lenticrisprv2 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    Addgene inc lenticrisprv 2 plasmid
    Generation of the miR-26a-knockout line in HeLa cells using the CRISPR-Cas9 system. ( a ) Two sgRNAs were designed for miR-26a depletion by CRISPR DESIGN ( http://crispr.mit.edu/ ). ( b ) The sequencing results showed that the two sgRNAs were appropriately inserted into the <t>lentiCRISPRv2</t> vector. ( c ) The sequencing data revealed that a 28-bp deletion in the target site was introduced by the CRISPR-Cas9 system.
    Lenticrisprv 2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv 2 plasmid/product/Addgene inc
    Average 88 stars, based on 32 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv 2 plasmid - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    99
    Addgene inc lenticrisprv2
    GFP-Tsg101 knock-in using CRISPR-Cas9 and HDR. A , knock-in strategy. Cells were transduced with <t>LentiCRISPRv2</t> to express Cas9 with sgRNA targeting the start of the Tsg101 gene and transfected with a donor template plasmid containing a puromycin resistance selection marker and a GFP tag flanked by HRs for the target site. Cas9 generates a DSB in the genomic DNA at the target site, and the donor template can be integrated into the DSB by HDR, resulting in GFP knock-in. Otherwise, the DSB is repaired by the more efficient process of NHEJ, leaving insertions or deletions that knock out Tsg101. Tsg101 knockout was lethal, which helped to select against cells that did not achieve the knock-in. B , Western blotting for Tsg101 in cell lysates of GFP-Tsg101 KI clonal lines and WT parental lines. The KI cell lines express GFP-Tsg101 at lower than WT levels and do not express untagged Tsg101. α-Tubulin is shown as a loading control.
    Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 99/100, based on 1221 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2/product/Addgene inc
    Average 99 stars, based on 1221 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Addgene inc lenticrisprv2 vector
    Generate CRISPR/Cas9 vector to target ABCB1. The map of <t>LentiCRISPRv2</t> vector (A) and the locations and sequences of two sgRNAs for targeting ABCB1 (B) are shown.
    Lenticrisprv2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 99/100, based on 446 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2 vector/product/Addgene inc
    Average 99 stars, based on 446 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 vector - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    93
    Addgene inc lenticrisprv2 a9 cells lenticrisprv2 plasmid
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lenticrisprv2 A9 Cells Lenticrisprv2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2 a9 cells lenticrisprv2 plasmid/product/Addgene inc
    Average 93 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 a9 cells lenticrisprv2 plasmid - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    92
    Abcam lenticrisprv2
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lenticrisprv2, supplied by Abcam, used in various techniques. Bioz Stars score: 92/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2/product/Abcam
    Average 92 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    97
    Fisher Scientific lenticrisprv2
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lenticrisprv2, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 97/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2/product/Fisher Scientific
    Average 97 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 - by Bioz Stars, 2020-04
    97/100 stars
      Buy from Supplier

    97
    Addgene inc bsmbi digested lenticrisprv2
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Bsmbi Digested Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsmbi digested lenticrisprv2/product/Addgene inc
    Average 97 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    bsmbi digested lenticrisprv2 - by Bioz Stars, 2020-04
    97/100 stars
      Buy from Supplier

    94
    Addgene inc lenticrisprv2 sgrna
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lenticrisprv2 Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2 sgrna/product/Addgene inc
    Average 94 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 sgrna - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    95
    Addgene inc lentiviral vector lenticrisprv2
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lentiviral Vector Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 67 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector lenticrisprv2/product/Addgene inc
    Average 95 stars, based on 67 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector lenticrisprv2 - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    94
    Addgene inc lenticrisprv2 lcv2 vector
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lenticrisprv2 Lcv2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2 lcv2 vector/product/Addgene inc
    Average 94 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 lcv2 vector - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    91
    GenScript lenticrisprv2 vector
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lenticrisprv2 Vector, supplied by GenScript, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2 vector/product/GenScript
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 vector - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    80
    Addgene inc lenticrisprv2 sgrna rasal2 plasmid
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lenticrisprv2 Sgrna Rasal2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 80/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2 sgrna rasal2 plasmid/product/Addgene inc
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 sgrna rasal2 plasmid - by Bioz Stars, 2020-04
    80/100 stars
      Buy from Supplier

    92
    Addgene inc lenticrisprv2 lentiviral vector system
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lenticrisprv2 Lentiviral Vector System, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2 lentiviral vector system/product/Addgene inc
    Average 92 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 lentiviral vector system - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    94
    Addgene inc lenticrisprv2 puro system
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lenticrisprv2 Puro System, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2 puro system/product/Addgene inc
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 puro system - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    93
    Addgene inc lentivirus vector lenticrisprv2
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lentivirus Vector Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentivirus vector lenticrisprv2/product/Addgene inc
    Average 93 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    lentivirus vector lenticrisprv2 - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    94
    Addgene inc bsmbi digested lenticrisprv2 plasmid
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Bsmbi Digested Lenticrisprv2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsmbi digested lenticrisprv2 plasmid/product/Addgene inc
    Average 94 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    bsmbi digested lenticrisprv2 plasmid - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    92
    Addgene inc all in one expression plasmid lenticrisprv2
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    All In One Expression Plasmid Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/all in one expression plasmid lenticrisprv2/product/Addgene inc
    Average 92 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    all in one expression plasmid lenticrisprv2 - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    96
    Addgene inc lenticrisprv2 grna construct pspax2
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lenticrisprv2 Grna Construct Pspax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2 grna construct pspax2/product/Addgene inc
    Average 96 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 grna construct pspax2 - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    94
    GenScript lentiviral vector lenticrisprv2
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lentiviral Vector Lenticrisprv2, supplied by GenScript, used in various techniques. Bioz Stars score: 94/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector lenticrisprv2/product/GenScript
    Average 94 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    lentiviral vector lenticrisprv2 - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    95
    Addgene inc cas9 expressing lenticrisprv2 vector
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Cas9 Expressing Lenticrisprv2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9 expressing lenticrisprv2 vector/product/Addgene inc
    Average 95 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    cas9 expressing lenticrisprv2 vector - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    97
    Addgene inc lenticrisprv2 puro vector
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lenticrisprv2 Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lenticrisprv2 puro vector/product/Addgene inc
    Average 97 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    lenticrisprv2 puro vector - by Bioz Stars, 2020-04
    97/100 stars
      Buy from Supplier

