , f , 10 μm. DOX doxycycline, RA retinoic acid, ROS reactive-oxygen species, m marker chromosome fragments that could not be definitively identified.
    Plko Lentiviral Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 55 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko lentiviral vector/product/Thermo Fisher
    Average 88 stars, based on 55 article reviews
    Price from $9.99 to $1999.99
    plko lentiviral vector - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    89
    Addgene inc plvthm lentiviral vector
    Expression of MYCN in ATRX -mutant cells leads to ROS production, DNA damage, and replicative stress. a Bar plot (mean±SD) of ROS levels on Day 6 ± doxycycline. P value was calculated using two-tailed Student t test. b Immunoblots on Day 4 ± doxycycline. The experiment was repeated with the same results. c Immunofluorescent detection of γH2AX (red) and nuclei (blue) in SKNMM MYCN cells on Day 4 ± doxycycline. The experiment was repeated with the same results. d Spectral karyotype analysis (SKY) of SKNMM MYCN cells ± DOX on Day 8. Chromosomes are shown adjacent to the pseudo-colored representation. Arrows indicate translocations. The pie charts show the proportion of cells with DNA fragmentation ( n = 50). P value was calculated using Chi-square test. e , f Micrographs of single-cell electrophoresis of individual nuclei (dashed circles) and their COMET tail (arrows) ± doxycycline on Day 5. g Mean±SD of the COMET assay scoring. The number of analyzed cells are presented on the graph. h Photograph of cresyl violet-stained colonies from SKNMM MYCN cells ± doxycycline, with increasing concentrations of retinoic acid (RA). i Immunoblots of SKNMM MYCN cells ± doxycycline, with or without 5 μ m RA. The level of MYCN protein was reduced by 30% (0.7×) in the presence of RA. j ChromHMM and ChIP-seq for MYCN, H3K4me3, and H3K27me3 for the CUX2 promoter for a MYCN -amplified neuroblastoma (SJNBL012407_X1) xenograft and SKNMM MYCN cells in the presence or absence of doxycycline after 4 days in culture. The gene expression (FPKM) is indicated, and the dashed line indicates the start of transcription. k Line plot of SKNMM MYCN cells in the presence or absence of doxycycline after 4, 6, 8, and 10 days in culture with or without ectopic expression of CUX2 or the GFP control from <t>lentiviral</t> infection. Each point is the mean and standard deviation of triplicate experiments, and the asterisks indicate statistical significance ( P = 0.005, 0.001, and 0.008 at days 6, 8, and 10, respectively, two-tailed Student's t test). Scale bars e , f , 10 μm. DOX doxycycline, RA retinoic acid, ROS reactive-oxygen species, m marker chromosome fragments that could not be definitively identified.
    Plvthm Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 89/100, based on 99 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plvthm lentiviral vector/product/Addgene inc
    Average 89 stars, based on 99 article reviews
    Price from $9.99 to $1999.99
    plvthm lentiviral vector - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    Image Search Results


    Lentiviral introduction of SV40 large T antigen and human telomerase reverse transcriptase ( hTERT ) genes significantly elongated the life span of the conjunctival epithelial cells from a gelatinous drop-like corneal dystrophy (GDLD) patient. Top, Plasmid

    Journal: Transactions of the American Ophthalmological Society

    Article Title: Establishment of a Human Conjunctival Epithelial Cell Line Lacking the Functional Tacstd2 Gene (An American Ophthalmological Society Thesis)

    doi:

    Figure Lengend Snippet: Lentiviral introduction of SV40 large T antigen and human telomerase reverse transcriptase ( hTERT ) genes significantly elongated the life span of the conjunctival epithelial cells from a gelatinous drop-like corneal dystrophy (GDLD) patient. Top, Plasmid

    Article Snippet: The amplified products were cloned into a commercial lentiviral vector (pLenti6.3/V5-TOPO; Life Technologies) and were validated by sequencing analysis using a primer pair (CMV_seq_F; 5′-CGC AAA TGG GCG GTA GGC GTG-3′, V5_seq_R; 5′-ACC GAG GAG AGG GTT AGG GAT-3′).

    Techniques: Plasmid Preparation

    Lactate influx in C3H10T½ cells is attenuated by stable knockdown of MCT1. MCT1 was stably knocked down in C3H10T½ cells by lentiviral shRNA transduction as described in Materials and Methods. ( a ) Relative MCT1 protein levels in C3H10T½ cells expressing empty control plasmid (pLKO.1) or MCT1 shRNA (KD), at day 0 (undifferentiated) and day 8 after differentiation induction. β-actin is shown as loading control. Membranes were cut horizontally before blotting and edges slightly cropped for presentation. The bar chart shows mean data from 3 independent experiments, normalized to control values at day 0 and day 8. ( b ) Tracer measurements of lactate influx were carried out as described in the legend to Fig. 4 , and net influx calculated as nmol lactate ·well −1 before ( b ) and after ( c ) differentiation. The figure shows means with SEM error bars of 3 independent biological replicates for pLKO.1 (black symbols) and MCT1 KD (gray symbols) cells. *, **p

    Journal: Scientific Reports

    Article Title: MCT1 and MCT4 Expression and Lactate Flux Activity Increase During White and Brown Adipogenesis and Impact Adipocyte Metabolism

    doi: 10.1038/s41598-017-13298-z

    Figure Lengend Snippet: Lactate influx in C3H10T½ cells is attenuated by stable knockdown of MCT1. MCT1 was stably knocked down in C3H10T½ cells by lentiviral shRNA transduction as described in Materials and Methods. ( a ) Relative MCT1 protein levels in C3H10T½ cells expressing empty control plasmid (pLKO.1) or MCT1 shRNA (KD), at day 0 (undifferentiated) and day 8 after differentiation induction. β-actin is shown as loading control. Membranes were cut horizontally before blotting and edges slightly cropped for presentation. The bar chart shows mean data from 3 independent experiments, normalized to control values at day 0 and day 8. ( b ) Tracer measurements of lactate influx were carried out as described in the legend to Fig. 4 , and net influx calculated as nmol lactate ·well −1 before ( b ) and after ( c ) differentiation. The figure shows means with SEM error bars of 3 independent biological replicates for pLKO.1 (black symbols) and MCT1 KD (gray symbols) cells. *, **p

    Article Snippet: Next, 2.75 μg lentiviral vector (pLKO-siMCT1, pLKO.1 empty vector, Sigma-Aldrich), 0.75 μg of the two packaging plasmids (pRSV-Rev, pMDLg/pRRE, Addgene plasmids # 12253, 12251) and 0.75 μg envelope plasmid (pMD2.G, Addgene plasmid # 12259) (kindly provided by Dr. Didier Trono), were mixed with 12.5 μL FuGENE and DMEM to a total volume of 250 μL, incubated 15 min at RT and added to the cells.