    93
    Addgene inc vector system lenticrisprv2
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Vector System Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vector system lenticrisprv2/product/Addgene inc
    Average 93 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    vector system lenticrisprv2 - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    93
    Addgene inc bbsi digested lenticrisprv2 control vector
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Bbsi Digested Lenticrisprv2 Control Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bbsi digested lenticrisprv2 control vector/product/Addgene inc
    Average 93 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    bbsi digested lenticrisprv2 control vector - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    95
    Addgene inc lentivirus expression vector lenticrisprv2
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lentivirus Expression Vector Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentivirus expression vector lenticrisprv2/product/Addgene inc
    Average 95 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    lentivirus expression vector lenticrisprv2 - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    94
    Addgene inc alkaline phosphatase digested lenticrisprv2 blast
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Alkaline Phosphatase Digested Lenticrisprv2 Blast, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/alkaline phosphatase digested lenticrisprv2 blast/product/Addgene inc
    Average 94 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    alkaline phosphatase digested lenticrisprv2 blast - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    92
    Addgene inc raf1 lenticrisprv2 plasmid
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Raf1 Lenticrisprv2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/raf1 lenticrisprv2 plasmid/product/Addgene inc
    Average 92 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    raf1 lenticrisprv2 plasmid - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    94
    Addgene inc human lenticrisprv2 plasmid library
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Human Lenticrisprv2 Plasmid Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human lenticrisprv2 plasmid library/product/Addgene inc
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    human lenticrisprv2 plasmid library - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    95
    Addgene inc lentivirus transfer vector lenticrisprv2
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lentivirus Transfer Vector Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentivirus transfer vector lenticrisprv2/product/Addgene inc
    Average 95 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    lentivirus transfer vector lenticrisprv2 - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    91
    Addgene inc lentivirus mediated crispr silencing lenticrisprv2
    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine <t>A9</t> cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing <t>LentiCRISPRv2</t> which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.
    Lentivirus Mediated Crispr Silencing Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentivirus mediated crispr silencing lenticrisprv2/product/Addgene inc
    Average 91 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    lentivirus mediated crispr silencing lenticrisprv2 - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    94
    Addgene inc transfer plasmid lenticrisprv2
    GFP-Tsg101 knock-in using CRISPR-Cas9 and HDR. A , knock-in strategy. Cells were transduced with <t>LentiCRISPRv2</t> to express Cas9 with sgRNA targeting the start of the Tsg101 gene and transfected with a donor template plasmid containing a puromycin resistance selection marker and a GFP tag flanked by HRs for the target site. Cas9 generates a DSB in the genomic DNA at the target site, and the donor template can be integrated into the DSB by HDR, resulting in GFP knock-in. Otherwise, the DSB is repaired by the more efficient process of NHEJ, leaving insertions or deletions that knock out Tsg101. Tsg101 knockout was lethal, which helped to select against cells that did not achieve the knock-in. B , Western blotting for Tsg101 in cell lysates of GFP-Tsg101 KI clonal lines and WT parental lines. The KI cell lines express GFP-Tsg101 at lower than WT levels and do not express untagged Tsg101. α-Tubulin is shown as a loading control.
    Transfer Plasmid Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transfer plasmid lenticrisprv2/product/Addgene inc
    Average 94 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    transfer plasmid lenticrisprv2 - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    93
    Addgene inc lentiviral lenticrisprv2 tagrfp vector
    GFP-Tsg101 knock-in using CRISPR-Cas9 and HDR. A , knock-in strategy. Cells were transduced with <t>LentiCRISPRv2</t> to express Cas9 with sgRNA targeting the start of the Tsg101 gene and transfected with a donor template plasmid containing a puromycin resistance selection marker and a GFP tag flanked by HRs for the target site. Cas9 generates a DSB in the genomic DNA at the target site, and the donor template can be integrated into the DSB by HDR, resulting in GFP knock-in. Otherwise, the DSB is repaired by the more efficient process of NHEJ, leaving insertions or deletions that knock out Tsg101. Tsg101 knockout was lethal, which helped to select against cells that did not achieve the knock-in. B , Western blotting for Tsg101 in cell lysates of GFP-Tsg101 KI clonal lines and WT parental lines. The KI cell lines express GFP-Tsg101 at lower than WT levels and do not express untagged Tsg101. α-Tubulin is shown as a loading control.
    Lentiviral Lenticrisprv2 Tagrfp Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral lenticrisprv2 tagrfp vector/product/Addgene inc
    Average 93 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    lentiviral lenticrisprv2 tagrfp vector - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    94
    Addgene inc bacterial dna carrying empty lenticrisprv2 vectors
    GFP-Tsg101 knock-in using CRISPR-Cas9 and HDR. A , knock-in strategy. Cells were transduced with <t>LentiCRISPRv2</t> to express Cas9 with sgRNA targeting the start of the Tsg101 gene and transfected with a donor template plasmid containing a puromycin resistance selection marker and a GFP tag flanked by HRs for the target site. Cas9 generates a DSB in the genomic DNA at the target site, and the donor template can be integrated into the DSB by HDR, resulting in GFP knock-in. Otherwise, the DSB is repaired by the more efficient process of NHEJ, leaving insertions or deletions that knock out Tsg101. Tsg101 knockout was lethal, which helped to select against cells that did not achieve the knock-in. B , Western blotting for Tsg101 in cell lysates of GFP-Tsg101 KI clonal lines and WT parental lines. The KI cell lines express GFP-Tsg101 at lower than WT levels and do not express untagged Tsg101. α-Tubulin is shown as a loading control.
    Bacterial Dna Carrying Empty Lenticrisprv2 Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial dna carrying empty lenticrisprv2 vectors/product/Addgene inc
    Average 94 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    bacterial dna carrying empty lenticrisprv2 vectors - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    Generation of the miR-26a-knockout line in HeLa cells using the CRISPR-Cas9 system. ( a ) Two sgRNAs were designed for miR-26a depletion by CRISPR DESIGN ( http://crispr.mit.edu/ ). ( b ) The sequencing results showed that the two sgRNAs were appropriately inserted into the lentiCRISPRv2 vector. ( c ) The sequencing data revealed that a 28-bp deletion in the target site was introduced by the CRISPR-Cas9 system.

    Journal: Scientific Reports

    Article Title: Label-free Quantitative Analysis of Protein Expression Alterations in miR-26a-Knockout HeLa Cells using SWATH-MS Technology

    doi: 10.1038/s41598-018-34904-8

    Figure Lengend Snippet: Generation of the miR-26a-knockout line in HeLa cells using the CRISPR-Cas9 system. ( a ) Two sgRNAs were designed for miR-26a depletion by CRISPR DESIGN ( http://crispr.mit.edu/ ). ( b ) The sequencing results showed that the two sgRNAs were appropriately inserted into the lentiCRISPRv2 vector. ( c ) The sequencing data revealed that a 28-bp deletion in the target site was introduced by the CRISPR-Cas9 system.

    Article Snippet: To produce the lentivirus, HEK 293 T cells seeded in 100-mm plates were cotransfected with 4.0 μg of lentiCRISPRv2 plasmids, 3.0 μg of psPAX2 (Addgene plasmid # 12260), and 1.0 μg of pMD2.G plasmids (Addgene plasmid #12259) using polyethyleneimine (Polysciences Inc., USA), according to the manufacturer’s instructions.

    Techniques: Knock-Out, CRISPR, Sequencing, Plasmid Preparation

    TRIM5alpha, IFITM1 and Tetherin are additional ISGs that contribute to the IFN block. ( A ) KO efficiencies in lentiCRISPRv2-edited THP-1 cells as determined by ICE analysis (left) or flow cytometry (right – pretreated with 1000 U/mL uIFN). ( B ) THP-1 cell pools edited for gene targets of interest were created by transducing wild type THP-1 cells with lentiCRISPRv2 sgRNA constructs (two different sgRNAs - for STAT1, STAT2, IRF9, MxB, TRIM5alpha and Tetherin, and three for IFITM1), selected for 2 weeks to allow gene knockout (see Figure 4—source data 1 Supplemental file 1 for analysis of gene knockout efficiency) and infected with HIV-1 LAI with and without IFNα pretreatment in triplicate (white bars = no IFNα, gray bars =+IFNα). The percentage of cells expressing HIV p24gag was assayed 2 days post-infection by intracellular staining and flow cytometry. NTC n = 9. MxB_2 n = 6. All other pools n = 3. ( C ) The Fold Inhibition (%p24 +cells without IFN/%p24 +cells with IFNα) is shown for each KO pool. Control (NTC) = gray; IFN pathway genes = magenta. MxB, TRIM5alpha, IFITM1 and Tetherin = Cyan. Cells pools with significantly reduced Fold Inhibition as compared to the NTC pools *p

    Journal: eLife

    Article Title: A virus-packageable CRISPR screen identifies host factors mediating interferon inhibition of HIV

    doi: 10.7554/eLife.39823

    Figure Lengend Snippet: TRIM5alpha, IFITM1 and Tetherin are additional ISGs that contribute to the IFN block. ( A ) KO efficiencies in lentiCRISPRv2-edited THP-1 cells as determined by ICE analysis (left) or flow cytometry (right – pretreated with 1000 U/mL uIFN). ( B ) THP-1 cell pools edited for gene targets of interest were created by transducing wild type THP-1 cells with lentiCRISPRv2 sgRNA constructs (two different sgRNAs - for STAT1, STAT2, IRF9, MxB, TRIM5alpha and Tetherin, and three for IFITM1), selected for 2 weeks to allow gene knockout (see Figure 4—source data 1 Supplemental file 1 for analysis of gene knockout efficiency) and infected with HIV-1 LAI with and without IFNα pretreatment in triplicate (white bars = no IFNα, gray bars =+IFNα). The percentage of cells expressing HIV p24gag was assayed 2 days post-infection by intracellular staining and flow cytometry. NTC n = 9. MxB_2 n = 6. All other pools n = 3. ( C ) The Fold Inhibition (%p24 +cells without IFN/%p24 +cells with IFNα) is shown for each KO pool. Control (NTC) = gray; IFN pathway genes = magenta. MxB, TRIM5alpha, IFITM1 and Tetherin = Cyan. Cells pools with significantly reduced Fold Inhibition as compared to the NTC pools *p

    Article Snippet: Plasmids lentiCRISPRv2 plasmid was a gift from Feng Zhang (Addgene #52961). pMD2.G and psPAX2 were gifts from Didier Trono (Addgene #12259/12260). lentiCRISPRv2 constructs targeting genes of interest were cloned into BsmBI-digested lentiCRISPRv2 by annealing complementary oligos ( ) with overhangs that allow directional cloning into lentiCRISPRv2.

    Techniques: Blocking Assay, Flow Cytometry, Cytometry, Construct, Gene Knockout, Infection, Expressing, Staining, Inhibition

    MxB is a dominant, early-acting ISG whose activity is masked by other ISGs when HIV entry is mediated by VSV-G. ( A ) Clonal MxB-KO THP-1 lines generated by transducing with an MxB-targeting sgRNA/lentiCRISPRv2 construct, selection and single-cell sorting. Western blot for MxB expression with and without IFNα stimulation overnight is shown for wild type (wt) THP-1 cells; MxB-KO clones were all IFNα treated overnight. Note: the lower molecular weight band in some lanes results from initiation at an internal Met codon that would not be predicted to have anti-HIV activity ( Goujon et al., 2015 ; Matreyek et al., 2014 ). ( B ) Nine individual clonal THP-1 lines (white/gray bars) along with five clonal THP-1 MxB-KO lines (pink bars) were pre-treated with IFNα overnight and infected with wt HIV-1 LAI . The percentage of cells expressing HIV p24gag was assayed 2 days post-infection by intracellular staining and flow cytometry (n = 3). Light bars = no IFN; Dark bars = overnight IFNα treatment prior to infection. ( C ) The Fold Inhibition (%p24 +cells without IFN/%p24 +cells with IFNα) calculated for each clonal line for wt HIV-1 LAI infections from the data in Panel B. Controls = gray; MxB-KO = magenta. Dotted line at a Fold Inhibition of 1 = no IFN inhibition. ( D ) Individual clonal control THP-1 lines (gray) along with MxB-KO clonal lines (magenta) were infected with VSV-G pseudotyped HIV both with and without IFNα pretreatment (n = 3). Fold Inhibition was calculated as in C. Dotted line: Fold Inhibition of 1 = no IFN inhibition. *p = 0.0014 (unpaired t test). ( E ) The PIKA HIV screen was performed in triplicate in ZAP-KO THP-1 cells. Y-Axis: IFN induction as determined by Differential Expression Analysis of microarray data in THP-1 cells (log 2 FoldChange). X-Axis: MAGeCK Gene Scores for Top 25 Hits. Magenta: IFN pathway genes (IFNAR1, STAT1, STAT2, IRF9). Cyan: highly-IFN induced, high-scoring candidate Hits. White: non-IFN induced genes including ZAP, N4BP1, and SLC35A2. High-scoring genes with no information on IFN induction in THP-1s are plotted as IFN DE log 2 FC = 0 but shown in Cyan with a gray outline. 10.7554/eLife.39823.014 MAGeCK Gene Analysis (Positive) of ZAP-KO THP-1 PIKA HIV HIV-1 LAI /VSVG Screen. pos|score sort: id. num. pos|score. pos|p-value. pos|fdr. pos|rank. pos|goodsgrna. pos|lfc. pos|score(-log10).