    Techniques: Stable Transfection, shRNA, Transduction, Expressing, Plasmid Preparation

    Endothelial cell association with -BD11 cells in vivo required matrix Galectin-1 expression. A: RT-PCR analysis of LGALS1 gene expression in pooled populations of -BD11 cells transfected with shRNA lentiviral vectors targeting a scrambled sequence (Control shRNA) or Galectin-1 (LGALS1 shRNA). B–J: Histomorphology of -BD11 transfectant tumour sections immunohistochemically stained (brown) for B: Galectin-1 in cells transfected with control shRNA or C: Galectin-1 in cells transfected with LGALS1 shRNA. D: CD34 immunohistochemical staining targeted murine endothelial cells in a parallel serial section equivalent to C. E: Whole tumour section of -BD11 cells transfected with LGALS1 shRNA with neighbouring subregion immunohistochemically stained for CD34 (arrow). F–H: Higher power magnification of arrow region in E, stained for F: CD34, G: Human-specific CD99, H: Galectin-1. Higher power magnification of Galectin-1 staining in regions in H that were I: CD99+/CD34− and J: CD99+/CD34+. Scale bar, 100 µm.

    Journal: PLoS ONE

    Article Title: Decellularized Matrix from Tumorigenic Human Mesenchymal Stem Cells Promotes Neovascularization with Galectin-1 Dependent Endothelial Interaction

    doi: 10.1371/journal.pone.0021888

    Figure Lengend Snippet: Endothelial cell association with -BD11 cells in vivo required matrix Galectin-1 expression. A: RT-PCR analysis of LGALS1 gene expression in pooled populations of -BD11 cells transfected with shRNA lentiviral vectors targeting a scrambled sequence (Control shRNA) or Galectin-1 (LGALS1 shRNA). B–J: Histomorphology of -BD11 transfectant tumour sections immunohistochemically stained (brown) for B: Galectin-1 in cells transfected with control shRNA or C: Galectin-1 in cells transfected with LGALS1 shRNA. D: CD34 immunohistochemical staining targeted murine endothelial cells in a parallel serial section equivalent to C. E: Whole tumour section of -BD11 cells transfected with LGALS1 shRNA with neighbouring subregion immunohistochemically stained for CD34 (arrow). F–H: Higher power magnification of arrow region in E, stained for F: CD34, G: Human-specific CD99, H: Galectin-1. Higher power magnification of Galectin-1 staining in regions in H that were I: CD99+/CD34− and J: CD99+/CD34+. Scale bar, 100 µm.

    Article Snippet: Cloning shRNA into Lentiviral Vector: Oligo Sequence The following oligos were cloned into the pSicoR PGK puro vector (PMID: 15240889, Addgene): Non-targeting/scrambled, 5′TGAAGGCCAGACGCGAATTATTCAAGAGATAATTCGCGTCTGGCCTTCTTTTTTC-3′ sense, 5′TCGAGAAAAAAGAAGGCCAGACGCGAATTATCTCTTGAATAATTCGCGTCTGGCCTTCA-3′ antisense; target sequence GAAGGCCAGACGCGAATTA .

    Techniques: In Vivo, Expressing, Reverse Transcription Polymerase Chain Reaction, Transfection, shRNA, Sequencing, Staining, Immunohistochemistry

    (A) Detection of EWS-FLI1 fusion gene expression in RD-ES and A673 cell lines using reverse transcription-polymerase chain reaction. (B) Expression levels of the fusion gene were downregulated in RD-ES and A-673 cells following siRNA transfection. (C) miR-34b expression in A673 cells was downregulated following siRNA transfection. (D) miR-34b expression in RD-ES cells was downregulated following siRNA transfection. (E) miR-34b expression was upregulated by the precursor of miR-34b in RD-ES and A-673 cells. (F) miR-34b expression was downregulated by the inhibitor of miR-34b in RD-ES and A-673 cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; NS, cells transfected with non-targeting siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA targeting the EWS-FLI1 fusion gene; Micro-up, NC(−) cell lines treated with precursor miR-34b sequences; Micro-down, NC(+) cell lines treated with complementary sequences of miR-34b. **P

    Journal: Molecular Medicine Reports

    Article Title: MicroRNA-34b promotes proliferation, migration and invasion of Ewing's sarcoma cells by downregulating Notch1

    doi: 10.3892/mmr.2018.9365

    Figure Lengend Snippet: (A) Detection of EWS-FLI1 fusion gene expression in RD-ES and A673 cell lines using reverse transcription-polymerase chain reaction. (B) Expression levels of the fusion gene were downregulated in RD-ES and A-673 cells following siRNA transfection. (C) miR-34b expression in A673 cells was downregulated following siRNA transfection. (D) miR-34b expression in RD-ES cells was downregulated following siRNA transfection. (E) miR-34b expression was upregulated by the precursor of miR-34b in RD-ES and A-673 cells. (F) miR-34b expression was downregulated by the inhibitor of miR-34b in RD-ES and A-673 cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; NS, cells transfected with non-targeting siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA targeting the EWS-FLI1 fusion gene; Micro-up, NC(−) cell lines treated with precursor miR-34b sequences; Micro-down, NC(+) cell lines treated with complementary sequences of miR-34b. **P

    Article Snippet: The lentiviral vector with complementary sequences of miR-34b was infected into normal cells to downregulate miR-34b expression, whereas the lentiviral vector with precursor sequences of miR-34b was infected into siRNA-transfected cells to upregulate miR-34b expression.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Transfection, Plasmid Preparation

    Protein expression levels of Notch1, Hes-1 and Hey-1 demonstrated the negative association with EWS-FLI1 and miR-34b in RD-ES and A673 cells. (A) The protein expression levels of Notch-1, Hes-1 and Hey-1 were increased following EWS-FLI1 repression in RD-ES cells. (B) The expression of Notch-1, Hes-1 and Hey-1 were decreased after miR-34b was upregulated in RD-ES cells in which EWS-FLI1 is repressed. (C) The expression of Notch-1, Hes-1 and Hey-1 were increased after miR-34b was downregulated in RD-ES cells. (D) The protein expression levels of Notch-1, Hes-1 and Hey-1 were increased following EWS-FLI1 repression in A673 cells. (E) The expression of Notch-1, Hes-1 and Hey-1 were decreased following miR-34b was upregulated in A673 cells in which EWS-FLI1 is repressed. (F) The expression of Notch-1, Hes-1 and Hey-1 were increased after miR-34b was downregulated in A673 cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; NS, cells transfected with non-targeting siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; MU, cell lines treated with precursor miR-34b sequences; MD, cell lines treated with complementary sequences of miR-34b. EWS, Ewing's sarcoma breakpoint region 1; FLI1, friend leukemia integration 1 transcription factor; Hes1, Hes family BHLH transcription factor 1; Hey1, Hes-related family BHLH transcription factor with YRPW motif 1; miR, microRNA; siRNA, small interfering RNA.

    Journal: Molecular Medicine Reports

    Article Title: MicroRNA-34b promotes proliferation, migration and invasion of Ewing's sarcoma cells by downregulating Notch1

    doi: 10.3892/mmr.2018.9365

    Figure Lengend Snippet: Protein expression levels of Notch1, Hes-1 and Hey-1 demonstrated the negative association with EWS-FLI1 and miR-34b in RD-ES and A673 cells. (A) The protein expression levels of Notch-1, Hes-1 and Hey-1 were increased following EWS-FLI1 repression in RD-ES cells. (B) The expression of Notch-1, Hes-1 and Hey-1 were decreased after miR-34b was upregulated in RD-ES cells in which EWS-FLI1 is repressed. (C) The expression of Notch-1, Hes-1 and Hey-1 were increased after miR-34b was downregulated in RD-ES cells. (D) The protein expression levels of Notch-1, Hes-1 and Hey-1 were increased following EWS-FLI1 repression in A673 cells. (E) The expression of Notch-1, Hes-1 and Hey-1 were decreased following miR-34b was upregulated in A673 cells in which EWS-FLI1 is repressed. (F) The expression of Notch-1, Hes-1 and Hey-1 were increased after miR-34b was downregulated in A673 cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; NS, cells transfected with non-targeting siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; MU, cell lines treated with precursor miR-34b sequences; MD, cell lines treated with complementary sequences of miR-34b. EWS, Ewing's sarcoma breakpoint region 1; FLI1, friend leukemia integration 1 transcription factor; Hes1, Hes family BHLH transcription factor 1; Hey1, Hes-related family BHLH transcription factor with YRPW motif 1; miR, microRNA; siRNA, small interfering RNA.

    Article Snippet: The lentiviral vector with complementary sequences of miR-34b was infected into normal cells to downregulate miR-34b expression, whereas the lentiviral vector with precursor sequences of miR-34b was infected into siRNA-transfected cells to upregulate miR-34b expression.

    Techniques: Expressing, Plasmid Preparation, Transfection, Small Interfering RNA

    Effects of miR-34b on the migration and invasion of RD-ES cells in vitro . Magnification, ×200 (A) Migratory and (B) invasive ability of normal RD-ES cells was inhibited when miR-34b expression was downregulated (top panel). However, miR-34b overexpression improved the migratory and invasive ability of siRNA-transfected-RD-ES cells (bottom panel). Quantification of (C) EWS-FLI1 (−) and (D) EWS-FLI1 (+) cells. The number of cells that passed through the membrane was counted. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; Micro-up, cell lines treated with precursor miR-34b sequences; Micro-down, cell lines treated with complementary sequences of miR-34b; EWS-FLI1 (+), cells that were not transfected with EWS-FLI1 fusion gene siRNA; EWS-FLI1 (−), cells that were transfected with EWS-FLI1 fusion gene siRNA against EWS-FLI1 gene. **P

    Journal: Molecular Medicine Reports

    Article Title: MicroRNA-34b promotes proliferation, migration and invasion of Ewing's sarcoma cells by downregulating Notch1

    doi: 10.3892/mmr.2018.9365

    Figure Lengend Snippet: Effects of miR-34b on the migration and invasion of RD-ES cells in vitro . Magnification, ×200 (A) Migratory and (B) invasive ability of normal RD-ES cells was inhibited when miR-34b expression was downregulated (top panel). However, miR-34b overexpression improved the migratory and invasive ability of siRNA-transfected-RD-ES cells (bottom panel). Quantification of (C) EWS-FLI1 (−) and (D) EWS-FLI1 (+) cells. The number of cells that passed through the membrane was counted. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; Micro-up, cell lines treated with precursor miR-34b sequences; Micro-down, cell lines treated with complementary sequences of miR-34b; EWS-FLI1 (+), cells that were not transfected with EWS-FLI1 fusion gene siRNA; EWS-FLI1 (−), cells that were transfected with EWS-FLI1 fusion gene siRNA against EWS-FLI1 gene. **P

    Article Snippet: The lentiviral vector with complementary sequences of miR-34b was infected into normal cells to downregulate miR-34b expression, whereas the lentiviral vector with precursor sequences of miR-34b was infected into siRNA-transfected cells to upregulate miR-34b expression.

    Techniques: Migration, In Vitro, Expressing, Over Expression, Transfection, Plasmid Preparation

    Proliferation and adhesion of RD-ES and A673 cells were detected using an MTT assay. (A) When miR-34b expression was upregulated, the siRNA-transfected RD-ES cells exhibited significantly increased proliferative capacity compared with cells in the control groups. (B) When miR-34b expression was upregulated, the siRNA-transfected A673 cells exhibited significantly increased proliferative capacity. (C) Proliferative ability of normal RD-ES cells was significantly inhibited when miR-34b expression was downregulated. (D) Proliferative of normal A673 cells was significantly inhibited when miR-34b expression was downregulated. (E) Overexpression of miR-34b significantly improved the adhesion of RD-ES cells, but had little effect on A673 cells. (F) Knockdown of miR-34b reduced the adhesive ability of RD-ES cells, but had little effect on A673 cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; Micro-up, cell lines treated with precursor miR-34b sequences; Micro-down, cell lines treated with complementary sequences of miR-34b. *P

    Journal: Molecular Medicine Reports

    Article Title: MicroRNA-34b promotes proliferation, migration and invasion of Ewing's sarcoma cells by downregulating Notch1

    doi: 10.3892/mmr.2018.9365

    Figure Lengend Snippet: Proliferation and adhesion of RD-ES and A673 cells were detected using an MTT assay. (A) When miR-34b expression was upregulated, the siRNA-transfected RD-ES cells exhibited significantly increased proliferative capacity compared with cells in the control groups. (B) When miR-34b expression was upregulated, the siRNA-transfected A673 cells exhibited significantly increased proliferative capacity. (C) Proliferative ability of normal RD-ES cells was significantly inhibited when miR-34b expression was downregulated. (D) Proliferative of normal A673 cells was significantly inhibited when miR-34b expression was downregulated. (E) Overexpression of miR-34b significantly improved the adhesion of RD-ES cells, but had little effect on A673 cells. (F) Knockdown of miR-34b reduced the adhesive ability of RD-ES cells, but had little effect on A673 cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; Micro-up, cell lines treated with precursor miR-34b sequences; Micro-down, cell lines treated with complementary sequences of miR-34b. *P

    Article Snippet: The lentiviral vector with complementary sequences of miR-34b was infected into normal cells to downregulate miR-34b expression, whereas the lentiviral vector with precursor sequences of miR-34b was infected into siRNA-transfected cells to upregulate miR-34b expression.