    Journal: eLife

    Article Title: A virus-packageable CRISPR screen identifies host factors mediating interferon inhibition of HIV

    doi: 10.7554/eLife.39823

    Figure Lengend Snippet: MxB is a dominant, early-acting ISG whose activity is masked by other ISGs when HIV entry is mediated by VSV-G. ( A ) Clonal MxB-KO THP-1 lines generated by transducing with an MxB-targeting sgRNA/lentiCRISPRv2 construct, selection and single-cell sorting. Western blot for MxB expression with and without IFNα stimulation overnight is shown for wild type (wt) THP-1 cells; MxB-KO clones were all IFNα treated overnight. Note: the lower molecular weight band in some lanes results from initiation at an internal Met codon that would not be predicted to have anti-HIV activity ( Goujon et al., 2015 ; Matreyek et al., 2014 ). ( B ) Nine individual clonal THP-1 lines (white/gray bars) along with five clonal THP-1 MxB-KO lines (pink bars) were pre-treated with IFNα overnight and infected with wt HIV-1 LAI . The percentage of cells expressing HIV p24gag was assayed 2 days post-infection by intracellular staining and flow cytometry (n = 3). Light bars = no IFN; Dark bars = overnight IFNα treatment prior to infection. ( C ) The Fold Inhibition (%p24 +cells without IFN/%p24 +cells with IFNα) calculated for each clonal line for wt HIV-1 LAI infections from the data in Panel B. Controls = gray; MxB-KO = magenta. Dotted line at a Fold Inhibition of 1 = no IFN inhibition. ( D ) Individual clonal control THP-1 lines (gray) along with MxB-KO clonal lines (magenta) were infected with VSV-G pseudotyped HIV both with and without IFNα pretreatment (n = 3). Fold Inhibition was calculated as in C. Dotted line: Fold Inhibition of 1 = no IFN inhibition. *p = 0.0014 (unpaired t test). ( E ) The PIKA HIV screen was performed in triplicate in ZAP-KO THP-1 cells. Y-Axis: IFN induction as determined by Differential Expression Analysis of microarray data in THP-1 cells (log 2 FoldChange). X-Axis: MAGeCK Gene Scores for Top 25 Hits. Magenta: IFN pathway genes (IFNAR1, STAT1, STAT2, IRF9). Cyan: highly-IFN induced, high-scoring candidate Hits. White: non-IFN induced genes including ZAP, N4BP1, and SLC35A2. High-scoring genes with no information on IFN induction in THP-1s are plotted as IFN DE log 2 FC = 0 but shown in Cyan with a gray outline. 10.7554/eLife.39823.014 MAGeCK Gene Analysis (Positive) of ZAP-KO THP-1 PIKA HIV HIV-1 LAI /VSVG Screen. pos|score sort: id. num. pos|score. pos|p-value. pos|fdr. pos|rank. pos|goodsgrna. pos|lfc. pos|score(-log10).

    Article Snippet: Plasmids lentiCRISPRv2 plasmid was a gift from Feng Zhang (Addgene #52961). pMD2.G and psPAX2 were gifts from Didier Trono (Addgene #12259/12260). lentiCRISPRv2 constructs targeting genes of interest were cloned into BsmBI-digested lentiCRISPRv2 by annealing complementary oligos ( ) with overhangs that allow directional cloning into lentiCRISPRv2.

    Techniques: Activity Assay, Generated, Construct, Selection, FACS, Western Blot, Expressing, Clone Assay, Molecular Weight, Infection, Staining, Flow Cytometry, Cytometry, Inhibition, Microarray

    Knockout of uPAR by CRISPR/Cas9 system. (A) The map of lentiCRISPRv2 vector. (B) The locations and sequences of two sgRNAs of uPAR. (C) The protein expression levels of uPAR were examined by Western blot, and vinculin was used as loading control. The genomic DNA of cells was amplified and sequenced by the designed primers. The sequencing comparison and original data of HCT8/T (D) and KB V200 (E) cells are shown.

    Journal: Frontiers in Oncology

    Article Title: Targeting uPAR by CRISPR/Cas9 System Attenuates Cancer Malignancy and Multidrug Resistance

    doi: 10.3389/fonc.2019.00080

    Figure Lengend Snippet: Knockout of uPAR by CRISPR/Cas9 system. (A) The map of lentiCRISPRv2 vector. (B) The locations and sequences of two sgRNAs of uPAR. (C) The protein expression levels of uPAR were examined by Western blot, and vinculin was used as loading control. The genomic DNA of cells was amplified and sequenced by the designed primers. The sequencing comparison and original data of HCT8/T (D) and KB V200 (E) cells are shown.

    Article Snippet: Vector Generation, Lentivirus Production, and Transduction LentiCRISPRv2 vector (from Addgene #52961) was digested with BsmBI and ligated with annealed oligonucleotides (uPAR-sg1-F: 5′-CACCGGACCAACGGGGATTGCCGTG-3′, uPAR-sg1-R: 5′-AA-ACCACGGCAATCCCCGTTGGTCC-3′; uPAR-sg2-F: 5′-CACCGGGACCACGATCGTGCGCTTG-3′, uPAR-sg2-R: 5′-AAACCAAGCGCACGATCGTGGTCCC-3′).

    Techniques: Knock-Out, CRISPR, Plasmid Preparation, Expressing, Western Blot, Amplification, Sequencing

    MGP depletion stimulates osteoclast differentiation and activity. (A) Efficiency of MGP knockout in BMMs using a CRISPR-Cas9 system. (B) Knockout of MGP leads to an increase in the mRNA levels of osteoclastic markers. BMMs were induced with 30 ng/ml

    Journal: Molecular and Cellular Biology

    Article Title: Unexpected Role of Matrix Gla Protein in Osteoclasts: Inhibiting Osteoclast Differentiation and Bone Resorption

    doi: 10.1128/MCB.00012-19

    Figure Lengend Snippet: MGP depletion stimulates osteoclast differentiation and activity. (A) Efficiency of MGP knockout in BMMs using a CRISPR-Cas9 system. (B) Knockout of MGP leads to an increase in the mRNA levels of osteoclastic markers. BMMs were induced with 30 ng/ml

    Article Snippet: The lentivirus system for CRISPR-Cas9 includes LentiCRISPRv2 backbone vector (Addgene, 52961), packaging plasmids psPAX2 (Addgene, 12260), and pVSVg (Addgene, 8454). sgRNA oligonucleotides were annealed and ligated into the LentiCRISPRv2 vector, generating plasmids that expressed a gRNA targeting MGP or a nontargeting sgRNA, respectively.