    Techniques: MTT Assay, Expressing, Transfection, Over Expression, Plasmid Preparation

    mRNA expression levels of Notch1, Hes-1 and Hey-1 demonstrated the negative association with that of EWS-FLI1 and miR-34b in RD-ES and A673 cells. (A) mRNA expression levels of Notch-1, Hes-1 and Hey-1 were increased when the expression of the EWS-FLI1 fusion gene was downregulated by siRNA in RD-ES and A673 cells. (B) Conversely, mRNA expression levels were inhibited after the siRNA-transfected cells were treated with miR-34b precursor sequences. (C) Notch-1, Hes-1 and Hey-1 mRNA expression was increased after miR-34b was downregulated in normal cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; NS, cells transfected with non-targeting siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; MU, cell lines treated with precursor miR-34b sequences; MD, cell lines treated with complementary sequences of miR-34b. **P

    Journal: Molecular Medicine Reports

    Article Title: MicroRNA-34b promotes proliferation, migration and invasion of Ewing's sarcoma cells by downregulating Notch1

    doi: 10.3892/mmr.2018.9365

    Figure Lengend Snippet: mRNA expression levels of Notch1, Hes-1 and Hey-1 demonstrated the negative association with that of EWS-FLI1 and miR-34b in RD-ES and A673 cells. (A) mRNA expression levels of Notch-1, Hes-1 and Hey-1 were increased when the expression of the EWS-FLI1 fusion gene was downregulated by siRNA in RD-ES and A673 cells. (B) Conversely, mRNA expression levels were inhibited after the siRNA-transfected cells were treated with miR-34b precursor sequences. (C) Notch-1, Hes-1 and Hey-1 mRNA expression was increased after miR-34b was downregulated in normal cells. BC, cell lines that were treated with lentiviral vector alone; NC(+), normal cell lines that were not transfected with siRNA; NS, cells transfected with non-targeting siRNA; siRNA, siRNA-transfected cells; NC(−), normal cell lines that were transfected with specific siRNA; MU, cell lines treated with precursor miR-34b sequences; MD, cell lines treated with complementary sequences of miR-34b. **P

    Article Snippet: The lentiviral vector with complementary sequences of miR-34b was infected into normal cells to downregulate miR-34b expression, whereas the lentiviral vector with precursor sequences of miR-34b was infected into siRNA-transfected cells to upregulate miR-34b expression.

    Techniques: Expressing, Transfection, Plasmid Preparation

    Levels of FasL in NP cells culture supernatants. FasL expression in normal NP cells supernatant is higher than that in the degenerate NP cells supernatant. After transfection of lentiviral vector encoding FasL, the FasL production of NP cells increases. Transfection with lentiviral vector encoded scrambled sequence shows low FasL expression. Data are representative of three experiments; error bars represent SEM. * p

    Journal: International Journal of Clinical and Experimental Pathology

    Article Title: FasL on human nucleus pulposus cells prevents angiogenesis in the disc by inducing Fas-mediated apoptosis of vascular endothelial cells

    doi:

    Figure Lengend Snippet: Levels of FasL in NP cells culture supernatants. FasL expression in normal NP cells supernatant is higher than that in the degenerate NP cells supernatant. After transfection of lentiviral vector encoding FasL, the FasL production of NP cells increases. Transfection with lentiviral vector encoded scrambled sequence shows low FasL expression. Data are representative of three experiments; error bars represent SEM. * p

    Article Snippet: The lentiviral vector (Genechem, Shanghai, China) encoding FasL labeled with green fluorescent protein (GFP) was used for FasL up-regulation.

    Techniques: Expressing, Transfection, Plasmid Preparation, Sequencing

    Transgene expression after lentiviral transduction of hMSCs. Notes: ( A ) hMSCs were transduced with lentivirus-VEGF 165 -ephrin A1-PE38KDEL at 100 MOI and observed under fluorescence microscopy 72 hours later. GFP expression was confirmed in transduced hMSCs, and the morphology of hMSCs did not alter compared to control. ( B ) Confirmation of VEGF 165 -ephrin A1-PE38KDEL transgene expression using RT-PCR. ( C ) Assessment of the mean concentrations of secreted VEGF 165 -ephrin A1-PE38KDEL in the supernatants of transduced hMSCs with ELISA at different time points. Error bars represent triplicate experiments. Abbreviations: hMSCs, human mesenchymal stem cells; PE, Pseudomonas exotoxin; MOI, multiplicity of infection; RT-PCR, reverse-transcription polymerase chain reaction; ELISA, enzyme-linked immunosorbent assay; mRNA, messenger ribonucleic acid; CON, control group; OE, over expression of VEGF group; UT, untreated group; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; VEP, vascular endothelial growth factor.

    Journal: Drug Design, Development and Therapy

    Article Title: A novel bispecific immunotoxin delivered by human bone marrow-derived mesenchymal stem cells to target blood vessels and vasculogenic mimicry of malignant gliomas

    doi: 10.2147/DDDT.S79475

    Figure Lengend Snippet: Transgene expression after lentiviral transduction of hMSCs. Notes: ( A ) hMSCs were transduced with lentivirus-VEGF 165 -ephrin A1-PE38KDEL at 100 MOI and observed under fluorescence microscopy 72 hours later. GFP expression was confirmed in transduced hMSCs, and the morphology of hMSCs did not alter compared to control. ( B ) Confirmation of VEGF 165 -ephrin A1-PE38KDEL transgene expression using RT-PCR. ( C ) Assessment of the mean concentrations of secreted VEGF 165 -ephrin A1-PE38KDEL in the supernatants of transduced hMSCs with ELISA at different time points. Error bars represent triplicate experiments. Abbreviations: hMSCs, human mesenchymal stem cells; PE, Pseudomonas exotoxin; MOI, multiplicity of infection; RT-PCR, reverse-transcription polymerase chain reaction; ELISA, enzyme-linked immunosorbent assay; mRNA, messenger ribonucleic acid; CON, control group; OE, over expression of VEGF group; UT, untreated group; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; VEP, vascular endothelial growth factor.

    Article Snippet: Lentiviral vectors and ex vivo gene transduction Lentivirus was packaged in 293 cells using the Lentiviral Vector System following the manufacturer’s protocol (GeneChem).

    Techniques: Expressing, Transduction, Fluorescence, Microscopy, Reverse Transcription Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay, Infection, Over Expression

    SUMOylation of TARBP2 controls miRNA/siRNA efficiency. ( a , b ) SUMOylation of TARBP2 is required for efficient RNA-induced gene silencing by recruiting more Ago2. A549 luc cell lines stably expressing pri-miRNA21 and Flag-TARBP2-WT or -K52R ( a , named as miR21-WT or miR21-K52R, respectively), or pri-miR130b and Flag-TARBP2-WT or -K52R ( b , named as miR130b-WT and miR130b-K52R, respectively) were generated by the lentiviral system. Cell lysates were used for IP with anti-Flag antibody and then detected with anti-Ago2 antibody. Cell lysates were used for immunoblotting with anti-Ago2, -GAPDH, -Flag and -PTEN ( a ) or -ZEB1 ( b ) antibodies. For full scans of western blots, see Supplementary Fig. 8 . ( c ) The SUMO-site mutation K52R of TARBP2 dominant-negatively abolishes inhibition of cell migration mediated by miR130b-ZEB1. Cell motilities of stable A549 luc cell lines including Control, miR130b-con, miR130b-WT and miR130b-K52R were analysed by a wound-healing assay with μ-Dish. ( d ) RIP assay was performed with 293T cells transfected with pri-miR21, myc-Ago2 and Flag-TARBP2-WT or -K52R. Thirty-six hours after transfection, cells were lysed for IP with anti-myc antibody to pull down RNA. Ago2-bound mature miR21 was extracted and analysed by real-time quantitative PCR. ( e – g ) SUMOylation of TARBP2 influences the efficiency of miRNA or siRNA mimic duplexes via the formation of the functional RISC. TARBP2-WT or -K52R with/without Ago2, together with miR21 ( e ), miR130b ( f ), mimic duplexes or siPTEN (siRNA for PTEN; g ) were co-transfected into HeLa cells, and the expression levels of the corresponding targets PTEN, ZEB1 and PTEN were determined. Immunoblotting was performed with anti-PTEN, anti-ZEB1, anti-Myc, anti-Flag and anti-GAPDH antibodies. ( h ) A model for SUMOylation of TARBP2 controls the efficiency of RNA-induced gene silencing by increasing its interaction with Ago2 and precursor miRNAs/siRNAs. ‘S'—SUMOylation; ‘P'—Phosphorylation.

    Journal: Nature Communications

    Article Title: SUMOylation of TARBP2 regulates miRNA/siRNA efficiency

    doi: 10.1038/ncomms9899

    Figure Lengend Snippet: SUMOylation of TARBP2 controls miRNA/siRNA efficiency. ( a , b ) SUMOylation of TARBP2 is required for efficient RNA-induced gene silencing by recruiting more Ago2. A549 luc cell lines stably expressing pri-miRNA21 and Flag-TARBP2-WT or -K52R ( a , named as miR21-WT or miR21-K52R, respectively), or pri-miR130b and Flag-TARBP2-WT or -K52R ( b , named as miR130b-WT and miR130b-K52R, respectively) were generated by the lentiviral system. Cell lysates were used for IP with anti-Flag antibody and then detected with anti-Ago2 antibody. Cell lysates were used for immunoblotting with anti-Ago2, -GAPDH, -Flag and -PTEN ( a ) or -ZEB1 ( b ) antibodies. For full scans of western blots, see Supplementary Fig. 8 . ( c ) The SUMO-site mutation K52R of TARBP2 dominant-negatively abolishes inhibition of cell migration mediated by miR130b-ZEB1. Cell motilities of stable A549 luc cell lines including Control, miR130b-con, miR130b-WT and miR130b-K52R were analysed by a wound-healing assay with μ-Dish. ( d ) RIP assay was performed with 293T cells transfected with pri-miR21, myc-Ago2 and Flag-TARBP2-WT or -K52R. Thirty-six hours after transfection, cells were lysed for IP with anti-myc antibody to pull down RNA. Ago2-bound mature miR21 was extracted and analysed by real-time quantitative PCR. ( e – g ) SUMOylation of TARBP2 influences the efficiency of miRNA or siRNA mimic duplexes via the formation of the functional RISC. TARBP2-WT or -K52R with/without Ago2, together with miR21 ( e ), miR130b ( f ), mimic duplexes or siPTEN (siRNA for PTEN; g ) were co-transfected into HeLa cells, and the expression levels of the corresponding targets PTEN, ZEB1 and PTEN were determined. Immunoblotting was performed with anti-PTEN, anti-ZEB1, anti-Myc, anti-Flag and anti-GAPDH antibodies. ( h ) A model for SUMOylation of TARBP2 controls the efficiency of RNA-induced gene silencing by increasing its interaction with Ago2 and precursor miRNAs/siRNAs. ‘S'—SUMOylation; ‘P'—Phosphorylation.

    Article Snippet: The Flag-TARBP2 was cloned into the lentiviral vector (System Biosciences, Mountain View, CA, USA) carrying EGFP and Puromycin genes .

    Techniques: Stable Transfection, Expressing, Generated, Western Blot, Mutagenesis, Inhibition, Migration, Wound Healing Assay, Transfection, Real-time Polymerase Chain Reaction, Functional Assay

    TARBP2 is SUMOylated in vitro and in vivo. ( a ) TARBP2 is mainly modified by SUMO1 in 293T cells. 293 T cells were co-transfected with myc-TARBP2, Flag-Ubc9 and His-SUMO1, or SUMO2, or SUMO3. Cell were lysed for precipitation with Ni 2+ -NTA resin and then analysed using western blot analysis with indicated antibodies. ( b ) SUMO1 conjugated covalently to TARBP2. 293T cells were transfected with indicated plasmids. Cell lysates were used forIP with anti-Flag antibody, followed by western blot analysis with anti-GFP antibody to detect the SUMOylated band. The same membrane was re-immunoblotted with anti-Flag antibody after stripping. ( c ) Senp1 interacts with TARBP2. 293T cells were transfected with indicated plasmids. Cell lysates were co-immunoprecipitated with anti-Flag antibody and were followed by western blotting with anti-Flag and anti-Senp1 antibodies. ( d ) Knockdown of Senp1 promotes TARBP2 SUMOylation. Senp1 was stably knocked down by lentiviral system carrying Senp1 shRNAs in 293T cells (293T senp1sh1 and senp1sh2). The two stable cell lines were transfected with indicated plasmids for 48 h, and cells were lysed for Ni 2+ -NTA resin precipitation. Western blot analysis was performed to detect the levels of TARBP2 SUMOylation with anti-myc antibody. ( e ) Overexpression of Senp1 removes SUMOylation of TARBP2. Myc-TARBP2, His-SUMO1, Flag-Ubc9, with or without SENP1 were co-transfected into 293T cells. Ni 2+ -NTA resin pull down was performed to detect the TARBP2 SUMOylation level. ( f ) Endogenous TARBP2 can be SUMOylated in HeLa cells stably overexpressing His-SUMO1. Cell lysates were used for Ni 2+ -NTA resin pull down to detect the band of SUMOylated TARBP2. For full scans of western blots ( b , d – f ), see Supplementary Fig. 8 .

    Journal: Nature Communications

    Article Title: SUMOylation of TARBP2 regulates miRNA/siRNA efficiency

    doi: 10.1038/ncomms9899

    Figure Lengend Snippet: TARBP2 is SUMOylated in vitro and in vivo. ( a ) TARBP2 is mainly modified by SUMO1 in 293T cells. 293 T cells were co-transfected with myc-TARBP2, Flag-Ubc9 and His-SUMO1, or SUMO2, or SUMO3. Cell were lysed for precipitation with Ni 2+ -NTA resin and then analysed using western blot analysis with indicated antibodies. ( b ) SUMO1 conjugated covalently to TARBP2. 293T cells were transfected with indicated plasmids. Cell lysates were used forIP with anti-Flag antibody, followed by western blot analysis with anti-GFP antibody to detect the SUMOylated band. The same membrane was re-immunoblotted with anti-Flag antibody after stripping. ( c ) Senp1 interacts with TARBP2. 293T cells were transfected with indicated plasmids. Cell lysates were co-immunoprecipitated with anti-Flag antibody and were followed by western blotting with anti-Flag and anti-Senp1 antibodies. ( d ) Knockdown of Senp1 promotes TARBP2 SUMOylation. Senp1 was stably knocked down by lentiviral system carrying Senp1 shRNAs in 293T cells (293T senp1sh1 and senp1sh2). The two stable cell lines were transfected with indicated plasmids for 48 h, and cells were lysed for Ni 2+ -NTA resin precipitation. Western blot analysis was performed to detect the levels of TARBP2 SUMOylation with anti-myc antibody. ( e ) Overexpression of Senp1 removes SUMOylation of TARBP2. Myc-TARBP2, His-SUMO1, Flag-Ubc9, with or without SENP1 were co-transfected into 293T cells. Ni 2+ -NTA resin pull down was performed to detect the TARBP2 SUMOylation level. ( f ) Endogenous TARBP2 can be SUMOylated in HeLa cells stably overexpressing His-SUMO1. Cell lysates were used for Ni 2+ -NTA resin pull down to detect the band of SUMOylated TARBP2. For full scans of western blots ( b , d – f ), see Supplementary Fig. 8 .