    Techniques: Activity Assay, Knock-Out, CRISPR

    GFP-Tsg101 knock-in using CRISPR-Cas9 and HDR. A , knock-in strategy. Cells were transduced with LentiCRISPRv2 to express Cas9 with sgRNA targeting the start of the Tsg101 gene and transfected with a donor template plasmid containing a puromycin resistance selection marker and a GFP tag flanked by HRs for the target site. Cas9 generates a DSB in the genomic DNA at the target site, and the donor template can be integrated into the DSB by HDR, resulting in GFP knock-in. Otherwise, the DSB is repaired by the more efficient process of NHEJ, leaving insertions or deletions that knock out Tsg101. Tsg101 knockout was lethal, which helped to select against cells that did not achieve the knock-in. B , Western blotting for Tsg101 in cell lysates of GFP-Tsg101 KI clonal lines and WT parental lines. The KI cell lines express GFP-Tsg101 at lower than WT levels and do not express untagged Tsg101. α-Tubulin is shown as a loading control.

    Journal: The Journal of Biological Chemistry

    Article Title: Genomic tagging of endogenous human ESCRT-I complex preserves ESCRT-mediated membrane-remodeling functions

    doi: 10.1074/jbc.RA119.009372

    Figure Lengend Snippet: GFP-Tsg101 knock-in using CRISPR-Cas9 and HDR. A , knock-in strategy. Cells were transduced with LentiCRISPRv2 to express Cas9 with sgRNA targeting the start of the Tsg101 gene and transfected with a donor template plasmid containing a puromycin resistance selection marker and a GFP tag flanked by HRs for the target site. Cas9 generates a DSB in the genomic DNA at the target site, and the donor template can be integrated into the DSB by HDR, resulting in GFP knock-in. Otherwise, the DSB is repaired by the more efficient process of NHEJ, leaving insertions or deletions that knock out Tsg101. Tsg101 knockout was lethal, which helped to select against cells that did not achieve the knock-in. B , Western blotting for Tsg101 in cell lysates of GFP-Tsg101 KI clonal lines and WT parental lines. The KI cell lines express GFP-Tsg101 at lower than WT levels and do not express untagged Tsg101. α-Tubulin is shown as a loading control.

    Article Snippet: We thank Dr. Feng Zhang for the gift of LentiCRISPRv2 (Addgene plasmid 52961), Dr. Heinrich Leonhardt for the gift of pCANTD-EGFP, Dr. David Sabatini for the gift of pLJM1-EGFP (Addgene plasmid 19319), Dr. Didier Trono for the gift of psPAX2 (Addgene plasmid 12260), and Dr. Xuedong Liu for the gift of VSV-G.

    Techniques: Knock-In, CRISPR, Transduction, Transfection, Plasmid Preparation, Selection, Marker, Non-Homologous End Joining, Knock-Out, Western Blot

    CRISPR/Cas9-mediated IRF1 gene knockout a , Western blot analysis of CRISPR/Cas9-mediated IRF1 knockout. hSAECs stably transduced by empty lentiCRISPR (Con) or lentiCRISPRv2 with IRF1 sgRNA (CRISPR) were stimulated with 50 µg/mL poly(I:C) for 0h (−) and 3h (+). Total cell lysates were detected using IRF1 Ab. α-Tubulin blot is shown as the loading control. Shown are representative blots from two experiments. b – c , Q-RT-PCR analysis of IFNB1 ( b ) and IFNL1 ( c ) in cells used in a and stimulated with 50 µg/mL poly(I:C) for 0h, 2h, 4h and 6h. d – f , Q-RT-PCR analysis of IFNB1 ( d ), IFNL1 ( e ) and RV16 viral RNA 5’ UTR ( f ) in cells used in a and infected with RV16 for 0h, 8h and 24h. Data are the mean ± S.D. from n=3 biological replicates.

    Journal: Nature microbiology

    Article Title: Epigenetic silencing of IRF1 dysregulates type III interferon responses to respiratory virus infection in epithelial to mesenchymal transition

    doi: 10.1038/nmicrobiol.2017.86

    Figure Lengend Snippet: CRISPR/Cas9-mediated IRF1 gene knockout a , Western blot analysis of CRISPR/Cas9-mediated IRF1 knockout. hSAECs stably transduced by empty lentiCRISPR (Con) or lentiCRISPRv2 with IRF1 sgRNA (CRISPR) were stimulated with 50 µg/mL poly(I:C) for 0h (−) and 3h (+). Total cell lysates were detected using IRF1 Ab. α-Tubulin blot is shown as the loading control. Shown are representative blots from two experiments. b – c , Q-RT-PCR analysis of IFNB1 ( b ) and IFNL1 ( c ) in cells used in a and stimulated with 50 µg/mL poly(I:C) for 0h, 2h, 4h and 6h. d – f , Q-RT-PCR analysis of IFNB1 ( d ), IFNL1 ( e ) and RV16 viral RNA 5’ UTR ( f ) in cells used in a and infected with RV16 for 0h, 8h and 24h. Data are the mean ± S.D. from n=3 biological replicates.

    Article Snippet: CRISPR/Cas9-mediated IRF1 gene knockout The LentiCRISPRv2 system (a gift from Feng Zhang [Addgene plasmid # 52961] ) was used to prepare lentivirus for IRF1 gene knockout, with the sgRNA sequence 5’- ACAAGGATGCCTGTTTGTTC −3’ targeting exon 3 ( ) .

    Techniques: CRISPR, Gene Knockout, Western Blot, Knock-Out, Stable Transfection, Reverse Transcription Polymerase Chain Reaction, Infection

    CRISPR-Cas9 loss-of-function screen identifies protein-coding genes, including known oncogenes STAT5A and BCL2, as important for MV4-11 cell line growth. (A) Overall experimental design of lentiCRISPRv2 library screen. (B) Log2 Fold Change of each protein-coding gene targeted in lentiCRISPRv2 library screen (x-axis) plotted against–Log10 P-Value (y-axis). Dotted line represents p-value = 0.05. (C) Fold change of STAT5A normalized read counts in lentiCRISPRv2 library screen as compared to TP0. (D) Western blot of STAT5A using cellular extract from STAT5A-CR1, STAT5A-C2, or EV control infected MV4-11 cells with actin serving as load control. (E) DNA sequencing of the STAT5A locus from four representative STAT5A-CR1 infected MV4-11 clones (C1-C4). STAT5A represents the wild type (WT) sequence. Black box indicates translational start site. Arrow represents predicted cleavage site of Cas9 endonuclease. Red box identifies mutated region, with dashed lines indicating deleted nucleotides. (F, G) Growth curve for STAT5A-CR1 or STAT5A-CR2 infected MV4-11 cells compared to EV control. (H) Fold change of BCL2 normalized read counts in lentiCRISPRv2 library screen as compared to TP0. (I) Western blot of BCL2 in BCL2-CR1 or EV control infected MV4-11 cells with actin serving as load control. (J) Growth curve for BCL2-CR1 infected MV4-11 cells compared to EV control. (B, C, H) Represents combined data from three independently performed lentiCRISPRv2 library infections. Data represented as mean +/- SEM. P-values as indicated: *≤0.05, **≤0.01, ***≤0.001, and ns p > 0.05. See also S1 Table .