    Article Snippet: The Flag-TARBP2 was cloned into the lentiviral vector (System Biosciences, Mountain View, CA, USA) carrying EGFP and Puromycin genes .

    Techniques: In Vitro, In Vivo, Modification, Transfection, Western Blot, Stripping Membranes, Immunoprecipitation, Stable Transfection, Over Expression

    SUMOylation of TARBP2 increases its binding with Ago2. ( a , b ) The SUMO-site mutation K52R of TARBP2 affects the interaction between TARBP2 and Ago2. 293T cells were transfected Flag-TARBP2-WT or -K52R with ( a ) or without ( b ) myc-Ago2. Forty-eight hours after transfection, cells were lysed for IP with anti-Flag antibody, followed by western blotting with anti-Myc ( a ) or anti-Ago2 ( b ) antibody, respectively. ( c ) SUMOylation enhances TARBP2 binding with Ago2. 293T cells transfected with Flag-TARBP2 were treated with 100 μM H 2 O 2 for 3 h before being harvested. Cell lysates were used for IP with anti-Flag antibody, followed by western blotting with anti-Myc antibody. ( d ) SUMO1 interacts with two SIMs of Ago2. Upper panels: putative SIMs of Ago2 and their mutations (SIM1-wt: 162 L-D-V-V 165 , SIM1-mu: A-A-A-A; SIM-2-wt: 519 V-V-I-L 522 , SIM2-mu: A-A-A-A. Lower panels: plasmid myc-Ago2-WT, -SIM1-mu or -SIM2-mu with/without GFP-SUMO1 were transfected into 293T cells. IP with anti-Myc antibody and immunoblotting with anti-GFP antibody were performed. ( e ) Ago2 interacts with SUMO1 conjugated to TARBP2 via its SIMs. pGEX4T1-TARBP2 with or without pE1E2S1 were co-transfected into E. coli BL21 (DE3). GST-TARBP2 protein was purified, and then immunoblotting with anti-SUMO1 and anti-GST antibodies was performed (left panels). This validated that highly SUMOylated GST-TARBP2 was used for pull down of the same amount of each lysate from 293T cells transfected with the control vector, myc-Ago2 WT or SIM1-mu or SIM2-mu, followed by immunoblotting with anti-Myc antibody (right panels). Cell lysates were also used as an Input. ( f ) The SUMO-site mutation K52R of TARBP2 decreases Ago2. Stable endogenous TARBP2-knocked down 293T cell line (namely TARBP2sh 293 T) was generated by the lentiviral system containing shRNA targeting 3′-UTR of TARBP2 mRNA (left panels). TARBP2sh 293T cells were transfected with Flag-TARBP2-WT or -K52R. Immunoblotting with anti-Dicer, anti-Ago2, anti-Flag and anti-GAPDH antibodies was performed. ( g ) SUMOylation of TARBP2 stabilizes Ago2. Stable HeLa cell lines expressing Flag-TARBP2-WT or -K52R were treated with 100 μg ml −1 CHX for indicated time and cell lysates were immunoblotted with anti-Ago2, anti-Flag and anti-GAPDH antibodies. For full scans of western blots ( a , b , d , g ), see Supplementary Fig. 8 .

    Journal: Nature Communications

    Article Title: SUMOylation of TARBP2 regulates miRNA/siRNA efficiency

    doi: 10.1038/ncomms9899

    Figure Lengend Snippet: SUMOylation of TARBP2 increases its binding with Ago2. ( a , b ) The SUMO-site mutation K52R of TARBP2 affects the interaction between TARBP2 and Ago2. 293T cells were transfected Flag-TARBP2-WT or -K52R with ( a ) or without ( b ) myc-Ago2. Forty-eight hours after transfection, cells were lysed for IP with anti-Flag antibody, followed by western blotting with anti-Myc ( a ) or anti-Ago2 ( b ) antibody, respectively. ( c ) SUMOylation enhances TARBP2 binding with Ago2. 293T cells transfected with Flag-TARBP2 were treated with 100 μM H 2 O 2 for 3 h before being harvested. Cell lysates were used for IP with anti-Flag antibody, followed by western blotting with anti-Myc antibody. ( d ) SUMO1 interacts with two SIMs of Ago2. Upper panels: putative SIMs of Ago2 and their mutations (SIM1-wt: 162 L-D-V-V 165 , SIM1-mu: A-A-A-A; SIM-2-wt: 519 V-V-I-L 522 , SIM2-mu: A-A-A-A. Lower panels: plasmid myc-Ago2-WT, -SIM1-mu or -SIM2-mu with/without GFP-SUMO1 were transfected into 293T cells. IP with anti-Myc antibody and immunoblotting with anti-GFP antibody were performed. ( e ) Ago2 interacts with SUMO1 conjugated to TARBP2 via its SIMs. pGEX4T1-TARBP2 with or without pE1E2S1 were co-transfected into E. coli BL21 (DE3). GST-TARBP2 protein was purified, and then immunoblotting with anti-SUMO1 and anti-GST antibodies was performed (left panels). This validated that highly SUMOylated GST-TARBP2 was used for pull down of the same amount of each lysate from 293T cells transfected with the control vector, myc-Ago2 WT or SIM1-mu or SIM2-mu, followed by immunoblotting with anti-Myc antibody (right panels). Cell lysates were also used as an Input. ( f ) The SUMO-site mutation K52R of TARBP2 decreases Ago2. Stable endogenous TARBP2-knocked down 293T cell line (namely TARBP2sh 293 T) was generated by the lentiviral system containing shRNA targeting 3′-UTR of TARBP2 mRNA (left panels). TARBP2sh 293T cells were transfected with Flag-TARBP2-WT or -K52R. Immunoblotting with anti-Dicer, anti-Ago2, anti-Flag and anti-GAPDH antibodies was performed. ( g ) SUMOylation of TARBP2 stabilizes Ago2. Stable HeLa cell lines expressing Flag-TARBP2-WT or -K52R were treated with 100 μg ml −1 CHX for indicated time and cell lysates were immunoblotted with anti-Ago2, anti-Flag and anti-GAPDH antibodies. For full scans of western blots ( a , b , d , g ), see Supplementary Fig. 8 .

    Article Snippet: The Flag-TARBP2 was cloned into the lentiviral vector (System Biosciences, Mountain View, CA, USA) carrying EGFP and Puromycin genes .

    Techniques: Binding Assay, Mutagenesis, Transfection, Western Blot, Plasmid Preparation, Purification, Generated, shRNA, Expressing

    Effects of ectopic microRNA-18a expression on gene expression and cell growth in MB231RN-LM cells. (A) Expression levels of microRNA-18a (miR-18a) in cells transduced with lentiviral vector expressing miR-18a green fluorescent protein (GFP) (LM-miR-18a) and or control cells transduced with lentiviral vector expressing GFP only (LM-GFP). (B) Effect of miR-18a on expression levels of predicted target mRNAs. mRNA levels were examined by quantitative PCR (qPCR) and normalized to ACTB . The expression levels of all the presented genes were significantly reduced by miR-18a expression ( n = 3, P

    Journal: Breast Cancer Research : BCR

    Article Title: MicroRNA-18a inhibits hypoxia-inducible factor 1α activity and lung metastasis in basal breast cancers

    doi: 10.1186/bcr3693

    Figure Lengend Snippet: Effects of ectopic microRNA-18a expression on gene expression and cell growth in MB231RN-LM cells. (A) Expression levels of microRNA-18a (miR-18a) in cells transduced with lentiviral vector expressing miR-18a green fluorescent protein (GFP) (LM-miR-18a) and or control cells transduced with lentiviral vector expressing GFP only (LM-GFP). (B) Effect of miR-18a on expression levels of predicted target mRNAs. mRNA levels were examined by quantitative PCR (qPCR) and normalized to ACTB . The expression levels of all the presented genes were significantly reduced by miR-18a expression ( n = 3, P

    Article Snippet: The miArrest miR-18a inhibitor encoded by a lentiviral vector that coexpresses mCherry (HmiR-AN0255-AM03; GeneCopoeia) was used to establish MDA-MB-231 sublines with low miR-18a activity (MB231-18aIN).

    Techniques: Expressing, Transduction, Plasmid Preparation, Real-time Polymerase Chain Reaction

    Establishment of vaccine cell lines by lentiviral transduction. ( A ) Lentiviral constructs used in this study. LTR, long terminal repeat. Ψ, packaging signal. RRE, Rev response element. cPPT, central polypurine tract. CMVp, CMV promoter. IRES, internal ribosome entry site. Bsd, blasticidin resistance gene. WPRE, woodchuck hepatitis virus posttranscriptional regulatory element. Sp, Signal peptide of IL-7. FA, furin cleavage site and P2A peptide. ( B ) Western blot analysis of secreted IL-21 and IL-7 in vaccine cell-conditioned media. Note that the two bands of IL-21 in the 21/7 CM lane represented two possible cleavage products: cleavage at furin site resulted in IL-21 + 4AA, while cleavage at P2A site resulted in IL-21 + 25AA. CM, conditioned medium. AA, amino acids. ( C ) Western blot analysis of STAT proteins activated in response to secreted IL-21 and IL-7. SC, splenocytes. MC, medium control. Full-length blots are presented in Supplementary Figure S1 .

    Journal: Scientific Reports

    Article Title: Forced co-expression of IL-21 and IL-7 in whole-cell cancer vaccines promotes antitumor immunity

    doi: 10.1038/srep32351

    Figure Lengend Snippet: Establishment of vaccine cell lines by lentiviral transduction. ( A ) Lentiviral constructs used in this study. LTR, long terminal repeat. Ψ, packaging signal. RRE, Rev response element. cPPT, central polypurine tract. CMVp, CMV promoter. IRES, internal ribosome entry site. Bsd, blasticidin resistance gene. WPRE, woodchuck hepatitis virus posttranscriptional regulatory element. Sp, Signal peptide of IL-7. FA, furin cleavage site and P2A peptide. ( B ) Western blot analysis of secreted IL-21 and IL-7 in vaccine cell-conditioned media. Note that the two bands of IL-21 in the 21/7 CM lane represented two possible cleavage products: cleavage at furin site resulted in IL-21 + 4AA, while cleavage at P2A site resulted in IL-21 + 25AA. CM, conditioned medium. AA, amino acids. ( C ) Western blot analysis of STAT proteins activated in response to secreted IL-21 and IL-7. SC, splenocytes. MC, medium control. Full-length blots are presented in Supplementary Figure S1 .

    Article Snippet: The two fragments were either directly cloned into a lentiviral vector, pLVX-IRES-Bsd, which was derived from pLVX-IRES-ZsGreen1 (Clontech, Mountain View, CA USA) by replacing ZsGreen1 coding sequence with that of the blasticidin resistance gene, or first joined by coding sequences of a furin cleavage site and a P2A peptide, and then cloned into the same vector.

    Techniques: Transduction, Construct, Western Blot

    Inhibition of BTG2 expression accounted for function of miR-25-3p in TNBC. a . BTG2 protein expression level was measured by western blot. b , c . cell proliferation of Sum-1315 and ZR-751 cells transfected with GV272 empty construct (miR-NC), miR-25-3p inhibitor lentivirus (miR-inhibitor) and BTG2 interfering RNA (siBTG2),miR-25-3p mimics lentivirus (miR-mimics) and BTG2 lentiviral vector(lv-BTG2) was determined by CCK-8 and colony formation assay. d . The cell apoptosis of Sum-1315 and ZR-751 cells after cotransfection was measured in flow cytometry analysis. * p

    Journal: Molecular Cancer

    Article Title: MiR-25-3p promotes the proliferation of triple negative breast cancer by targeting BTG2

    doi: 10.1186/s12943-017-0754-0

    Figure Lengend Snippet: Inhibition of BTG2 expression accounted for function of miR-25-3p in TNBC. a . BTG2 protein expression level was measured by western blot. b , c . cell proliferation of Sum-1315 and ZR-751 cells transfected with GV272 empty construct (miR-NC), miR-25-3p inhibitor lentivirus (miR-inhibitor) and BTG2 interfering RNA (siBTG2),miR-25-3p mimics lentivirus (miR-mimics) and BTG2 lentiviral vector(lv-BTG2) was determined by CCK-8 and colony formation assay. d . The cell apoptosis of Sum-1315 and ZR-751 cells after cotransfection was measured in flow cytometry analysis. * p

    Article Snippet: The lentiviral vector containing BTG2 DNA sequence and siRNA for BTG2 were constructed by Genepharma (Shanghai, China).