    Journal: PLoS ONE

    Article Title: Genome-Wide CRISPR-Cas9 Screen Identifies MicroRNAs That Regulate Myeloid Leukemia Cell Growth

    doi: 10.1371/journal.pone.0153689

    Figure Lengend Snippet: CRISPR-Cas9 loss-of-function screen identifies protein-coding genes, including known oncogenes STAT5A and BCL2, as important for MV4-11 cell line growth. (A) Overall experimental design of lentiCRISPRv2 library screen. (B) Log2 Fold Change of each protein-coding gene targeted in lentiCRISPRv2 library screen (x-axis) plotted against–Log10 P-Value (y-axis). Dotted line represents p-value = 0.05. (C) Fold change of STAT5A normalized read counts in lentiCRISPRv2 library screen as compared to TP0. (D) Western blot of STAT5A using cellular extract from STAT5A-CR1, STAT5A-C2, or EV control infected MV4-11 cells with actin serving as load control. (E) DNA sequencing of the STAT5A locus from four representative STAT5A-CR1 infected MV4-11 clones (C1-C4). STAT5A represents the wild type (WT) sequence. Black box indicates translational start site. Arrow represents predicted cleavage site of Cas9 endonuclease. Red box identifies mutated region, with dashed lines indicating deleted nucleotides. (F, G) Growth curve for STAT5A-CR1 or STAT5A-CR2 infected MV4-11 cells compared to EV control. (H) Fold change of BCL2 normalized read counts in lentiCRISPRv2 library screen as compared to TP0. (I) Western blot of BCL2 in BCL2-CR1 or EV control infected MV4-11 cells with actin serving as load control. (J) Growth curve for BCL2-CR1 infected MV4-11 cells compared to EV control. (B, C, H) Represents combined data from three independently performed lentiCRISPRv2 library infections. Data represented as mean +/- SEM. P-values as indicated: *≤0.05, **≤0.01, ***≤0.001, and ns p > 0.05. See also S1 Table .

    Article Snippet: Unique sgRNA sequences were cloned into a lentiCRISPRv2 construct (a gift from Feng Zhang; Addgene plasmid #52961) containing either a puro resistance or GFP selection marker.

    Techniques: CRISPR, Western Blot, Infection, DNA Sequencing, Clone Assay, Sequencing

    Identification of individual microRNAs, including miR-155, that regulate MV4-11 cell line growth. (A) Western blots of Ago2 and Drosha using cellular extract from Ago2-CR1, Drosha-CR1, and EV infected MV4-11 cell lines with actin serving as load control. (B) Growth curve for Ago2-CR1 and Drosha-CR1 infected MV4-11 cells compared to EV control. (C) Log2 Fold Change of each conserved microRNA gene targeted in lentiCRISPRv2 library screen (x-axis) plotted against–Log10 P-Value (y-axis). Dotted line represents p-value = 0.05. Represents combined data from three independently performed lentiCRISPRv2 library infections. (D) Schematic of miR-155 hairpin sequence as annotated in miRBase and sgRNA design of two independent miR-155-targeting lentiCRISPRv2 constructs (155-CR1, 155-CR2). (E) Expression levels of miR-155 in MV4-11 cells infected with EV control, 155-CR1, or 155-CR2 lentiCRISPRv2 constructs determined by qPCR. Expression normalized to 5s. (F) DNA sequencing of five representative 155-CR1 and 155-CR2 infected MV4-11 clones (C1-C5). 155 represents the WT sequence. Arrow indicates predicted cleavage site of Cas9. Red box identifies the mutated region, with dashed lines indicating deleted nucleotides. (G) Competitive growth curve of EV (GFP+), 155-CR1 (GFP+), or 155-CR2 (GFP+) infected MV4-11 cells mixed ~1:1 with WT MV4-11 cells at time point 0. Y-axis = (%GFP+ cells at indicated time point)/(%GFP+ cells initial). Data represented as mean +/- SEM. P-values as indicated: *≤0.05, **≤0.01, ***≤0.001, and ns p > 0.05. See also S2 Table .

    Journal: PLoS ONE

    Article Title: Genome-Wide CRISPR-Cas9 Screen Identifies MicroRNAs That Regulate Myeloid Leukemia Cell Growth

    doi: 10.1371/journal.pone.0153689

    Figure Lengend Snippet: Identification of individual microRNAs, including miR-155, that regulate MV4-11 cell line growth. (A) Western blots of Ago2 and Drosha using cellular extract from Ago2-CR1, Drosha-CR1, and EV infected MV4-11 cell lines with actin serving as load control. (B) Growth curve for Ago2-CR1 and Drosha-CR1 infected MV4-11 cells compared to EV control. (C) Log2 Fold Change of each conserved microRNA gene targeted in lentiCRISPRv2 library screen (x-axis) plotted against–Log10 P-Value (y-axis). Dotted line represents p-value = 0.05. Represents combined data from three independently performed lentiCRISPRv2 library infections. (D) Schematic of miR-155 hairpin sequence as annotated in miRBase and sgRNA design of two independent miR-155-targeting lentiCRISPRv2 constructs (155-CR1, 155-CR2). (E) Expression levels of miR-155 in MV4-11 cells infected with EV control, 155-CR1, or 155-CR2 lentiCRISPRv2 constructs determined by qPCR. Expression normalized to 5s. (F) DNA sequencing of five representative 155-CR1 and 155-CR2 infected MV4-11 clones (C1-C5). 155 represents the WT sequence. Arrow indicates predicted cleavage site of Cas9. Red box identifies the mutated region, with dashed lines indicating deleted nucleotides. (G) Competitive growth curve of EV (GFP+), 155-CR1 (GFP+), or 155-CR2 (GFP+) infected MV4-11 cells mixed ~1:1 with WT MV4-11 cells at time point 0. Y-axis = (%GFP+ cells at indicated time point)/(%GFP+ cells initial). Data represented as mean +/- SEM. P-values as indicated: *≤0.05, **≤0.01, ***≤0.001, and ns p > 0.05. See also S2 Table .

    Article Snippet: Unique sgRNA sequences were cloned into a lentiCRISPRv2 construct (a gift from Feng Zhang; Addgene plasmid #52961) containing either a puro resistance or GFP selection marker.

    Techniques: Western Blot, Infection, Sequencing, Construct, Expressing, Real-time Polymerase Chain Reaction, DNA Sequencing, Clone Assay

    Anti-correlation functional profiling identifies relevant miRNA-target interactions, including miR-150 repression of p53, that regulate MV4-11 cell line growth. (A) Heat map indicating representative oncogenes whose loss leads to decreased cell growth according to Log2 Fold Change values from lentiCRISPRv2 library screen (first column), and functionally anti-correlated miRNAs that are predicted to target each oncogene. Grey boxes indicate that the miRNA is not predicted to bind the 3’UTR of the oncogene (NT = Not targeted). (B) Heat map indicating representative TSGs whose loss lead to increased cell growth according to our Log2 Fold Change values from lentiCRISPRv2 library screen (first column), and miRNAs predicted to target each TSG whose growth anti-correlated in library. Grey boxes indicates that the miRNA is not predicted to bind the 3’UTR of TSG (NT = Not targeted). (C) Schematic showing miR-150 targeting of the p53 3’UTR. (D) Schematic of the miR-150 hairpin sequence as annotated in miRBase and sgRNA design of the miR-150-targeting lentiCRISPRv2 construct (150-CR1). (E) Expression level of miR-150 in MV4-11 cells infected with EV control or 150-CR1 lentiCRISPRv2 constructs determined by qPCR. Expression normalized to 5s. (F) Western blot of p53 in p53-CR1, 150-CR1, and EV control infected MV4-11 cell lines with actin serving as load control. (G) Competitive growth curve of EV (GFP+), p53-CR1 (GFP+), or 150-CR1 (GFP+) infected MV4-11 cells mixed ~1:1 with WT MV4-11 cells at time point 0. Y-axis = (%GFP+ cells at indicated time point)/(%GFP+ cells initial). (A, B) Only expressed protein-coding genes and microRNAs with p-values

    Journal: PLoS ONE

    Article Title: Genome-Wide CRISPR-Cas9 Screen Identifies MicroRNAs That Regulate Myeloid Leukemia Cell Growth

    doi: 10.1371/journal.pone.0153689

    Figure Lengend Snippet: Anti-correlation functional profiling identifies relevant miRNA-target interactions, including miR-150 repression of p53, that regulate MV4-11 cell line growth. (A) Heat map indicating representative oncogenes whose loss leads to decreased cell growth according to Log2 Fold Change values from lentiCRISPRv2 library screen (first column), and functionally anti-correlated miRNAs that are predicted to target each oncogene. Grey boxes indicate that the miRNA is not predicted to bind the 3’UTR of the oncogene (NT = Not targeted). (B) Heat map indicating representative TSGs whose loss lead to increased cell growth according to our Log2 Fold Change values from lentiCRISPRv2 library screen (first column), and miRNAs predicted to target each TSG whose growth anti-correlated in library. Grey boxes indicates that the miRNA is not predicted to bind the 3’UTR of TSG (NT = Not targeted). (C) Schematic showing miR-150 targeting of the p53 3’UTR. (D) Schematic of the miR-150 hairpin sequence as annotated in miRBase and sgRNA design of the miR-150-targeting lentiCRISPRv2 construct (150-CR1). (E) Expression level of miR-150 in MV4-11 cells infected with EV control or 150-CR1 lentiCRISPRv2 constructs determined by qPCR. Expression normalized to 5s. (F) Western blot of p53 in p53-CR1, 150-CR1, and EV control infected MV4-11 cell lines with actin serving as load control. (G) Competitive growth curve of EV (GFP+), p53-CR1 (GFP+), or 150-CR1 (GFP+) infected MV4-11 cells mixed ~1:1 with WT MV4-11 cells at time point 0. Y-axis = (%GFP+ cells at indicated time point)/(%GFP+ cells initial). (A, B) Only expressed protein-coding genes and microRNAs with p-values

    Article Snippet: Unique sgRNA sequences were cloned into a lentiCRISPRv2 construct (a gift from Feng Zhang; Addgene plasmid #52961) containing either a puro resistance or GFP selection marker.

    Techniques: Functional Assay, Sequencing, Construct, Expressing, Infection, Real-time Polymerase Chain Reaction, Western Blot

    GABA A β1-3 subunits are necessary for inhibitory transmission A) Diagram of the vector constructs used to express the chained sgRNAs (in pink) for β1, β2, and β3 and Cas9 (in yellow). CBh: promoter; NLS: nuclear localization sequence; 2A: cleavage peptide; U6: promoter; hUbC: promoter. B) Western blot of rat dissociated hippocampal cultures infected with lentiviruses for both Cas9 and sgRNA (CRISPR lanes) or cultures transfected with lentivirus only for Cas9 (Control lanes). Lysates were probed for expression of β1, β2/3, and actin (n=4 replicates). C) Representative image of our organotypic hippocampal slice culture preparation with a zoomed in image of a transfected cell. D) Representative evoked IPSC traces of an untransfected cell (in black) and cell transfected with the sgRNAs for β1-3 and Cas9 (in green). E) Varying absolute amplitudes were observed in control untransfected cells while transfected cells displayed no inhibitory current (***p = 0.0002, n = 18) F) .

    Journal: Neuron

    Article Title: The GABAA receptor β subunit is required for inhibitory transmission

    doi: 10.1016/j.neuron.2018.03.046

    Figure Lengend Snippet: GABA A β1-3 subunits are necessary for inhibitory transmission A) Diagram of the vector constructs used to express the chained sgRNAs (in pink) for β1, β2, and β3 and Cas9 (in yellow). CBh: promoter; NLS: nuclear localization sequence; 2A: cleavage peptide; U6: promoter; hUbC: promoter. B) Western blot of rat dissociated hippocampal cultures infected with lentiviruses for both Cas9 and sgRNA (CRISPR lanes) or cultures transfected with lentivirus only for Cas9 (Control lanes). Lysates were probed for expression of β1, β2/3, and actin (n=4 replicates). C) Representative image of our organotypic hippocampal slice culture preparation with a zoomed in image of a transfected cell. D) Representative evoked IPSC traces of an untransfected cell (in black) and cell transfected with the sgRNAs for β1-3 and Cas9 (in green). E) Varying absolute amplitudes were observed in control untransfected cells while transfected cells displayed no inhibitory current (***p = 0.0002, n = 18) F) .

    Article Snippet: The human codon-optimized Cas9 and chimeric sgRNA expression plasmid (pX458) and lentiviral plasmid for expression of Cas9 (lentiCRISPRv.2) were developed by the Zhang lab and obtained from Addgene (plasmid #48138 and #52961) ( ; ).

    Techniques: Transmission Assay, Plasmid Preparation, Construct, Sequencing, Western Blot, Infection, CRISPR, Transfection, Expressing

    Generate CRISPR/Cas9 vector to target ABCB1. The map of LentiCRISPRv2 vector (A) and the locations and sequences of two sgRNAs for targeting ABCB1 (B) are shown.

    Journal: American Journal of Translational Research

    Article Title: Targeting ABCB1-mediated tumor multidrug resistance by CRISPR/Cas9-based genome editing

    doi:

    Figure Lengend Snippet: Generate CRISPR/Cas9 vector to target ABCB1. The map of LentiCRISPRv2 vector (A) and the locations and sequences of two sgRNAs for targeting ABCB1 (B) are shown.