    Techniques: Inhibition, Expressing, Western Blot, Transfection, Construct, Plasmid Preparation, CCK-8 Assay, Colony Assay, Cotransfection, Flow Cytometry, Cytometry

    Vector construction and restriction endonuclease analysis. ( A ) The iCAR19 construct (upper) consisted of the Tet-on sequence and the CD19-CAR fragment. The iGFP construct (lower) consisted of the Tet-on sequence and the GFP sequence. ( B ) Constructs in ( A ) were respectively cloned into the pCDH-CMV-MCS-EF1α-copGFP lentiviral backbone between SnaBI and SalI sites. ( C − E ) the restriction endonuclease analysis results of pCDH-induce ( C ), iGFP ( D ), and iCAR19 ( E ) transfer vector plasmid. SnaBI-SalI digestion was used for pCDH-induce vector. SalI digestion was used for iGFP and iCAR19 vectors.

    Journal: International Journal of Molecular Sciences

    Article Title: Development of Inducible CD19-CAR T Cells with a Tet-On System for Controlled Activity and Enhanced Clinical Safety

    doi: 10.3390/ijms19113455

    Figure Lengend Snippet: Vector construction and restriction endonuclease analysis. ( A ) The iCAR19 construct (upper) consisted of the Tet-on sequence and the CD19-CAR fragment. The iGFP construct (lower) consisted of the Tet-on sequence and the GFP sequence. ( B ) Constructs in ( A ) were respectively cloned into the pCDH-CMV-MCS-EF1α-copGFP lentiviral backbone between SnaBI and SalI sites. ( C − E ) the restriction endonuclease analysis results of pCDH-induce ( C ), iGFP ( D ), and iCAR19 ( E ) transfer vector plasmid. SnaBI-SalI digestion was used for pCDH-induce vector. SalI digestion was used for iGFP and iCAR19 vectors.

    Article Snippet: After 48 h of induction, iCAR19 T cells were incubated with Raji and K562 cells stably transduced with lentiviral vector encoding firefly luciferase (Lentigen Technology, Gaithersburg, MD, USA) at an E:T ratio of 5:1.

    Techniques: Plasmid Preparation, Construct, Sequencing, Clone Assay

    Expression of MYCN in ATRX -mutant cells leads to ROS production, DNA damage, and replicative stress. a Bar plot (mean±SD) of ROS levels on Day 6 ± doxycycline. P value was calculated using two-tailed Student t test. b Immunoblots on Day 4 ± doxycycline. The experiment was repeated with the same results. c Immunofluorescent detection of γH2AX (red) and nuclei (blue) in SKNMM MYCN cells on Day 4 ± doxycycline. The experiment was repeated with the same results. d Spectral karyotype analysis (SKY) of SKNMM MYCN cells ± DOX on Day 8. Chromosomes are shown adjacent to the pseudo-colored representation. Arrows indicate translocations. The pie charts show the proportion of cells with DNA fragmentation ( n = 50). P value was calculated using Chi-square test. e , f Micrographs of single-cell electrophoresis of individual nuclei (dashed circles) and their COMET tail (arrows) ± doxycycline on Day 5. g Mean±SD of the COMET assay scoring. The number of analyzed cells are presented on the graph. h Photograph of cresyl violet-stained colonies from SKNMM MYCN cells ± doxycycline, with increasing concentrations of retinoic acid (RA). i Immunoblots of SKNMM MYCN cells ± doxycycline, with or without 5 μ m RA. The level of MYCN protein was reduced by 30% (0.7×) in the presence of RA. j ChromHMM and ChIP-seq for MYCN, H3K4me3, and H3K27me3 for the CUX2 promoter for a MYCN -amplified neuroblastoma (SJNBL012407_X1) xenograft and SKNMM MYCN cells in the presence or absence of doxycycline after 4 days in culture. The gene expression (FPKM) is indicated, and the dashed line indicates the start of transcription. k Line plot of SKNMM MYCN cells in the presence or absence of doxycycline after 4, 6, 8, and 10 days in culture with or without ectopic expression of CUX2 or the GFP control from lentiviral infection. Each point is the mean and standard deviation of triplicate experiments, and the asterisks indicate statistical significance ( P = 0.005, 0.001, and 0.008 at days 6, 8, and 10, respectively, two-tailed Student's t test). Scale bars e , f , 10 μm. DOX doxycycline, RA retinoic acid, ROS reactive-oxygen species, m marker chromosome fragments that could not be definitively identified.

    Journal: Nature Communications

    Article Title: MYCN amplification and ATRX mutations are incompatible in neuroblastoma

    doi: 10.1038/s41467-020-14682-6

    Figure Lengend Snippet: Expression of MYCN in ATRX -mutant cells leads to ROS production, DNA damage, and replicative stress. a Bar plot (mean±SD) of ROS levels on Day 6 ± doxycycline. P value was calculated using two-tailed Student t test. b Immunoblots on Day 4 ± doxycycline. The experiment was repeated with the same results. c Immunofluorescent detection of γH2AX (red) and nuclei (blue) in SKNMM MYCN cells on Day 4 ± doxycycline. The experiment was repeated with the same results. d Spectral karyotype analysis (SKY) of SKNMM MYCN cells ± DOX on Day 8. Chromosomes are shown adjacent to the pseudo-colored representation. Arrows indicate translocations. The pie charts show the proportion of cells with DNA fragmentation ( n = 50). P value was calculated using Chi-square test. e , f Micrographs of single-cell electrophoresis of individual nuclei (dashed circles) and their COMET tail (arrows) ± doxycycline on Day 5. g Mean±SD of the COMET assay scoring. The number of analyzed cells are presented on the graph. h Photograph of cresyl violet-stained colonies from SKNMM MYCN cells ± doxycycline, with increasing concentrations of retinoic acid (RA). i Immunoblots of SKNMM MYCN cells ± doxycycline, with or without 5 μ m RA. The level of MYCN protein was reduced by 30% (0.7×) in the presence of RA. j ChromHMM and ChIP-seq for MYCN, H3K4me3, and H3K27me3 for the CUX2 promoter for a MYCN -amplified neuroblastoma (SJNBL012407_X1) xenograft and SKNMM MYCN cells in the presence or absence of doxycycline after 4 days in culture. The gene expression (FPKM) is indicated, and the dashed line indicates the start of transcription. k Line plot of SKNMM MYCN cells in the presence or absence of doxycycline after 4, 6, 8, and 10 days in culture with or without ectopic expression of CUX2 or the GFP control from lentiviral infection. Each point is the mean and standard deviation of triplicate experiments, and the asterisks indicate statistical significance ( P = 0.005, 0.001, and 0.008 at days 6, 8, and 10, respectively, two-tailed Student's t test). Scale bars e , f , 10 μm. DOX doxycycline, RA retinoic acid, ROS reactive-oxygen species, m marker chromosome fragments that could not be definitively identified.

    Article Snippet: CUX2 expression in SKNMMMYCN cells SKNMMMYCN cells were transduced by a lentiviral vector (pLenti-C-mGFP-P2A-Puro) from Origene expressing either CUX2 (Cat# RC222063L4V) or GFP control construct (Cat# PS100093V).

    Techniques: Expressing, Mutagenesis, Two Tailed Test, Western Blot, Electrophoresis, Single Cell Gel Electrophoresis, Staining, Chromatin Immunoprecipitation, Amplification, Infection, Standard Deviation, Marker