    Article Snippet: The two targeting sequences from exon 5 and 8 of ABCB1 end with a 5’ NGG3’ PAM (protospacer-adjacent motif) sequence were cloned into LentiCRISPRv2 vector respectively ( ).

    Techniques: CRISPR, Plasmid Preparation

    Stable knockout of ABCB1 by CRISPR/Cas9 system. KBV 200 and HCT-8/V cells were selected with puromycin after transduction with LentiCRISPRv2 viral supernatant. The protein expression was examined by Western blot after lysing cells, and 14-3-3 was used

    Journal: American Journal of Translational Research

    Article Title: Targeting ABCB1-mediated tumor multidrug resistance by CRISPR/Cas9-based genome editing

    doi:

    Figure Lengend Snippet: Stable knockout of ABCB1 by CRISPR/Cas9 system. KBV 200 and HCT-8/V cells were selected with puromycin after transduction with LentiCRISPRv2 viral supernatant. The protein expression was examined by Western blot after lysing cells, and 14-3-3 was used

    Article Snippet: The two targeting sequences from exon 5 and 8 of ABCB1 end with a 5’ NGG3’ PAM (protospacer-adjacent motif) sequence were cloned into LentiCRISPRv2 vector respectively ( ).

    Techniques: Knock-Out, CRISPR, Transduction, Expressing, Western Blot

    MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine A9 cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing LentiCRISPRv2 which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.

    Journal: eLife

    Article Title: Parvovirus minute virus of mice interacts with sites of cellular DNA damage to establish and amplify its lytic infection

    doi: 10.7554/eLife.37750

    Figure Lengend Snippet: MVM associates with artificially-engineered sites of DNA damage. ( A ) Murine A9 fibroblasts were infected with MVM at an MOI of 10 for 18 hr. Cells were sensitized with Hoechst 33342 solution prior to irradiation in selected regions of interest with a 405 nanometer laser (top 3 panels), and were compared with un-irradiated cells (bottom panel). Cells were fixed and analyzed for the localization of DNA damaged sites (detected by green γ-H2AX staining), with that of MVM NS1 protein ( red ). The irrelevant transcription factor NR5A2 ( red ) was used as a negative control as this marker that does not colocalize with APAR bodies (see Figure 1 ). The nuclear periphery is demarcated with dotted white lines and DAPI staining. ( B ) Schematic of γ-H2AX binding to the cellular genome on chromosome 9 (top panel) compared with MVM-interaction sites (bottom panel) in parasynchronized murine A9 cells infected with MVM (MOI 5) for 16 hr. The site where guide RNAs were designed for DDR induction is shown as a red rectangle and labelled ‘CRISPR/Cas9’. Focused V3C-qPCR assays were performed in A9 cells constitutively expressing LentiCRISPRv2 which were transiently transfected with guide RNAs (nontargeting, labelled as ‘CTRL’ or specific to the 9qE1 site, labelled as ‘TGT’), and infected with MVM at an MOI for 5 for 16 hr. The spatial association of MVM with cellular sites were determined with Taqman probes on ( C ), the MVM genome, and reciprocal interaction with the Taqman probe on ( D ), the 9qE1 break site. ( E ) MVM association with Chr19 VAD at 19qA was tested by focused Taqman qPCR. NS1 occupancy at ( F ), the 9qE1 break site and ( G ), the 19qA VAD was assayed by ChIP-qPCR in cells transfected with non-targeting (CTRL) and specific (TGT) guide RNAs. Background levels were determined using IgG pulldowns. qPCR data are presented as mean ± SEM of three independent experiments.

    Article Snippet: LentiCRISPRv2 A9 cells LentiCRISPRv2 plasmid was obtained from Addgene (plasmid# 52961, [ ]) and pseudotyped viruses were generated in 1 × 106 293 T cells transfected with 1 µg of LentiCRISPRv2, 1 µg of HIV Gag/Pol and 1 µg VSV-G proteins using Lipo293D (SignaGen).

    Techniques: Infection, Irradiation, Staining, Negative Control, Marker, Binding Assay, CRISPR, Real-time Polymerase Chain Reaction, Expressing, Transfection, Chromatin Immunoprecipitation

    GFP-Tsg101 knock-in using CRISPR-Cas9 and HDR. A , knock-in strategy. Cells were transduced with LentiCRISPRv2 to express Cas9 with sgRNA targeting the start of the Tsg101 gene and transfected with a donor template plasmid containing a puromycin resistance selection marker and a GFP tag flanked by HRs for the target site. Cas9 generates a DSB in the genomic DNA at the target site, and the donor template can be integrated into the DSB by HDR, resulting in GFP knock-in. Otherwise, the DSB is repaired by the more efficient process of NHEJ, leaving insertions or deletions that knock out Tsg101. Tsg101 knockout was lethal, which helped to select against cells that did not achieve the knock-in. B , Western blotting for Tsg101 in cell lysates of GFP-Tsg101 KI clonal lines and WT parental lines. The KI cell lines express GFP-Tsg101 at lower than WT levels and do not express untagged Tsg101. α-Tubulin is shown as a loading control.

    Journal: The Journal of Biological Chemistry

    Article Title: Genomic tagging of endogenous human ESCRT-I complex preserves ESCRT-mediated membrane-remodeling functions

    doi: 10.1074/jbc.RA119.009372

    Figure Lengend Snippet: GFP-Tsg101 knock-in using CRISPR-Cas9 and HDR. A , knock-in strategy. Cells were transduced with LentiCRISPRv2 to express Cas9 with sgRNA targeting the start of the Tsg101 gene and transfected with a donor template plasmid containing a puromycin resistance selection marker and a GFP tag flanked by HRs for the target site. Cas9 generates a DSB in the genomic DNA at the target site, and the donor template can be integrated into the DSB by HDR, resulting in GFP knock-in. Otherwise, the DSB is repaired by the more efficient process of NHEJ, leaving insertions or deletions that knock out Tsg101. Tsg101 knockout was lethal, which helped to select against cells that did not achieve the knock-in. B , Western blotting for Tsg101 in cell lysates of GFP-Tsg101 KI clonal lines and WT parental lines. The KI cell lines express GFP-Tsg101 at lower than WT levels and do not express untagged Tsg101. α-Tubulin is shown as a loading control.

    Article Snippet: The LentiCRISPRv2 transfer plasmid was a gift from Feng Zhang (Addgene plasmid 52961).

    Techniques: Knock-In, CRISPR, Transduction, Transfection, Plasmid Preparation, Selection, Marker, Non-Homologous End Joining, Knock-Out, Western Blot